5/1/06 9:41:41 AM
rolnieduna
MICROBIOLOGY
edited by
Arthur C Ouwehand
Danisco Innovation
Kantvik, Finland
Elaine E. Vaughan
Unilever R&D, Vlaardingen and
Wageningen University, Wageningen,
The Netherlands
Taylor & Francis
Taylor & Francis Group
New York London
Taylor St Francis is an imprint of the
Taylor & Francis Group, an informa business
DK2999 FM.indd 2
4/25/06 12:54:06 PM
DK2999_Discl.fm Page 1 Thursday, February 9, 2006 1 1:36 AM
+
Published in 2006 by
Taylor & Francis Group
270 Madison Avenue
New York, NY 10016
© 2006 by Taylor & Francis Group, LLC
No claim to original U.S. Government works
Printed in the United States of America on acid-free paper
10 987654321
International Standard Book Number- 10: 0-8247-2641-3 (Hardcover)
International Standard Book Number- 13: 978-0-8247-2641-6 (Hardcover)
This book contains information obtained from authentic and highly regarded sources. Reprinted material is quoted with
permission, and sources are indicated. A wide variety of references are listed. Reasonable efforts have been made to publish
reliable data and information, but the author and the publisher cannot assume responsibility for the validity of all materials
or for the consequences of their use.
No part of this book may be reprinted, reproduced, transmitted, or utilized in any form by any electronic, mechanical, or
other means, now known or hereafter invented, including photocopying, microfilming, and recording, or in any information
storage or retrieval system, without written permission from the publishers.
For permission to photocopy or use material electronically from this work, please access www.copyright.com
(http://www.copyright.com/) or contact the Copyright Clearance Center, Inc. (CCC) 222 Rosewood Drive, Danvers, MA
01923, 978-750-8400. CCC is a not-for-profit organization that provides licenses and registration for a variety of users. For
organizations that have been granted a photocopy license by the CCC, a separate system of payment has been arranged.
Trademark Notice: Product or corporate names may be trademarks or registered trademarks, and are used only for
identification and explanation without intent to infringe.
Library of Congress Cataloging-in-Publication Data
Catalog record is available from the Library of Congress
informa
Taylor & Francis Group
is the Academic Division of Informa pic.
Visit the Taylor & Francis Web site at
http : //www. taylor andfr ancis. com
We dedicate this book to Willem M. de Vos and Seppo Salminen, who contribute
significantly to insight in gut microbe-host interactions, and moreover,
as our colleagues and mentors in this field.
in
Preface
The human gastrointestinal tract microorganisms, termed the "microbiota," have been
investigated since the beginning of microbiological studies, when Antonie van
Leeuwenhoek, the father of microbiology, investigated the microorganisms in his own
stools. The human microbiota comprises trillions of microbes distributed in various niches
throughout the intestinal tract and is one of the most complex microbial ecosystems on
earth. The host and its microbiota have co-evolved together, and considering the
staggering numbers and diversity, it is therefore not surprising that the microbiota exert a
major influence on the host. The original term for the microbiota upon discovery was the
"flora" or "microflora," literally translated as "small plants," which has a botanical
connotation. These terms are still used widely today and internationally recognized.
Nevertheless, it is considered more appropriate to use the term microbiota, i.e., "small
life" taking into account that the human microbiota is comprised of bacteria, archaea,
bacteriophage, a smaller number of yeasts, and some protozoa; hence, this term is mainly
used throughout this book. With this book, we have made an attempt to cover all issues
associated with the gastrointestinal microbiota, from health to disease and from sampling
to identification. Although various books have addressed the intestinal microbiota, this
has mainly been from the perspective of disease or nutrition, while the microbiota itself
has rarely been the focus. This current book aims to fill this gap and provide the reader
with a comprehensive overview of all aspects related to the gastrointestinal microbiota.
There have been major scientific advances especially in human intestinal microbiology in
the recent past, which are also covered by the contributions.
Early studies were limited to description of the culturable microbes, which as we
now realize, made up only a minority of the gastrointestinal tract microbiota. Due to the
development of molecular biological techniques over the last decade, microbes can now
be detected and studied to a large extent, without the need for culturing. In the first chapter,
Kaouther Ben Amor and Elaine Vaughan review the major achievements of recent times in
determining the diversity of the microbiota using modern molecular techniques, based on
16S ribosomal RNA, as well as methods to evaluate their activity within the various
niches. Research of the gastrointestinal tract microbiota, especially in the case of humans,
is often restricted to fecal material. In fact, a range of other sampling techniques are
available, which are presented by Angele Kerckhoffs and colleagues, to access the small
intestine, as well as noninvasive sampling methods that are routinely used in medical
practice. This is an important issue since feces represent only the luminal material of the
terminal colon and will provide insufficient information about other locations of the gut.
Anne McCartney and Glenn Gibson describe the succession of the microbiota in infants, as
well as the earlier culturing studies, and the methodology to characterize the microbiota
vi Preface
down to subspecies level. It has long been recognized that the intestinal microbiota plays
an important role in maintaining health in infants. Currently, much attention is also
focused on the intestinal microbiota of the elderly, as is discussed in the chapter by Fang
He. In western nations, the elderly are becoming a more numerous segment of the
population, and it is becoming increasingly established that intestinal health has a major
role in their quality of life.
While establishing the microbiota diversity and their activity (live versus dead) is a
major challenge, it is essential to know and understand their effects on the host. The
intestinal microbiota has a major influence on the development and maintenance of our
immune system as described by Marie-Christiane Moreau. Because of their direct contact
with the host, the activity and interaction of the microbiota with the intestinal mucosa may
be more important than the activity of microbes in the lumen, as described by Wai Ling
Chow and Yuan-Kun Lee. The human microbiota also play a major role in our nutrition.
Barry Goldin reviews the myriad of metabolic possibilities of the human microbiota
concerning the metabolism of food ingredients and drugs we consume, as well as host-
derived substrates. Max Bingham focuses on the metabolism by the microbiota of
polyphenols, which are considered to be key active constituents of fruits and vegetables
and responsible for many of the health protective effects of diets rich in these foods.
Today, functional genomics technologies are developing and will facilitate our ability to
detect the microbes and determine the molecular mechanisms of their impact on the host.
Through the sequencing of an ever-increasing number of microbiota genomes, and elegant
molecular studies, a further understanding is being obtained into the molecular functioning
of the host-microbiota interactions, a dynamic area that is discussed by Peter Bron, Willem
de Vos, and Michiel Kleerebezem.
The gastrointestinal tract microbiota is receiving more attention than ever in
particular in relation to disease. Fergus Shanahan, Barbara Sheil, and coworkers review
the relationship between the intestinal microbiota and inflammatory bowel diseases, as
well as give an overview of the probiotic clinical trials and the potential mechanisms of
probiotics for ameliorating these intestinal diseases. Through its metabolism, the intestinal
microbiota is thought to play an important role in both the etiology and prevention of
colorectal cancer, as discussed by Patricia Heavey, Ian Rowland, and Joseph Rafter. In
addition to diseases of the gastrointestinal tract, Pirkka Kirjavainen and Gregor Reid also
discuss that diseases such as allergy are being recognized to have an "intestinal
component," again mediated through the interaction between the microbiota and the
intestinal immune system.
In order to gain a better understanding of the composition and functioning of the
intestinal microbiota and how this can be influenced, intestinal models have been
developed; this allows for a simplification of the complex intestinal ecosystem as presented
by Harri Makivuokko and Paivi Nurminen. Experimental animals, as described by
Anders Henriksson, have also been highly valuable for this purpose, especially with the
availability of various knockout animal models for disease. Also the use of animals with a
"human" microbiota provide valuable models to investigate the influence of substances
on the microbiota and host physiology. The best animal models to show the importance of
the intestinal microbiota are germ-free animals. Their physiological differences compared
to conventional animals are striking and show clearer than any other model the role
intestinal microbes play, as discussed by Elisabeth Norin and Tore Midtvedt. Because of its
influence on the health and well being of the host, strategies have been devised to alter the
composition and/or activity of the intestinal microbiota. Antibiotics have long been known
to alter the composition of the intestinal microbiota, as discussed by Asa Sullivan and Carl
Erik Nord, which may lead to various side effects, depending on the activity spectrum of the
Preface vii
antibiotic. Methods to improve the activity and composition of the intestinal microbiota
include probiotics, microbes ingested orally that provide beneficial effects, and prebiotics
substrates that are selectively metabolized by the beneficial native gastrointestinal tract
microbes, as discussed in the chapters by Chandraprakash Khedkar and Arthur Ouwehand,
and Ross Crittenden and Martin Playne, respectively.
The major part of the book deals with the microbiota of humans, and when animals
are studied, it is often as a model for humans. Minna Rinkinen describes the microbiota of
companion animals, an area that has received very little attention to date, although the
well being of pets can contribute significantly to the well being of the owner. In the case of
farm animals, discussed by Alojz Bomba and colleagues, there is an important economic
drive where the role of the microbiota on performance is a major focus. This will only
become more important from 2006 onward as antimicrobial growth promoters will be
prohibited in the European Union.
Gastrointestinal Microbiology is a vibrant field of research that is benefiting from
many interdisciplinary interactions between different research groups in the world, that are
using, developing, and applying novel technologies. Exciting initiatives are emerging with
high through put technologies such as sequence analysis of the human microbiome
(collective genomes of the gut microbiota) and metabolomics applied to microbiota and
nutritional research. There is occasionally some overlap in information scattered
throughout the book that is valuable since the reader will get an appreciation for the
different opinions and perspectives that reflect the current state of research findings in the
literature for this subject. It remains a highly complex task to understand the mutual
relationship between members of the microbial community in the gut and their interaction
with the host.
Finally, we hope that all readers will share our excitement for this dynamic subject
that impacts on all our lives.
Arthur C. Ouwehand
Elaine E. Vaughan
Acknowledgments
We are most grateful to the contributing authors who have been willing to share their
knowledge and experience in their field of intestinal microbiology. They are all busy
researchers and yet they committed themselves to writing these chapters. It has been a
pleasure to cooperate with these experts for the production of this book. Together their
excellent contributions provide the state-of-the-art research on the human intestinal
microbiology as well as informative chapters about the animal microbiota for comparative
purposes. Elaine Vaughan acknowledges the staff and colleagues in Unilever Research and
Development, and in the Laboratory of Microbiology, especially the Molecular Ecology
Group, Wageningen University, for inspiring discussions on intestinal microbiology and
critical support in this field. She further acknowledges the enjoyable and stimulating
collaborations with the Wageningen Center of Food Sciences. Arthur Ouwehand similarly
acknowledges the support and inspiration from the colleagues at Danisco Innovation and
the Functional Foods Forum, University of Turku. We thank the Egerton Group Ltd. for
their excellent support during production of this book. Importantly, our families,
especially our spouses (Dr. Patrick Wouters and Anna-Maija Ouwehand), who have
learned to live with Gut Microbiology, we give our heartfelt thanks.
IX
Contents
Preface .... v
Contributors .... xvii
1. Molecular Ecology of the Human Intestinal Microbiota
Kaouther Ben Amor and Elaine E. Vaughan
Introduction .... 1
GI-Tract Microbiota as Identified by 16S rRNA
Gene Analysis .... 2
Fingerprinting Reveals Characteristics of
the Microbiota .... 5
16S rRNA-Targeted Probes Quantify the GI-Tract
Microbiota .... 7
New Molecular Diversity Approaches .... 12
Assessment of Microbiota Vitality and Metabolic
Activity .... 13
Perspectives .... 15
References .... 16
2. Sampling Microbiota in the Human Gastrointestinal Tract 25
Angele P. M. Kerckhoffs, Melvin Samsom, Gerard P. van Berge Henegouwen,
Louis M. A. Akkermans, Vincent B. Nieuwenhuijs, and Maarten R. Visser
Introduction .... 25
Esophagus: Microbiota and Sampling
Techniques .... 28
Stomach: Microbiota and Sampling Techniques .... 29
Small Intestine: Microbiota and
Sampling Techniques .... 32
Large Intestine: Microbiota and Sampling
Techniques .... 42
Conclusion .... 45
References .... 46
xi
xii Contents
3. The Normal Microbiota of the Human Gastrointestinal Tract:
History of Analysis, Succession, and Dietary Influences 51
Anne L. McCartney and Glenn R. Gibson
Introduction .... 51
Role of the Gastrointestinal Microbiota
in Humans .... 52
Acquisition of the Gut Microbiota .... 54
Composition of the Adult Fecal Microbiota Assessed
by Culturing .... 55
Composition of the Adult Fecal Microbiota Assessed
by Molecular Techniques .... 58
Investigations at the Subspecies Level .... 68
Conclusion .... 69
References .... 70
4. The Intestinal Microbiota of the Elderly 75
Fang He
Introduction .... 75
Colonization and Succession of Human Intestinal
Microbiota with Age .... 75
Bifidobacteria in the Elderly .... 79
Conclusion .... 88
References .... 88
5. Immune Modulation by the Intestinal Microbiota 93
Marie-Christiane Moreau
Introduction .... 93
Brief Review of the Intestinal Microbiota .... 94
Brief Review of Immune Responses .... 95
The Intestinal Immune System .... 97
Relationships Between the Intestinal Immune System and
Intestinal Microbiota .... 103
Relationships Between the Peripheral Immune System and
Intestinal Microbiota .... 112
Conclusion .... 116
References .... 117
6. Mucosal Interactions and Gastrointestinal Microbiota 123
Wai Ling Chow and Yuan-Kun Lee
Introduction .... 123
Features of the Gastrointestinal Tract .... 124
Microbiota and Gastrointestinal System .... 127
Development of GI Tract Normal Microbiota
in Humans .... 129
Cross-Talk Between Bacteria and Intestinal
Epithelial Cells .... 131
Conclusion .... 132
References .... 133
Contents xiii
7. The Metabolism of Nutrients and Drugs by the Intestinal
Microbiota 137
Barry R. Goldin
Introduction .... 137
General Metabolism and Function
of the Microbiota .... 137
Nutrients and Dietary Plant Compounds .... 138
Intestinal Bacterial Metabolism of Host Endogenously
Synthesized Compounds .... 142
Other Bacterial Reactions .... 143
Bacterial Intestinal Formation of Mutagens .... 144
Bacterial Intestinal Drug Metabolism .... 147
Conclusion .... 150
References .... 150
8. The Metabolism of Polyphenols by the Human
Gut Microbiota 155
Max Bingham
Summary .... 155
Introduction .... 155
Types of Polyphenols and Microbial
Metabolism .... 156
Phenolic Acids — Hydroxycinnamates and
Hydroxybenzoates .... 157
Flavonoids .... 159
Anthocyanidins .... 162
Proanthocyanidins .... 163
Perspectives .... 163
References .... 164
9. Molecular Analysis of Host-Microbe Interactions in the
Gastrointestinal Tract 169
Peter A. Bron, Willem M. de Vos, and Michiel Kleerebezem
Introduction .... 169
Bacterial Responses to the Host .... 170
Insights from Genomics .... 176
In Situ Profiling of Transcription in the
GI Tract 180
Concluding Remarks and Future
Perspectives .... 182
References .... 183
10. The Infant Intestinal Microbiota in Allergy 189
Pirkka V. Kirjavainen and Gregor Reid
Introduction .... 189
xiv Contents
Allergies — An Overview .... 190
Allergy-Associated Compositional Characteristics of
Infant Gut Microbiota .... 191
Interpreting the Gut Microbiota
Characteristics .... 194
Conclusion .... 198
References .... 199
11. Probiotics: A Role in Therapy for Inflammatory
Bowel Disease 207
Barbara Sheil, Jane McCarthy, Liam O'Mahony,
Malik M. Anwar, and Fergus Shanahan
Introduction .... 207
The Role of the Enteric Microbiota in the
Normal Gut .... 208
The Importance of the Enteric Microbiota in
Inflammatory Bowel Disease .... 209
Probiotics .... 211
Efficacy of Probiotics in Inflammatory
Bowel Disease .... 213
Discussion .... 218
References .... 219
12. The Gastrointestinal Microbiota in Cancer 225
Patricia M. Heavey, Ian R. Rowland, and Joseph J. Rafter
Introduction .... 225
The Stomach .... 226
The Large Intestine .... 228
Surrogate Markers for Diet-Related
Colon Cancer Studies .... 230
Conclusion .... 233
References .... 234
13. In Vitro Methods to Model the Gastrointestinal Tract 237
Harri Mdkivuokko and Pdivi Nurminen
Introduction .... 237
Types of Intestinal Simulator Models .... 237
Simulating the Rumen .... 244
Conclusion .... 250
References .... 250
14. Animal Models for the Human Gastrointestinal Tract 253
Anders Henriksson
Introduction .... 253
Contents xv
Animal Models Used for Studies on the Human
GI Microbiota .... 256
Conclusion .... 265
References .... 265
15. Born Germ-Free — Microbial Dependent 273
Elisabeth Norin and Tore Midtvedt
Introduction .... 273
Terminology .... 274
Germ-Free Animals and Dietary
Requirements .... 274
Intestinal Microbiota, Gross Anatomy, Histology,
and Motility .... 275
Biochemical Functions and the Gastrointestinal
Microbiota .... 276
Immunology and Germ-Free Life .... 279
Conclusion .... 281
References .... 281
16. Modifying the Human Intestinal Microbiota with Prebiotics .... 285
Ross Crittenden and Martin J. Playne
Introduction .... 285
Why Modify the Intestinal Microbiota? .... 285
The Prebiotic Strategy to Modifying the Intestinal
Microbiota .... 286
A Brief History of the Development of Bifidus
Factors and Prebiotics .... 287
Currently Available Prebiotic Carbohydrates .... 289
Modifying the Intestinal Bifidobacterium
Population .... 290
Synbiotics .... 294
Mechanisms of the Bifidogenic Effect .... 295
Advantages of the Prebiotic Strategy .... 295
Disadvantages of the Prebiotic Approach .... 300
Safe Dosage Levels .... 300
Conclusion and Future Directions .... 300
References .... 302
17. Modifying the Gastrointestinal Microbiota with Probiotics 315
Chandraprakash D. Khedkar and Arthur C. Ouwehand
Introduction .... 315
Probiotics .... 316
Proposed Health Benefits of Probiotics .... 317
Modifying Intestinal Microbiota Composition Through
Intake of Probiotics .... 322
Modifying the Microbial Metabolic Activity .... 324
xvi Contents
Conclusion .... 327
References .... 327
18. Modifying the Intestinal Microbiota with Antibiotics 335
Asa Sullivan and Carl Erik Nord
Introduction .... 335
Antimicrobial Agents That Inhibit the Synthesis
of the Bacterial Cell Wall — (3-Lactam
Antibiotics .... 336
Other Agents with Inhibitory Effect on the Synthesis
of the Cell Wall— Glycopeptides .... 348
Antimicrobial Agents Interfering with the Synthesis
of Proteins .... 349
Agents Blocking the Metabolism of
Folic Acid .... 355
Antimicrobial Agents That Interfere with the Synthesis
ofDNA 355
Conclusion .... 362
References .... 362
19. The Intestinal Microbiota of Pets: Dogs and Cats 371
Minna Rinkinen
Introduction .... 371
Development of Intestinal Microbiota in
Dogs and Cats .... 371
Canine and Feline Gastrointestinal
Microbiota .... 372
Modifying the Intestinal Microbiota: Pre- and
Probiotics .... 375
Conclusion .... 376
References .... 376
20. The Gastrointestinal Microbiota of Farm Animals 381
Alojz Bomba, Zuzana Jonecovd, Sofia Gancarcikovd, and
Radomira Nemcovd
Introduction .... 381
Microbiota of the Gastrointestinal Tract
in Farm Animals .... 382
Influencing the Ecosystem of the Digestive Tract in
Farm Animals .... 387
The Use of Gnotobiotic Animals in Studies of the
Gastrointestinal Microbiota in Farm Animals .... 393
Conclusion .... 395
References .... 395
Index .... 401
Contributors
Louis M. A. Akkermans Department of Surgery, Utrecht University Medical Center,
Utrecht, The Netherlands
Kaouther Ben Amor Laboratory of Microbiology, Wageningen University,
Wageningen, The Netherlands
Malik M. Anwar Alimentary Pharmabiotic Centre, Departments of Medicine
and Surgery, Microbiology, National Food Biotechnology Centre, National University
of Ireland, Cork, Ireland
Max Bingham Unilever Research and Development, Vlaardingen, The Netherlands
Alojz Bomba Institute of Gnotobiology and Prevention of Diseases in Young,
University of Veterinary Medicine, Kosice, Slovak Republic
Peter A. Bron Wageningen Centre for Food Sciences and NIZO Food Research,
BA Ede, Wageningen, The Netherlands
Wai Ling Chow National University of Singapore, Department of Microbiology,
Faculty of Medicine, Singapore
Ross Crittenden The Preventative Health Flagship, Food Science Australia,
Werribee, Victoria, Australia
Willem M. de Vos Wageningen Centre for Food Sciences and Laboratory of
Microbiology, Wageningen University, Wageningen, The Netherlands
Sofia Gancarcikova Institute of Gnotobiology and Prevention of Diseases in Young,
University of Veterinary Medicine, Kosice, Slovak Republic
Glenn R. Gibson Food Microbial Sciences Unit, School of Food Biosciences,
Whiteknights, University of Reading, Reading, U.K.
Barry R. Goldin Department of Public Health and Family Medicine, Tufts University
School of Medicine, Boston, Massachusetts, U.S.A.
Fang He Technical Research Laboratory, Takanashi Milk Products Co., Ltd,
Yokohama, Kanagawa, Japan
Patricia M. Heavey School of Life Sciences, Kingston University, Kingston-upon-
Thames, U.K.
xvii
xviii Contributors
Gerard P. van Berge Henegouwen Department of Gastroenterology, Utrecht
University Medical Center, Utrecht, The Netherlands
Anders Henriksson DSM Food Specialties, Sydney, Australia
Zuzana Jonecova Institute of Gnotobiology and Prevention of Diseases in Young,
University of Veterinary Medicine, Kosice, Slovak Republic
Angele P. M. Kerckhoffs Department of Gastroenterology, Utrecht University
Medical Center, Utrecht, The Netherlands
Chandraprakash D. Khedkar Department of Dairy Microbiology and Biotechnol-
ogy (Maharashtra Animal and Fishery Sciences University, Nagpur), College of Dairy
Technology, Warud (Pusad), India
Pirkka V. Kirjavainen Canadian Research and Development Center for Probiotics,
The Lawson Health Research Institute, London, Ontario, Canada
Michiel Kleerebezem Wageningen Centre for Food Sciences and NIZO Food
Research, BA Ede, Wageningen, The Netherlands
Yuan-Kun Lee National University of Singapore, Department of Microbiology,
Faculty of Medicine, Singapore
Harri Makivuokko Danisco Innovation, Kantvik, Finland
Jane McCarthy Alimentary Pharmabiotic Centre, Departments of Medicine
and Surgery, Microbiology, National Food Biotechnology Centre, National University
of Ireland, Cork, Ireland
Anne L. McCartney Food Microbial Sciences Unit, School of Food Biosciences,
Whiteknights, University of Reading, Reading, U.K.
Tore Midtvedt Microbiology and Tumor Biology Center, Karolinska Institutet,
Stockholm, Sweden
Marie-Christiane Moreau French Institute of Agronomical Research (INRA),
Nancy, France
Radomira Nemcova Institute of Gnotobiology and Prevention of Diseases in Young,
University of Veterinary Medicine, Kosice, Slovak Republic
Vincent B. Nieuwenhuijs Department of Surgery, Utrecht University Medical Center,
Utrecht, The Netherlands
Carl Erik Nord Department of Laboratory Medicine, Karolinska University Hospital,
Karolinska Institutet, Stockholm, Sweden
Elisabeth Norin Microbiology and Tumor Biology Center, Karolinska Institutet,
Stockholm, Sweden
Paivi Nurminen Danisco Innovation, Kantvik, Finland
Contributors xix
Liam O'Mahony Alimentary Pharmabiotic Centre, Departments of Medicine and
Surgery, Microbiology, National Food Biotechnology Centre, National University of
Ireland, Cork, Ireland
Arthur C. Ouwehand Danisco Innovation, Kantvik, and Functional Foods Forum,
University of Turku, Turku, Finland
Martin J. Playne Melbourne Biotechnology, Hampton, Victoria, Australia
Joseph J. Rafter Department of Medical Nutrition, Novum, Huddinge University
Hospital, Karolinska Institutet, Stockholm, Sweden
Gregor Reid Canadian Research and Development Center for Probiotics, The Lawson
Health Research Institute, London, Ontario, Canada
Minna Rinkinen Department of Clinical Veterinary Sciences, Faculty of Veterinary
Medicine, University of Helsinki, Helsinki, Finland
Ian R. Rowland Northern Ireland Center for Food and Health, University of Ulster,
Coleraine, Northern Ireland, U.K.
Melvin Samsom Department of Gastroenterology, Utrecht University Medical
Center, Utrecht, The Netherlands
Fergus Shanahan Alimentary Pharmabiotic Centre, Departments of Medicine and
Surgery, National University of Ireland, Cork, Ireland
Barbara Sheil Alimentary Pharmabiotic Centre, Departments of Medicine and
Surgery, Microbiology, National Food Biotechnology Centre, National University
of Ireland, Cork, Ireland
o
Asa Sullivan Department of Laboratory Medicine, Karolinska University Hospital,
Karolinska Institutet, Stockholm, Sweden
Elaine E. Vaughan Unilever Research and Development, Vlaardingen, and
Laboratory of Microbiology, Wageningen University, Wageningen, The Netherlands
Maarten R. Visser Department of Microbiology, Utrecht University Medical Center,
Utrecht, The Netherlands
1
Molecular Ecology of the Human
Intestinal Microbiota
Kaouther Ben Amor
Laboratory of Microbiology, Wageningen University Wageningen, The Netherlands
Elaine E. Vaughan
Unilever Research and Development, Vlaardingen, and Laboratory of Microbiology,
Wageningen University, Wageningen, The Netherlands
INTRODUCTION
The human gastrointestinal (GI) tract is the home of a huge microbial assemblage, the
microbiota, the vast extent of which is only now being revealed. The number of micro
organisms within the intestine greatly exceeds human cells, resulting in one of the most
diverse and dynamic microbial ecosystems. Relationships among the microbes, and
between the microbiota and the host, have a profound influence on all concerned (1,2). The
Gl-tract offers various niches with nutrients, those ingested and generated by the host, and
a relatively non-hostile environment to the microbes. The microbiota play essential roles
in a wide variety of nutritional, developmental, and immunological processes and
therefore significantly contribute to the well being of the host (3-6). During the last
decade, specific bacterial isolates, termed "probiotics," have been extensively used in an
attempt to modulate the intestinal microbiota to benefit the host. Today, there is persuasive
evidence for probiotics in prevention or treatment of a number of intestinal disorders in
humans, especially for reducing bouts of diarrhea and providing relief for lactose
intolerant individuals (7,8). In order to rationally use probiotics, prebiotics or other
functional foods as therapeutic agents, in-depth knowledge of the structure, dynamics, and
function of the bacterial populations of the Gl-tract microbiota is crucial.
Studying the microbial ecology in the intestine involves determining the abundance
and diversity of the microorganisms present, their activity within this niche, and their
interactions with each other and their host (symbiosis, commensalism and pathogenicity).
Although the human intestinal microbiota have been extensively investigated by culture-
based methods more than any other natural ecosystem (9-11), our knowledge about the
culturable fraction of this community is limited. This is essentially due to the challenges of
obtaining pure cultures of intestinal inhabitants, which are hindered by the largely
anaerobic nature of this community, and the paucity of suitable enrichment strategies to
simulate intestinal conditions. The advent of molecular techniques based on 16S
1
2 Amor and Vaughan
ribosomal RNA (rRNA) gene analysis is now allowing a more complete assessment of this
complex microbial ecosystem by unraveling the extent of the diversity, abundance and
population dynamics of this community (12,13). These techniques have extended our view
of those microorganisms that have proven difficult to culture and which play an important
role in gut physiology. This huge intestinal microbial reservoir is estimated to contain
1000 bacterial species and as much as 10 14 cells (1,14). Besides studying the diversity, it is
essential to identify these microbes based upon their eco-physiological traits, i.e., those
that are functionally active versus those that are effectively redundant and play little or no
role at a particular time or at a given site of the intestinal tract. The latter requires the
development of approaches that monitor the activity of these microorganisms at the single
cell level in their natural habitat. This chapter initially reviews molecular techniques to
study the diversity of the microbiota, and subsequently highlights newly developed
molecular methods to study the eco-physiology of the Gl-tract.
GI-TRACT MICROBIOTA AS IDENTIFIED BY 16S rRNA
GENE ANALYSIS
The human Gl-tract microbiota comprise bacteria, archaea and eukarya. It is by far the
bacteria that dominate and reach the highest cell density documented for any microbial
ecosystem (1). The comparative analysis of environmentally retrieved nucleic acid
sequences, most notably of rRNA molecules and the genes encoding them, has become
the standard over the last decade for cultivation-independent assessment of bacterial
diversity in environmental samples (Fig. 1) (15,16). The 16S rRNA gene comprises
highly variable to highly conserved regions, and the differences in sequence are used to
distinguish bacteria at different levels from species to domain and determine phylogenetic
relationships. rRNA gene fragments are today routinely retrieved without prior
cultivation of the microbes by constructing 16S ribosomal DNA (rDNA) libraries. The
procedure is based upon polymerase chain reaction (PCR)-mediated amplification of 16S
rRNA genes or gene fragments, isolated from the environmental sample, followed by
segregation of individual gene copies by cloning into Escherichia coli. In this way a
library of community 16S rRNA genes is generated, the composition of which can be
estimated by screening clones, full or partial sequence analysis, and comparing them with
adequate appropriate reference sequences in databases to infer their phylogenetic
affiliation. Large databases of 16S rRNA gene sequence information (> 200,000
sequences) for described as well as uncultured microorganisms are available, which
provide a high-resolution platform for the assignment of those new sequences obtained in
16S rDNA libraries. Databases harboring 16S rRNA sequences include the ARB software
package (17), the Ribosomal Database project (http://rdp.cme.msu.edu/index.jsp) (18)
and EMBL (www.embl-heidelberg.de/).
Sequencing of 16S rDNA clone libraries generated from various sites of the Gl-tract
including terminal ileum, colon, mucosa and feces have confirmed that relevant fractions
of gut bacteria were derived from new, as yet undescribed bacterial phylotypes (19-23).
Clearly the biases of culturing studies in the 1960s and 1970s such as incomplete
knowledge of culture conditions and selectivity had prejudiced the outcome. The new
molecular studies revealed that the vast majority of rDNA amplicons generated directly
from fecal or biopsy samples of adults, originated from the phyla of the Firmicutes
(including the large class of Clostridia and the lactic acid bacteria), Bacteroidetes,
Actinobacteria (including Atopobium and Bifidobacterium spp.) and Proteobacteria
Molecular Ecology of the Human Intestinal Microbiota
DNA/rRNA of /&
intestinal ecosystem//
Comparative analysis
by PCR-DGGE
PCRon 16SrDNA
or rRNA —^
Quantitative real time
PCR to monitor
GC clamp on
PCR primer & PCR <■
:■ ii n i i :■
u
it
16SrRNA
PCR products
16srDNA
clone libraries
and sequence analysis
Probe and primer
design
4 4
G
A
<^=C>
Identification
and phylogeny
Band extraction
and identification
fl
Figure 1 PCR-based approaches to monitor the Gl-tract microbiota. The 16S rDNA or rRNA
isolated from a Gl-tract sample may be amplified by (reverse transcriptase-) PCR using primers that
target all or some bacteria. The amplicons may be cloned and sequenced in order to identify the
bacteria present in the sample. The 16S rRNA gene comprises highly variable to highly conserved
regions, and the differences in sequence are used to determine phylogenetic relationships and
distinguish bacteria at different levels from species to domain. The DGGE technique is based on
16S rRNA sequence-specific melting behavior of the PCR products, generated with primers one of
which contains a 40-bp GC clamp. Statistical software enables the calculation of similarity indices
and cluster analysis to compare the samples. The 16S rRNA sequences may also be used to design
new primers specific for bacterial groups or species in order to quantify them in samples by real
time PCR. Abbreviations: DGGE, denaturing gradient gel electrophoresis; DNA, deoxyribonucleic
acid; GC, guanine cytosin; PCR, polymerase chain reaction; rDNA, ribosomal deoxyribonucleic
acid; rRNA, ribosomal ribonucleic acid.
(including Escherichia coli). The large class of Clostridia comprises the Clostridium
coccoides-Eubacterium rectale group, and the Clostridium leptum group consists of
Ruminococcus species and Faecalibacterium prausnitzii. These analyses indicated that
the adult intestinal microbiota constitutes a majority of low and high G + C content
Gram-positive bacteria. The latter has been indirectly confirmed by analysis of the
metagenome of bacterial viruses recovered from fecal samples that revealed
predominantly viral sequences with similarity to genomes of bacteriophages specific for
Gram-positive bacteria (24). In fact, this bacterial diversity at the division level relative to
other microbial ecosystems is quite low, mainly deriving from the divisions Firmicutes
and the Cytophaga-Flavobacterium-Bacteroides (9,19).
Interestingly, molecular inventories based on 16S rDNA clone libraries of microbial
communities in inflammatory bowel disease (IBD) patients differed from healthy
4 Amor and Vaughan
subjects (25). In several Crohn's disease (CD) patients numerous clones were isolated
belonging to phylogenetic groups that are commonly not dominant in adult fecal
microbiota of healthy persons, while Bacteroides vulgatus was the only molecular species
shared by all patients, and E. coli clones were also detected unlike in healthy persons (25).
In another study, 16S rDNA libraries generated from mucosa-associated microbiota of
patients with IBD revealed a reduction in diversity due to a loss of normal anaerobic
bacteria, especially those belonging to the Bacteroides, Eubacterium and Lactobacillus
species. Most of the sequenced clones retrieved (70%) were assigned to known intestinal
bacteria, but a significant number of the cloned sequences were affiliated to normal
residents of the oral mucosa such as Streptococcus species (26). It was suggested that
alteration of the microbiota in mucosal inflammation reflects a metabolic imbalance of the
complex microbial ecosystem with severe consequences for the mucosal barrier rather
than disrupted defense to single microorganisms (26).
Even though sequencing of cloned 16S rDNA amplicons provides relevant
information about the identity of uncultured bacteria, the data are not quantitative.
Moreover, PCR and cloning steps are not without bias (27): a recent comparative
analysis of clone libraries from a fecal sample pointed out that the number of PCR
cycles may affect the diversity of the amplified 16S rDNAs and thus should be
minimized (28). More rapid culture-independent options to the cloning procedures
include exploring of the complex microbial populations using a variety of fingerprinting
methods. See Table 1 for an overview of some current methods used to investigate the
intestinal microbiota.
Table 1 Potential and Limitations of Various Methods for Investigating the Diversity of the
Human Intestinal Microbiota
Method
Application
Comments
Culturing
16S rRNA gene
libraries and
sequencing
Dot-blot
hybridization
FISH
PCR-DGGE/TGGE
T-RFLP
Quantitative real
time PCR
Isolation of pure cul-
tures, enumeration
Identification and
phylogeny
Detection, quantifi-
cation and activity
Single cell detection
and enumeration
Rapid profiling of total
microbiota
Rapid profiling of total
microbiota
Detection and quanti-
fication
Not representative for microbiota; insufficient
selective media; time consuming
Large scale cloning is laborious; primer bias
can be an issue
Gives information about activity of microbiota;
of rRNA; comprehensive set of probes
published
High throughput with image analysis software
and flow cytometry; requires probe design;
comprehensive set of probes published
Detection of specific groups possible; semi-
quantitative identification by band extraction
and sequencing
Identification by cloning and sequencing; bank
of T-RF under construction
Requires probe/primers design; very high
throughput
Abbreviations: DGGE, denaturing gradient gel electrophoresis; FISH, fluorescent in situ hybridization; PCR,
polymerase chain reaction; rRNA, ribosomal ribonucleic acid; TGGE, temperature gradient gel electrophoresis;
T-RF, terminal restriction fragment; T-RFLP, terminal restriction fragment length polymorphism.
Molecular Ecology of the Human Intestinal Microbiota 5
FINGERPRINTING REVEALS CHARACTERISTICS
OF THE MICROBIOTA
PCR-Denaturing Gradient Gel Electrophoresis
The most commonly applied fingerprinting methods used to study the Gl-tract
microbiota are denaturing and temperature gradient gel electrophoresis (DGGE and
TGGE, respectively) of PCR-amplified genes coding for 16S rRNA (Fig. 1) (12,23).
Other techniques such as terminal restriction fragment length polymorphism (T-RFLP)
and single strand conformation polymorphism (SSCP) analysis are being applied but
less frequently (26,29). The common principle of these methods is based on the
separation of PCR-amplified segments of 16S rRNA genes of the same length, but
with different sequence to visualize the diversity within the PCR amplicons by a
banding pattern. One of the PCR primers has a 40-bp GC clamp to hold the DNA
strands of the PCR product or amplicon together. With DGGE/TGGE, separation is
based on the decreased electrophoretic mobility of partially melted double-stranded
DNA molecules in polyacrylamide gels containing a linear gradient of DNA
denaturants (a mixture of formamide and urea) or a linear temperature gradient,
respectively. As a result mixed amplified PCR products will form a banding pattern
after staining that reflects the different melting behaviors of the various sequences
(30,31). Subsequent identification of specific bacterial groups or species present in the
sample can be achieved either by cloning and sequencing of the excised bands or by
hybridization of the profile using phylogenetic probes (30). Furthermore, comple-
mentation of the fingerprinting results with statistical analysis provides additional
information of the observed diversity by highlighting some putative correlation
between different sets of variables (32).
Since its application to study the intestinal microbiota, PCR-DGGE/-TGGE
fingerprinting has advanced our knowledge of the intestinal microbiota by unraveling
the complexity of this ecosystem and providing insight in the establishment and
succession of the bacterial community within the host (23,33). The succession of the
microbiota in the feces of infants over the first year of life has been visualized using DGGE
profiles of the total microbial community, which showed the relatively simple and unstable
infant fecal ecosystem (31). In healthy adults, the predominant fecal microbiota was
shown to be complex, host-specific and remarkably stable in time (23,34,35). DGGE
profiles for monozygotic twins were significantly more similar than for unrelated
individuals, while marital partners showed less similar profiles than twins, indicating the
influence of genotype over dietary or environmental factors (35). DGGE profiles also
revealed that the predominant bacterial species associated with the colonic mucosa are
uniformly distributed along the colon, but significantly different from the predominant
fecal community (36,37).
Under certain environmental circumstances and/or in genetically susceptible
individuals, there is clear evidence that the Gl-tract microbiota may play a role in the
pathogenesis and etiology of a number of inflammatory diseases such as ulcerative colitis
(UC), and CD (30,38,39). Using DGGE, TGGE and SSCP fingerprinting analyses, it was
demonstrated that fecal and mucosal-associated microbiota of patients with UC and CD is
altered, less complex, and also unstable over time as compared to matched healthy people
(26,40,41). In subjects with irritable bowel syndrome (IBS), higher temporal instability
was also seen in comparison to healthy persons, but this was likely influenced by
antibiotics used during the study (42).
Amor and Vaughan
Group-Specific PCR-DGGE
Bands originating from lactobacilli in fecal samples could not be detected on the DGGE
profiles since they represent less than 1% of the community, which is approximately the
detection limit of this method (43,44). The dominant fecal microbiota of adults as assessed
by DGGE was not significantly altered following consumption of certain probiotic strains
(34,43). Although DGGE or TGGE were initially developed for total ecosystem
communities, the sensitivity of the method for detecting specific groups that are present
in lower numbers in the Gl-tract such as bifidobacteria and especially lactobacilli has been
considerably enhanced by using group- or genus-specific primers (34,45-47).
Consequently, it was possible to monitor the effect of the administration of prebiotics
and/or probiotics on the composition of indigenous bifidobacterial species, and to track the
probiotic strain itself (46). In the latter case, DGGE profiles showed that the simultaneous
administration of the prebiotic and probiotic (synbiotic approach) did not improve the
colonization of the probiotic strain in the gut of the tested individuals. In another study,
the DGGE profiles generated from fecal samples of healthy individuals fed a probiotic
strain Lactobacillus paracasei F19, allowed the tracing of the probiotic and supported its
presence as autochthonous within the intestinal community of a number of indivi-
duals (45). A nested PCR-DGGE approach has been developed to determine the diversity
of sulfate-reducing bacteria (SRB) in complex microbial communities (48). SRB have
been implicated in the pathogenesis of IBD, and consequently are an interesting
population to investigate.
Recently an approach combining GC fractionation with DGGE (GC-DGGE)
effectively reduced the complexity of the community DNA mixture being analyzed such
that the total diversity within each fraction could be more effectively assessed (49). Thus,
initially the total DNA of the complex community was fractionated using buoyant density
gradient centrifugation based on the % G + C content, using bisbenzimidazole which
preferentially binds to A + T rich regions (50). This fractionation based on G + C content
effectively reduced the complexity of the community DNA mixture being analyzed and
the total diversity within each fraction could be more effectively assessed by the
subsequent DGGE.
Terminal-Restriction Fragment Length Polymorphism
Another community fingerprinting technique which is gaining in popularity is T-RFLP (51).
The basis is a PCR reaction for the 16S rRNA gene in the complex community followed by
restriction enzyme digestion that generates the terminal restriction fragments (T-RFs). The
latter are separated by electrophoresis or by using a capillary electrophoresis sequencer,
which is more high throughput and reproducible (52), to produce a fingerprint. The
technique has been used in several studies, including characterizing the human fecal
bifidobacteria, as well as the tracking of probiotic Lactobacillus strains, and monitoring
antibiotic-induced alterations in intestinal samples (53,54). Further improvements in this
technique include the application of new primer-enzyme combinations for specifically
bacterial populations in human feces (29). Furthermore, a novel phylogenetic assignment
database for the specific T-RFLP analysis of human fecal microbiota (PAD-HCM) has been
designed, which enables a high-level prediction of the terminal-restriction fragments at the
species level (55). This will facilitate the use of this technique in studies on the microbiota.
While the application of 16S rDNA-based fingerprinting methods are particularly
well suited for examining time series and population dynamics, a more quantitative
Molecular Ecology of the Human Intestinal Microbiota 7
approach is useful to complement our knowledge about the composition and structure of
this complex intestinal ecosystem.
16S rRNA-TARGETED PROBES QUANTIFY
THE GI-TRACT MICROBIOTA
Hybridization with rRNA-targeted oligonucleotide probes has become the method of choice
for the direct cultivation-independent identification of individual bacterial cells in natural
samples. During the last decade, this technique has extended our view of bacterial
assemblages and the population dynamics of complex microbial communities (15,56,57). The
most commonly used biomarker for hybridization techniques, whether dot-blot or fluorescent
in situ hybridization (FISH), is the 16S rRNA molecule because of its genetic stability, domain
structure with conserved and variable regions, and high copy number. Highly conserved
stretches may thus be used to design domain- specific probes such as EUB338/EUBII/EUBIII
which collectively target most of the bacteria, whereas specific probes for each taxonomic
level, between bacterial and archaeal, down to genus-specific and species-specific, can be
designed according to the highly variable regions of the 16S rRNA (15,58-60). The increasing
availability of 16S rRNA sequences has contributed significantly to the development of the
hybridization methods and their application in different microbial ecosystems. Unquestion-
ably, the success of the implementation of 16S rRNA hybridization strategies depends on
different factors, among them rational design and validation of newly designed rRNA-
targeted probes.
Probe Design and Validation
There is an online resource for oligonucleotide probes, called probeBase (142), which
contains published FISH rRNA-targeted probes as well as recommended conditions of use,
and many probes for dominant or interesting microbiota groups are described here (61).
When designing new probes, one must consider specificity, sensitivity and accessibility to
the target sequence. Nucleic acid probes can be designed to specifically target taxonomic
groups at different levels of specificity (from species to domain) by virtue of variable
evolutionary conservation of the rRNA molecules. The probes are typically 15-25
nucleotides in length. Appropriate software such as the ARB software package (17) and
availability of large databases (http://rdp.cme.msu.edu/html/) are useful tools for rapid
probe design and in silico specificity profiling. Additional experimental evaluation of the
probes with target and non-target microorganisms is necessary to ensure the specificity and
the sensitivity of the newly designed probe. It is important to notice that the validation of a
newly designed probe requires different procedures for the dot blot (62) and FISH format
(60). Moreover, the hybridization and washing conditions (temperature, salt concentration
and detergent) are also crucial for obtaining a detectable probe signal (63). The
accessibility of the probe to its target site is another factor to be considered when designing
new probes. The accessibility of probe target sites on the 16S and 23 S rRNA of Escherichia
coli has been mapped systematically by flow cytometry (FCM) and FISH, and it was shown
that probe-conferred signal intensities vary greatly among different targets sites (64,65).
More recently, it was demonstrated that accessibility patterns of 16S rRNA's are more
similar for phylogenetically related organisms; these findings may be the first description
of consensus probe accessibility maps for prokaryotes (66).
8
Amor and Vaughan
Hybridization Techniques
Nucleic acid probing of complex communities comprises two major techniques: dot blot
hybridization and FISH. In the dot blot format, total DNA or RNA is extracted from the
sample and is immobilized on a membrane together with a series of RNA from reference
strains. Subsequently, the membrane is hybridized with a radioactively labeled probe and
Specific
fluorescent
oligonucleotides
rRNA in
ribosomes
Antibodies
□
Enzyme
activity
Membrane
integrity
Fluorescent microscopy
and Image analysis
(A)
. .f
Flow cytometry
• . .* i
Fluorescent activated
cell sorting
(
\
Culturing
Molecular Analysis
-e.g., DGGE
Figure 2 FISH involves whole cell hybridization with fluorescent oligonucleotide probes targeted
against specific bacterial groups and species {left-hand scheme). The fluorescent probe hybridized
cells may be visualized and/or counted using fluorescent microscopy and image analysis. The right-
hand scheme illustrates how the viability of the cells may be assessed using functional probes that
can also be visualized by fluorescent microscopy (A). FISH-labeled or functional probe-labeled cells
may also be detected and enumerated using the flow cytometer (FCM). (B) shows a dot blot of fecal
cells that were hybridized with a Bifidobacterium-specific probe. Following FCM the cells can be
sorted according to the functional properties based on the probe stains, and subjected to further
analysis. Abbreviation: DGGE, denaturing gradient gel electrophoresis.
Molecular Ecology of the Human Intestinal Microbiota 9
after a stringent washing step the amount of target rRNA is quantified. The membrane can
be rehybridized with a general bacterial probe, and the amount of population-specific
rRNA detected with the specific probe is expressed as a fraction of the total bacterial RNA.
Quantification of the absolute and relative (as compared to total rRNA) amounts of a
specific rRNA reflects the abundance of the target population. Consequently this technique
does not represent a direct measure of cell number since cellular rRNA content varies with
the current environmental conditions and the physiological activity of the cells at the time
of sampling (67). Dot-blot hybridization has been successfully used to quantify rRNA
from human fecal and cecal samples (68,69). It was found that strict anaerobic bacterial
populations represented by the Bacteroides, Clostridium leptum and Clostridium
coccoides groups were significantly lower in the cecum (right colon) than in the feces,
while the Lactobacillus group was significantly higher in the feces than in the cecum (68).
In contrast to dot-blot hybridization, FISH is applied to morphologically intact cells
and thus provides a quantitative measure of the target organism without the limitation of
culture-dependent methods (Fig. 2) (15,70). Following fixation, bacteria from any given
sample can be hybridized with an appropriate probe or set of probes. The fixation allows
permeabilization of the cell membrane and thus facilitates the accessibility of the
fluorescent probes to the target sequence. For some Gram-positive bacteria, especially
lactobacilli, additional pre-treatments including the use of cell wall lytic enzymes e.g.,
lysozyme, mutanolysin, protease K or a mixture is needed (71-73). Prior to hybridization,
the cells can be either immobilized on gelatine-treated glass slides or simply kept in
suspension when analyzed by FCM. The oligonucleotide probe is labeled covalently at the
5' end with a fluorescent dye, such as fluorescein iso(thio)cyanate, while any necessary
competitor probes are unlabeled. The stringency, i.e., conditions of hybridization that
increase the specificity of binding between the probe and its target sequence, can be adjusted
by varying either the hybridization temperature or formamide concentration. Under highly
stringent conditions oligonucleotide probes can discriminate closely related target sites.
Post-hybridization stringency can be achieved by lowering the salt concentration in the
washing buffer in order to remove unbound probe and avoid unspecific binding.
Quantification of FISH Signals
Over the past years, significant methodological improvements of the probe fluorescent-
conferred signal have been reported. These include the use of brighter fluorochromes
including Cy3 and Cy5 (74,75), and unlabeled helper oligonucleotide probes (76) that bind
adjacent to and increase the accessibility of the selected target site. Horseradish peroxidase
labeled probes and tyramide signal amplification (also termed CARD-FISH) can be used
to significantly enhance the signal intensity of hybridized cells (77). However, the latter
requires effective permeabilization for the large enzyme-probe complex to enter the cell
with the risk of damaging and lysing fixed cells. A further possibility is the use of peptide
nucleic acid (PNA) probes which can confer very bright signals to the cell (78,79).
However, currently PNA probes are rather expensive and previously published
oligonucleotide probes cannot be simply translated into PNA probes.
Epifluorescence microscopy is the standard method by which fluorescent-stained
cells are enumerated; however, the method is time consuming and subjective (56,57). This
technique has been improved by development of automated image acquisition and analysis
software allowing accurate microscopic enumeration of fecal bacterial cells (73).
Alternatively, FCM offers a potential platform for high-resolution, high throughput
identification and enumeration of microorganisms using fluorescent rRNA-targeted
oligonucleotides with the possibility of cell sorting (40,80-84).
10 Amor and Vaughan
An FCM method for direct detection of the anaerobic bacteria in human feces was first
described over a decade ago (85). A membrane-impermeable nucleic acid dye propidium
iodide (PI) was used in combination with the intrinsic scatter parameters of the cells to
discriminate fecal cells from large particles. Coupling FCM results and image analysis, the
authors showed that most of the particles detected with a large forward scatter value
corresponded to aggregates most likely representing mucus fragments and undigested
dietary compounds. They confirmed by means of cell sorting that the Pi-stained cells (fecal
cells) corresponded to a 2-D surface area of <1.5 urn while the unstained particles
(aggregates) were around 5.0 um (85). The work highlighted the potential of FCM to study
anaerobic fecal bacteria without culturing. Despite this valuable work and to quote from
Shapiro "the subject matter may stink, but the method is superb" (86), the application of
FCM to study the intestinal microbiota is still in development.
FISH-FCM was applied to detect and accurately quantify both fecal and mucosa-
associated bacteria, and statistical analysis showed a high correlation between the FCM
counts and microscopic counts (Fig. 2) (37,44,84). Using FCM, several thousands of cells
can be counted accurately in a few seconds. Following the hybridization step, fecal
cells are stained with a nucleic acid dye, for example PI, SYTO BC, and TOTO-1, to
detect the total cells and subsequently spiked with standard beads of known size and
concentration. The beads are thus used as an internal standard to calibrate the measured
volume and to determine the absolute count of the probe-detected cells (40,87). In
addition to the determination of the absolute cell counts, the fluorescence intensity signal
can also be quantified using fluorescent beads with known fluorescent intensities (86).
This is of major importance for determining optimal hybridization conditions for newly
designed probes (37,82,88). FCM is becoming a popular method for high-resolution, high
throughput identification of microorganisms using fluorescent rRNA-targeted
oligonucleotides.
Application of FISH to Study the Gl-Tract Ecosystem
During the last five years, hybridization studies with rRNA-targeted probes have provided
significant knowledge about the composition and structure of the gut microbiota. A large
panel of oligonucleotide probes specific for various genera predominant in the GI tract
have been designed and validated (Table 2), and have been used intensively in
these studies.
The uniqueness and complexity of the human gut microbiota revealed by finger-
printing techniques were supported by results of analysis using nucleic-acid probe-based
methods. These studies revealed that the majority of fecal bacteria belong to the
Clostridium coccoides-Eubacterium rectale group and the Clostridium leptum group
( ~ 20-30% each), Bacteroides ( ~ 10%), Atopobium and bifidobacteria groups in that order
of abundance (81,89,91,96,97). The Clostridium coccoides-Eubacterium rectale probe
(Erec482) (Table 2) covers Eubacterium hallii, Lachnospira and Ruminococcus members,
while the Clostridium leptum group comprises members of Ruminococcus species and
Faecalibacterium prausnitzii (89,98). In particular members of C. coccoides-E. rectale,
C leptum, and the Bacteroides groups constituted more than half of the fecal microbiota.
Atopobium and bifidobacteria groups comprised typically 4-5% each. The Lactobacillus -
Enterococcus group, Enterobacteriaceae, Phascolarctobacterium and relatives, and
Veillonella were less dominant (0.1 to a few percent) (90,91). However, differences in
the occurrence of these bacterial groups have been reported by different research groups.
These deviations may be due to the different methods or probes used, but it is also likely
that the observed variance is due to the differences in the genetic background, lifestyle,
Molecular Ecology of the Human Intestinal Microbiota
11
Table 2 FISH Probes Used to Study the Gastrointestinal Microbiota
Probe
Probe sequence (5"— 3")
Target organism
% Formamide
Reference
Eub338
GCTGCCTCCCGTAGGAGT
Most bacteria
0-80
(58)
Eubll
GCAGCCACCCGTAGGTGT
Planctomycetes
0-60
(60)
Eublll
GCTGCCACCCGTAGGTGT
Verrucomicrobia
0-60
(60)
Bac303
CCAATGTGGGGGACCTT
Bacteroides/
Prevotella
(59)
Bdis656
CCGCCTGCCTCAAACATA
Bacteroides
distasonis
(89)
Bfra602
GAGCCGCAAACTTTCACAA
Bacteroides fragilis
30
(89)
Bvulgl017
AGATGCCTTGCGGCT-
TACGGC
Bacteroides vulgatus
30
(82)
Bfrag998
GTTTCCACATCATTCCACTG
Bacteroides fragilis
30
(83)
Bdistl025
CGCAAACGGCTATTGGTAG
Bacteroides
distasonis
30
(68)
Erec482
GCTTCTTAGTCAR a GTACCG
Clostridium
coccoides group
(89)
Clep866
GGTGGATWACTTATTGTG
Clostridium leptum
group
30
(90)
Rfla729
AAAGCCCAGTAAGCCGCC
Ruminococcus
flavefaciens
20
(91)
Rbro730
TAAAGCCCAGY a AGGCCGC
Ruminococcus bromii
(91)
Rcal733
CAGTAAAGGCCCAG-
TAAGCC
Ruminococcus
callidus
30
(90)
ElgcOl
GGGACGTTGTTTCTGAGT
Clostridium leptum
subgroup
(89)
Fprau645
CCTCTGCACTACTCAA-
GAAAA
Faecalibacterium
prausnitzii
15
(92)
Bifl64
CATCCGGCATTACCACCC
Bifidobacteria
(93)
Ato291
GGTCGGTCTCTCAACCC
Atopobium group
(94)
Veil223
AGACGCAATCCCCTCCTT
Veillonella
(91)
Ecyl387
CGCGGCATTGCTGCTTCA
Eubacterium
cylindroides
20
(91)
Cvirl414
GGGTGTTCCCGRCTCTCA
Clostridium viride
30
(90)
Edes635
AGACCARCAGTTTGAAA
Eubacterium
desmolans
30
(90)
Lach571
GCCACCTACACTCCCTTT
Lachnospira group
40
(91)
Ehall469
CCAGTTACCGGCTCCACC
Eubacterium halii
group
20
(91)
Phasco741
TCAGCGTCAGACACAGTC
Phascolarctobacte
Hum group
(91)
Enterl432
CTTTTGCAACCCACT
Enteric group
30
(68,69)
Strc498
GTTAGCCGTCCCTTTCTGG
Lactococcus lactis
ssp. lactis
30
(89,90)
Labl58
GGTATTAGCAY a CTGT
TTCCA
Lactobacillus!
Enterococcus
(95)
Urobe63
AATAAAGTAATTCCCGTTCG
Uncultured Rumino-
coccus obeum-like
bacteria
20
(84)
Urobeb
AAARAARTATTTCCCGTTCG
Non338
ACATCCTACGGGAGGC
Negative control
(83)
N, R, W, and Y are the International Union of Pure and Applied Chemistry codes for ambiguous bases.
12 Amor and Vaughan
and diet in the human populations studied. Two large studies, where an extensive array of
oligonucleotide probes that targeted the major bacterial groups in the GI- tract of northern
European adults was used, showed that 62-75% of the fecal bacteria could be detected and
identified. The remainder (~ 30%) could either belong to members of the Archaea,
Eukarya or most likely to yet unknown bacteria (90,91). These types of studies provide a
valuable basis in order to eventually determine factors that change the microbiota such as
lifestyle, diet or illness. Interestingly, FISH-FCM analysis of fecal microbiota of
patients with UC revealed substantial temporal variations in the major bacterial groups
studied (i.e., Bacteroides, C. coccoides-E. rectale, Atopobium, bifidobacteria and
lactobacilli), which was further was supported by PCR-DGGE profiles (40).
NEW MOLECULAR DIVERSITY APPROACHES
Real Time PCR
Real time quantitative PCR (qPCR) of the 16S rRNA gene is being developed the last
few years for the detection and quantification of human intestinal microbiota, which has
Q
the advantages of being high throughput and measuring from 1 to up to 10 CFU (99).
Both SYBR Green I and TaqMan chemistries have been used to target Bacteroides
frag His, Bifidobacterium species, E. coli, L. acidophilus and Ruminococcus productus,
and the method was demonstrated to be easier and faster than dot-blot hybridization
methodology (100). Real-time qPCR (5 f nuclease PCR assay) has been used to study the
microbiota that adhere to the colonic mucosa (101). The primer-probe combinations
were applied to DNA for the detection of E. coli and Bacteroides vulgatus from pure
cultures and colonic biopsy specimens. The assay was very sensitive detecting as little
as 1 and 9 CFU of E. coli and B. vulgatus, respectively. Many of the qPCR assays being
developed target the lactobacilli and Bifidobacterium species that may be incorporated
in functional foods (102,103). Besides real time PCR of the 16S rRNA gene, the option
to use the transaldolase gene of Bifidobacterium species has also been investigated and
appeared to be superior to the former in quantifying bifidobacterial populations in
infants (104). The qRT-PCR assays have been used for various applications such as
comparison of healthy persons versus patients suffering from IBS (105), and in patients
with active IBD (26). Recently, a TaqMan real-time PCR-based method for the
quantification of 20 dominant bacterial species and groups of the microbiota was
developed (106). This method involved a pair of conserved primers, as well as universal
and specific quantification probes, for species, group or genus in question, in a single
reaction, and allowed relative and absolute quantification of bacteria in human biopsy
and fecal samples. Further developments in real-time qPCR will facilitate our insight
into the dynamics of the microbiota.
Diagnostic DNA Microarrays
The development of DNA oligonucleotide microarrays offer a fast, high throughput option
for detection and estimation of the diversity of microbes in a complex ecosystem (107).
Alternative terms for the microarrays are phylochips, microbial diagnostic microarrays and
identification arrays. Their principle is based on the dot-blot hybridization described above.
Typically microarrays contain hundreds of oligonucleotide probes, usually based on the 16S
rRNA gene, specific for different strains or species or genera of microorganisms that are
detected in a single assay. Total DNA or RNA is isolated from the sample, fragmented,
and amplified by PCR with the simultaneous incorporation of labeled nucleotides, or
Molecular Ecology of the Human Intestinal Microbiota 13
directly chemically labeled. The labeled fragments are hybridized to the probes
immobilized on a surface, and following washing hybridized fragments are detected by a
fluorescence scanner. There are many different forms of arrays to which the probes can be
attached including macroarrays, and glass microarrays that are low to medium density, and
very high density Affymetric microarrays (> 10 4 probes typically 25 mer per chip) (108).
Three-dimensional form microarrays such as the Pamgene system and gel-pads allow the
option for quantitative detection (109). Studies are underway to apply microarray
technology to the human intestinal microbiota (16). A macroarray membrane-based method
with 60 40-mer oligonucleotide probes specific for the dominant microbiota demonstrated
the feasibility of arrays for detection (110). The high throughput potential of arrays will
undoubtedly encourage further efforts in this area in the coming years.
ASSESSMENT OF MICROBIOTA VITALITY AND METABOLIC ACTIVITY
The aforementioned molecular techniques have greatly contributed to our fundamental
understanding of the biodiversity, establishment, succession and structure of the intestinal
microbiota; yet little is known about the in situ association between the microbial diversity
and the metabolic activity of a phylogenetic affiliated group. A further challenge is to
determine the physiological activity of the detected cells. This includes those cells that are
naturally present within the ecosystem as well as the ingested members from fermented or
functional foods. Moreover, the use of specific food-grade lactic acid bacteria as vectors
for therapeutic delivery of molecules with targeted activity in the host is being investigated
(111,112). These bacteria appear capable of surviving and of being physiologically active
at the mucosal surfaces in animal models. Biological containment systems are being
developed for these genetically modified lactic acid bacteria to limit their activity to the
host and allow their use in human healthcare (113).
In Situ Activity
Quantitative hybridization with fluorescent rRNA probes (as in FISH) is a useful indicator
of activity as there is a correlation between the growth rate, which is coupled to efficient
protein synthesis, and the number of ribosomes. The FISH technique has been used to
estimate growth rates of Escherichia coli cells colonizing the intestinal tract of mice (1 14).
In situ activity of pure cultures of the human commensal Lactobacillus plantarum strain
has been measured by correlating the rRNA, as determined by fluorescence intensity, with
the cell growth rate (72). However, at very high cell densities, a typical property of
L. plantarum at late stages of growth, changes in the cell envelope appeared to prevent
effective entry of the probe into the cells. Permeabilization issues may confound
application of this technique to certain microbes in complex environments like the
intestine. Furthermore, recent data suggest that cellular ribosome content is not always an
indicator of physiological activity. Apparently some bacterial cells might be highly active
but possess a low ribosome content (115), while other bacterial types possess high RNA
even after extended starvation periods (116).
During the last years several innovative methods have been developed to resolve the
linkage between taxonomic identity, activity and function in microbial communities. One
of these techniques involves microautoradiography (MAR), which when combined with
FISH (MAR-FISH), determines the uptake of specific radiochemicals by individual cells
(1 17,1 18). MAR-FISH allows monitoring of the radio-labeled substrate uptake patterns of
the probe-identified organisms under different environmental conditions (117,119). This
14 Amor and Vaughan
method has been applied with high throughput DNA microarray analysis to study the
complex activated sludge ecosystem (120).
Linking Taxomony to Function
Another recently developed molecular technique coupled with substrate labeling is stable
isotope probing (SIP) (121,122). In SIP, either lipid biomarkers (123), DNA (121) or RNA
(124) are extracted from microbial communities incubated with C-labeled substrates. If
cells grow on the added compounds, their pool of macromolecules will be isotopically
enriched (heavy) compared to those of inactive organisms. For DNA- or RNA-SIP,
identification of the metabolically active organisms (heavy) is achieved by separation of
community DNA/RNA according to their buoyant density by means of equilibrium
density-gradient centrifugation, followed by PCR-amplification of 16S rRNA genes in the
isotopically heavy DNA/RNA pool, cloning and sequencing. The use of RNA was
proposed as a more responsive biomarker as its turnover is much higher than that of
DNA (124). Phospholipid fatty acids are also used as biomarker for C enrichments, but
their resolution for diversity analysis is less powerful than for sequence analysis.
Reporters to Monitor Gene Expression
Molecular reporter systems may also be used to monitor activity of specific genes of a
microbe of the complex intestinal ecosystem. Generally this involves fusing the reporter
gene to the promoter of the bacterial gene of interest, such as stress- and starvation-
induced genes and other growth physiology-related genes. It is noteworthy that this
approach involves a genetically modified microbe, and consequently, its application is
limited to animal studies. The adaptation of ingested lactic acid bacteria has received
particular attention in terms of how they adapt their metabolism in order to survive and
colonize within the gastrointestinal niches.
The fusion of bacterial promoters from Lactococcus lactis with genes of the reporter
protein luciferase (luxA-luxB genes of Vibrio harveyi) was developed to investigate gene
expression of this food-grade bacteria in the mouse intestinal tract (125). L. lactis strains
marked with reporter genes for luciferase and the green fluorescent protein (GFP; from
Aequorea victoria) were studied for their metabolic activity and survival by assessment of
lysis, respectively, which revealed differential expression depending on the intestinal
conditions and mode of administration (126). Following consumption by rats and analysis
of the strains in the different regions of the intestinal tract, the lactococci were
demonstrated to survive gastric transit quite well but the majority lost activity and
underwent lysis in the duodenum. The luciferase gene reporter system has also been
applied to a probiotic Lactobacillus casei strain that is added to fermented dairy products.
The luciferase-harboring L. casei derivative was consumed in milk by mice harboring
human microbiota. Luciferase activity was undetectable in the stomach to jejunum, but
detected when the cells reached the ileum, and the activity remained at a maximum level in
the cecum, confirming reinitiation of protein synthesis in the ileal and cecal compartments
(127,128).
Several variants of the GFP have been developed such as GFPs with alternative
emission wavelengths, or with reduced stability to monitor shifts in gene expression
(129,130).
Molecular Ecology of the Human Intestinal Microbiota 15
Flow Cytometry-Based Approaches
FCM in combination with a variety of fluorescent physiological probes and cell sorting
analysis is invaluable for measuring viability of cells in environmental samples
(80,87,131,132). Ability to grow in medium is the current standard to assess viability, but
it is recognized that some cells enter a non-culturable state although still exhibit metabolic
activity. The criteria by which viability is evaluated by the FCM include membrane
permeability or integrity, enzyme activity, and/or maintenance of a membrane-potential
(Fig. 2). One of the most widely used dyes for assessment of viability is carboxy-fluorescein
diacetate, a non-fluorescent precursor that diffuses across the cell membrane, but is retained
only by viable cells with intact membranes which convert it into a membrane-impermeant
fluorescent dye by non-specific esterases of active cells. Another probe is PI, a nucleic acid
dye, which is excluded by viable cells with intact membranes, but enters cells with damaged
membranes and binds to their DNA or RNA. Simultaneous staining of fecal Bifidobacterium
species with these two probes was used to assess their viability during bile salt stress (133).
Subsequent detection with the FCM and cell sorting revealed three populations representing
viable, injured and dead cells, whereby a significant portion (40%) of the injured cells could
be cultured. This approach highlights the importance of multi-parametric FCM as a
powerful technique to monitor physiological heterogeneity within stressed populations at
the single cell level.
FCM also allows monitoring of bacterial heterogeneity at the single cell level and
provides a mean to sort sub-populations of interest for further molecular analysis (15).
Recently, the viability of fecal microbiota in fecal samples was assessed by combining a
viability assay with flow sorting, and subsequent analysis by PCR-DGGE and
identification by cloning and 16S rRNA sequencing (80). The fecal cells of four adults
were initially discriminated with physiological probes PI and SYTO BC into viable,
injured and dead cells. This revealed that only approximately half of the microbial
community in fecal samples is viable, while the remainder was injured or dead (about a
quarter each of the total community). This is in agreement with a previous analysis of
proportions of dead bacteria in 10 persons which ranged from 17% to 34%, as assessed by
PI only (134). The 16S rRNA analysis indicated which bacterial groups comprised
live, dead or injured populations, for example many butyrate-producers were in the live
fractions, while many clones from Bacteroides were found in the dead fractions (80).
Specific PCR-DGGE and 16S rRNA analysis of the bifidobacterial and lactobacilli
populations showed sequences with low similarity to the characterized species suggested
the potential of as yet uncultured novel species in humans (80,135). This interesting
combination of technologies provided ecological information on the in situ diversity and
activity of the fecal microbes.
PERSPECTIVES
This chapter has highlighted the extraordinary advances in the molecular technologies that
have substantially contributed to our knowledge and understanding of the human intestinal
microbiota. The application of these molecular tools has greatly facilitated our analysis
of the composition of the human microbiota. A picture of the "typical" microbiota for at
least the northern European population of infants and adults is emerging, as are differences
in individuals with intestinal diseases. The diversity is far greater than previously
predicted from the initial culturing studies in the 1960s. Consequently, further
technological improvements to perform the techniques at higher throughput, and for
16 Amor and Vaughan
measurement of more subtle changes in the diversity of the microbiota due to, for example,
specific dietary components, require further development. Microarray technology is
amenable to both these requirements, and currently DNA microarrays are being
constructed for the human microbiota using 16S rRNA sequences of microbiota (136);
[Mirjana Rajilic and Willem M. de Vos, personal communication]. FCM with its unique
capacity for quantitative and high throughput analysis is resulting in the development of an
alternative type of array using beads with oligonucleotide probes on the surface that can be
applied in hybridization assays in suspension (137-139).
The substantial impact of this highly diverse microbiota on the health of the human
host is now well recognized, such as processing of undigested food, contributing to the host
defense and regulating fat storage amongst others (6, 140, 141). It is a particular challenge to
develop methods that allow monitoring of microorganisms according to their eco-
physiological traits in situ. The application of cytometric protocols using fluorescent
probes in combination with molecular techniques opens the potential for examining key
microbial processes and community function in complex microbial ecosystems. Further
efforts to determine the molecular foundations of the host-microbiota interactions will
require multi-disciplinary approaches. The rewards of this research in terms of promoting
host health via our microbiota and diet can be substantial, as well as novel approaches for
treating intestinal diseases and infections caused by pathogens.
REFERENCES
1. Backhed F, Ley RE, Sonnenburg JL, Peterson DA, Gordon JI. Host-bacterial mutualism in the
human intestine. Science 2005; 5717:1915-1920.
2. Rawls JF, Samuel BS, Gordon JI. Gnotobiotic zebrafish reveal evolutionarily conserved
responses to the gut microbiota. Proc Natl Acad Sci USA 2004; 101:4596-4601.
3. Falk PG, Hooper LV, Midtvedt T, Gordon JI. Creating and maintaining the gastrointestinal
ecosystem: what we know and need to know from gnotobiology. Microbiol Mol Biol Rev
1998;62:1157-1170.
4. Stappenbeck TS, Hooper LV, Gordon JI. Developmental regulation of intestinal
vasculogenesis by indigenous microbes via Paneth cells. Proc Natl Acad Sci USA 2002;
99:15451-15455.
5. Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, Edberg S, Medzhitov R. Recognition of
commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell 2004;
118:229-241.
6. Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science 2001;
292:1115-1118.
7. Ouwehand AC, Salminen S, Isolauri E. Probiotics: an overview of beneficial effects. Antonie
Van Leeuwenhoek 2002; 82:279-289.
8. Rachmilewitz D, Katakura K, Karmeli F, et al. Toll-like receptor 9 signaling mediates the
anti-inflammatory effects of probiotics in murine experimental colitis. Gastroenterology
2004; 126:520-528.
9. Finegold SM, Sutter VL, Mathisen GE. Normal indigenous flora. In: Hentges DJ, ed. Human
Intestinal Microflora in Health and Disease. New York: Academic Press, 1983:3-31.
10. Holdeman LV, Good IJ, Moore WE. Human fecal flora: variation in bacterial composition
within individuals and a possible effect of emotional stress. Appl Environ Microbiol 1976;
31:359-375.
11. Moore WE, Holdeman LV. Human fecal flora: the normal flora of, 20 Japanese-Hawaiians.
Appl Microbiol 1974; 27:961-979.
12. Vaughan EE, Schut F, Heilig HGHJ, Zoetendal EG, de Vos WM, Akkermans ADL. A
molecular view of the intestinal ecosystem. Curr Issues Intest Microbiol 2000; 1:1—12.
Molecular Ecology of the Human Intestinal Microbiota 17
13. Zoetendal EG, Cheng B, Koike S, Mackie RI. Molecular microbial ecology of the
gastrointestinal tract: from phylogeny to function. Curr Issues Intest Microbiol 2004; 5:31-47.
14. Whitfield J. Features-science and health: microbial soup of life is sieved for treasure.
Financial Times, 16 April 2004 http://news.ft.com.
15. Amann R, Ludwig W, Schleifer K. Phylogenetic identification and in situ detection of
individual microbial cells without cultivation. Microbiol Rev 1995; 59:143-169.
16. Namsolleck P, Thiel R, Lawson P, et al. Molecular methods for the analysis of gut microbiota.
Microb Ecol Health Dis 2004; 16:71-85.
17. Ludwig W, Strunk O, Westram R, et al. ARB: a software environment for sequence data.
Nucleic Acids Res 2004; 32:1363-1371.
18. Cole JR, Chai B, Marsh TL, et al. The Ribosomal database project (RDP-II): previewing a
new autoaligner that allows regular updates and the new prokaryotic taxonomy. Nucleic Acids
Res 2003; 31:442-443.
19. Eckburg PB, Bik EM, Bernstein CN, et al. Diversity of the human intestinal microbial flora.
Sci Express 2005; 14:1-4.
20. Hayashi H, Sakamoto Y, Benno M. Phylogenetic analysis of the human gut microbiota using
16S rDNA clone libraries and strictly anaerobic culture-based methods. Microbiol Immunol
2002; 46:535-548.
21. Hold GL, Pryde SE, Russell VJ, Furrie E, Flint HJ. Assessment of microbial diversity in
human colonic samples by 16S rDNA sequence analysis. FEMS Microbiol Ecol 2002;
39:33-39.
22. Suau A, Bonnet R, Sutren M, et al. Direct analysis of genes encoding 16S rRNA from
complex communities reveals many novel molecular species within the human gut. Appl
Environ Microbiol 1999; 65:4799-4807.
23. Zoetendal EG, Akkermans ADL, De Vos WM. Temperature gradient gel electrophoresis
analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities
of active bacteria. Appl Environ Microbiol 1998; 64:3854-3859.
24. Mangin I, Bonnet R, Seksik P, et al. Molecular inventory of fecal microflora in patients with
Crohn's disease. FEMS Micro Ecol 2004; 50:25-36.
25. Breitbart M, Hewson I, Felts B, et al. Metagenomic analyses of an uncultured viral
community from human feces. J Bacteriol 2003; 185:6220-6223.
26. Ott SJ, Musfeldt M, Wenderoth DF, et al. Reduction in diversity of the colonic mucosa
associated bacterial microflora in patients with active inflammatory bowel disease. Gut 2004;
53:685-693.
27. Von Wintzingrode F, Gobel UB, Stackebrandt E. Determination of microbial diversity in
environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiol Rev 1997;
21:213-229.
28. Bonnet R, Suau A, Dore J, Gibson GR, Collins MD. Differences in rDNA libraries of
fecal bacteria derived from 10- and 25-cycle PCRs. Int J Syst Evol Microbiol 2002;
52:757-763.
29. Nagashima K, Hisada T, Sato M, Mochizuki J. Application of new primer-enzyme
combinations to terminal restriction fragment length polymorphism profiling of bacterial
populations in human feces. Appl Environ Microbiol 2003; 69:1251-1262.
30. Muyzer G, de Waal E, Uitterlinden A. Profiling of complex microbial populations by
denaturing gradient gel electrophoresis analysis of polymerase chain reaction-amplified genes
coding for 16S rRNA. Appl Environ Microbiol 1993; 59:695-700.
31. Rosenbaum V, Riesner D. Temperature-gradient gel electrophoresis. Thermodynamic
analysis of nucleic acids and proteins in purified form and in cellular extracts. Biophys
Chem 1987; 26:235-246.
32. Formin N, Hamelin S, Tarnawski S, et al. Statistical analysis of denaturing gel electrophoresis
(DGE) fingerprinting patterns. Environ Microbiol 2002; 4:634-643.
33. Favier CF, Vaughan EE, De Vos WM, Akkermans ADL. Molecular monitoring of succession
of bacterial communities in human neonates. Appl Environ Microbiol 2002; 68:219-226.
18 Amor and Vaughan
34. Tannock GW, Munro K, Harmsen HJM, Welling GW, Smart J, Gopal PK. Analysis of the
fecal microflora of human subjects consuming a probiotic product containing Lactobacillus
rhamnosus DR20. Appl Environ Microbiol 2000; 66:2578-2588.
35. Zoetendal EG, Akkermans ADL, Akkermans-van Vliet WM, de Visser JAGM, de Vos WM.
The host genotype affects the bacterial community in the human gastrointestinal tract.
Microbiol Ecol Health Dis 2001; 13:129-134.
36. Nielsen D, Moller P, Rosenfeldt V, Paerregaard A, Michaelsen K, Jakobsen M. Case study of
the distribution of mucosa-associated Bifidobacterium species, and Lactobacillus species,
and other lactic acid bacteria in the human colon. Appl Environ Microbiol 2003;
69:7545-7548.
37. Zoetendal EG, von Wright A, Vilpponen-Salmela T, Ben- Amor K, Akkermans ADL, de
Vos WM. Mucosa-associated bacteria in the human gastrointestinal tract are uniformly
distributed along the colon and differ from the community recovered from feces. Appl
Environ Microbiol 2002; 68:3401-3407.
38. Campieri M, Gionchetti P. Bacteria as the cause of ulcerative colitis. Gut 2001; 48:132-135.
39. Shanahan F. Probiotics: a perspective on problems and pitfalls. Scand J Gastroenterol Suppl
2003;(237):34-46.
40. Ben- Amor K, Heikamp-de jong I, Verhaegh S, de Vos WM, Vaughan EE. Population
dynamics and diversity of fecal microbiota of patients with ulcerative colitis participating in a
probiotic trial. In: Ben- Amor K, eds. Microbial ecophysiology of the human intestinal tract: A
flow cytometric approach. Netherland: PhD Thesis Wageningen University, 2004:83-121.
41 . Seksik P, Rigottier-Gois L, Gramet G, et al. Alterations of the dominant fecal bacterial groups
in patients with Crohn's disease of the colon. Gut 2003; 52:237-242.
42. Matto J, Maunuksela L, Kajander K, et al. Composition and temporal stability of
gastrointestinal microbiota in irritable bowel syndrome-a longitudinal study in IBS and
control subjects. FEMS Immunol Med Microbiol 2005; 43:213-222.
43. Vaughan EE, Heilig HGHJ, Zoetendal EG, et al. Molecular approaches to study probiotic
bacteria. Trends Food Sci Technol 1999; 10:400-404.
44. Zoetendal EG, Ben Amor K, Akkermans AD, Abee T, de Vos W. DNA isolation protocols
affect the detection limit of PCR approaches of bacteria in samples from the human
gastrointestinal tract. Syst Appl Microbiol 2001; 24:405-410.
45. Heilig HGHJ, Zoetendal EG, Vaughan EE, Marteau P, Akkermans ADL, de Vos WM.
Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine
as determined by specific amplification of, 16S ribosomal DNA. Appl Environ Microbiol
2002;68:114-123.
46. Satokari RM, Vaughan EE, Akkermans AD, Saarela M, De Vos WM. Polymerase chain
reaction and denaturing gradient gel electrophoresis monitoring of fecal Bifidobacterium
populations in a prebiotic and probiotic feeding trial. Syst Appl Microbiol 2001;
24:227-231.
47. Walter J, Hertel C, Tannock GW, Lis CM, Munro K, Hammes WP. Detection of
Lactobacillus, Pediococcus, Leuconostoc, and Weissella species in human feces by using
group- specific PCR primers and denaturing gradient gel electrophoresis. Appl Environ
Microbiol 2001; 67:2578-2585.
48. Dar SA, Kuenen JG, Muyzer G. Nested PCR-denaturing gradient gel electrophoresis approach
to determine the diversity of sulfate-reducing bacteria in complex microbial communities.
Appl Environ Microbiol 2005; 71:2325-2330.
49. Holben WE, Feris KP, Kettunen A, Apajalahti JH. GC fractionation enhances microbial
community diversity assessment and detection of minority populations of bacteria by
denaturing gradient gel electrophoresis. Appl Environ Microbiol 2004; 70:2263-2270.
50. Holben WE, Harris D. DNA-based monitoring of total bacterial community structure in
environmental samples. Mol Ecol 1995; 4:627-6331.
5 1 . Kitts CL. Terminal restriction fragment patterns: a toll for comparing microbial communities
and assessing community dynamics. Curr Issues Intest Microbiol 2001; 2:17-25.
Molecular Ecology of the Human Intestinal Microbiota 19
52. Osborn AM, Moore ER, Timmis KN. An evaluation of terminal-restriction fragment length
polymorphism (T-RFLP) analysis for the study of microbial community structure and
dynamics. Environ Microbiol 2000; 2:39-50.
53. Jernberg C, Sullivan A, Edlund C, Jansson JK. Monitoring of antibiotic-induced alterations in
the human intestinal microflora and detection of probiotic strains by use of terminal restriction
fragment length polymorphism. Appl Environ Microbiol 2005; 71:501-506.
54. Sakamoto M, Hayashi H, Benno Y. Terminal restriction fragment length polymorphism
analysis for human fecal microbiota and its application for analysis of complex bifidobacteria!
communities. Microbiol Immunol 2003; 47:133-142.
55. Matsumoto M, Sakamoto M, Hayashi H, Benno Y. Novel phylogenetic assignment database
for terminal-restriction fragment length polymorphism analysis of human colonic microbiota.
J Microbiol Methods 2005; 61:305-319.
56. Lipski A, Friedrich U, Altendorf K. Application of rRNA-targeted oligonucleotide probes in
biotechnology. Appl Microbiol Biotechnol 2001; 56:40-57.
57. Moter A, Gobel UB. Fluorescence in situ hybridization (FISH) for direct visualization of
microorganisms. J Microbiol Methods 2000; 41:85-112.
58. Amann RI, Binder B, Olson R, Chisholm SW, Devereux R, Stahl D. Combination of 16S
rRNA-targeted oligonucleotide probes with flow cytometry for analyzing mixed microbial
populations. Appl Environ Microbiol 1990; 56:1919-1925.
59. Manz W, Amann R, Ludwig W, Vancanneyt M, Schleifer K. Application of a suite of 16S
rRNA-specific oligonucleotide probes designed to investigate bacteria of the phylum
cytophaga-flavobacter-bacteroides in the natural environment. Microbiology 1996;
142:1097-1106.
60. Daims H, Bruhl A, Amann R, Schleifer KH, Wagner M. The domain-specific probe EUB338
is insufficient for the detection of all Bacteria: development and evaluation of a more
comprehensive probe set. Syst Appl Microbiol 1999; 22:434-444.
61. Loy A, Horn M, Wagner M. Probebase: an online resource for rRNA-targeted oligonucleotide
probes. Nucleic Acids Res 2003; 31:514-516.
62. de los Reyes FL, Ritter W, Raskin L. Group-specific small-subunit rRNA hybridization
probes to characterize filamentous foaming in activated sludge systems. Appl Environ
Microbiol 1997; 63:1107-1117.
63. Stahl DA, Amann R. Development and application of nucleic acid probes. In:
Stackerbrandt E, Goodfellow M, eds. Nucleic Acid Techniques in Bacterial Systematics.
Chichester: John Wiley & Sons Ltd, 1991:205-248.
64. Fuchs BM, Syutsubo K, Ludwig W, Amann R. In situ accessibility of Escherichia coli, 23S
rRNA to fluorescently labeled oligonucleotide probes. Appl Environ Microbiol 2001;
67:961-968.
65. Fuchs BM, Wallner G, Beisker W, Schwippl I, Ludwig W, Amann R. Flow cytometric
analysis of the in situ accessibility of Escherichia coli 16S rRNA for fluorescently labeled
oligonucleotide probes. Appl Environ Microbiol 1998; 64:4973-4982.
66. Behrens S, Fuchs BM, Mueller F, Amann R. Is the in situ accessibility of the 16S rRNA
of Escherichia coli for Cy3-labeled oligonucleotide probes predicted by a three-
dimensional structure model of the 30S ribosomal subunit? Appl Environ Microbiol 2003;
69:4935-4941.
67. Molin S, Givskov M. Application of molecular tools for in situ monitoring of bacterial growth
activity. Environ Microbiol 1999; 1:383-391.
68. Marteau P, Pochart P, Dore J, Bera-Maillet C, Bernalier A, Corthier G. Comparative study of
bacterial groups within the human cecal and fecal microbiota. Appl Environ Microbiol 2001;
67:4939-4942.
69. Sghir A, Gramet G, Suau A, Rochet V, Pochart P, Dore J. Quantification of bacterial groups
within human fecal flora by oligonucleotide probe hybridization. Appl Environ Microbiol
2000; 66:2263-2266.
70. Amann R, Fuchs BM, Behrens S. The identification of microorganisms by fluorescence in situ
hybridization. Curr Opin Biotechnol 2001; 12:231-236.
20 Amor and Vaughan
71. Beimfohr C, Krause A, Amann R, Ludwig W, Schleifer KH. In situ identification of
lactococci, enterococci and streptococci. Syst Appl Microbiol 1993; 16:450-456.
72. de Vries MC, Vaughan EE, Kleerebezem M, De Vos WM. Optimising single cell activity
assessment of Lactobacillus plantarum by fluorescent in situ hybridization as affected by
growth. J Microbiol Methods 2004; 59:109-115.
73. Jansen GJ, Wildeboer-Veloo ACM, Tonk RHJ, Franks AH, Welling GW. Development and
validation of an automated, microscopy-based method for enumeration of groups of intestinal
bacteria. J Microbiol Methods 1999; 37:215-221.
74. Glockner FO, Amann R, Alfreider A, et al. An in situ hybridization protocol for detection and
identification of planktonic bacteria. Syst Appl Microbiol 1996; 19:403-406.
75. Southwick PL, Ernst LA, Tauriello EW, et al. Cyanine dye labeling reagents —
carboxymethylindocyanine succinimidyl esters. Cytometry 1990; 11:418-430.
76. Fuchs BM, Glockner FO, Wulf J, Amann R. Unlabeled helper oligonucleotides increase the
in situ accessibility to 16S rRNA of fluorescently labeled oligonucleotide probes. Appl
Environ Microbiol 2000; 66:3603-3607.
77. Pernthaler A, Pernthaler J, Amann R. Fluorescence in situ hybridization and catalyzed
reporter deposition for the identification of marine bacteria. Appl Environ Microbiol 2002;
68:3094-3101.
78. Oliveira K, Brecher SM, Durbin A, et al. Direct identification of Staphylococcus aureus from
positive blood culture bottles. J Clin Microbiol 2003; 41:889-891.
79. Perry-O'Keefe H, Rigby S, Oliveira K, et al. Identification of indicator microorganisms using
a standardized PNA FISH method. J Microbiol Methods 2001; 47:281-292.
80. Ben-Amor K, Heilig HG, Smidt H, Vaughan EE, Abee T, de Vos WM. Genetic diversity of
viable, injured and dead fecal bacteria assessed by fluorescence activated cell sorting and,
16S rRNA gene analysis. Appl Environ Microbiol 2005; 71:4679-4689.
81. Rigottier-Gois L, Le Bourhis A-G, Gramet G, Rochet V, Dore J. Fluorescent hybridization
combined with flow cytometry and hybridization of total RNA to analyse the composition of
microbial communities in human faeces using 16S rRNA probes. FEMS Microbiol Ecol 2003;
43:237-245.
82. Rigottier-Gois L, Rochet V, Garrec N, Suau A, Dore J. Enumeration of Bacteroides species in
human faeces by fluorescent in situ hybridization combined with flow cytometry using 16S
rRNA probes. Syst Appl Microbiol 2003; 26:110-118.
83. Wallner G, Amann R, Beisker W. Optimizing fluorescent in situ hybridization with rRNA-
targeted oligonucleotide probes for flow cytometric identification of microorganisms.
Cytometry 1993; 14:136-143.
84. Zoetendal EG, Ben-Amor K, Harmsen HJM, Schut F, Akkermans ADL, de Vos WM.
Quantification of uncultured Ruminococcus obeum-\ike bacteria in human fecal samples by
fluorescent in situ hybridization and flow cytometry using 16S rRNA-targeted probes. Appl
Environ Microbiol 2002; 68:4225-4232.
85. van der Waaij LA, Mesander G, Limburg PC, Wan der Waaij D. Direct flow cytometry of
anaerobic bacteria in human feces. Cytometry 1994; 16:270-279.
86. Shapiro HM. Practical Flow Cytometry. New York: Wiley-Liss Inc., 1995.
87. Ben- Amor K, Abee T, De Vos WM. Flow cytometric analysis of microorganisms. In: Ben-
Amor K, eds. Microbial Eco-physiology of the Human Intestinal Tract: A flow cytometric
approach. Netherland: PhD thesis Wageningen University, 2004:21-47.
88. Derrien M, Ben- Amor K, Vaughan EE, de Vos WM. Validation of 16S rRNA probe specific
for the novel intestinal mucin-degrader Akkermansia muciniphila. In: Ahonen R, Saarela M,
Mattila-Sandholm T, eds. The FOOD, Gl-tract Functionality and Human Heatlh Cluster.
PROEUHEALTH. Vol. VTT Biotechnolgy. Sitges, Spain, 2004. http://www.vtt.fi/inf/pdf/.
89. Franks AH, Harmsen HJM, Raangs GC, Jansen GJ, Schut F, Welling GW. Variations of
bacterial populations in human feces measured by fluorescent in situ hybridization with
group- specific 16S rRNA-targeted oligonucleotide Probes. Appl Environ Microbiol 1998;
64:3336-3345.
Molecular Ecology of the Human Intestinal Microbiota 21
90. Lay C, Rigottier-Gois L, Holmstrum K, et al. Colonic microbiota signatures across five
northern European countries. Appl Environ Microbiol 2005; 717:4153-4155.
9 1 . Harmsen HJM, Raangs GC, He T, Degener JE, Welling GW. Extensive set of 1 6S rRNA-based
probes for detection of bacteria in human feces. Appl Environ Microbiol 2002; 68:2982-2990.
92. Suau A, Rochet V, Sghir A, et al. Fusobacterium prausnitzii and related species represent a
dominant group within the human fecal flora. Syst Appl Microbiol 2001; 24:139-145.
93. Langendijk P, Schut F, Jansen G, et al. Quantitative fluorescence in situ hybridization of
Bifidobacterium spp. with genus-specific 16S rRNA-targeted probes and its application in
fecal samples. Appl Environ Microbiol 1995; 61:3069-3075.
94. Harmsen HJM, Wildeboer-Veloo ACM, Grijpstra J, Knol J, Degener JE, Welling GW.
Development of 16S rRNA-based probes for the Coriobacterium group and the Atopobium
cluster and their application for enumeration of Coriobacteriaceae in human feces from
volunteers of different age groups. Appl Environ Microbiol 2000; 66:4523-4527.
95. Harmsen JHM, Elfferich P, Schut F, Welling GW. A 16S rRNA-targeted probe for detection
of lactobacilli and enterococci in fecal samples by fluorescent in situ hybridization. Micro
Ecol Health Dis 1999; 11:3-12.
96. Lay C, Sutren M, Rochet V, Saunier K, Dore J, Rigottier-Gois L. Design and validation of 16S
rRNA probes to enumerate members of the Clostridium leptum subgroup in human fecal
microbiota. Environ Microbiol 2005; 7:933-946.
97. Rochet V, Rigottier-Gois L, Rabot S, Dore J. Validation of fluorescent in situ hybridization
combined with flow cytometry for assessing interindividual variation in the composition of
human fecal microflora during long-term storage of samples. J Microbiol Methods 2004;
59:263-270.
98. Collins MD, Lawson PA, Willems A, et al. The phylogeny of the genus Clostridium: proposal
of five new genera and eleven new species combinations. Int J Syst Bacteriol 1994;
144:812-826.
99. Nadkarni MA, Martin FE, Jacques NA, Hunter N. Determination of bacterial load by real-
time PCR using a broad-range (universal) probe and primers set. Microbiology 2002;
148:257-266.
100. Malinen E, Kassinen A, Rinttila T, Palva A. Comparison of real-time PCR with SYBR
Green I or 5 ' -nuclease assays and dot-blot hybridization with rDNA-targeted
oligonucleotide probes in quantification of selected fecal bacteria. Microbiology 2003;
149:269-277.
101. Huijsdens XW, Linskens RK, Mak M, Meuwissen SG, Vandenbroucke-Grauls CM,
Savelkoul PH. Quantification of bacteria adherent to gastrointestinal mucosa by real-time
PCR. J Clin Microbiol 2002; 40:4423-4427.
102. Bartosch S, Fite A, Macfarlane GT, McMurdo ME. Characterization of bacterial communities
in feces from healthy elderly volunteers, and hospitalized elderly patients by using real-time
PCR and effects of antibiotic treatment on the fecal microbiota. Appl Enivr Microbiol 2004;
70:3575-3581.
103. Matsuki T, Watanabe K, Fujimoto J, Takada T, Tanaka R. Use of 16S rRNA gene-targeted
group-specific primers for real-time PCR analysis of predominant bacteria in human feces.
Appl Environ Microbiol 2004; 71:7220-7228.
104. Requena T, Burton J, Matsuki T, et al. Identification, detection, and enumeration of human
Bifidobacterium species by PCR targeting the transaldolase gene. Appl Environ Microbiol
2002; 68:2420-2427.
105. Malinen E, Rinttila T, Kajander K, et al. Analysis of the fecal microbiota of irritable bowel
syndrome patients and healthy controls with real-time PCR. Am J Gastroenterol 2005;
100:373-382.
106. Ott SJ, Musfeldt M, Ullmann U, Hampe J, Schreiber S. Quantification of intestinal bacterial
populations by real-time PCR with a universal primer set and minor groove binder probes: a
global approach to the enteric flora. J Clin Microbiol 2004; 42:2566-2572.
107. Bodrossy L, Sessitsch A. Oligonucleotide microarrays in microbial diagnostics. Curr Opin
Microbiol 2004; 7:245-254.
22 Amor and Vaughan
108. Wilson KH, Wilson WJ, Radosevich JL, et al. High-density microarray of small- subunit
ribosomal DNA probes. Appl Environ Microbiol 2002; 68:2535-2541.
109. Guschin DY, Mobarry BK, Proudnikov D, Stahl DA, Rittmann BE, Mirzabekov AD.
Oligonucleotide microchips as genosensors for determinative and environmental studies in
microbiology. Appl Environ Microbiol 1997; 63:2397-2402.
110. Wang RF, Kim SJ, Robertson LH, Cerniglia CE. Development of a membrane-array method
for the detection of human intestinal bacteria in fecal samples. Mol Cell Probes 2002;
16:341-350.
111. Geoffroy MC, Guyard C, Quatannens B, Pavan S, Lange M, Mercenier A. Use of green
fluorescent protein to tag lactic acid bacterium strains under development as live vaccine
vectors. Appl Environ Microbiol 2000; 66:383-391.
1 12. Hanniffy S, Wiedermann U, Repa A, et al. Potential and opportunities for use of recombinant
lactic acid bacteria in human health. Adv Appl Microbiol 2004; 56:1-64.
113. Steidler L. Live genetically modified bacteria as drug delivery tools: at the doorstep of a new
pharmacology? Expert Opin Biol Ther 2004; 4:439-441.
1 14. Rang CU, Licht TR, Midtvedt T, et al. Estimation of growth rates of Escherichia coli BJ4 in
streptomycin-treated and previously germfree mice by in situ rRNA hybridization. Clin Diagn
Lab Immunol 1999; 6:434-436.
115. Pernthaler A, Pernthaler J, Schattenhofer M, Amann R. Identification of DNA-
synthesizing bacterial cells in coastal North Sea plankton. Appl Environ Microbiol
2002; 68:5728-5736.
116. Morgenroth E, Obermayer A, Arnold E, Bruhl A, Wagner M, Wilderer PA. Effect of long-
term idle periods on the performance of sequencing batch reactors. Water Sci Technol 2000;
41:105-113.
117. Lee N, Nielsen PH, Andreasen KH, et al. Combination of fluorescent in situ hybridization and
microautoradiography-a new tool for structure-function analyses in microbial ecology. Appl
Environ Microbiol 1999; 65:1289-1297.
118. Nielsen JL, Christensen D, Kloppenborg M, Nielsen PH. Quantification of cell-specific
substrate uptake by probe-defined bacteria under in situ conditions by microautoradiography
and fluorescence in situ hybridization. Environ Microbiol 2003; 5:202-211.
119. Daims H, Nielsen JL, Nielsen PH, Schleifer KH, Wagner M. In situ characterization of
Nitrospira-like nitrite-oxidizing bacteria active in wastewater treatment plants. Appl Environ
Microbiol 2001; 67:5273-5284.
120. Adamczyk J, Hesselsoe M, Iversen N, et al. The isotope array, a new tool that employs
substrate-mediated labeling of rRNA for determination of microbial community structure and
function. Appl Environ Microbiol 2003; 69:6875-6887.
121. Radajewski S, Ineson P, Parekh NR, Murrell JC. Stable-isotope probing as a tool in microbial
ecology. Nature 2000; 403:646-649.
122. Radajewski S, McDonald IR, Murrell JC. Stable-isotope probing of nucleic acids: a window
to the function of uncultured microorganisms. Curr Opin Biotechnol 2003; 14:296-302.
123. Boschker HTS, Middelburg JJ. Stable isotope and biomarkers in microbial ecology. FEMS
Microbiol Ecol 2002; 40:85-95.
124. Manefield M, Whiteley AS, Griffiths RI, Bailey MJ. RNA stable isotope probing, a novel
means of linking microbial community function to phylogeny. Appl Environ Microbiol 2002;
68:5367-5373.
125. Corthier G, Delorme C, Ehrlich SD, Renault P. Use of luciferase genes as biosensors to study
bacterial physiology in the digestive tract. Appl Environ Microbiol 1998; 64:2721-2722.
126. Drouault S, Corthier G, Ehrlich SD, Renault P. Survival, physiology, and lysis of Lactococcus
lactis in the digestive tract. Appl Environ Microbiol 1999; 65:4881-4886.
127. Oozeer R, Mater DD, Goupil-Feuillerat N, Corthier G. Initiation of protein synthesis by a
labeled derivative of the Lactobacillus casei DN-114 001 strain during transit from the
stomach to the cecum in mice harboring human microbiota. Appl Environ Microbiol 2004;
70:6992-6997.
Molecular Ecology of the Human Intestinal Microbiota 23
128. Oozeer R, Furet JP, Goupil-Feuillerat N, Anba J, Mengaud J, Corthier G. Differential
activities of four Lactobacillus casei promoters during bacterial transit through the
gastrointestinal tracts of human-microbiota-associated mice. Appl Environ Microbiol 2005;
71:1356-1363.
129. Cormack BP, Valdivia RH, Falkow S. FACS-optimized mutants of the green fluorescent
(GFP). Gene 1996; 173:33-38.
130. Andersen JB, Sternberg C, Poulsen LK, Bjorn SP, Givskov M, Molin S. New unstable variants
of green fluorescent protein for studies of transient gene expression in bacteria. Appl Environ
Microbiol 1998; 64:2240-2246.
131. Bernard L, Courties C, Duperray C, Schafer H, Muyzer G, Lebaron P. A new approach to
determine the genetic diversity of viable and active bacteria in aquatic ecosystems. Cytometry
2001;43:314-321.
132. Whiteley AS, Griffiths RI, Bailey MJ. Analysis of the microbial functional diversity within
water- stressed soil communities by flow cytometric analysis and CTC + cell sorting.
J Microbiol Methods 2003; 54:257-267.
133. Ben-Amor K, Breeuwer P, Verbaarschot P, et al. Multiparametric flow cytometry and cell
sorting for the assessment of viable, injured, and dead Bifidobacterium cells during bile salt
stress. Appl Environ Microbiol 2002; 68:5209-5216.
134. Apajalahti JHA, Kettunen A, Nurminen PH, Jatila H, Holben WE. Selective plating
underestimates abundance and shows differential recovery of bifidobacterial species from
human feces. Appl Environ Microbiol 2003; 69:5731-5735.
135. Vaughan EE, Heilig H, Ben Amor K, De Vos WM. Diversity, vitality and activities of
intestinal lactic acid bacteria and bifidobacteria assessed by molecular approaches. FEMS
Microbiol Rev 2005; 29:477-490.
136. Palmer C, Bik EM, Eckburg MB, Eisen MB, Relman DA, Brown PO. Microarray-based
characterisation of the human colonic flora: a direct comparison to 16S rDNA sequencing —
21C abstract. p37. In Beneficial Microbes ASM conferences, April 2005, Nevada U.S.A.
137. Kohara Y, Noda H, Okano K, Kambara H. DNA probes on beads arrayed in a capillary,
'Bead-array,' exhibited high hybridization performance. Nucl Acids Res 2002; 30:e87.
138. Nolan JP, Sklar LA. Suspension array technology: evolution of the flat- array paradigm.
Trends Biotechnol 2002; 20:9-12.
139. Spiro A, Lowe M. Quantitation of DNA sequences in environmental PCR products by a
multiplexed, bead-based method. Appl Envir Microbiol 2002; 68:1010-1013.
140. Hooper LV, Midtvedt T, Gordon JI. How host-microbial interactions shape the nutrient
environment of the mammalian intestine. Ann Rev Nutr 2002; 22:283-307.
141. Backhed F, Ding H, Wang T, et al. The gut microbiota as an environmental factor that
regulates fat storage. Proc Natl Acad Sci USA 2004; 101:15718-15723.
142. www.microbial-ecology.net/probebase/.
2
Sampling Microbiota in the Human
Gastrointestinal Tract
Angele P. M. Kerckhoffs, Melvin Samsom, and Gerard P. van Berge Henegouwen
Department of Gastroenterology, Utrecht University Medical Center, Utrecht,
The Netherlands
Louis M. A. Akkermans and Vincent B. Nieuwenhuijs
Department of Surgery Utrecht University Medical Center, Utrecht, The Netherlands
Maarten R. Visser
Department of Microbiology, Utrecht University Medical Center, Utrecht,
The Netherlands
INTRODUCTION
General Introduction
Antonie van Leeuwenhoek (1632-1723) was the first to describe numerous micro-
organisms from the gastrointestinal tract, which he described as "animalcules," having
designed the first glass lenses for the microscope that were powerful enough to observe
bacteria. His curiosity brought him to investigate samples taken from his own mouth
and other people who never brushed their teeth, and he compared these findings with
people who brushed their teeth daily and used large amounts of alcohol. He even
investigated his own fecal samples in a period of diarrhea, compared these findings
with fecal samples of animals, and reported these observations to the Royal Society in
London (1).
We now know that the mucosal surface of the human gastrointestinal tract is about
300 m 2 and is colonized by 10 13 — 10 14 bacteria consisting of hundreds of different species.
The prevalence of bacteria in different parts of the gastrointestinal tract depends on pH,
peristalsis, oxidation-reduction potential within the tissue, bacterial adhesion, bacterial
cooperation, mucin secretion containing immunoglobulins (Ig), nutrient availability, diet,
and bacterial antagonism. The composition of the Gram-negative, Gram-positive, aerobic,
and anaerobic microbiota has been extensively studied by culturing methods, and shown to
change at the various sites of the gastrointestinal tract (Fig. 1).
The stomach and proximal small bowel normally contain relatively small numbers
of bacteria because of peristalsis, and the antimicrobial effects of gastric acidity. An intact
ileocecal valve is likely to be an important barrier to backflow of colonic bacteria into the
25
26
Kerckhoffs et al.
w
_c
13
o
a>
03
CO
E
1—
o
O
CO
CO
E
=3
C
CD
O
=5
T3
10i
E
=3
C
_o
o
o
Q Gram-negative bacteria
■ Gram-positive bacteria
E3 Anaerobes
g Aerobes/facultative
anaerobes
Figure 1 Numbers ( lu log) of gram-negative bacteria, gram-positive bacteria, anaerobes and
aerobes and facultative/anaerobes per gram of intestinal material in the human intestinal tract.
Source: From Refs. 2-8.
ileum. The intestinal microbiota play a prominent role in gastrointestinal physiology and
pathology. A bacterial population is essential for the development of the gastrointestinal
mucosal immune system, for the maintenance of a normal physiological environment, and
for providing essential nutrients (9). Culturing techniques suggested that dietary changes
had a negligible effect on the intestinal microbiota composition (2,10). More recently
molecular techniques indicated that diet can alter the microbiota composition, but the
predominant groups are generally not substantially altered (11,12). In contrast, antibiotics
can dramatically alter the composition of the intestinal microbiota.
Physiology of Microbiota Host Interaction in Humans
Normal gastrointestinal tract microbiota is essential for the physiology of its host. The
microbiota in the gastrointestinal tract have important effects on nutrient processing,
immune function, and a broad range of other host activities some of which are briefly
described below (13). Pasteur (1822-1895) suggested that the intestinal microbiota might
play an essential role in the digestion of food. We now know that bacteria harbor unique
metabolic capabilities which enable otherwise poorly utilizable nutrients to be
metabolized (14). The intestinal microbiota possess enzymes that can convert endogenous
substrates, and dietary components, such as fibers, to provide short-chain fatty acids, and
other essential nutrients, which are absorbed by the host (10). This interaction of host
and bacteria, when one or both members derive specific benefits from metabolic
capabilities, is defined as mutualism. Bacteria also produce a number of vitamins that the
host can utilize, especially those of the B-complex (15).
The microbiota affords resistance to colonization by potential pathogens that cannot
compete with entrenched residents of the microbial community for nutrients (13).
Autochthonous or native microorganisms colonize specific intestinal habitats, whereas
allochthonous or transient bacteria can only colonize particular habitats under abnormal
conditions. The normal microbiota prevent colonization of allochthonous species or
potential pathogens by releasing metabolic waste products as well as bacteriocins, and
colicins which have antibacterial activity. A pathogenic relationship results in damage to
the host. Most pathogens are allochthonous microorganisms. However, some pathogens
Sampling Microbiota in the Human Gastrointestinal Tract 27
can be autochthonous to the ecosystem, and live in harmony with the host unless the
system is disturbed. Antibiotic therapy can drastically reduce the normal microbiota, and
the host may then be overrun by introduced pathogens or by overgrowth of commensal
microbial members normally present in small numbers. One notable example is following
treatment with clindamycin, overgrowth by Clostridium difficile that survives the
antibiotic treatment can give rise to pseudomembranous colitis (10,16).
Microbial factors are known to influence host postnatal development. Commensals
acquired during the early postnatal life are essential for the development of tolerance, not
only to themselves but also to other luminal antigens. Development of B- and T-cell
responses depend on the microbiota. The natural antibodies that arise in response to the
antigens of the normal gut microbiota are of great importance in immunity to a number of
pathogenic species. Somatic hypermutation of Ig genes in intestinal lymphoid follicles
plays a key role in regulating the composition of the microbial community (14).
The microbiota participate in bile acid metabolism. In the colon, bacterial enzymes
convert cholic acid and chenodeoxycholic acid into the secondary bile acids deoxycholic
acid and lithocholic acid, respectively, which in general are poorly reabsorbed; most of
these are then eliminated in the stool. In patients with small bowel bacterial overgrowth
(SBBO), bile acids are deconjugated and metabolized more proximally in the small bowel,
and removed from further participation in the normal enterohepatic circulation, resulting
in bile acid malabsorption and steatorrhea. Steatorrhea is defined as excessive loss of fat in
the stool, i.e., greater than 7 g or 9% of intake for 24 hours (3).
The effects of having a normal intestinal microbiota has been determined by
comparing the characteristics of germ-free and conventionally reared animals. In the small
bowel of germ-free animals there are dramatic reductions in leukocytic infiltration of
the lamina propria, and both the size and number of Peyer's patches. Moreover, the
intraluminal pH is more alkaline, and the reduction potential more positive. Colonization
of the intestinal tract of germ-free animals with even a single strain of bacteria is followed
by the rapid development of physiologic inflammation of the mucosa resembling that of
conventional animals. The migrating motor complex (MMC) is a cyclic pattern of motility
that occurs during fasting, and is an important mechanism in controlling bacterial
overgrowth in the upper small bowel. Gut transit is slow in the absence of the
intestinal microbiota. The effect of selected microbial species in germ-free rats on
small intestinal myoelectric activity is promotion or suppression of the initiation and
migration of the MMC depending on the species involved. Anaerobes, which have a
fermentative metabolism, emerge as important promoters of regular spike burst activity in
the small intestine. Introduction of the fermentative species Clostridium tabificum,
Lactobacillus acidophilus, and Bifidobacterium bifidum into the gastrointestinal tract of
germ-free rats significantly reduces the MMC period, and accelerates small intestinal
transit. In contrast introduction of bacteria with respiratory potential such as Micrococcus
luteus and Escherichia coli in the germ-free rats prolongs the MMC period. Intestinal
microbiota accelerate transit through the small intestine in the fasting state compared to
the unchanged intestinal myoelectric response to food. Overall, the promoting influence
of the conventional intestinal microbiota on MMC reflects the net effect of bacterial
species with partly opposite effects (17-19).
In conclusion, the bacterial microbiota has a range of specific functions including
intestinal transit, absorption of nutrients, and in the modulation of the immune system of the
gastrointestinal tract. The introduction of pathogen bacteria can disturb the normal
physiological functions of the gastrointestinal tract to a great extent. A number of functional
tests for the detection of intestinal pathogenic bacteria have been developed, and are
described below.
28 Kerckhoffs et al.
Importance of Sampling the Gastrointestinal Tract
The current knowledge of the human intestinal microbiota is mostly based on culture
techniques but also more recently on molecular biology techniques that are applied to feces
and gastrointestinal fluids or biopsies. Sampling of the gastrointestinal tract is clinically
necessary for the diagnosis of Helicobacter pylori, and the etiology of diarrhea. The
gastrointestinal tract is also sampled for research questions on SBBO or for the investigation
of host-bacterial relationships in the gut. There are various methods of obtaining material to
study the microbiota. Research or diagnosis of bacteria anywhere in the gastrointestinal
tract can be performed using invasive or noninvasive methods. The various methods of
investigating microbiota in the gastrointestinal tract will be specified for different
compartments of the gastrointestinal tract, and the advantages and disadvantages of the
sampling methodologies will be described below.
ESOPHAGUS: MICROBIOTA AND SAMPLING TECHNIQUES
Normal Microbiota
The mouth and the oropharynx predominantly harbor Gram-positive organisms (20). The
most numerous species comprise the streptococci, Neisseria, and Veillonella, but
Fusobacteria, Bacteroides, lactobacilli, staphylococci, yeasts, and Enter ob act eria are
also present in smaller amounts (4). The esophagus is covered with a stratified squamous
epithelium layer, which is a mechanical barrier coated with saliva and mucus, that has high
peristalsis and Ig containing mucus secretion, all of which contribute to prevention of
infection. Because of the lack of absolute anatomic or known physiological barriers,
bacteria can be introduced into the esophagus by the swallowing of food, by resident oral
microbiota or by reflux from a colonized stomach (21). The esophagus, with its large
mucosal surface located just downstream of the bacterial species-rich oropharynx,
provides a potential environment for bacterial colonization, but so far limited research has
been performed. A recent molecular analysis of the distal esophagus indicated members of
6 phyla, of which Streptococcus (39%), Prevotella (17%), and Veillonella (14%) were the
most prevalent, and also demonstrated that most esophageal bacteria are similar or
identical to residents of the upstream oral microbiota (21). Quantitative cultivation-based
studies indicated that aerobic organisms were present in all, and obligate anaerobes in 80%
of the subjects investigated. No differences in frequencies of isolation or composition of
the microbiota were found between different subjects (5,22).
Disease-Causing Microbiota
A pathogen is a microorganism which by direct contact with or infection of another
organism causes disease in that organism. Thus a microbe which produces a toxin that
causes disease in the absence of the microbe itself would not be regarded a pathogen.
Members of the commensal microbiota may become pathogenic and cause disease if the
host defense mechanisms are compromised, or if they are introduced into normally sterile
body sites. The esophagus of individuals with deficient immune systems (HIV or post-
transplantation patients) may become infected with Candida albicans, cytomegalovirus,
herpes simplex virus, Histoplasma capsulatum, Mycobacterium avium, and Cryptospor-
idium. These microorganisms are usually not seen in immunocompetent persons. With the
exception of Mycobacterium species, bacterial etiologies for inflammation involving
the distal esophagus have not been explored (23). Mycobacterial involvement of the
Sampling Microbiota in the Human Gastrointestinal Tract 29
esophagus is rare (incidence 0.14%) in both immunocompromised and immunocompetent
hosts with advanced pulmonary tuberculosis (23).
Luminal Washes
Luminal washes to sample esophageal bacteria give poor yields. The washes may contain
a few transient bacteria of oropharyngeal origin, or even no microbes at all, or an average
of 16 colony forming units per ml (CFU/ml) with no common species found (24,25).
Either intestinal contents are passed through the alimentary canal with high peristalsis, and
prevent bacteria from residing in the esophagus, or the bacteria present in the washes are
not culturable. Another possibility is that the bacteria are very closely associated with the
esophageal mucosa, and cannot be removed by simple washes. This technique is not
commonly used for research questions, and is clinically irrelevant.
Biopsy
Esophageal mucosal biopsy specimens from the distal esophagus can be obtained during
upper endoscopy. The endoscope passes orally into the esophagus, and the biopsy forceps
can be shielded from the oral microbiota. The forceps consists of a pair of sharpened cups.
Forceps with a central spike make it easier to take specimens from lesions which have to
be approached tangentially (such as in the esophagus). The maximum diameter of the cups
is limited by the size of the operating channel. The length of the cups is limited by the
radius of curvature through which they must pass in the instrument tip (26). Patients are
instructed not to eat or drink for at least 4-6 hours before endoscopy (small sips of water
are permissible for comfort) (27). The channel of the endoscope can also harbor bacteria if
secretions have inadvertently been suctioned while advancing the endoscope.
Oropharyngeal and gastric bacteria can contaminate the biopsy. Chlorhexidine or
acidified sodium chlorite mouth rinse has been used to decontaminate the oropharynx. To
compare biopsy samples of two individuals or to compare the reproducibility in one
subject the biopsies have to be taken at the same level (28).
STOMACH: MICROBIOTA AND SAMPLING TECHNIQUES
Normal Microbiota
The human stomach is lined with columnar secreting epithelium. Normally most of the
bacteria in the stomach are killed because of the low pH levels, and the typical numbers
detected are less than 10 CFU/ml (2,6,26). Lactic acid bacteria are commonly isolated
from the human gastric acid contents, especially when good anaerobic techniques are
used. Candida and some other yeast species are also detected. Bacteria isolated from
gastric contents are considered transient members. These bacteria have been passed down
from habitats above the stomach or have been present in ingested materials (29). The
normal resident microbiota of the stomach consists mainly of Gram-positive aerobic
bacteria, such as streptococci, staphylococci, and lactobacilli (2,6,26,30). The microbiota
isolated from gastric contents are presented in Table 1. In healthy fasting patients large
numbers of Enterococcus, Pseudomonas, Streptococcus, Staphylococcus, and Rothia
(Stomatococcus) may be isolated in culture when acidity is physiologically reduced, as
occurs at night, and during phase I (motor quiescence) of the MMC (32-34).
30 Kerckhoffs et al.
Table 1 Microorganisms Isolated from the Stomach by Culturing
Microbial type
Lactobacilli
Streptococci
Bifidobacteria
Clostridia
Veillonella
Coliforms
Peptostreptococcus, Bacteroides
Staphylococcus, Actinobacillus
Candida albicans
Torulopsis
Unidentified yeasts
Neisseria
Micrococcus
Note: The most prevalent bacterial types are italicized.
Source: From Refs. 2, 15, 22, 31.
Disease-Causing Microbiota
Bacteria closely associated, and attached to the epithelium like Helicobacter pylori, may
be sampled from gastric contents with difficulty (29). H. pylori is a Gram-negative
bacterium that resides below the mucous layer next to the gastric epithelium. H. pylori is
rarely found before age 10 but increases to 10% in those between 18 and 30 years of age,
and to 50% in those older than age 60 (35). In developing nations the majority of children
are infected before age 10, and adult prevalence peaks at more than 80% before age 50.
Thus H. pylori infection ranges depend on age and socioeconomic differences (36).
H. pylori produces urease, an enzyme that breaks down urea into ammonium and
bicarbonate. Ammonium provides an alkaline environment, which helps the bacterium
protect itself from gastric acid injury. Most infected subjects do not have symptoms of
H. pylori infection. However, H. pylori may induce acute gastritis with symptoms such as
epigastric pain, bloating, nausea and vomiting, and/or chronic gastritis. Furthermore, it
may also be associated with ulcer disease and gastric carcinomas.
Other gastric bacteria besides Helicobacter species only become apparent in patients
with reduced acidity (achlorhydria). Achlorhydria may occur in elderly persons (37).
Colonization of the gastric lumen may occur in patients on anti- secretory medication
meant to reduce gastric acid secretion. Many subjects regularly use these anti- secretory
drugs. Acid suppression may allow bacteria to survive in the stomach which results in
gastric bacterial overgrowth with the degree of overgrowth depending upon the elevation
of the pH (20). Infectious gastritis is more rarely caused by Mycobacterium tuberculosis,
Mycobacterium avium, Actinomyces israellii, and Treponema pallidum (3).
Biopsy
To investigate the gastric microbiota, tissue is generally obtained by an endoscopic biopsy.
Slightly less invasive methods are available to obtain a specimen such as the use of a small
bowel biopsy tube or capsule, or biopsy forceps that can be passed through a modified
nasogastric tube positioned either in the gastric body or antrum. A biopsy is clinically
unnecessary to diagnose H. pylori via microbiological methods unless one wishes to
Sampling Microbiota in the Human Gastrointestinal Tract 31
isolate the organism for antibiotic susceptibility testing. Recommendations to maximize
the diagnostic yield of endoscopic biopsies include the use of large-cup biopsy forceps,
obtaining at least two samples from the lesser curvature and the greater curvature (the
prepyloric antrum and the body), and proper mounting and preparation of the samples.
Special stains (H&E, Giemsa, and Warthin- Starry staining) are often used to help detect
the presence of H. pylori (38).
The rapid urease test (by agar gel slide tests) involves placing a biopsy specimen from
the antrum of the stomach on a test medium that contains urea (39). The biopsy specimens
for the rapid urease test have to be removed from the sterilized biopsy forceps with a sterile
toothpick, and have to be placed immediately into a tube. The urea is hydrolyzed by urease
enzymes of H. pylori, and the ammonium formed increases the pH. A phenol indicator that
changes the color from yellow at pH 6.8 to magenta at pH 8.4 can detect the pH alteration.
The color change read off 1 hour after and 24 hours after the introduction of the gastric
biopsy is an indication for the presence of H. pylori. Recommendations to maximize the
rapidity and sensitivity of rapid urease tests are to warm the slide, and to use two regular or
one jumbo biopsy specimen(s) (40). Increasing the number of biopsies to more than two
biopsies from the antrum may increase the sensitivity, given that this probably increases
the H. pylori load, and therefore the amount of urease. However, this will prolong the
endoscopy time and add to the discomfort of the patient. The agar gel test may take up to
24 hours to turn positive, particularly in the presence of a low bacterial density. Recent use
of antibiotics, bismuth, or proton pump inhibitors may render rapid urease tests falsely
negative. Compared with histology as the gold standard in the diagnosis of H. pylori
infection, the sensitivity of the rapid urease test is 70-99%, and the specificity is 92-100% in
untreated patients (40). Mucosal biopsies can be fixed in neutral buffered formaldehyde, and
if the rapid urease test is negative the biopsy can sent in the next day for histologic
assessment. The presence or absence of//, pylori can be established by examining three sets
of tissue levels within 12 consecutive sections. On microscopic examination of the tissue
obtained by biopsy, the bacteria may be seen lining the surface epithelium. The sensitivity
for histologic examination is 70-90%. Giemsa staining is required for H. pylori diagnosis.
Culture for//, pylori is insensitive. Biopsies should be plated within 2 hours (or transported
in a special medium) on nonselective media enriched with blood or serum, and incubated in
a moist and microaerobic atmosphere. The identity of any colonies grown can be confirmed
using Gram's stain and biochemical tests.
Aspiration
In order to sample gastric fluid a Shiner tube may be used. This is a polyvinyl tube with a
stainless steel sampling capsule at the end with which the specimens are obtained by
suction. This tube can be sterilized in the autoclave or by boiling (6). Sampling the luminal
content of the stomach may lead to underestimation of the size or even misinterpretation
of the composition of gastric microbial communities (29). Estimates per unit weight of
material of the population levels of microbes attached to an epithelium surface made from
samples of the mucosa itself have been found to be higher than estimates made from the
luminal content in the region (29). This technique is not clinically relevant, and is hardly
ever used in research models.
Urea Breath Test
The urea breath test is a noninvasive test that detects radio-labeled carbon dioxide excreted
in the breath of persons with H. pylori infection; orally administered urea is hydrolyzed to
32 Kerckhoffs et al.
carbon dioxide and ammonium in the presence of the enzyme urease, which is present in
H. pylori. In non-infected subjects, urea leaves the stomach unchanged, unless there is
urease activity from bacteria in the oral cavity or in situations of gastric bacterial
overgrowth. The urea breath test is a highly sensitive (93.3%) and specific (98.1%)
method (41). The two breath tests available are the 14 C urea (radioactive), and 13 C urea
(stable isotope) breath tests. The C urea breath test avoids radioactivity, and is the test of
choice for children and pregnant women. The major limitation is the need for a gas isotope
mass spectrometer to analyze the breath samples and calculate the ratio of C to C. A
4-hour fast is generally recommended before the urea breath test, and a test meal is given
before the solution of labeled urea. This test meal delays gastric emptying, and increases
contact time with the bacterial urease. It is relatively inexpensive compared to the "gold
standard" of endoscopy with biopsy, and histological examination described above. The
urea breath test avoids sampling errors that can occur with random biopsy of the antrum.
False positive results can occur if gastric bacterial overgrowth with urease-producing
bacteria other than H. pylori are present. False positive results can also occur if the
measurements are taken too soon after the urea ingestion because the action of the oral
microbiota on the urea may be measured. False negative results can be obtained if the
patients were recently treated with antibiotics, bismuth preparations or acid suppression
therapy, because the test is dependent on the numbers of//, pylori (42). Performance of the
urea breath test has been associated with several disadvantages especially in infants,
toddlers or handicapped children because one needs active collaboration. False positive
results in infants affect the accuracy of the test, but correction for the carbon dioxide
production of the tested individual will improve the specificity (43,44).
Other tests that do not require a mucosal biopsy include serologic tests and stool
antigen tests. Chronic H. pylori infection elicits a circulating IgG antibody response that
can be quantitatively measured by enzyme-linked immunosorbent assay (ELISA tests).
The ELISA is based on a specific anti-//. pylori immune response, and this serologic test is
as sensitive (95.6%) and specific (92.6%) as biopsy-based methods (41). The presence of
IgG does not indicate an active infection. IgG antibody titers may decrease over time
(6-12 months) in patients who have been successfully treated. ELISA or immuno-
chromatographic methods can be performed on the fecal samples to detect H. pylori
antigen. The limit of sensitivity of the test is 10 5 H. pylori cells per g of feces (45).
Sensitivities and specificities of 88-97% and 76-100% have been reported (41,44-47).
The stool antigen test is not used for follow-up evaluation of the H. pylori eradication as it
gives false positive results. In conclusion, the noninvasive tests are sufficiently accurate
for the diagnosis of H. pylori infection.
SMALL INTESTINE: MICROBIOTA AND SAMPLING TECHNIQUES
Normal Microbiota
The small intestine comprises the proximal, mid, and distal areas, which are designated
the duodenum, jejunum, and ileum. The velocity of the intraluminal content of the small
intestine decreases from the duodenum to the ileum. The microbes isolated from the
small intestine include those descending from habitats above the small intestine such as the
mouth, and ingested food. The microbes pass through the intestine with the chyme, and in the
fasting state by the MMC. The MMC interdigestive motility prevents colonic microbiota from
entering the proximal small intestine which would cause SBBO. The microbial species
isolated from the small intestine are listed in Table 2. The density of microbiota increases
towards the distal small intestine. The upper two thirds of the small intestine (duodenum and
Sampling Microbiota in the Human Gastrointestinal Tract 33
jejunum) contain only low numbers of roughly the same microorganisms, which range
from 10 to 10 bacteria/ml (2). Culturing studies indicated that acid- and aero-tolerant
Gram-positive species such as lactobacilli and streptococci dominate in the proximal part,
while distally anaerobic, and more Gram-negative bacteria increasingly dominate. Whipple's
disease is a rare multisy stemic bacterial infection caused by Tropheryma whipplei. T. whipplei
could not be cultured from the small intestine for decades, and was diagnosed by
histopathology. Nowadays T. whipplei can be detected using polymerase chain reaction
(PCR) or ribosomal RNA techniques on duodenal biopsies or fecal samples (48). The rich
microbiota of the initial section of the large intestine (cecum) find their way through the
ileocecal valve back into the ileum. The microbiota of the ileum begins to resemble that of the
colon with around 10 to 10 bacteria/ml of the intestinal contents. With decreased
intraluminal transit, decreased acidity, and lower oxidation-reduction potentials, the ileum
maintains a more diverse and numerous microbial community (29). Factors that compromise
the oxidation-reduction potential within the tissues are obstruction and stasis, tissue
anoxia, trauma to tissues, vascular insufficiency, and foreign bodies (49). Decreased
oxidation-reduction potential specifically predisposes to infection with anaerobes (50).
Disease-Causing Microbiota
Pathogenic bacteria of the small intestine, which cause severe diarrhea, are enterotoxic
Escherichia coli (ETEC) and Vibrio cholerae. V. cholerae is diagnosed when it is present in
fecal material. ETEC produces enterotoxins that cause intestinal secretion and diarrhea, and is
a common cause of traveler's diarrhea. In SBBO, the proximal small intestine is populated by
a substantially higher number of microorganisms than usual. These are frequently anaerobic
bacteria that are normally not present in large numbers in the duodenum and the proximal
jejunum. A total count of microorganisms exceeding 10 5 colony forming units/ml in a
duodenal or jejunal aspirate is generally accepted as SBBO (51). Some gastroenterologists
Table 2 Microorganisms Isolated from the Small Intestine by Culturing
Most prevalent microbes in duodenum Most prevalent microbes in
Microbial types and proximal jejunum distal jejunum and ileum
Lactobacilli Lactobacilli
Streptococci Streptococci
Bifidobacteria Bifidobacteria
Clostridia Clostridia
Coliforms
Bacteroides Bacteroides
Veillonellae Veillonellae
Gram positive
nonsporing
anaerobes
Staphylococci Staphylococci
Actinobacilli Actinobacilli
Yeasts Yeasts
Candida albicans
Haemophilus
Fusobacterium
Note: The most prevalent bacterial types are italicized.
Source: From Refs. 2, 15, 22.
34
Kerckhoffs et al.
also accept a concentration of colonic microorganisms above 10 CFU/ml as positive for
SBBO. A profound suppression of gastric acid may facilitate the colonization of the upper
small intestine (20). To diagnose SBBO, the quantitative culture of a small intestine is used,
and considered to be the gold standard. Fluid aspirated from the descending part of the
duodenum may be cultured in order to detect bacterial overgrowth in diffuse small
bowel disorders.
Biopsy
To obtain biopsy samples from the small intestine upper endoscopy has to be performed.
Upper endoscopy is performed after an overnight fast of at least 10 hours. An endoscope
has a length of approximately 1 meter, and has a biopsy channel. During endoscopy the
esophagus, stomach, and duodenal wall can be systematically inspected. To allow a good
view air insufflation is required; the patient may complain of bloating during the
endoscopy. When the endoscope reaches the site of interest, the biopsy from the small
intestinal mucosa is rapidly taken by standard biopsy forceps. Figure 2 shows the size
(in centimeters) of the tip of an endoscope, and a biopsy forceps. The distal part of the
jejunum and the ileum cannot be reached using a standard endoscope, and therefore is not
sampled. Endoscopic biopsies are an adequate substitute for jejunal suction biopsies. The
advantage over capsule biopsy is that the site of interest can be inspected before the biopsy
is taken (52-54). Adequacy of mucosal biopsies is a function of size and numbers of
biopsies obtained (54). Alligator-type forceps obtain larger specimen pieces than oval-
shaped forceps (55). Forceps with a needle, or the multibite forceps, allow more biopsies
to be taken per passage, and improve the quality of tissue obtained (55). Biopsy forceps
without a needle can be used to obtain two samples per passage through the endoscope that
are quantitatively as good as when only one sample is collected. This approach can save
time, and causes no significant damage to the biopsy specimens. Because air insufflation
may distort the intraluminal anaerobic environment, nitrogen could be used as a substitute
if the intention is to culture anaerobic bacteria. There is also the risk of contamination with
microbiota from more proximal habitats that were passed along via the endoscope.
Figure 2 Tip of a standard endoscope and biopsy forceps with needle (tape measure in
centimeters).
Sampling Microbiota in the Human Gastrointestinal Tract 35
The biopsies have to be taken at a certain distance from the endoscope to prevent sampling
contaminated parts of the intestine.
Intestinal biopsies taken from living persons may not yield satisfactory results
because the biopsies are only a minimal part of the total intestinal wall (56). The number
of persons sampled must be large to generate reliable results. The best source of
information on microbiota in the small intestine so far has been achieved with sampling
from autopsy studies of accident victims. As slow cooling of the gastrointestinal tract can
cause alterations in bacterial localization the samples have to be taken immediately after
death (57), and the number of individuals sampled must still be quite large.
Full Thickness Biopsy
Full thickness biopsy is a peroperative or laparoscopic biopsy (muscularis-containing
biopsy) used to diagnose motility disturbances. One incision is situated below the
umbilicus, and one in the left fossa. The bowel loop is identified laparoscopically, and will
then be exteriorized through the incision below the umbilicus. The full thickness biopsy of
at least 10X10 mm will then be taken with a surgical knife. The bowel loop is closed with
absorbable sutures, and repositioned into the abdomen (56). Drawbacks of biopsies taken
at surgery are the manipulation of the patients' diet (fasting), and the bowel preparation or
preoperative treatment with antibiotics (29,58). Biopsies taken at surgery have the
advantage of larger sample size than endoscopic biopsies, and various analyses may be
applied such as molecular typing of bacteria in intestinal tissue of Crohn's patients (59).
Mucosal Brushings
Mucosal brushings may be used to sample bacteria from the intestinal mucosa. The
cytology brush, protected by a sheath, is passed through the instrument channel of
the endoscope. After the endoscope is placed at the location of interest, the brush is
advanced from its sleeve within sight of the mucosal surface, and rubbed and rolled across
the surface. Thereafter, the brush is pulled back into the sleeve. Normally, cytology
brushes are only covered with a plastic sleeve to protect the specimen during withdrawal.
This sleeve, however, does not protect against contamination; the use of suction of saliva
and gastric fluid during endoscopy contaminates the suction channel of the endoscope, and
the subsequent passage of the brush without a sheath through the suction channel causes
loss of sterility of the brush (27). These brushes cannot be used for sampling bacteria in the
lumen of the gastrointestinal tract. Avoidance of any suction during endoscopy is
extremely difficult. To obtain small bowel samples without contamination one could
utilize a catheter with a specimen brush plugged with sterile Vaseline. Brushes cannot be
protected from contact with air, so it is not useful for the isolation of anaerobes for culture.
To determine the concentration of bacteria obtained by the brush present per milliliter, one
has to standardize the loading capacity of the brush used. Brushing is a highly reproducible
technique (92%) (60).
Peroperative Needle Aspiration
Peroperative needle aspiration is useful for relatively inaccessible locations within the
intestinal tract. The technique is only applicable for patients with an underlying disease who
will undergo laparotomy or laparoscopy. The microbiota may be influenced by pre-operative
fasting, antibiotic prophylaxis, and anesthesia. Until 1959 the peroperative needling technique
was regularly performed at operation (61,62) but is currently no longer performed routinely.
36 Kerckhoffs et al.
The advantages of this technique are asepsis and the lack of contamination from other regions
of the gastrointestinal tract.
Self-Opening Capsule
The Crosby capsule, first applied in 1957, was used to obtain biopsies from the small
intestine before the introduction of the endoscope. This self-opening capsule is a metallic
capsule of 19 to 1 1 mm with a round opening of 4 mm (53). A long tiny tube is attached to
the capsule, and this is muscle loaded through an endoscope which is passed into the
second part of the duodenum. Intestinal mucosa is sucked into the tube by suction and
excised. Every part of the stomach and the small intestine can be reached (63). Sizes of the
biopsies are 5-8 mm, with stomach biopsies usually being smaller. Failure of obtaining
biopsies is 6%. The mucous membrane is very mobile with respect to the muscular layer so
only mucosa is sucked into the capsule, and the risk of perforation is very small.
Muscularis propria is never cut. The risk of bleeding (0.14%) and intestinal perforation is
very small (64).
Capsules that can be opened electronically are also available. They have the
disadvantage of a long interval between sample collection and culturing. During this
interval, bacteria inside the capsule can replicate, and influence growth of other bacteria in
the capsule. It is a very imprecise method. The advantage of this technique is that, like the
Crosby capsule, every part of the small intestine can be examined. The disadvantage of the
suction biopsy capsule used to provide specimens from the proximal jejunum is the need
for radiological screening for the location of the capsule. This makes it unsuitable for
repeated use in young children, and women who are or might be pregnant. There may be
some discomfort when the procedure is prolonged. The technique fails in up to 10% of the
cases. To overcome the problem of determining the sampling location with the capsule
biopsy, it is better to take specimens with endoscopic forceps. Capsule biopsies are not
common in current clinical gastroenterology practice (52).
Aspirate
Small bowel aspiration for quantitative and qualitative culture specimens is still regarded
as the gold standard for diagnosis of SBBO. The sample should be properly harvested with
respect to sterile technique and accurate location. The exact composition of the microbiota
is not important for the diagnosis of SBBO if one uses the definition that more than 10 5
colony forming units/ml small intestinal fluid represents SBBO, but it is of use when
antibiotic therapy is being considered. It should be realized that cultures of randomly
harvested samples can produce false-negative results if the sample is not taken from the
actual site of bacterial overgrowth.
Culturing is not necessary if one uses gas chromatographic detection and analysis of
volatile fatty acids in the aspirates. The volatile fatty acids are produced by the metabolism
of microorganisms such as Bacteroides and Clostridia. This is essentially a rapid test for
the presence of anaerobic bacteria. When gas chromatography of volatile fatty acids is
compared with cultures of jejunal aspirates, it shows a sensitivity of 56% and specificity of
100% (51). When the tests for volatile fatty acids in jejunal aspirates are positive, this
always indicates the presence of bacterial overgrowth. This procedure avoids the more
complicated, time-consuming, and expensive bacteriological analysis of jejunal samples
(51,65,66). The numbers of bacteria per milliliter of intestinal fluid taken at two different
levels of the proximal jejunum show highly significant correlations (rs = 0.90, p< 0.001);
Sampling Microbiota in the Human Gastrointestinal Tract 37
thus one does not have to obtain the aspirate from the exact same location in the proximal
jejunum (51).
Aspirate can be acquired by intestinal intubation with sterile or nonsterile tubes, the
capsule method, direct needle aspiration of the gut contents, peroral intubation, and by
the string test as described below.
Intubation with Sterile or Nonsterile Tubes
This endoscopic method for collection of proximal gastrointestinal fluid for culture is
simple and can be performed during routine endoscopy. When the endoscope reaches the
descending part of the duodenum, the polyethylene tube will pass through the biopsy
channel into the intestinal lumen. Intestinal intubation seems to be the most suitable and
reliable method for studying small intestinal microbiota, because of the short sample
collection time and minimal disturbance of physiological conditions. Care must be taken to
prevent contamination with upper respiratory tract microbiota during the passage of the
tube, and to maintain oxygen-free conditions for anaerobic culturing. A closed
polyethylene tube filled with water through the suction channel of the endoscope is
therefore recommended, as it is not necessary to keep the suction channel sterile. The water
has to have been boiled for sterilization and the removal of dissolved oxygen. The distal end
is closed with a plug of agar. Because the innertube remains sterile even after the
passage through the nonsterile suction channel of the endoscope, the use of an overtube
eliminates the possibility of contamination. The proximal end can be attached to a double
way stopcock connected to a syringe containing boiled water. In the duodenum the agar plug
can be expelled from the tube by injection of the water in the syringe. After several minutes
the expelled water has gone through and the duodenal contents can be aspirated into the
tube, after which the tube is removed from the endoscope. Precision of the sample site and
proven absence of contamination are the main advantages. Since fresh aspirate is known to
tolerate oxygen fairly well for an exposure time of at least 8 hours, it is a good method for
obtaining aerobic and anaerobic samples (60,62,67).
Highly significant correlations (rs = 0.84, p< 0.001) were found between the
numbers of bacteria/ml of jejunal aspirate obtained from the closed and open tubes,
confirming that the intubation method is highly reproducible (51). The use of suction
during endoscopy contaminates the suction channel of the endoscope. The first milliliter of
aspirate can be discarded to avoid this, although this is very difficult in the duodenum,
where at best only a few milliliters of aspirate will be found (67). Using an open tube for
collection of small bowel fluid can theoretically lead to contamination, but according to
reported studies this does not seem to be the case (68,69).
Duodenal String Test (Enterotest)
The duodenal string test capsule is a cheap and simple device used for sampling the
contents of the upper gastrointestinal tract. It has been used for the diagnosis of typhoid
fever, whereby sampling duodenal contents by a "string" test yields a positive culture in
70% of patients (70). The weighted gelatin capsule contains a silicone rubber bag and a
140 cm highly absorbent nylon string. After a 10-hour fast the device is administered. The
first 10 cm of the nylon line is pulled out from the capsule by the protruding loop.
The capsule is then swallowed with water while the loop is held outside the mouth. The
loop is then taped to the face to secure the line. After approximately 3.5 hours the thread
has moved into the duodenum. The volume of the duodenal fluid absorbed by the distal
end of the thread is calculated by subtracting the dry weight of the segment. The distal end
is squeezed out between sterile gloved fingers in order to collect the intestinal contents.
38 Kerckhoffs et al.
Its major applications in pediatrics are the diagnosis of enteric parasitic infestations, and
the diagnosis of Salmonella infection, Giardia lamblia, and assessment of duodenal bile
salts in the diagnosis of neonatal cholestasis in duodenal contents. A drawback of the
Enterotest is that when the string is pulled out of the gastrointestinal tract, the intestinal
contents adhering to it are exposed first to the sterilizing effect of gastric acid, and
afterwards to contamination with microbiota present in the esophagus and pharynx. The
Enterotest is not useful for the isolation of anaerobes because samples cannot be protected
from contact with air. The clinical value of the string test compared with a sterile
endoscopic method for sampling small bowel secretions is limited by poor sensitivity,
specificity, and positive predictive value. Thus the string test is not an adequate substitute
for oro-duodenal intubation for the detection of SBBO (60,71).
Peroral Intubation
Peroral intubation and aspiration of luminal contents can be achieved using Miller- Abbott
or Levin tubes. These tubes were modified to suit the special needs for culture studies. The
headpiece of a Miller- Abbott tube comprises a capsule, which may be opened and closed
by hydraulic pressure. The capsule has an advantage of large size (44.5 X 12 mm), but it
has been proven possible for bacteria to gain access into the closed capsule in vitro. A
Levin tube is clinically used as a gastroduodenal feeding tube with a length of
125 centimeters. A long radio-opaque tube is used, marked for accurate placement, either
single- or double-lumened, with or without balloons, and perforated by one or more holes
at its distal end. These perforations were either left free or were protected by means of a
collodion membrane, a thin rubber sheath, or by plugs, which could be either dissolved or
dispelled by positive pressure at the moment of taking samples for culture. Contamination
of the tubes depends on the degree of contamination of the surrounding fluid, the exposure
time, and the static environment. The small intestine contains only a very small quantity of
fluid in contrast to gastric juice, which may be aspirated in large quantities. A disadvantage
of peroral intubation is the lack of certainty that the specimen obtained from the desired
level of the intestine has not been contaminated by bacteria from a higher position during
its passage.
Noninvasive Methods
Because small intestinal intubation for quantitative culture is inconvenient, expensive, and
not widely available, a variety of surrogate tests for bacterial overgrowth in the small
intestine have been devised based on the metabolic actions of enteric bacteria rather than
on increases in the number of bacteria. Several indirect methods have been developed to
overcome the problem of location-dependence of aspirates for culturing. A comparison
between the small intestinal noninvasive tests versus invasive methods with culture of
material obtained for diagnosis of SBBO is presented in Table 3. Most of these indirect
tests lack sensitivity for reliable detection of SBBO. The main reason for this is the great
variability of the microbiota and its metabolic profile. The tests are based on a specific
bacterial metabolic activity. Thus, if this particular activity is not present in the microbiota
of a SBBO patient, the test will yield a false-negative result. For this reason urinary
excretion tests (e.g., indican excretion, D-xylose, conjugated para-aminobenzoic acid),
and analysis of intestinal aspirates for bacterial metabolic products (e.g., deconjugated bile
acids in serum) lack the required reliability for detection of SBBO, and have become
obsolete (71-75). These tests will not be described further.
Sampling Microbiota in the Human Gastrointestinal Tract
39
Table 3 Small Intestinal Noninvasive Tests Compared to Jejunal Culture (Gold Standard)
Test
Sensitivity (%) Specificity (%)
Simplicity
14C-D-xylose BT
42-100
85-100
Excellent
Lactulose H 2 BT
68
44
Excellent
Glucose H 2 BT
62-93
78-83
Excellent
13C and 14C- glycocholate BT
20-70
76-90
Abbreviations: BT, breath test; H2, hydrogen.
Source: From Refs. 42, 51, 78, 80, 84, 101-105.
To diagnose bacterial overgrowth, various breath tests may be used including the
14 C-glycocholate, 14 C-D-xylose, lactulose-H 2 , and glucose-H 2 tests. The rationale for
the breath test is the production of volatile metabolites i.e., carbon dioxide (C0 2 ),
hydrogen (H 2 ) or methane (CH 4 ), by intraluminal bacteria from the administered
substrates, which can be measured in the exhaled air. The most successful and popular
methods analyze either expired isotope-labeled C0 2 after timed oral administration of
14 C- or 13 C-enriched substrates, or breath hydrogen following feeding of a non-labeled
fermentable carbohydrate substrate.
The 14 C- and 13 C-breath tests measure the pulmonal excretion of labeled C0 2
produced by the fermentation of labeled substrates, using either a radioactive or a
stable isotope. The increasing availability of methods for analyzing stable isotopes
has raised interest in replacing the radioactive 14 C by non-radioactive 13 C. The use of
radioactive isotopes is not recommended for study of children or women who are or
might be pregnant. C0 2 can be measured by mass spectrometry. Because of concerns
about diagnostic accuracy, costs of the substrates and equipment, and limited availability,
these tests have not gained widespread acceptance.
The first breath test to diagnose SBBO was the hydrogen breath test described by
Levitt in 1969 (76). Hydrogen is a constituent of human breath derived exclusively
from bacterial fermentation reactions in the intestinal lumen. Detection of hydrogen in
expired breath is considered a measure of the metabolic activity of the hydrogen-
producing bacteria. Bacteria produce hydrogen from carbohydrate substrates, and human
tissue does not generate hydrogen. The colon is considered to be the only place in the
human body where hydrogen is produced, because of the high amount of hydrogen-
producing bacteria. In cases of SBBO, hydrogen is also produced in the small intestine.
Part of the produced hydrogen is reabsorbed from the intestine into the blood, and is
exhaled. Measurement of breath hydrogen could circumvent the administration of a
radioactive isotope in testing for bacterial overgrowth. This test assumes the presence of
a hydrogen-producing microbiota, but in 15-20% of humans the microbiota of the subject
does not meet this condition. Hydrogen breath analysis is therefore not sufficiently reliable
as a diagnostic tool in SBBO.
14 C-Glycocholate Breath Test
l4 C-glycocholate breath test or bile acid test is based on the bile salt deconjugating
capacity of bacteria in the proximal small bowel. Conjugated bile acids are excreted
through the bile in the duodenum, and they are reabsorbed in the terminal ileum.
Conjugated bile acids are in the enterohepatic circulation. Physiologically, less than 5% of
the conjugated bile acids reach the colon. After excretion in the duodenum, bile acids
stimulate micellization of dietary lipids. After oral administration of glycocholic bile
40 Kerckhoffs et al.
acid (a normal component of bile) this is normally reabsorbed in the terminal ileum. In
cases of SBBO some bacteria split off glycine on the amide bond of cholylglycine. Glycine
is absorbed, and fermented in the liver to C0 2 , H 2 0, and ammonia (NH 4 ); the C0 2
produced is exhaled. When using 14 C glycocholate, the 14 C0 2 in the exhaled air can
be measured.
The sensitivity is too low (20-70%) to allow SBBO to be demonstrated without
additional intestinal culturing. A rise in labeled C0 2 does not differentiate bile salt wastage
from bacterial overgrowth. This is a disadvantage given that a significant number of SBBO
patients may have had ileal resection. Ruling out bile salt malabsorption as an explanation
for a positive breath test can be done with stool collection (42,77).
The false negative rate for the 14 C-glycocholate breath test is 30-40%. There are
three reasons for false negative outcomes. Firstly, one needs anaerobic organisms to
deconjugate bile salts. Secondly, not all cases of bacterial overgrowth involve bile salt
deconjugation. Lastly, the fatty meal (usually a polymeric supplement) given with the
cholylglycine may, in theory, affect the ratio of labeled and unlabeled carbon dioxide
absorbed, diluting the labeled carbon dioxide with that produced from the metabolism of
the meal. False positive results are possible in case of ileal pathology, ileal resection, and
increased intestinal transit. In those cases bile acids are deconjugated by the (anaerobic)
colonic microbiota. The disadvantage of using radioactivity in 14 C-substrate breath tests
can be overcome by using the stable C-isotope, which is measured by mass spectrometry
in breath samples. However, the use of C-isotope does not improve the sensitivity.
14
C-D-xylose Breath Test
The 14 C-D-xylose breath test was considered to be the only breath test for the detection of
bacterial overgrowth with high sensitivity (95-100%) and 100% specificity, but these
promising results have not been sustained (42). Compared with cultures of the duodenal
aspirates, the sensitivity and specificity are 60% and 40%, respectively (78).
This test is based on the assumption that the overgrown aerobic Gram-negative
microbiota ferment D-xylose. The 14 C0 2 produced, and unmetabolized xylose are
absorbed by the proximal small bowel, which thus avoids confusion of results caused by
metabolism of substrate by colonic bacteria. Subjects must fast at least 8 hours before the
test, and no smoking or exercise is permitted for 12 hours before the breath test. Following
a 1 g oral dose of 14 C-D-xylose in water, elevated 14 C0 2 levels are detected in the breath
within 60 minutes in 85% of patients with SBBO.
False negative rates for the 14 C-D-xylose breath test are 35-78%. False negative
results cannot be entirely attributed to the absence of D-xylose fermentation of the
microbiota (overgrown bacteria in 81.8% of SBBO patients are capable of D-xylose
fermentation); body weight is correlated to endogenous C0 2 production, and should
therefore also be taken into account (79). Disturbed gastric emptying and small intestinal
motility can also contribute to a false-negative result of the 14 C-D-xylose breath test
because of delayed delivery of the labeled substrate to the metabolizing microbiota.
Refinement of the 14 C-D-xylose breath test to include a transit marker for intestinal
motility increases its specificity. With the transit marker one can determine whether the
site of metabolism is in the small intestine or the colon (80).
Lactulose Hydrogen Breath Test
Lactulose is an easily fermented disaccharide, and is used for the detection of bacterial
overgrowth, and for determination of the orocecal transit time. The lactulose hydrogen
Sampling Microbiota in the Human Gastrointestinal Tract 41
breath test is a simple, inexpensive, and noninvasive technique to diagnose SBBO. The
lactulose breath test is performed after 12 hours fasting previous to the test. Hydrogen
breath samples are taken at baseline, and subsequently every 10-30 minutes after the test
meal that contains 10-12 g of lactulose. The hydrogen breath samples are analyzed gas
chromatographically (81). Baseline samples average 7.1+5 parts per million (ppm) of H 2
and 0-7 ppm for CH 4 (82). Values of the baseline sample over 20 ppm H 2 are suspect for
bacterial overgrowth. Values between 10 and 20 suggest incomplete fasting before the test
or ingestion of slowly digested foods the day before the test, the colon being the source of
the elevated levels (82). Slowly digested foods like beans, bread, pasta, and fiber must not
be consumed the night before the test because these foods produce prolonged hydrogen
excretion (82). The patient is not allowed to eat during the complete test. Antibiotics and
laxatives must be avoided for weeks prior to breath hydrogen testing. Cigarette smoking,
sleeping, and exercise must be avoided at least a half hour before and during the test
because these may induce hyperventilation (42). Chlorhexidine mouthwash must be used
before the test to eliminate oral bacteria, which might otherwise contribute to an early
hydrogen peak after the substrate is given. Lactulose, which reaches the colon, shows
peaks usually more than 20 ppm above baseline after 2-3 hours of testing. Lactulose is not
absorbed in the small intestine so every patient should have a colonic peak, assuming the
colonic microbiota has not been altered. Peaks associated with SBBO occur within 1 hour,
and are less prominent. Some laboratories measure H 2 and CH 4 simultaneously whereas
others test CH 4 selectively after flat lactulose tests (42). Figure 3 shows lactulose breath
test results in a patient with small bowel bacterial overgrowth.
The lactulose hydrogen breath test is positive for small intestinal bacterial overgrowth
if there is an increase in breath hydrogen of > 10 parts per million above basal that occurs at
least 15 minutes before the cecal peak. Strict interpretative criteria, such as requiring two
consecutive breath hydrogen values more than 10 ppm above the baseline reading, and
recording a clear distinction of the small bowel peak from the subsequent colonic peak
(double peak criterion), are recommended. Application of the double peak criterion alone
for interpretation of the lactulose hydrogen breath test is inadequately sensitive, even with
scintigraphy, to diagnose bacterial overgrowth. Twenty-seven percent of normal subjects
have no peak due to organic acid reduction or dilution from voluminous diarrhea (42).
The disadvantage of this test is that it is not always easy to distinguish breath
hydrogen arising from small bowel colonization from that resulting from cecal
fermentation in patients with an exceptionally rapid orocecal transit time. A comparison
with the jejunal culture sensitivity of 68% and specificity of 44% has been described (51).
A sensitivity of 16% for SBBO has been described (83).
Despite the attractive aspects of ease of performance and avoidance of a radioactive
tracer, breath hydrogen tests are not sufficiently sensitive or specific to justify their
substitution for the 14 C-D-xylose breath test for noninvasive detection of intestinal
bacterial overgrowth.
Glucose Hydrogen Breath Test
Glucose hydrogen breath tests can also be used to detect SBBO. Glucose is completely
absorbed before reaching the colon even in patients with previous gastric surgery, who
have faster than normal transit. Patients receive a solution containing 50-80 g of glucose
dissolved in 250 ml water after fasting for 12 hours. Breath hydrogen concentrations are
analyzed with an H 2 monitor after direct expiration through a Y-piece that prevents air
from mixing with the exhaled hydrogen (84). Hydrogen concentration is determined
every 10-15 minutes for two hours. Results of the hydrogen breath test are considered
42
Kerckhoffs et al.
Lactulose breath test
E
Q.
Q.
C/)
as
CD
200 -i
180-
160-
140-
120-
100-
80-
60-
40-
20-
0-
-20-
-♦ — Hydrogen (H 2 )
«— Methane (CH 4 )
o
9? tf>
# # x# JV° >°
V
\" NT
Time (minutes)
Figure 3 Production of hydrogen (H 2 ) and methane (CH 4 ) in a patient with bacterial overgrowth
of the small bowel (SB BO). Fasting H 2 and CH 4 production at- 10 and minutes; 10 grams of
lactulose was administered at minutes.
positive when the hydrogen concentration increases by 14-20 ppm (85). Smoking and
exercise are not allowed during the test, and the day previous to the test (86). The
hydrogen breath test shows stable intra-individual results in healthy people. However, in
patients with high values there is a large day-to-day variation (87). The coefficient of
variation is 5-10% (84,88). Sensitivity of 93% and specificity of 78% have been
described (85). The glucose hydrogen breath test has a sensitivity of 62% and a
specificity of 83% compared with jejunal culture (51). Poor sensitivity due to rapid
absorption of glucose substrate in the proximal small bowel, which inhibits hydrogen
generation, can be explained by a washout effect of concomitant diarrhea, loss of
bacterial microbiota because of recent antibiotic therapy, or an acidic bowel lumen.
LARGE INTESTINE: MICROBIOTA AND SAMPLING TECHNIQUES
Normal Microbiota
The large intestine including the cecum, colon, and the rectum harbors over 500 species of
11 10
bacteria, mainly obligate anaerobes (99.9%) with 10 -10 CFU/g (2,10). Microorganisms
isolated from large intestine and fecal samples are listed in Table 4. Bacteroides, Bifido-
bacteria, Eubacteria, Clostridia, and Enterobacteriaceae can predominantly be found in
the colon. Novel molecular methods are aiding better understanding of the microbiota,
which is challenging to culture due to the anaerobic nature of most of the microbiota, and
insufficient knowledge of the culturing conditions (90,91). Knowledge about the mucosa-
associated bacterial communities in different parts of the colon is limited as most attention
has been focused on bacteria present in feces. Enormous microbial populations can develop
in the lumen of the large bowel, and especially in that of the cecum because these areas have
a relative stagnation in the flowing stream (up to 60 hours) and very low oxidation-
reduction potentials. The transit time of the lumenal content exceeds the doubling times of
bacteria. Whether the microbiota is transient or truly autochthonous to habitats in the region
remains a main concern. Bacteria in food are known to pass into human feces at high
population levels. Bacteria from habitats above the large bowel pass down into the lumen of
that region. The population levels of transients probably do not contribute significantly to
Sampling Microbiota in the Human Gastrointestinal Tract
43
Table 4 Microbiota Isolated from the Large Intestine and Feces by Culturing
Microbial types in large intestine
Microbial types in feces
Lactobacilli
Streptococci
Bifidobacteria
Clostridia
Propionibacterium
Eubacterium
Bacteroides
Fusobacterium
Veillonella
Staphylococcus
Coliforms
Bacillus sp
Yeasts
Spiral shaped microbes
Actinobacillus
Enterobacteriaceae
Enterococci
Lactobacilli
Streptococci
Bifidobacteria
Clostridia
Propionibacterium
Eubacterium
Bacteroides
Fusobacterium
Veillonella
Staphylococcus
Coliforms
Bacillus sp
Yeasts
Spiral shaped bacteria
Peptococcus
Ruminococcus
Coprococcus
Acidaminococcus, Succinivibrio, Butyrivibrio,
Megasphaera, Gemminger
Catenabacterium
Peptostreptococcus
Note: The most prevalent bacterial types are italicized.
Source: From Refs. 2, 10, 15, 22, 89.
the level in the region. Bacteria in the colon are important in processing maldigested
carbohydrates (92).
Disease-Causing Microbiota
Yersinia enterocolitica, Salmonella, Shigella, Campylobacter, Clostridium difficile,
enterohemorragic Escherichia coli (EHEC), and enteropathogenic Escherichia coli
(EPEC) are the most common pathogenic bacteria in the colon that cause diarrhea.
Diarrhea can also occur after oral antibiotic treatment. Poorly absorbed antibiotics change
the normal composition of the microbiota in the colon (93). Suppression of the normal
microbiota may lead to reduced colonization resistance with subsequent overgrowth of
resistant microbiota, yeasts, and Clostridium difficile. This organism produces a protein
toxin which causes necrosis and ulceration of the colonic mucosa, called antibiotic-
associated hemorrhagic colitis.
Biopsy
A standard colonoscope has a length of 1 .30 to 1 .60 m, so that the colon and the distal ileum
can be evaluated. Long colonoscopes (165-180 cm) are able to reach the cecum even in
overly long and tortuous colons (27). Biopsy specimens can be collected with a flexible
colonoscope and flexible biopsy forceps. Patients are given a laxative solution to drink the
day before the examination. The object of full preparation is to cleanse the entire colon of
fecal material, especially the proximal parts, to allow a clear view (27). So it is very likely
44 Kerckhoffs et al.
that the bacteria in the biopsy sample are mucosa associated as the luminal bacteria will have
been washed away (94). Typically biopsy samples contain 10 5 -10 6 bacteria, and the
predominant mucosa-associated bacterial community is host specific and uniformly
distributed along the colon but differs significantly from the fecal community (95). Biopsy
samples are very small in size, and therefore more easily exposed to oxygen during
sampling; therefore, the number of viable strict anaerobes might be reduced easily.
Relatively high levels of facultative anaerobes are reported to be present in intestinal biopsy
samples. To minimize contamination during sampling, the colonoscope jaws will have to be
washed in tap water after each biopsy is performed.
Pyxigraphy
Pyxigraphy is a technique which makes use of a capsule that can be swallowed, and by
which contents of the gastrointestinal tract can be sampled under remote control.
Pyxigraphy is a simple and safe sampling method that allows the microbial population of
the proximal colon to be studied (96).
Fecal Samples
Feces are a complex microbial habitat, with many niches occupied by bacteria. It is
estimated that bacteria account for about 30% of the fecal mass, and 40-55% of fecal
solids. All of the bacteria in feces are exposed to the influences of dehydrating and
concentrating mechanisms of the colon and rectum, and intense biochemical activity of the
organisms living in the material. When the samples consist of only feces, the composition
and localization of communities anywhere in the tract cannot be revealed. Bacteroides
accounts for nearly 20% of the species that can be cultivated from feces (10). The
Bacteroides and Prevotella group (gram-negative anaerobes), and Eubacterium rectale
and Clostridium coccoides species (gram-positive anaerobes) are predominantly present in
the fecal samples (90,92). The predominant bacterial community in feces is stable in time,
host specific, affected by ageing, and not significantly altered after consumption of
probiotic strains (97).
Fecal samples have to be collected in sterile bags, and kept at low temperature
( — 80°C to +4°C) before processing (88). Stool specimens or rectal swabs can be used
for the diagnosis of cholera. Dipsticks in rectal swabs are used for the rapid diagnosis
of cholera caused by Vibrio cholerae. Dipstick analysis uses colloidal gold particles,
and is based on a one-step immunochomatography principle. The sensitivity and the
specificity of the dipsticks is greater than 92% and 91% respectively. This rapid test
(diagnosis within 10 minutes) requires minimal technical skills (98,99).
Most knowledge of the gastrointestinal microbiota stems from colon or feces
bacteriology. A major limitation in studying the proximal human colonic microbiota is the
lack of suitable sampling methods. Studies in which only feces are sampled can never
reveal the composition and localization of epithelial and cryptal communities anywhere in
the tract. Such studies reveal little about the composition of lumenal communities in any
area except perhaps the large bowel (29).
Low fecal pH is caused by ingestion of poorly absorbed carbohydrates or
carbohydrate malabsorption in the small intestine, and consequently, the bacteria in the
colon ferment the carbohydrate. Fecal pH of less than six is highly suggestive of
carbohydrate malabsorption. A breath hydrogen test with lactose can confirm
carbohydrate malabsorption. In this test a fasting patient is given 25 g of lactose dissolved
in water, and exhaled breath is assayed for hydrogen content at baseline, and at intervals
Sampling Microbiota in the Human Gastrointestinal Tract
45
Lactase deficiency
Figure 4 Principle of the hydrogen breath test with lactose to determine carbohydrate
malabsorption in the small intestine.
for several hours as described in Figure 4. As explained above, because hydrogen is not a
normal product of human metabolism, any increase in breath hydrogen concentration
represents bacterial fermentation, and indicates that unabsorbed lactose has reached
the colon.
CONCLUSION
The different methods of investigating the intestinal microbiota in humans all have their
advantages, and their drawbacks as described above. If one desires information about the
gastrointestinal tract one should also weigh the benefits of the (research) question, and
their financial consequences. Sampling of the gastrointestinal tract in humans is far more
difficult than in animal models. The sampled area is relatively small in comparison with
the total area. In animal models the animal can be sacrificed so that the complete intestinal
tract can be sampled and investigated. Unfortunately, individuals who are killed in
accidents are the best source of complete information about microbiota in the
gastrointestinal tract (29).
In general, the patient prefers the noninvasive method. Noninvasive methods are of
particular importance for very young pediatric patients, pregnant women, and the elderly,
as well as for research purposes. The difficulties of sampling the entire gastrointestinal
tract are reduced by the noninvasive tests. However, noninvasive methods are often less
sensitive and less specific. Invasive methods, such as endoscopy, are extremely unpleasant
but are highly sensitive and specific, and have the advantage of sampling at the accurate
location. The conditions that have to be satisfied in obtaining an uncontaminated specimen
46 Kerckhoffs et al.
from anywhere in the gastrointestinal tract have to include: (1) strict asepsis of method,
which necessitates that the instrument used must be suitable for sterilization by heat or gas;
(2) prevention of contamination of the internal channels in which the culture specimen is
to be lodged, until the site of sampling is reached, and protection against further
contamination on withdrawal of the instrument; and (3) verification of the location from
which cultures have been obtained.
As the development of molecular biology techniques increases the current sampling
techniques can be revised. The condition of anaerobic sampling is becoming less important.
Possible improvement of the current sampling methods only seems possible in small details.
Nanotechnology is one of the promising techniques for possible improvement of sampling
and analysis of bacteria in the human gastrointestinal tract.
REFERENCES
1. Leeuwenhoek AV, Dobell C. Antony van Leeuwenhoek and His "Little Animals": Being
Some Account of the Father of Protozoology and Bacteriology and His Multifarious
Discoveries in these Disciplines. London: Staples Press, 1932.
2. Simon GL, Gorbach SL. The human intestinal microbiota. Dig Dis Sci 1986; 3L147S-162S.
3. Feldman M, Friedman LS, Sleisenger MH, Fortran JS. Sleisenger & Fortran's Gastrointestinal
and Liver Disease: Pathophysiology, Diagnosis, Management. 7th ed. Philadelphia: W.B.
Saunders, 2002.
4. Galatola G, Grosso M, Barlotta A, et al. Diagnosis of bacterial contamination of the small
intestine using the 1 g [14C] xylose breath test in various gastrointestinal diseases. Minerva
Gastroenterol Dietol 1991; 37:169-175.
5. Mannell A, Plant M, Frolich J. The microbiota of the oesophagus. Ann R Coll Surg Engl 1983;
65:152-154.
6. Drasar BS, Shiner M, McLeod GM. Studies on the intestinal flora. I. The bacterial flora of the
gastrointestinal tract in healthy and achlorhydric persons. Gastroenterology 1969; 56:71-79.
7. King TS, Elia M, Hunter JO. Abnormal colonic fermentation in irritable bowel syndrome.
Lancet 1998; 352:1187-1189.
8. Mallory A, Savage D, Kern F, Jr., Smith JG. Patterns of bile acids and microbiota in the
human small intestine. II. Microflora. Gastroenterology 1973; 64:34-42.
9. Cunningham-Rundles S, Ahrn S, Abuav-Nussbaum R, Dnistrian A. Development of
immunocompetence: role of micronutrients and microorganisms. Nutr Rev 2002;
60:S68-S72.
10. Carman RJ, Van Tassell RL, Wilkins TD. The normal intestinal microbiota: ecology,
variability and stability. Vet Hum Toxicol 1993; 35:11-14.
11. Blaut M, Collins MD, Welling GW, Dore J, van Loo J, de Vos W. Molecular biological
methods for studying the gut microbiota: the EU human gut flora project. Br J Nutr 2002;
87:S203-S211.
12. Blaut M. Relationship of prebiotics and food to intestinal microbiota. Eur J Nutr 2002;
41:111-116.
13. Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science 2001;
292:1115-1118.
14. Gordon JI, Stappenbeck TS, Hooper LV, et al. Response from Jeffrey I. Gordon. Commensal
bacteria make a difference. Trends Microbiol 2003; 11:150-151.
15. Zinsser H. Zinsser Microbiology. 20th ed. Norwalk, CT: Appleton & Lange, 1992.
16. Hopkins MJ, Macfarlane GT. Changes in predominant bacterial populations in human feces
with age and with Clostridium difficile infection. J Med Microbiol 2002; 51:448-454.
17. Husebye E, Hellstrom PM, Sundler F, Chen J, Midtvedt T. Influence of microbial species on
small intestinal myoelectric activity and transit in germ-free rats. Am J Physiol Gastrointest
Liver Physiol 2001; 280:G368-G380.
Sampling Microbiota in the Human Gastrointestinal Tract 47
18. Husebye E, Hellstrom PM, Midtvedt T. Intestinal microbiota stimulates myoelectric activity
of rat small intestine by promoting cyclic initiation and aboral propagation of migrating
myoelectric complex. Dig Dis Sci 1994; 39:946-956.
19. Nieuwenhuijs VB, Verheem A, Duijvenbode-Beumer H, et al. The role of interdigestive small
bowel motility in the regulation of gut microbiota, bacterial overgrowth, and bacterial
translocation in rats. Ann Surg 1998; 228:188-193.
20. Williams C. Occurrence and significance of gastric colonization during acid-inhibitory
therapy. Best Pract Res Clin Gastroenterol 2001; 15:511-521.
21. Pei Z, Bini EJ, Yang L, Zhou M, Francois F, Blaser MJ. Bacterial biota in the human distal
esophagus. Proc Natl Acad Sci USA 2004; 101:4250-4255.
22. Sjostedt S. The upper gastrointestinal microbiota in relation to gastric diseases and gastric
surgery. Acta Chir Scand Suppl 1989; 551:1-57.
23. Jain SK, Jain S, Jain M, Yaduvanshi A. Esophageal tuberculosis: is it so rare? Report of 12
cases and review of the literature Am J Gastroenterol 2002; 97:287-291.
24. Gagliardi D, Makihara S, Corsi PR, et al. Microbial flora of the normal esophagus. Dis
Esophagus 1998; 11:248-250.
25. Pajecki D, Zilberstein B, dos Santos MA, et al. Megaesophagus microbiota: a qualitative and
quantitative analysis. J Gastrointest Surg 2002; 6:723-729.
26. Franklin MA, Skoryna SC. Studies of the natural gastric flora: I Bacterial flora of fasting
human subjects. Can Med Assoc J 1966; 95:1349-1355.
27. Cotton Peter B, Williams Christopher B. 4th ed. Practical Gastrointestinal Endoscopy.
London: Blackwell Scientific Publications, 1996.
28. Osias GL, Bromer MQ, Thomas RM, et al. Esophageal bacteria and Barrett's esophagus:
a preliminary report. Dig Dis Sci 2004; 49:228-236.
29. Savage DC. Microbial ecology of the gastrointestinal tract. Annu Rev Microbiol 1977;
31:107-133.
30. Simon GL, Gorbach SL. Intestinal flora in health and disease. Gastroenterology 1984;
86:174-193.
31. Franklin MA, Skoryna SC. Studies on natural gastric flora: survival of bacteria in fasting
human subjects. Can Med Assoc J 1971; 105:380-386.
32. Monstein HJ, Tiveljung A, Kraft CH, Borch K, Jonasson J. Profiling of bacterial flora in
gastric biopsies from patients with Helicobacter py/on-associated gastritis and histologically
normal control individuals by temperature gradient gel electrophoresis and 16S rDNA
sequence analysis. J Med Microbiol 2000; 49:817-822.
33. Verhagen MA, Roelofs JM, Edelbroek MA, Smout AJ, Akkermans LM. The effect of
cisapride on duodenal acid exposure in the proximal duodenum in healthy subjects. Aliment
Pharmacol Ther 1999; 13:621-630.
34. Pasricha PJ. Effect of sleep on gastroesophageal physiology and airway protective
mechanisms. Am J Med 2003; 1 15:1 14S-1 18S.
35. Pounder RE, Ng D. The prevalence of Helicobacter pylori infection in different countries.
Aliment Pharmacol Ther 1995; 9:33-39.
36. Graham DY, Adam E, Reddy GT, et al. Seroepidemiology of Helicobacter pylori infection in
India. Comparison of developing and developed countries. Dig Dis Sci 1991; 36:1084-1088.
37. Guerre J, Vedel G, Gaudric M, Paul G, Cornuau J. Bacterial flora in gastric juice taken at
endoscopy in 93 normal subjects. Pathol Biol (Paris) 1986; 34:57-60.
38. Wong BC, Wong WM, Wang WH, et al. An evaluation of invasive and non-invasive tests for
the diagnosis of Helicobacter pylori infection in Chinese. Aliment Pharmacol Ther 2001;
15:505-511.
39. Cotton, Williams. Practical gastrointestinal endoscopy. 4th ed. London: Blackwell Scientific
Publications, 1996.
40. Lim LL, Ho KY, Ho B, Salto-Tellez M. Effect of biopsies on sensitivity and specificity of
ultra-rapid urease test for detection of Helicobacter pylori infection: A prospective
evaluation. World J Gastroenterol 2004; 10:1907-1910.
48 Kerckhoffs et al.
41. Monteiro L, de Mascarel A, Sarrasqueta AM, et al. Diagnosis of Helicobacter pylori
infection: noninvasive methods compared to invasive methods and evaluation of two new
tests. Am J Gastroenterol 2001; 96:353-358.
42. Romagnuolo J, Schiller D, Bailey RJ. Using breath tests wisely in a gastroenterology practice:
an evidence-based review of indications and pitfalls in interpretation. Am J Gastroenterol
2002;97:1113-1126.
43. Koletzko S, Feydt-Schmidt A. Infants differ from teenagers: use of non-invasive tests for
detection of Helicobacter pylori infection in children. Eur J Gastroenterol Hepatol 2001;
13:1047-1052.
44. Makristathis A, Pasching E, Schutze K, Wimmer M, Rotter ML, Hirschl AM. Detection of
Helicobacter pylori in stool specimens by PCR and antigen enzyme immunoassay. J Clin
Microbiol 1998; 36:2772-2774.
45. MacKay WG, Williams CL, McMillan M, Ndip RN, Shepherd AJ, Weaver LT. Evaluation of
protocol using gene capture and PCR for detection of Helicobacter pylori DNA in feces.
J Clin Microbiol 2003; 41:4589-4593.
46. Basset C, Holton J, Ricci C, et al. Review article: diagnosis and treatment of Helicobacter: a
2002 updated review. Aliment Pharmacol Ther 2003; 17:89-97.
47. Vakil N, Rhew D, Soil A, Ofman JJ. The cost-effectiveness of diagnostic testing strategies for
Helicobacter pylori. Am J Gastroenterol 2000; 95:1691-1698.
48. Maibach RC, Dutly F, Altwegg M. Detection of Tropheryma whipplei DNA in feces by PCR
using a target capture method. J Clin Microbiol 2002; 40:2466-2471.
49. Edmiston CE, Jr., Krepel CJ, Seabrook GR, Jochimsen WG. Anaerobic infections in the
surgical patient: microbial etiology and therapy. Clin Infect Dis 2002; 35:S1 12— SI 18.
50. Finegold SM. Host factors predisposing to anaerobic infections. FEMS Immunol Med
Microbiol 1993; 6:159-163.
51. Corazza GR, Menozzi MG, Strocchi A, et al. The diagnosis of small bowel bacterial
overgrowth. Reliability of jejunal culture and inadequacy of breath hydrogen testing.
Gastroenterology 1990; 98:302-309.
52. Mee AS, Burke M, Vallon AG, Newman J, Cotton PB. Small bowel biopsy for malabsorption:
comparison of the diagnostic adequacy of endoscopic forceps and capsule biopsy specimens.
Br Med J (Clin Res Ed) 1985; 291:769-772.
53. Crosby WH, Kugler HW. Intraluminal biopsy of the small intestine; the intestinal biopsy
capsule. Am J Dig Dis 1957; 2:236-241.
54. Flick AL, Quionton WE, Rubin CE. A peroral hydraulic biopsy tube for multiple sampling at
any level of the gastro-intestinal tract. Gastroenterology 1961; 40:120-126.
55. Chu KM, Yuen ST, Wong WM, et al. A prospective comparison of performance of biopsy
forceps used in single passage with multiple bites during upper endoscopy. Endoscopy 2003;
35:338-342.
56. Tornblom H, Lindberg G, Nyberg B, Veress B. Full-thickness biopsy of the jejunum reveals
inflammation and enteric neuropathy in irritable bowel syndrome. Gastroenterology 2002;
123:1972-1979.
57. Davis CP. Postmortem alterations of bacterial localization. Scan Electron Microsc 1980; 523-
6:542.
58. Bengmark S, Jeppsson B. Gastrointestinal surface protection and mucosa reconditioning.
JPEN J Parenter Enteral Nutr 1995; 19:410-415.
59. Tiveljung A, Soderholm JD, Olaison G, Jonasson J, Monstein HJ. Presence of eubacteria in
biopsies from Crohn's disease inflammatory lesions as determined by 16S rRNA gene-based
PCR. J Med Microbiol 1999; 48:263-268.
60. Leon-Barua R, Gilman RH, Rodriguez C, et al. Comparison of three methods to obtain upper
small bowel contents for culture. Am J Gastroenterol 1993; 88:925-928.
61. Shiner M, Waters TE, Gray JD. Culture studies of the gastrointestinal tract with a newly
devised capsule. Results of tests in vitro and in vivo. Gastroenterology 1963; 45:625-632.
62. Tally FP, Stewart PR, Sutter VL, Rosenblatt JE. Oxygen tolerance of fresh clinical anaerobic
bacteria. J Clin Microbiol 1975; 1:161-164.
Sampling Microbiota in the Human Gastrointestinal Tract 49
63. Nakshabendi IM, McKee R, Downie S, Russell RI, Rennie MJ. Rates of small intestinal
mucosal protein synthesis in human jejunum and ileum. Am J Physiol 1999;
277:E1028-E1031.
64. Sheehy TW. Intestinal biopsy. Lancet 1964; 41:959-962.
65. Mayhew JW, Gorbach SL. Internal standards for gas chromatographic analysis of metabolic
end products from anaerobic bacteria. Appl Environ Microbiol 1977; 33:1002-1003.
66. Gorbach SL, Mayhew JW, Bartlett JG, Thadepalli H, Onderdonk AB. Rapid diagnosis of
anaerobic infections by direct gas-liquid chromatography of clinical speciments. J Clin Invest
1976; 57:478-484.
67. Bardhan PK, Gyr K, Beglinger C, Vogtlin J, Frey R, Vischer W. Diagnosis of bacterial
overgrowth after culturing proximal small-bowel aspirate obtained during routine upper
gastrointestinal endoscopy. Scand J Gastroenterol 1992; 27:253-256.
68. Tabaqchali S. The pathophysiological role of small intestinal bacterial flora. Scand
J Gastroenterol Suppl 1970; 6:139-163.
69. Norby RS, Haagen NO, Justesen T, Jacobsen IE, Lave J, Magid E. Comparison of an open and
a closed tube system for collection of jejunal juice. Scand J Gastroenterol 1983; 18:353-357.
70. Muraca M, Vilei MT, Miconi L, Petrin P, Antoniutti M, Pedrazzoli S. A simple method for the
determination of lipid composition of human bile. J Lipid Res 1991; 32:371-374.
71. Riordan SM, Mclver CJ, Duncombe VM, Bolin TD. An appraisal of a 'string test' for the
detection of small bowel bacterial overgrowth. J Trop Med Hyg 1995; 98:117-120.
72. Bardhan PK, Feger A, Kogon M, et al. Urinary choloyl-PABA excretion in diagnosing small
intestinal bacterial overgrowth: evaluation of a new noninvasive method. Dig Dis Sci 2000;
45:474-479.
73. Mayer PJ, Beeken WL. The role of urinary indican as a predictor of bacterial colonization in
the human jejunum. Am J Dig Dis 1975; 20:1003-1009.
74. Krawitt EL, Beeken WL. Limitations of the usefulness of the D-xylose absorption test. Am
J Clin Pathol 1975; 63:261-263.
75. Einarsson K, Bergstrom M, Eklof R, Nord CE, Bjorkhem I. Comparison of the proportion of
unconjugated to total serum cholic acid and the [ 14 C] -xylose breath test in patients with
suspected small intestinal bacterial overgrowth. Scand J Clin Lab Invest 1992; 52:425-430.
76. Levitt MD. Production and excretion of hydrogen gas in man. N Engl J Med 1969;
281:122-127.
77. Hepner GW. Increased sensitivity of the cholylglycine breath test for detecting ileal
dysfunction. Gastroenterology 1975; 68:8-16.
78. Valdovinos MA, Camilleri M, Thomforde GM, Frie C. Reduced accuracy of 14 C-D-xylose
breath test for detecting bacterial overgrowth in gastrointestinal motility disorders. Scand
J Gastroenterol 1993; 28:963-968.
79. Riordan SM, Mclver CJ, Duncombe VM, Bolin TD, Thomas MC. Factors influencing the 1-g
14 C-D-xylose breath test for bacterial overgrowth. Am J Gastroenterol 1995; 90:1455-1460.
80. Lewis SJ, Young G, Mann M, Franco S, O'Keefe SJ. Improvement in specificity of [ 14 C]D-
xylose breath test for bacterial overgrowth. Dig Dis Sci 1997; 42:1587-1592.
81. Metz G, Gassull MA, Drasar BS, Jenkins DJ, Blendis LM. Breath-hydrogen test for small-
intestinal bacterial colonisation. Lancet 1976; 1:668-669.
82. Perman J A, Modler S, Barr RG, Rosenthal P. Fasting breath hydrogen concentration: normal
values and clinical application. Gastroenterology 1984; 87:1358-1363.
83. Riordan SM, Mclver CJ, Walker BM, Duncombe VM, Bolin TD, Thomas MC. The lactulose
breath hydrogen test and small intestinal bacterial overgrowth. Am J Gastroenterol 1996;
91:1795-1803.
84. Brummer RJ, Armbrecht U, Bosaeus I, Dotevall G, Stockbruegger RW. The hydrogen (H 2 )
breath test. Sampling methods and the influence of dietary fibre on fasting level. Scand
J Gastroenterol 1985; 20:1007-1013.
85. Kerlin P, Wong L. Breath hydrogen testing in bacterial overgrowth of the small intestine.
Gastroenterology 1988; 95:982-988.
50 Kerckhoffs et al.
86. Thompson DG, O'Brien JD, Hardie JM. Influence of the oropharyngeal microbiota on the
measurement of exhaled breath hydrogen. Gastroenterology 1986; 91:853-860.
87. Riordan SM, Mclver CJ, Bolin TD, Duncombe VM. Fasting breath hydrogen concentrations
in gastric and small-intestinal bacterial overgrowth. Scand J Gastroenterol 1995; 30:252-257.
88. Rumessen JJ, Kokholm G, Gudmand-Hoyer E. Methodological aspects of breath hydrogen
(H 2 ) analysis. Evaluation of a H 2 monitor and interpretation of the breath H 2 test. Scand J Clin
Lab Invest 1987; 47:555-560.
89. Moore WE, Holdeman LV. Special problems associated with the isolation and identification
of intestinal bacteria in fecal flora studies. Am J Clin Nutr 1974; 27:1450-1455.
90. Mai V, Morris JG, Jr. Colonic bacterial flora: changing understandings in the molecular age.
J Nutr 2004; 134:459^164.
91. Tlaskalova-Hogenova H, Stepankova R, Hudcovic T, et al. Commensal bacteria (normal
microbiota), mucosal immunity and chronic inflammatory and autoimmune diseases.
Immunol Lett 2004; 93:97-108.
92. Zhong Y, Priebe MG, Vonk RJ, et al. The role of colonic microbiota in lactose intolerance.
Dig Dis Sci 2004; 49:78-83.
93. Edlund C, Nord CE. Effect on the human normal microbiota of oral antibiotics for treatment
of urinary tract infections. J Antimicrob Chemother 2000; 46:41-48 discussion 63-65: 41-48.
94. Huijsdens XW, Linskens RK, Mak M, Meuwissen SG, Vandenbroucke-Grauls CM,
Savelkoul PH. Quantification of bacteria adherent to gastrointestinal mucosa by real-time
PCR. J Clin Microbiol 2002; 40:4423-4427.
95. Zoetendal EG, von Wright A, Vilpponen-Salmela T, Ben Amor K, Akkermans AD, de
Vos WM. Mucosa-associated bacteria in the human gastrointestinal tract are uniformly
distributed along the colon and differ from the community recovered from feces. Appl
Environ Microbiol 2002; 68:3401-3407.
96. Pochart P, Lemann F, Flourie B, Pellier P, Goderel I, Rambaud JC. Pyxigraphic sampling to
enumerate methanogens and anaerobes in the right colon of healthy humans. Gastroenter-
ology 1993; 105:1281-1285.
97. Zoetendal EG, Cheng B, Koike S, Mackie RI. Molecular microbial ecology of the
gastrointestinal tract: from phylogeny to function. Curr Issues Intest Microbiol 2004; 5:31-47.
98. Bhuiyan NA, Qadri F, Faruque AS, et al. Use of dipsticks for rapid diagnosis of cholera
caused by Vibrio cholerae 01 and 0139 from rectal swabs. J Clin Microbiol 2003;
41:3939-3941.
99. Nato F, Boutonnier A, Rajerison M, et al. One-step immunochromatographic dipstick tests for
rapid detection of Vibrio cholerae 01 and 0139 in stool samples. Clin Diagn Lab Immunol
2003; 10:476^78.
100. Sayler GS, Simpson ML, Cox CD. Emerging foundations: nano-engineering and bio-
microelectronics for environmental biotechnology. Curr Opin Microbiol 2004; 7:267-273.
101. Stotzer PO, Kilander AF. Comparison of the 1-gram ( 14 C)-D-xylose breath test and the 50-
gram hydrogen glucose breath test for diagnosis of small intestinal bacterial overgrowth.
Digestion 2000; 61:165-171.
102. King CE, Toskes PP, Guilarte TR, Lorenz E, Welkos SL. Comparison of the one-gram d-
[ 14 C]xylose breath test to the [ 14 C]bile acid breath test in patients with small-intestine
bacterial overgrowth. Dig Dis Sci 1980; 25:53-58.
103. Sherr HP, Sasaki Y, Newman A, Banwell JG, Wagner HN, Jr., Hendrix TR. Detection of
bacterial deconjugation of bile salts by a convenient breath-analysis technic. N Engl J Med
1971; 285:656-661.
104. Metz G, Drasar BS, Gassull MA, Jenkins DJA, Blendis LM. Breath-hydrogen test for small-
intestinal bacterial overgrowth. Lancet 1976; 1:668-669.
105. Rumessen JJ, Gudmand-Hoyer E, Bachmann E, Justesen T. Diagnosis of bacterial overgrowth
of the small intestine. Comparison of the 14 C-D-xylose breath test and jejunal cultures in 60
patients. Scan J Gastroenterol 1985; 20:1267-1275.
3
The Normal Microbiota of the Human
Gastrointestinal Tract: History of Analysis,
Succession, and Dietary Influences
Anne L. McCartney and Glenn R. Gibson
Food Microbial Sciences Unit, School of Food Biosciences, Whiteknights,
University of Reading, Reading, U.K.
INTRODUCTION
The human body is a wonderland for the microbial world, with harsh uninhabitable lands
in some regions and lush fertile metropolis in others. The normal microbiota of humans is
an extensive and diverse microbial community, which is composed primarily of bacteria
from numerous phylogenetic clusters (1-5). The largest proportion of the human
microbiota is found in the gastrointestinal (GI) tract, or more specifically the colon. Other
regions of the body harboring indigenous bacterial populations include the skin, oral
cavity, upper respiratory tract, and urogenital tract (3). This chapter aims to discuss the
normal microbiota of the human GI tract and our current understanding of its composition
and role in human health. Discussion of the interactions between the gut microbiota and
the host will also abridge the impact of extrinsic factors, such as diet and environment.
The GI tract of humans can be divided into three anatomical regions, namely, the
stomach, small intestine (comprising duodenum, jejunum, and ileum) and large intestine
or colon. Distinctive physicochemical environments are found within the different regions
and the microbial populations harbored reflect this, both quantitatively and qualitatively
(3,6,7). Thus, the normal microbiota of the human GI tract is often subdivided into three
distinct bacterial communities: that of the upper GI tract, the ileum and the colon.
The rapid transit time and acidic conditions of the stomach restrict the levels of
microbial colonization of this region (6,8). Gastric juices and small-intestine secretions
(bile and pancreatic fluids) amplify the hostile nature of the upper GI tract to microbial
establishment. However, some aciduric Gram-positive bacteria (lactobacilli and
streptococci) can be detected in this region (~10 2 -10 4 bacterial cells per milliliter of
contents). In addition, some micro-organisms, such as Helicobacter pylori (the possible
etiological agent in peptic ulcers and Type B gastritis), are able to survive, evade or
combat the harsh conditions of the stomach (9-12). Helicobacter spp. use their flagellae to
51
52 McCartney and Gibson
avoid peristaltic movement and burrow into the mucosal lining of the stomach, where they
are partially protected from the acidic conditions by producing NH 3 from urea to
neutralize the acid (11,12).
The flow of digesta (intestinal motility) is somewhat slower in the ileum,
compared with the upper GI tract, and conditions are thus more favorable for microbial
colonization. Available data indicate increasing bacterial population levels (10 -10
bacterial cells per milliliter of contents) and a higher diversity of micro-organisms, with
the presence of Gram-negative facultatively anaerobic bacteria (such as members of the
family Enterobacteriaceae) and obligate anaerobes (including Bacteroides, Veillonella,
Fusobacterium and Clostridium species) in conjunction with lactobacilli and entero-
cocci (1,3,6).
The typical GI transit time is between 55 and 70 hours (13,14). Taken together with
a more neutral pH and relative abundance of nutrients (including non-digestible
carbohydrates and food components which have escaped digestion in the upper GI tract,
sloughed off epithelial cells and microbial cell debris), this region of the human GI tract is
an oasis for microbial growth, attaining levels of 10 10 — 10 12 bacterial cells per gram of
contents (3,6,8). The composition of the colonic microbiota is extremely complex,
generally estimated to comprise greater than 500 bacterial species, although it is thought
that 30-40 predominate. The majority of members of the colonic microbiota are obligate
anaerobic genera, including Bacteroides, Bifidobacterium, Clostridium, Enterococcus,
Eubacterium, Fusobacterium, Peptococcus, Peptostreptococcus and Ruminococcus
(2,3,15). Our understanding of the composition of the normal colonic microbiota has
largely resulted from studies of the fecal microbiota. Questions regarding the accuracy of
fecal samples to represent the colonic microbiota have been initially addressed by
bacteriological analysis of the intestinal contents of sudden-death victims (14,16). This
work demonstrated that cultivation studies of the fecal microbiota accurately reflected the
culturable component of the distal colon. However, with recent advances in molecular
technology (and indeed in cultivation assays), as well as sampling methods (including
medical advances affording biopsy samples), analysis of the microbiota in different
regions of the GI tract is now feasible as discussed below and in previous chapters. Future
studies will, no doubt, begin to unravel the impact of impairment or disease on the mucosal
microbiota, as well as the interaction between the luminal microbiota, the mucosally
associated microbiota and the host.
ROLE OF THE GASTROINTESTINAL MICROBIOTA IN HUMANS
Traditionally, the colon has been considered to largely be the human sewage system
which, as well as storing and removing waste material from the GI tract, was capable
of recycling water (i.e., absorption). However, we now recognize that the GI tract is one of
the most metabolically and immunologically active organs of the human body. Indeed, the
primary function of the microbiota is generally considered to be salvage of energy
via fermentation of carbohydrates, such as indigestible dietary residues (plant cell walls,
non-digestible fibers and oligosaccharides), mucin side-chains and sloughed-off epithelial
cells (5,6,8,13,17). It has been estimated that between 20 and 60 grams of carbohydrate are
available in the colon of healthy human adults per day, as well as 5-20 grams of protein. In
addition to salvaging energy, principally through production of short-chain fatty acids
(SCFAs) and their subsequent absorption and use by the host, microbial fermentation
produces gases (principally hydrogen, carbon dioxide and methane) and increases
biomass. These all impact upon gut physiology. Components of the gut microbiota also
The Normal Microbiota of the Human Gastrointestinal Tract 53
synthesize certain B and K vitamins, metabolize xenobiotics, contribute to amino acid
homeostasis, may impact drug efficacy and are an integral part of the host defense (both
through host-microbe and microbe-microbe interactions; including colonization resist-
ance) (6,17,18). Recent observations, using molecular techniques and germ-free/
gnotobiotic animals, have also identified that intestinal bacteria can influence gene
expression of epithelial cells (5,19). Taken together, the activity of the microbiota, or
certain components thereof, may be more important to the homeostasis of the ecosystem
than specific numerics. Although the combination of all these factors, as well as host and
environmental factors, will ultimately determine the equilibrium of the colon.
Three main SCFAs are produced by microbial fermentation in the human colon:
acetate, butyrate, and propionate (the approximate molar ratio for which is 70:10:20 —
although diet and microbiota composition influence the exact ratio) (5). SCFAs supply
energy to cells (acetate, muscle; butyrate, colonocytes; propionate, liver), affect colonic
metabolism, control epithelial cell proliferation and differentiation, and impact upon
bowel motility and circulation (including water absorption and the hepatic regulation of
lipids and sugars) (5,8,13).
Uptake and utilization of acetate is the primary method of the host salvaging energy
from non-digestible dietary carbohydrates. Acetate may also play a role in lipogenesis by
adipocytes and, together with propionate, may be involved in modulation of glucose
metabolism (via the glycaemic index). Butyrate is estimated to provide between 40 and
70% of the required energy of the colonic mucosa (5,6). In vitro studies have demonstrated
inhibition of proliferation of neoplastic cell lines by butyrate, suggesting a possible
beneficial role of butyrate against the progression of colorectal carcinoma. Such work has
also shown that butyrate stimulates cell differentiation, promoting reversion to non-
neoplastic phenotypes.
In addition to carbohydrate fermentation, bacterial metabolism of amino acids may
generate branched-chain fatty acids (such as isobutyrate, isovalerate, and 2-methyl
butyrate), whilst microbial degradation of peptides and proteins forms potentially toxic
compounds (including ammonia, amines, phenols, and indoles) (8,17).
The colonic microbiota impacts upon amino acid homeostasis, with 1-20% of
circulating plasma lysine being derived from the activity of gut bacteria (18). In addition,
microbial hydrolysis of urea to ammonia by the gut microbiota is important in the
recycling of nitrogen in the intestine.
The protective effect of the gut microbiota against pathogenic microorganisms falls
under two umbrellas: 1, colonization resistance and, 2, stimulation of immune function. In
the healthy state, the resident microbiota effectively inhibits the establishment and/or
overgrowth of harmful bacteria. A number of mechanisms appear to be responsible,
including competition for adhesion sites, competition for nutrients, production of
environmental conditions restrictive to pathogenic growth (pH, redox potential),
production of anti-microbial compounds (either toxic metabolites or bacteriocins)
and/or generation of signals which interact with gene expression of exogenous organisms
(3,8,13). In addition, certain members of the intestinal microbiota are known to stimulate
immune function (both locally and systemically) (17,20,21). Interactions between the
mucosal barrier, the indigenous microbiota and the gut-associated lymphoid tissue
(GALT) are paramount to the host defense against pathogenic invasion and infection. This
three-component system is integral to the equilibrium of the GI tract ecosystem and
defines the balance between oral tolerance and mounting an immune response.
Bacterial-host cell communications can also impact upon expression by host cells.
One example of this is the ability of Bad. thetaiotaomicron to influence fucosylated
glycoconjugate production by intestinal cells in relation to the availability of fucose
54 McCartney and Gibson
(a substrate for the organism) (5,19). In this manner, the bacteria can essentially order
nutrients from the epithelial cells as necessary. Such microbial induced signals may also
act in cell-cell communications between different bacterial species and play an important
role in homeostasis of their environmental niche.
ACQUISITION OF THE GUT MICROBIOTA
Acquisition of the normal microbiota is a biological succession which commences during
or immediately following birth (depending on the mode of delivery). During natural birth,
the neonate is exposed to the maternal microbiota, both vaginal and fecal (22-24).
However, colonization is delayed in infants born via Caesarian section and the major
source of inoculation is thought to be from the environment (including nosocomially from
within the maternity ward) (23). Caesarean section delivery has been correlated with an
increased clostridial component in the infant microbiota. Indeed, recent studies have
demonstrated that higher clostridial counts in children delivered by Caesarean section
relative to children delivered vaginally persist even after 7 years of age (25).
During the initial phase of acquisition, facultative anaerobes predominate
(enterobacteria and streptococci) and effectively reduce the redox potential of the gut
environment enabling colonization by obligate anaerobes (including bacteroides,
bifidobacteria, Clostridia, and eubacteria). Factors such as diet and host genetics play
important roles in the development of the microbiota (with some bacterial populations
eliminated and others maintained) (3,24). The classical studies by Tissier almost a century
ago first highlighted the significant difference of the fecal microbiota harbored by breast-
fed and formula-fed infants. Indeed, Tissier described three phases of microbial
acquisition in infants: 1, initial hours of life when the fecal bacterial content was nil;
2, beginning between the tenth and twentieth hour of life, comprising a heterogeneous
microbiota; 3, after passage of maternal milk through the intestinal tract, the microbiota
being predominated by bifidobacteria (an obligately anaerobic Gram-positive bacillus
which often exhibits bifurcating morphology, formerly named Bacillus bifidus by Tissier)
(3,26,27). A fourth phase, following introduction of solid foods (weaning), was later
described and is characterized by modulation of the breast-fed microbiota towards an
adult-type microbiota (climax community) harboring a more complex and diverse
bacterial community (13,28,29). It is worth noting that Tissier also speculated that
subdominant populations (including facultative anaerobes) were harbored during phase
three of acquisition and that complete bacteriological examination was necessary to
determine this. No doubt some such populations are then re-established as predominant
members within the heterogeneous climax community through the introduction of
complex carbohydrates into the diet.
Bottle-fed infants did not demonstrate the same succession of micro-organisms as
seen in their breast-fed counterparts. Indeed, Tissier observed that formula- fed infants
maintained a heterogeneous fecal microbiota beyond day 4. Much work has been compiled
over the last 30 years comparing the fecal microbiota of exclusively milk-fed infants. Until
recently, such studies were performed using traditional cultivation techniques. A range of
data has accumulated and while notable differences may still be observed between breast-
fed and formula-fed infants, they are not as startling as those shown by Tissier. In general,
the bifidobacterial microbiota, both carriage (percentage of infants harboring
bifidobacteria) and population level, of exclusively milk-fed infants was not significantly
different (30-33). However, levels of other organisms, notably Bacteroides, Clostridia and
enterobacteria, were significantly higher in formula-fed infants. Thus, breast-fed infants
The Normal Microbiota of the Human Gastrointestinal Tract 55
harbored a bifidobacterially predominant fecal microbiota, whereas formula-fed
infants harbored a larger bacterial load comprising greater heterogeneity with higher
levels of Bacteroides, enterobacteria and Clostridia. Studies investigating the fecal
microbiota of infants fed different formulae (for example, following fortification with iron
and/or oligosaccharides) have shown that the constituents of the infant formulae impact
upon the microbial composition (24,34). Recent studies employing molecular biological
methods have further clarified the situation, demonstrating an initial diverse microbiota
during the first 4-6 days of life (phase 2) followed by establishment of a bifidobacterially
predominant microbiota in breast-fed infants (phase 3) which is not as obvious in formula-
fed infants. Namely, bifidobacteria formed 60-91% of the bacterial composition of
breast-fed infants (n = 6) and between 28 and 75% of the total microbial load of formula-
fed infants (n = 6) after day six (35). Inter-individual differences were noted in both
feeding groups, with respect to the relative proportions of the bacterial groups studied.
Molecular characterization studies of the predominant isolates from concurrent cultivation
work further highlighted the distinction between the microbiota harbored by infants [both
between feeding groups and inter-individually (35)].
COMPOSITION OF THE ADULT FECAL MICROBIOTA
ASSESSED BY CULTURING
Much of the early information on the composition of the human colonic microbiota was
elucidated using traditional cultivation techniques. The majority of such work was driven
by the quest to determine the relationship between diet and colonic cancer (16,36-38).
Epidemiological studies had identified that risk of colon cancer correlated with dietary
habit, with higher colorectal cancer incidence in populations consuming a high-fat, low-
fiber diet. In 1969, Aries and coworkers (39) postulated that this correlation between diet
and cancer should be reflected in the composition of the colonic microbiota. Thus, interest
in the effect of diet on the GI microbiota began in earnest. The majority of these early
studies compared the fecal microbiota of individuals from different populations which had
significantly different incidences of colon cancer. For example, Aries and coworkers (39)
compared the fecal microbiota of English subjects (relatively high incidence) to that of
Ugandans (low incidence). Significantly higher numbers of Bacteroides and bifidobacteria
were enumerated from English individuals (Table 1), whilst enterococci, lactobacilli,
streptococci, and yeasts were present at higher numbers in the fecal microbiota of
Ugandan subjects. Subsequent studies compared the microbial compositions of multiple
populations with either a high or a low incidence of colon cancer (38). Again, higher yields
of bacteroides were seen for the high-risk populations (Table 1). However, an even more
striking observation was the higher anaerobe-to-aerobe ratio in fecal samples from the
high-incidence populations. Moore and colleagues (40) similarly showed higher levels of
Bacteroides and bifidobacteria in subjects from high-risk populations (North Americans),
when compared to low-risk populations (Africans). However, these observations were not
consistent for a second low-risk population (Japanese) for whom the greatest percentage of
isolates was Bacteroides (Table 2). More detailed characterization of these isolates
identified that Bacteroides vulgatus, Bacteroides distasonis and Peptostreptococcus
productus (reclassified as Ruminococcus productus) were the more predominant members
of the fecal microbiota of high-risk populations (40). In addition, a notably higher
percentage of isolates in the low-risk populations belonged to the species Bacteroides
fragilis, Eubacterium aerofaciens (reclassified as Collinsella aerofaciens) and Escherichia
coli (Table 2). Such detailed analyses of the microbial community have highlighted the
56
McCartney and Gibson
O
C
03
u
c
o
o
U
O
a
• i-H
o
c
HH
o
-J
o
X3
00
•I-H
J3
0)
• -H
c
o
U
B
o
GO
Is
73
• i-H
>
• i-H
C
I— I
e
o
73
■4-J
o
-^
'o
U
or
<D
S
03
13
o
Ph
c
o
• i-H
■4-J
• i-H
o
s
o
U
• T-H
Sh
<U
■*— »
o
03
Oh-
io
si
60
a
o
. i-H
o3
00
• i-H
>
n
CO
r3
Sh
CD
O
s-
<
c3
S-H
o
o3 pfi
C O
b
c3
<
83 2s 1 SP •*
c « o «
-v — 1
X>
O
60
o
H
03
-*— '
O
H
o
c3
60
X)
o
Sh
O
c3
C
c3
Sh O
<D O
O
o
o
O .-H
o °
ST °
£ °
c/3
c3
. —
o
O
&
60
■4— »
60
O o3
<D
>
o
o3
• i-H
73
•c
■4— '
60
o
t 4
u
!
c3
o
•a
73
<D
eg
s
■4—4
O
0J
•4— <
o
60
73
• i-H
o
Sh
M-H
o
60
.
"a.
o
£
Z
c3
60
o\car^esvo<Nvo
£; Z; <n -h o o -h en
~* en ir> u~>
QQ-Hini^i^^Hm>n
Q Q «-h <N I (N I <N CT | on t>
^^OOOOOnOnGn
<h ^-< r- H i- H i — I i-H
r--ooqcooNOO^co
irihiniriinint^odh
qooHooqHoo«no\
inooN^q^trnocoos
-mZZZZ^ZZ
^■iri^rnrnioiri^in
^^■iriiriiriiriioirii^
ONcnoooNi-jONcnr^vq
t^ cn I 00 oq r^ oq cN ^t ; fN
0\CCO\0\0\0\COO\0\
OoooocncNCNoot^^H
^t^j-^0(N(N-H'N|-^Hin
Gd Cd
.y o
b
S-H
o
s:
• i-H
00
c
o
60
j g
< <
-° s
60 73
OD ^
W D W (^ ^ ffl P
3 ^
•t= o
o
C
03
73
C
00
u
o
60
a)
c
03
Oh 73
,03 a
c
c3
43
11
O
o
00
a
3
3
cd
O- bH
O ON
CO
c
-
O
o
E
o
X) ..
00
m
«+H
<u
P«H
c
tin
73
o
£
■—
o
o
73
■*— •
o
c
Q
Z
is
— a)
si a ^
u < Co
•»-H
CO g
^
The Normal Microbiota of the Human Gastrointestinal Tract 57
Table 2 Incidence of Bacterial Populations in Fecal Samples of Individuals from Countries with
High or Low Risk of Colon Cancer
High incidence
Low incidence
North American and
polyp patients
Bacterial population
(rc = 40-160) a
Japanese (n
= 10)
Africans (n = 4)
Bacteroides spp.
29.2 b
34.4
23.1
Bacteroides vulgatus
12.5
7.7
2.6
Bacteroides distasonis
4.0
1.7
0.9
Bacteroides thetaiotaomicron/
5.2
7.0
1.7
uniformis group
Bacteroides fragilis
2.3
3.2
8.0
Bifidobacterium spp.
7.7
7.8
1.8
Bifidobacterium adolescentis
4.3
6.1
1.2
Peptostreptococcus productus I
3.0
2.1
1.3
Peptostreptococcus productus II
5.7
2.2
1.9
Eubacterium aerofaciens II
0.8
2.7
9.2
Escherichia coli
0.5
1.0
4.6
Fusobacterium prausnitzii
5.6
3.4
3.5
a Incidence of colon cancer per 100,000.
b Percentage of isolates.
Source: From Ref. 40.
importance of investigating population dynamics and not merely population levels. For
more information on the influence of the intestinal microbiota and diet on the risk for colon
cancer, see the chapter by Rafter and Rowland in this book.
At this time (mid-1970s), researchers became concerned with the inherent variation
between the different populations and the possible impact this may have on interpretation
of the data (e.g., geographical, and genetic differences between the study groups).
Subsequent investigations concentrated on comparing dietary changes within cultural
populations. Initial work included comparison of two generations of Japanese living in Los
Angeles, one maintaining the traditional Japanese (low-risk) diet and the other having
adopted a high-risk Western diet (41). Interestingly, no statistically significant differences
were seen in the predominant genera of the fecal microbiota of the two groups. In addition,
though significant differences in the prevalence of certain species were observed between
the dietary groups, the average age of the two groups was also significantly different
(Table 3). So commenced the era of longitudinal studies, using individual subjects as their
own controls. One of the first such studies investigated the fecal microbiota of three North
Americans over several months and different dietary regimens (42). Greater inter-
individual variation (between different subjects) in species composition was seen than
intra-individual variation (between multiple samples from the same subject). Drasar and
coworkers (36) monitored volunteers' fecal habits and composition over a six- week period
(3 weeks on a conventional diet, followed by 3 weeks on a high-fiber diet). The only
significant changes corresponded to stool weight and transit times. Hentges and colleagues
(43) followed 10 subjects during baseline (1 month on a typical American diet; control), a
meatless diet (1 month), a high-beef diet (1 month) and control diet again (1 month). Three
stool samples were collected from each subject during the fourth week of each dietary
period. Bacteroides spp. counts were significantly higher during the high-beef diet than the
meatless diet (P<0.01). Similar statistically significant observations were, however, seen
58 McCartney and Gibson
Table 3 Summary of the Statistically Significant Differences Between Japanese Subjects
Consuming Different Diets
Japanese diet
Western diet
P value 3
Age (years)
60.30
41.3
0.013 b
Streptococcus faecalis var faecalis
9.83 c
8.46
0.038 b
Other facultative or aerobic organisms
7.20
4.75
<0.01
Eubacterium contortum
9.58
ND
0.033
Eubacterieum Intum
10.20
10.07
0.015
Bifidobacterium infantis other
ND
10.29
0.009
Peptostreptococcus sp. 1
10.53
0.033
Peptostreptococcus sp. 1-25
8.29
4.64
0.00 l b
a Based on contingency table analysis (Fisher's exact probability statistic).
Confirmed by Student's r-test.
c Mean logio counts per gram feces (dry weight).
Abbreviation: ND, none detected.
Source: From Ref. 37.
between the Bacteroides spp. counts of the two control diet periods. Perhaps a better study
strategy would have incorporated a control diet between the cross-over from meatless to
high-beef diets. Indeed, this work demonstrated that short-term cross-over design dietary
investigations may hinder identification of the effects of the different diets on the
microbiota. Studies incorporating either prolonged diet regimens (allowing the microbiota
to stabilize) or interspersed with control diet (enabling a return to baseline) may better
demonstrate the microbial impact of each diet.
Another important aspect in studies monitoring the microbial composition over time
and between subjects is the analytical method employed. For example, in the study by
Hentges and colleagues (43), the data were essentially averaged twice (first by subject,
then by dietary period). Such analysis is flawed due to the inter-individual variation which
negates significance observed intra-individually. Indeed, this was discussed by Cummings
(44), who concluded that overall changes in a group would be obscured due to inter-
individual variations using such analytical methods.
Overall, data from early cultivation studies have indicated that the major bacterial
populations harbored by individuals within a given society (i.e., Japanese, British,
American) are reasonably stable to species level (3,45). Intra-individual, as well as inter-
individual (even within a given society), subspecies variation has been documented in a
number of studies following stability of the E. coli biotypes in humans (46-50). As will be
discussed below, molecular fingerprinting techniques have demonstrated the complexity
and dynamics of the bifidobacterial and lactobacilli populations of healthy New
Zealanders (51,52). Such studies have highlighted the complex nature of the bacterial
community residing in the distal regions of the human GI tract, with variation observed
both in stability and in composition.
COMPOSITION OF THE ADULT FECAL MICROBIOTA
ASSESSED BY MOLECULAR TECHNIQUES
With the advent of molecular-based techniques, bacterial characterization has become
much more accurate, since it no longer relies upon phenotypic traits (which often vary
The Normal Microbiota of the Human Gastrointestinal Tract 59
due to the elastic nature of bacterial growth). In addition, more direct comparisons can be
made between laboratories and across different studies. Initial work employed molecular
methods to identify and/or discriminate different bacterial isolates from cultivation
studies. One such study demonstrated that the majority of bacterial isolates from six
healthy humans belonged to either the Bad. fragilis group or the Clostridium coccoides
group (53). Bifidobacterium, the Clostridium leptum subgroup, Collinsella and
Prevotella were also shown to be common phylogenetic lineages represented in healthy
humans. Recent developments in molecular biology afford not only accurate and
reproducible identification techniques for microbial isolates, but also strategies for direct
community analysis at a number of genetic levels. Improved understanding of microbial
taxonomy has generated a wealth of probing and polymerase chain reaction (PCR)-based
strategies for quantification and/or qualification studies. Community profiling assays,
including denaturing gradient gel electrophoresis (DGGE) and sequencing of clonal
libraries from GI samples, have revolutionized our knowledge of the microbial
composition of the GI tract.
The development and application of PCR-based methods and probing strategies,
which have circumvented cultivation, highlighted the "tip-of-the-iceberg" scenario that
our knowledge of the GI tract microbiota amounted to. The coverage that cultivation
studies afforded has been calculated to be as low as 10%, although others suggest it may be
as high as 40-58% (15,54-56). Modern cultivation media and incubation conditions
enable greater diversity, and therefore coverage, to be recognized. However, many
components of the human gut microbiota remain elusive to cultivation in vitro. Molecular
strategies also have their limitations, including detection limits and inherent biasing. As
such, the overall objective of the study generally determines which assay is most
appropriate. In the case of investigations to elucidate the diversity and dynamics of the
human gut microbiota, a polyphasic approach is best, allowing thorough analysis at
multiple taxonomic levels.
Microbiota Assessed by Clone Libraries and Community
Profiling Techniques
Two PCR-based profiling strategies have been used to obtain an overall profile of complex
bacterial communities — clone libraries and PCR-DGGE [or alternatively PCR-TGGE
(temperature gradient gel electrophoresis)]. Both utilize universal PCR primers to amplify
the 16S rRNA genes from total DNA isolated from samples.
Suau and colleagues (15) prepared a detailed phylogenetic inventory of the fecal
microbiota of a healthy 40-year-old male subject using PCR-cloning. A total of 520 clones
were obtained from two transformations of the same ligation product from the 10-cycle
PCR amplification (120 from the first and 400 from the second). The 282 clones that were
sequenced were classified as belonging to 82 molecular species, 20 of which corresponded
to bacteria previously cultivated from human stool samples (i.e., 24% corresponded to
sequences available in public databases). Three major monophyletic groups contained 270
(95.7%) of the 282 clones; the Clos. coccoides group (125 clones), the Baderoides group
(88 clones) and the Clos. leptum group (57 clones). The remainder of the clones were
distributed among a variety of phylogenetic clusters; two belonged to recognized
molecular species {Streptococcus salivarius and Streptococcus parasanguinis), whilst the
remainder were potentially novel molecular species. Most interesting was a lack of
bifidobacterial sequences amongst the clones analyzed (even though rRNA dot-blot
hybridizations indicated the carriage of bifidobacteria). Two possibilities could explain
this: (1) lack of amplification of bifidobacterial rRNA genes, due to DNA extraction
60 McCartney and Gibson
protocol, denaturation conditions during PCR, or amplification efficiency; and (2)
coverage of the biodiversity provided by the 282 clones was insufficient (coverage was
calculated to be 85%; thus, the probability that the 283rd clone was a different molecular
species from the 82 already observed was 15%). An investigation of the 25-cycle PCR
clone library was performed in parallel to this work, using the same subject (57).
Comparison of the 10- and 25-cycle approaches demonstrated that PCR cycle number
influences the diversity of the resulting phylogenetic profile. The clonal library obtained
from the 25-cycle PCR was less diversified than that from the 10-cycle PCR. However,
differences in diversity were seen between the two methods. That is, molecular species or
operational taxonomic units (OTUs) were present in the 25-cycle PCR clone library that
were not represented in the 10-cycle PCR clone library.
Previous work by Wilson and Blitchington (58) demonstrated somewhat similar
results, with 25 of 50 clones (50%) classified as Clos. leptum subgroup, 34% as
Bacteroides group and 10% as Clos. coccoides group. The disparity in the clostridial
representation of the different clone libraries most probably reflects either inter-individual
variations or disparity of the protocols. However, bifidobacteria were again absent from
the clone library. In addition, Eubacterium rectale was not covered in the clone library in
this earlier study, although Eub. rectale isolates were cultured from the same sample (58).
These data highlight the difficulty to approach full coverage of the complex microbiota
and further demonstrate that a polyphasic approach is pertinent. However, such work has
enabled identification of previously unknown components of the fecal microbiota, and the
sequence data can be used to develop new probing strategies to accurately quantify
such bacteria.
Work carried out as part of the European Union (EU) human gut microbiota project
using PCR clone libraries demonstrated that microbial diversity increased with age (57). In
addition, the percentage of OTUs corresponding to known molecular species was highest
in infants and lowest in the elderly subjects. Thus, not only was the microbial diversity
greater in the elderly subjects, but also 92% of OTUs were undescribed (potentially
novel) species.
The alternative to sequencing and subsequent phylogenetic analysis of clone
libraries is to employ TGGE or DGGE to separate the 16S rRNA gene clones. Such
techniques essentially provide a fingerprint representation of the numerically dominant
members of the microbial community and allow rapid profiling of the microbial diversity
of different samples (59). In addition, the TGGE/DGGE patterns can be used to selectively
identify 16S rRNA amplicons of interest for characterization (which is achieved by
sequencing and phylogenetic analysis). Recent years have seen an explosion in the
development and application of TGGE and DGGE in human gut microbiology (Table 4).
Zoetendal and coworkers (56) demonstrated the use of TGGE for monitoring the bacterial
composition of human fecal samples. They compared the PCR-TGGE profiles of 16
healthy adults and identified host-specific patterns reflecting inter-individual variation in
the predominant microbiota of stool samples. Some bands were seen in samples from
multiple subjects, suggesting that certain members of the predominant human fecal
microbiota were common across the volunteers (56). In addition, the study encompassed
longer-term surveillance of the microbial community of two subjects. The PCR-TGGE
profiles of each individual did not differ greatly with time, demonstrating that
the predominant bacterial species were relatively stable. Phylogenetic analysis of the
predominant bacteria was performed via cloning and sequencing. PCR-TGGE of each
clone enabled mobility comparisons and showed 45 of the 78 clones had similar mobility
to one of the 15 prominent bands of the fecal PCR-TGGE profile. This work demonstrated
that the majority of predominant bacterial species represented in the fingerprint did not
The Normal Microbiota of the Human Gastrointestinal Tract
61
bo
o
-O
o
cj
d
a
c
§
a
a
a
a
H
c
o
• i-H
4— '
cd
CJ
• H
.Q
(0
co
■4— »
CO
O
S-H
cd
>
o
c
o
. -H
4—1
cd
00
. —
■*-'
co
CJ
>
C
co
4—1
O
C/3
c
o
• i-H
4-J
Oh
O
Oh
4— '
CD
00
Sh
H
CJ
d
Sh
C4-H
<D
c4
.d
o
cd
CJ
73
CD
4-J
Cd
J-H
4— I
a
o
00
d
•iH
4—1
cd
^-< o
3-9
>
73
C
d
CD
<u
CO
o
pq cd
o §*
a 3
- i
0) cd
"Eh
I
53
cd
73
CD
cd
O
Oh
00
c
• i-H
d
X)
P-)
a
a
H
•—
.9 £
^^ CO
cd 73
£> -o
o
Jh
cd
CO
cd
CO
CD
4— >
'—
o
CJ
•s e
d
c
1 s
<D
. —
c
d
O
CJ
a)
c
CO
O-
S-H D
« to
53
>
c
£ -a
cd CO
73 J3
CD 00
fa 3
ll
Cd —i
-d cd
1.2
Jh
o
4— '
o
Cd
X)
CD
CJ
d
.CD
cd
d
73
d
C
? a
o
73
> cd CD
73
d
cd
>
S-H
cd
>
Jh
CD
>
O
cd
73 X>
CN
Jh
.O
>
• i-H
73
C
cd
4—1
CO
C
o
CO
cd
co d
~~ Jh
O
d
c
S h
si
Q&o
73 Hi
« s
2 a
^o
c3
CO
• i-H
C
C
CO
' 15
co
<u
3 _
h_, 73
** cd G\
4-J
• i-H
c
i
a
o
CJ
4— >
o
H
cd
GJ
'cd
73
c
4-4
CJ
O
N
CO
4— '
CJ
CD
's?
D
CO
^O
CJ
-C
4— »
tw
O
d
•I-H
c
cj
cj
CO
CJ
s-
CJ
CO
CJ
Oh
CO
d
c
CJ
>>
00
>% o
•a s .2
^3
co 53
CO
g i
Oh O
W o
O d
X CD
U CD
i CO
PSl CO
ft. g>
4-J
CJ
cd
o
73
S §
CJ
73
C
'—
Oh
0^
u
Cm
o
d
t>3
-d
00
CJ
4— I
CJ
£
CJ
4— <
4— <
cd
Oh
73
CJ
4— <
CO
'—
CO
>
CJ
Cj
Q
4—
Cj— i CO
w cj
O T -1
-4= 7-t
O
cj
CD C-t
73 P
53
>
o
d
o
• i-H
4—4
cd
•c
cd
>
C4-H 'rt
O 3
00 3
73
cj
Uh
u
IT)
c -d
CD
co
cd
d
73
• i-H
>
• i-H
73
CJ
cd
O
73
d ^
9 P
CO Qh
CO
4— »
CJ
d 'SP
° d
d co
cd cd
CO
Id >,
d ^
73 cd
•r" s-i
> CD
cd
*C
cj
4—1
CJ
cd
£>
O
73
cd
cd O
d ^
A
>
• i-H
73
d
• i-H
I
cd
CD
IT,
d S
73
d
cd
ij Oh
o -7
5-H
0J
d
CD
00
cj
5-H
CJ
.5 ^
o
CD
.« o
•S fa
d o
CA «H-H
"H o in
O cd u co
•r- -d -^
>> « d <D
• - B CD CD
5 cd O >
4--
v:
d
73
CO
cd
CO
o
CD
1 <
-d
cd
CO
cd
a
CD
•IH
d
a
d
•H
C+H
m
Ph
w
C< )
^O
cd
• iH
CD
4— <
CJ
cd
-O
O
73
cd
•H
CQ
o
cd
*-•
cj
•H
^d
o
4— <
cd
& td
U w
^ g
3 a
O co
cd CD
I CD
^ H Oh
CJ CO
cd
d
o
• -H
4-J
cd
° -d
cd
>
cd
d
73
• H
>
-d co
c d
•t 1 d
Jh O
4^ £
73
d ,
cd «g
d c
CD o
.2 -
>1
CD ^
J-,
CD
Id
B
4— > CD
"d Id
73 d
«» s
N ^
cd
■fi
4-<
cd oq
.a <
CJ w
cd
S-H
cd co .CD
CJ
Oh
CO
Oh d
Oh 7 Cd
2 y §
oo Cm -d
^o
CJ
53
B
O
CO
cd
-o
S
CJ
cd
-o 5
d
■-*
a
d
o
a
d
cd
.3 a
d *h
o g c3
'4 Ha 1
o- d -^
o o|
CD 73 •T'
^ .s
cd
d
o 5 - 1
5 ^ d
Oh On-d
CN
d oo
o d
CJ 1^ *-'
• -H 73 O
% 8 .&
a ^ ■§
cd 00 55
W •§
O d
Q g
Jh
O
+-H
o
-o
Cc< CD 3
p7 co co
Cm
•9 1 oo
CD ^ 'JB
oo oo -g
d c CD
° 73 S
o CQ ^ ^h
■^ 3 1 -a
O MH "G d
I
o
•—
Oh
d
o
co cd
d- 'd
d °
73 CJ
cd • jh
N .2
CN
73
d
* CD
co O
co c
CD CD
73^
cd 73
CJ
Jh
CJ
d
cd
cj
3 £
d C
00 *-h
c^
4-J
co o
■§ ?.
d ^
CD <£
8 y=
r P
•*-» Vh
CD CL
^ w
•d O
S Q
o T
^3 u
CD Cm
Jh ^
Jh 7T(
Cd O
S 4^
•-H .j-H
^H (h
CD 3
> *d
•d a
•-H . — .
CO c/5
o
Cm
Oh
a
c
CJ
d
cd
'—
43 H o
73 ^
CD -d O
Ch^OO w
d d 73
O CD
H >-» fa
00-^ ^
co d
d cd
° Sh
co cd
5h ih
cd d
Oh 00 _
73 'co -d
co co
id c
d cd
d a
d d
CD r-
M-) 00
o d ^3
cd cd
co U 4-»
cd C cd
o cd 75
73 oo d
c c §
-H -lH 3
d w
d U CD
_cd O ^
^^ Vh •*- J
a « 2
d 73 -o
M d >.
- CD 41^
g oo 'd
cd ^h cd
> CD .73
oj .d .a
pO CD co
o
oo
cd
73
d
cd
■si
O
CJ
• H
73
d
• H
>>
4-J
• H
5h
cd
13
d
d
CO
5-
cd
CJ
co VsO
d
CJ
o
CN
CJ CD
o 00
t: d
Oh cd
•i-H S-H
si w
CO
d
o
'CO
(30
d
CO
C4-
o
4h
13
Jh
o
d
... «>
CO CJ
cd d
d «
2 fa
Jig
5h '^h
Oh 73
CJ
-d
o
. -H
4-J
CJ
d
cj
cd
d
c
co
CO
oo
00 CD
O ^
CD
4— > — '
cj cd
c?+ a
>
n
X5
o
-H
U
Jh
4— '
( >
-H
•H
o
a
Oh
^^
a
cd
n
u
(i)
CJ
C+H
CO feH
c^ Oh
«D ^
C+H
° S d
d
73
^ Ih 73
o
cd
CN
cd
4—1
CJ
Id
73
d
cj
O
N
73
S
4>a
S
a
62
McCartney and Gibson
ft
s
r
■»*
*~
r
>^
tofi
o
o
o
G
o
C
cd
e
a
a
Q
w
a
a
H
c
o
• i-H
4-J
cd
O
• i-n
"a.
a>
.q
re
CO
4— >
CO
»H
cd
CD
>
O
c
c
• l-H
-4— >
cd
OX)
• l-H
4— »
co
cd
>
c
CO
4—1
o
a)
IE 5
00
d
c
• l-H
4— »
ex
o
o-
4— '
<D
W)
s-.
cd
H
a)
o
d
cd
S-H
«8
3
a)
Sh Sh
CD -O
cd
g
<D
d -G
<D £
CD "^
CO g
• !-H 1)
?-H CO
CD
4=5 dj
O C
cd CD
O ^
73 co
IS «
• •" '—
^ Oh
CO Q
2 Q
* ri-H
CO Qj
CD C
P4 CD
W 9
a a
^ co
Q &
03
.2 "°
c
• ^H
G
cd
CD
£
C
« d
■2 .a
a) -G
cA
<4-H
I
CD
X
T3
CD
4— '
g
CD
CD
Oh co
G CD
CO «
cd
O
a
c
CD
CD
Cd
d
o
G
CO
gp.S
d H
• d CD
CD
CD
CD g
a , c
° k -
^^ 03 cO
CO
CD
CD
CD
3
CO
O g
•^ d
or
CD
'CO
cd
CD
Ph
a 3
O CD
i 73
43 X
CO
4— » ^^
9 r
1 £
CN
4-J
• I-H
c
=5
C
CD
4— I
o
H
en
03
4— '
CD
U
CD
•l-H
>
03
Ph
T3
d
c3
d
o
•I-H
4— <
03
•!-H
o9
>
d
T3
•I-H
>
•I-H
c
•I-H
I
Jh
CD
PJ
a
a
Q
73
d
c3
d
o
• i-H
4— <
c3
CD
B
o
CO
-H CD
> -3
CD
^^ CO
"■* r-
§ 8
■S •-
a
^3
cd
73
cd
>^
03
73
W) d
d cd
>
d 03
CD
CO
>.
O
•—
o
>^
a *
a
CO
I -l-H
u 5
• S ,s
d *g
II
s a
O 03
03
c3
d
u >
^ '-3
d.a
c3
O
•I-H
T3
^^ d
1o 3
5-H
CD lO
o >,,
_h 03 ■*-•
.a -o -a
o o .5
.-H ■*-» ■— l
£ b d
c3 o o
d C 'Z3
>-. Ph O
73 d B
CD CD CD
CD T3
CO
d
O
-G
d
o
4— >
CD
- 4—1
»- CO
o
Oh
CD
d
c3
jd
o
Vh
c3
4— <
CD
•l-H
T3
O
3 .H 03
CD co
d -^
CD
4d
4^
c
JO
03
•c
03
CD
(D
O
»H
D- CD
CD
O
H
d ^j > co
U
^
d
c3
5<.
2 ^
top c3
.a ^
73 O
d CO
CX "d
co d
CD O
6 a
o m
d
o
d
J2 CO
• - a
■IE
3 *"-4
3 ^
C3
Q
d
.03
O
d
o
d 1)
03 *-*
bo.a
.a cd
73 c>C
CD
.-H Ch
03
03
CO
c3
co CD
CD O
o d
O 73
d o
CO £
13 .a
•i-H
y 2
03 .O
>^
i
Vh
CD
> "rd
03
4— 1
CO
T3
d
E>3
73
d
CO
jd
4— <
d
O
^O g
_, o _
d .§ s
8 a .^ o o
d O Jo w CN
^3
»H
CD O
> T3
73 g
>j O
=2 d
O
Cj
Q
"ft
ft
O co
2
'o
03
73
CD
d
CD
S-.9
CO
-d
4— >
d
o
m
CO
■*-»
03
(N
5-
■a
-o
Oh
1
5 I
d
ft
O
Co
O
ft
c^
^
"ft
OX)
d
•l-H
T3
d
13
d
•l-H
• I*«4
-ft
a
O
a
ft
Oh
CO
a
'o
R
ft
3
^1-
03
4— >
CD
W)
•l-H
•l-H
CD
O
CD
3
13
1 B?
ft G
** id
ft ^3
ft X)
kJ 03
^ 4— >
H-H CO
O ^H
a d
.2 "o
3 '!H
c3 >
i-H 73
^ d
d
c^
o ^
co
13 ^
.2 ^
CD rH
Oh.S
d
CD
CD
CO , ,
03 c3
U d
d *-3
Jh CD
Oh d
MP
U
Oh
^h 03
Ch • "
CD -jj
S .1
O co
!h
Cm ^
>,-d
co tJ)
Oh "d
o -d
4—>
d
03
CD
cd
• l-H
d
• I-H
CO
<u
'—
(D
03
c^
cn
o
O X)
CD
CO
03
d
o
. pH
4— '
03
^H
d X5
o
d
'CO
CD
'cl
s e
CD
>
•I-H
T3
3
ft
cs
-ft
ft
4—
ft
C3
CO
4— >
I
'-4—
d
73 2
d cd
1 b
-- cd
« >
cd cd
•E Ch
^5 d
in >
'-d CD
P °
b cd
Oh U
PJ
a
a
a
&
u -^
Ch d
>^^
o
CD
CD
2 -°
cd |3
co
cd
'CO
>^
CO
O-
O
d
d
o
CD
13
4— '
o
H
03
CD
.CD
d
O
. -H
4-J
cd
• pH
cd
>
CD
cd
O
CO
"o-
CD
'CO
•—
CD
>
'CO
d
cd
'—
CO
r-CD
c
•—
o-
03
O
•—
CD
cd
'CO
C
CD
d
a
T3
d
cd
cd
C/j
CD
»-H
• i-H
d
B
CD
"o-
CD
£
• *
CO
cd
CO
"d
o
CD
CO
CD
• i-H
'Ph
£
cd
O-
'Eh
O
•l-H
a
CO
-O
cd
>.
d
4—1
d
CO
O-
CD
O
cd
d
• i-H
•l-H
13
CD
.(D
M-H
a
o
>H
Oh
4— <
d
CD
U
Ph
<D
fc
a
*W) 73
a
d
• i-H
«+H
Q
C^
o
li -d co
y ^ cd
o
•—
Oh
cd 03
d
73
• i-H
>
• i-H
73
«* -d
co
Oh
O
.3 S
X5
o
Jh
d
CD
CD
.a to
£ 3
Ch
^C co
Oh •>-'
O- ^ -
Lo .« .a
«o JO co
S d CD
=2 co O
*r* r~i d
g S g 8
ft .5 -a £
CA
a
00
d
►*-] CD
toO^
d
d
ft
C3
15 s
CD It!
co X3 cd
M d
d
o
o .a
i
o
O
cd .d
73 ^
ft
• - s
CO ft.
w 03
co O
d .cd
o ^
03
13 O o Sh c3
o o 5b^ o
O g CD d •-"
3 X) u. cd -O
d
o
£
00
2
'o
4— '
d
^ ^^
• i-H •^~ s
■M r. CO
03 co CD
^^ 13
±i w d
73 C +H
T3 Oh
d d
cd O
. Jh
d
d
CO
d
II
d 5
o
H
io
cd
4— I
CD
13
d
CD
O
N
'co
u
c
D.
C
•—
— -
o
0)
CD
13
— <
c
t3
cd
i-
Sb
CD
•—
3
— i
u
CD
0)
— <
pq
a
a
H
c
_o
"4—'
O
cd
0)
■—
d
•a
o
0)
Cfl
cd
u
cu
a
p.
of
U
Ch
CO
0)
u
c
-C
Q.
O
•—
— <
CD
0)
13
— 1
C
CD
73
cd
•—
too
too
c
a
cd
C
CD
73
w
a
a
Q
s
C3
The Normal Microbiota of the Human Gastrointestinal Tract 63
correspond to known species. However, the 15 prominent bands were identified as
belonging within different Clostridium clusters. In addition, the common biotypes found in
virtually all subjects' TGGE patterns were identified as Ruminococcus obeum,
Eubacterium hallii and Fusobacterium prausnitzii (reclassified as Faecalibacterium
prausnitzii) (56).
More recent studies by this group have shown a positive linear relationship between
host genetic relatedness and the similarity index of PCR-DGGE profiles (Table 4) (62).
Higher similarity was seen between profiles obtained for monozygotic twins living apart
than that seen for married couples. In addition, similarity was highest between
monozygotic twin individuals than between pairs of twins. No correlation was shown
between similarity index and gender or living arrangements of unrelated individuals,
suggesting these factors did not significantly impact upon the bacterial composition.
Inclusion of samples collected from four different primates (chimpanzee, gorilla,
macaque, and orangutan) and subsequent analysis demonstrated that PCR-DGGE profiles
of unrelated humans showed significantly greater similarity than that between humans and
other primates. This work has indicated that host genotype factors have an important
impact upon the bacterial composition of the gut microbiota (62).
A number of studies have also evaluated the application of PCR-DGGE to monitor
the composition and dynamics of particular components of the human gut microbiota
(60,61,64). To date, such research has concentrated on the lactic acid bacteria (LAB), as
well as bifidobacteria. Each of these studies has displayed evidence of the ability to use
PCR-DGGE for group- or genus-specific investigations. Overall, these studies
demonstrated inter-individual variation within specific bacterial populations (Table 4).
Differences were seen regarding the dynamics of different bacterial groups over time:
fluctuations were seen in the LAB of two New Zealand adults over 6 months (61); the
bifidobacterial population of five Finnish adults remained relatively stable over 4 weeks
(60); Lactobacillus spp. PCR-DGGE of several healthy adults displayed varying stability
over 20 months (stable for certain individuals and more dynamic for others) (64). The
study by Heilig and colleagues (64) also monitored the lactobacilli diversity in one baby
boy, from birth to 5 months of age. No Lactobacillus spp. PCR product was obtained for
the first 55 days (suggesting this population was either absent or below the detection limit).
Subsequently, two prominent amplicons were seen to persist throughout the study period
(64). These were identified as belonging to the species Lactobacillus rhamnosus and
Lactobacillus casei. In addition, this work displayed bacterial succession of the
lactobacilli corresponding to the introduction of solid foods (~3 months of age), from
which time a third prominent amplicon was observed (Lactobacillus salivarius). Two of
these studies further investigated the usefulness of this technique in probiotic feeding trials
(61,64). Both groups demonstrated the ability to identify probiotic- specific amplicons
within the group- specific bacterial profiles.
Favier and colleagues (63) performed a pilot study with two infants investigating the
feasibility of DGGE profiling to monitor bacterial succession during the first
10-12 months of life. One infant was exclusively breast-fed prior to weaning, whilst the
other was breast-fed for a fortnight and then mixed-fed (both formula- and breast-milk)
until weaning. The results demonstrated a simple fecal microbiota initially, which
progressively diversified with time. Bifidobacterial amplicons were predominant in the
fecal microbiota of both infants during the first 6 months. Alterations in diet, such as the
supplementation of breast-feeding with formula-milk and introduction of solid foods
(weaning), was associated with changes in the bacterial profiles. The shift in bacterial
profiles seen following weaning, was more pronounced in the exclusively breast-fed infant
(compared to the mixed-fed infant) — although this may be a reflection of the relative
64 McCartney and Gibson
simplicity of the pre- weaning profile of this infant (compared to the more complex pre-
weaning profile of the mixed-fed infant, comprised of multiple dominant amplicons) (63).
PCR-DGGE has also been used to compare the microbial component of biopsy
samples taken from different regions of the colon, both with each other and the fecal
microbiota (65). Inter-individual variation was shown for both fecal and biopsy samples.
Interestingly, the biopsy samples taken from three distinct regions of the colon (ascending,
transverse, and descending colon) of the same individual provided extremely similar
DGGE profiles (total community). Significant differences were evident in the total
community PCR-DGGE of fecal and biopsy samples. This is by no means alarming, as one
can readily appreciate the distinction of the two ecological niches (i.e., the luminal
microbiota and mucosally associated community), and the numbers within the species are
likely to differ and result in different profiles. However, Lactobacillus spp. PCR-DGGE
patterns from fecal and biopsy samples were very similar in 6/10 subjects. Minor
differences were seen in the Lactobacillus spp. PCR-DGGE profiles of the different biopsy
samples from three of the 10 individuals. Overall, no differences were noted in the
mucosally associated lactobacilli of different individuals based on host health (i.e., healthy
versus diseased tissues).
In summary, molecular methods enabling community analysis of the human fecal
microbiota have demonstrated that a large proportion of the predominant microbial
component are novel or unknown species — which have not yet been cultivated. Inter-
individual variation and intra-individual stability are consistent features of studies of the
prominent members of the total community. However, investigations of specific bacterial
groups or genera indicate varying levels of stability, with fluctuations seen in some cases.
Host genetic factors appear to play an important role in the microbial composition of
healthy human adults, though it is as yet undetermined what impact bacterial acquisition
and succession during childhood plays.
Directed PCR Analysis
In addition to PCR-cloning and PCR-DGGE profiling techniques, PCR strategies have
been employed in gut microbiology for many years to investigate the presence/absence or
activity of bacterial groups, genera, and even species. Such methods were initially
developed for identification purposes but have subsequently been utilized for detection,
essentially allowing qualitative analysis of the microbial component of samples. Modern
developments in PCR technology now afford quantitative PCR assays (e.g., real-time
PCR), though the major application of such methods to date has been clinical diagnostics.
Wang and coworkers (66) developed 12 species-specific PCR primer sets to
monitor the predominant gut microbiota of humans {Bact. distasonis, Bacteroides
thetaiotaomicron, Bact. vulgatus, Bifidobacterium adolescentis, Bifidobacterium longum,
Clostridium clostridioforme, E. coli, Eubacterium biforme, Eubacterium limosum, Fuso.
prausnitzii, Lactobacillus acidophilus and Pep. productus). During validation of the
species-specific PCR assays, the sensitivity of each primer set was examined with DNA
extracts from pure cultures. Interestingly, such work demonstrated that PCR sensitivities
varied markedly. Following validation of the PCR assays, Wang and coworkers (66)
examined the presence of the bacterial species in fecal samples from humans (seven
adults and two infants), two BALB/c mice, two Fischer rats, two cats, one dog, one
rhesus monkey and one rabbit. High titers of Clos. clostridioforme, Fuso. prausnitzii and
Pep. productus were detected in all samples examined. High titers of Bact.
thetaiotaomicron, Bact. vulgatus and Eub. limosum were also detected in all adult
human samples, whereas the Bacteroides spp. specific assays gave either weak or no
The Normal Microbiota of the Human Gastrointestinal Tract 65
PCR products for infant samples. Bifidobacteria! levels were higher in human infants
compared to adults and other animals.
Similar research by Matsuki and colleagues (53) developed four group-specific
primer sets to monitor the predominant bacteria in human feces. These 16S rRNA gene-
targeted primer sets included group-specific primers for the Bact. fragilis group and the
Clos. coccoides group, and genus-specific primers for Bifidobacterium and Prevotella.
DNA extracts were prepared from fecal samples collected from six healthy adults (five
males and one female) and used for the group-specific PCR detection assays. The Bact.
fragilis group, Bifidobacterium and Clos. coccoides group were detected in all six subjects,
whilst PCR detected Prevotella in only two of the six subjects (53).
PCR techniques have also been developed for identification and detection of
bacterial isolates or components at species level. One bacterial group that has enjoyed
particular interest in this regard is bifidobacteria (67-69). Investigation of the distribution
of the nine bifidobacterial species known to be harbored by humans was performed by
Matsuki and coworkers (68), using fecal samples from 48 healthy adults and 27 breast-fed
infants. No Bifidobacterium gallicum amplification products were obtained from any
sample. In addition, no Bifidobacterium infantis products were seen from the adult
samples. The bifidobacterial species that were most consistently detected in adult samples
were Bifidobacterium catenulatum (44/48), Bif. longum (31/48), Bif. adolescentis (29/48)
and Bifidobacterium bifidum (18/48). Overall, 29 of the 48 adult samples contained three
or four different bifidobacterial species, with 17 of the remaining 18 samples comprising
less than three species. The majority of breast-fed infants harbored Bifidobacterium breve
(19/27), with a smaller proportion of samples containing Bif. infantis (11/27) and
Bif. longum (10/27; six of which were positive for Bif. infantis). Interestingly, three breast-
fed infant samples were negative with all nine bifidobacterial species-specific primers. In
general, breast-fed infant fecal samples were positive for three or less bifidobacterial
species (23/27).
Germond and coworkers (67) designed and validated species-specific primers for
human bifidobacterial species and then developed PCR primer mixtures which enabled
detection of multiple species concurrently (i.e., in a single reaction). PCR mix one
comprised species-specific primers for seven bifidobacterial species: namely,
Bif. adolescentis, Bif. angulatum, Bif. bifidum, Bif. breve, Bif. catenulatum! pseudocate-
nulatum, Bif. infantis and Bif. longum. Application of this PCR primer mixture with fecal
DNA from two healthy human adults demonstrated both subjects harbored Bif. longum
and Bif. adolescentis, whilst a weak PCR amplification product was also seen for
Bif. angulatum for one subject. Confirmation assays performed with the individual
species-specific primer sets indicated that Bif. bifidum was under-represented during
concurrent PCR analysis as amplification was positive for both subjects when single
species PCR was used but negative using PCR mix one.
Requena and colleagues (69) investigated the use of the transaldolase gene in
identification and detection of nine bifidobacterial species {Bif. adolescentis,
Bif. angulatum, Bif. bifidum, Bif. breve, Bif. catenulatum, Bif. infantis, Bifidobacterium
lactis, Bif. longum and Bif. pseudo catenulatum). These workers examined its application
for both PCR-DGGE and real-time PCR. Seven of the nine bifidobacterial species could be
differentiated by transaldolase gene PCR-DGGE; Bif. angulatum and Bif. catenulatum
displayed the same mobility characteristics. Examination of the bifidobacterial species
diversity in fecal samples using this method showed 6/10 healthy adults contained two
amplicons, one being Bif. adolescentis. In four of the six profiles the second amplicon was
Bif. longum, the fifth profile also contained an unidentified amplicon and the sixth profile
contained two Bif. adolescentis amplicons. One sample gave no PCR-DGGE product, two
66 McCartney and Gibson
of the remaining three samples contained Bif. longum, the final sample contained
Bif. bifidum. This strategy was also employed to assess the fecal bifidobacterial diversity of
10 babies. One sample gave no PCR product, 8/10 contained Bif. bifidum (one of which
harbored a second unidentified amplicon) and the final sample comprised Bif. infantis,
Bif. longum and an unidentified amplicon.
Comparison of bifidobacterial enumerations obtained from plate counts and
bifidobacterial-specific real-time PCR with either transaldolase gene primers or 16S
rRNA primers has been performed (69). Good correlation was seen between all
three enumeration methods when healthy adult samples were used (n = l).
Correlation of bifidobacterial levels in infant samples (ft =10) was better between
cultivation work and 16S rRNA gene real-time PCR than between cultivation work
and transaldolase gene real-time PCR. Under-representation of the Bif. bifidum
component of samples during transaldolase gene real-time PCR was largely
responsible for this discrepancy.
Probing Strategies
As well as affording design of PCR primers for specific bacterial populations, the
improved 16S rRNA gene sequence information has greatly enhanced the development of
probing strategies for gut micro-organisms. Two probing strategies have generally been
employed, namely, dot-blot hybridization and fluorescent in situ hybridization (FISH).
The nature of the 16S rRNA gene of bacteria also enables development of oligonucleotide
probes targeting different taxonomic levels, i.e., domain level (Bact 338), group level (e.g.,
Chis 150), genus level (e.g., Bif 164) or species level (e.g., Bdis 656) (57,70). The last
5 years have seen enormous development and application of these strategies in gut
microbiology (71-76).
A longitudinal study was performed with nine healthy human volunteers (five males,
four females) monitoring the fecal microbiota using FISH (72). The results demonstrated
that 90-100% of 4', 6-diamidino-2-phenylindol dihydrochloride (DAPI)-stained cells were
hybridized by the bacterial probe (Bact 338), and that the Clos. coccoideslEub. rectale
group (Erect 482) and Bacteroides group (Bfra 602 and Bdis 656) represented almost 50%
of the total bacteria of healthy humans. In addition, the Low G + C #2 group (Lowgc2P)
comprised 12% of the total bacteria, and Bifidobacterium (Bif 164) 3%. Initial data
indicated that the Clostridium lituseburense group (Clit 135), the Clostridium histolyticum
group (Chis 150), and the StreptococcuslLactococcus group (Strc 493) all formed less than
1% of the total bacteria and so were not included in the longitudinal study. In general, the
fecal microbiota of individuals was shown to fluctuate during the 8-month study.
Interestingly, the greatest variation was seen in the bifidobacterial component of the
microbiota. A more recent study from the same laboratory group employed a set of 15
probes to investigate the microbial composition of 1 1 healthy volunteers (73). Again, the
Bacteroides group (27.7%) and the Clos. coccoideslEub. rectale group (22.7%) were seen
to be the numerically predominant bacterial components. In addition, three other
predominant groups were identified: Atopobium group (11.9%), Eubacterium low G + C
#2/Fuso. prausnitzii group (10.8%), and Ruminococcus and relatives (10.3%).
Bifidobacterium (4.8%), Eub. hallii and relatives (3.8%), Lachnospira and relatives
(3.6%), and Eubacterium cylindroides and relatives (1.8%) were also dominant members
of the microbiota. However, Enterobacteriaceae, the Lactobacillus! Enterococcus
group, Phascolarctobacterium and relatives, and Veillonella were all subdominant (each
forming 1%). Taken together, this afforded 90.5% coverage of the total bacteria hybridized
with the Bact 338 probe. (N.B.: Eub. hallii and relatives, and Lachnospira and relatives are
The Normal Microbiota of the Human Gastrointestinal Tract 67
subsets of the Clos. coccoideslEub. rectale group, so were not included in summation).
However, a large proportion of the DAPI-stained cells (~40%) were not accounted for by
the Bact 338 probe. The question arises as to whether these cells are non- viable or
metabolically inactive (low rRNA), impermeable, or represent novel bacterial groups
whose 16S rRNA differs within the "conserved" region the Bact 338 probe targets or in the
secondary structure surrounding it.
Other research groups have developed and validated additional oligonucleotide
probes suitable for FISH, for potentially important members of the human GI tract
microbiota (75,76). Ruminococcus obeum-like bacteria have been frequently identified in
ribosomal clonal libraries of human fecal samples and the development of probing
strategies was thus considered pertinent (76). Following validation, the Urobe 63 probe
was used to examine the Rum. obeum group in three healthy Dutch males (three samples
were collected from each subject over one month). FISH enumeration was performed both
by epifluorescent microscopy and by flow cytometry (which require different handling and
thus different protocols). The two methods gave comparable results, demonstrating that
Rum. obeum-like bacteria comprise ~2.5% of the total bacterial count (Bact 338). A
further six individuals (two males, four females) provided stool samples and the results
were consistent in all subjects. In addition, counts of the Clos. coccoideslEub. rectale
group were made which indicated that the Rum. obeum group accounted for ~ 16% of
this group (76). Similarly, the Fuso. prausnitzii cluster has been shown in numerous
molecular analyses to be part of the dominant microbiota of healthy humans. As such,
Suau, and coworkers (75) developed an oligonucleotide probe for this cluster which was
applicable both for FISH and dot-blot hybridizations. Overall, 16.5% (range 5-28%) of the
DAPI-stained cells hybridized with the Fprau 645 probe (n= 10 healthy adults). Samples
from a further 10 healthy individuals were used for dot-blot analysis with the same probe
and showed the Fuso. prausnitzii cluster accounted for 5.3% of the total bacterial 16S
rRNA (range 1.5-9.5%). Unfortunately, these data are not comparable as different samples
were used for each assay. In addition, the two assays provide distinctive enumeration:
FISH provides counts of the number of cells in the sample (which can be represented as a
percentage of total bacterial (Bact 338) cells or total cells (DAPI), whereas dot-blot
provides an index of the percentage of total 16S rRNA the specific population forms.
The index obtained by dot-blot is further complicated as it is not only proportional to the
number of cells in the sample, but also the number of copies of the rRNA gene in each cell
and the activity of the cells.
Dot-blot analyses of the healthy human fecal microbiota using an array of probes
have, once again, highlighted the inter-individual variation (71,74). Both studies
employed six oligonucleotide probes to monitor the predominant bacterial groups. The
work by Sghir and colleagues (74) (n = 21 healthy adults; 13 males, 14 females) was
consistent with earlier work which showed that the Bacteroides group (including
Bacteroides, Prevotella and Porphyromonas; 37%), the Clos. leptum subgroup (16%)
and the Clos. coccoideslEub. rectale group (14%) were predominant, accounting for 67%
of the total rRNA. Bifidobacterium and the enteric group each made up less than 1 % of
the total rRNA, whilst the low-G + C Gram-positive group (including Lactobacillus,
Streptococcus and Enterococcus) represented 1% (74). Marteau and coworkers (71)
similarly demonstrated the predominant fecal rRNA (n = S healthy adults; four males,
four females) corresponded to the Clos. coccoideslEub. rectale group (23%), the Clos.
leptum subgroup (13%) and the Bacteroides group (8%) using the same probes as Sghir
and colleagues (74). Although, using different probes, this later study indicated higher
bifidobacterial and Lactobacillus! Enterococcus rRNA indices, 3% and 7%, respectively.
Interestingly, Marteau and coworkers (71) compared the fecal rRNA indices of these
68 McCartney and Gibson
bacterial groups and E. coli species with cecal rRNA indices. Overall, the indices for the
Bacteroides group and the Clos. leptum subgroup were significantly higher in fecal
samples than cecal samples, and the Lactobacillus! Enterococcus fecal rRNA index was
significantly lower than that of the cecum. The Clos. coccoides/Eub. rectale rRNA index
was higher in fecal samples than cecal samples, but the inter-individual variation meant
that this was not statistically significant. Concurrent cultivation analysis monitoring total
anaerobes, facultative anaerobes, bifidobacteria and Bacteroides demonstrated signifi-
cantly higher levels of total anaerobes, bifidobacteria, and bacteroides populations in
fecal samples compared to cecal samples (71).
Most recent developments in probing strategies include membrane- array and/or
microarray methodologies (77,78). The results of these assays were in agreement with
previous studies, demonstrating inter-individual variation in the fecal microbiota of
different healthy human subjects. The predominant microbiota of healthy humans
determined by the membrane-array technique (employing 60 oligonucleotide probes
targeting 20 bacterial species) included Bacteroides species, Clos. clostridioforme,
Clos. leptum, Fuso. prausnitzii, Pep. productus, Ruminococcus species, Bifidobacterium
species and E. coli (78). In addition, analysis of the fecal microbiota of an individual
suffering long-term diarrhea demonstrated a loss of a number of bacterial species common
to the normal microbiota of healthy subjects. These results were replicated in a microarray
study using the same probe array (77), where the probes were printed on aldehyde slides
rather than applied to membranes.
Overall, probing and PCR-based strategies have been shown to afford good coverage
of the predominant microbiota of the GI tract. This situation is likely to improve with
continued development of specific primer sets and/or oligonucleotide probes, particularly
in the light of increased diversity as elucidated by community analysis work. Indeed, such
community profiling studies provide excellent direction for the development of novel
probes and primers.
INVESTIGATIONS AT THE SUBSPECIES LEVEL
One aspect of gut microbiology that is not amenable to current probing or PCR-based
methodologies is subspecies differentiation (i.e., investigations of the microbial comple-
xity and dynamics below the phylogenetic level of species). A number of studies have,
however, demonstrated the importance of such research (48,51,52). One study monitored
the composition of the bifidobacterial and lactobacilli populations of two healthy humans
over a 12-month period (52). Overall, the bifidobacterial levels of both individuals were
relatively stable throughout the study period [~ 10 10 /g of feces (wet weight)]. Lactobacilli
levels were relatively constant in subject one (~10 9 /g) but fluctuated considerably in
samples from subject two (10 6 -10 9 per gram). Bacteroides and enterobacterial levels were
also examined during the study; the former remained stable for both individuals and the
latter displayed marked variability (especially in subject two, for whom numbers were
below the detection limit in weeks 17 and 20). Genetic fingerprinting techniques were used
to differentiate the predominant bacterial isolates of the bifidobacterial and lactobacillus
populations. Interestingly, two distinct bifidobacterial profiles were seen, with one
individual harboring a simple, stable bifidobacterial population (five distinct strains of
bifidobacteria were detected during 12 months, one of which was numerically
predominant throughout the study). In contrast, the second subject harbored a more
complex and dynamic bifidobacterial population (36 distinct strains were seen over the
The Normal Microbiota of the Human Gastrointestinal Tract 69
12 months, with between four and nine strains at any given time). The Lactobacillus
populations of both subjects were simple and stable. None of the lactic acid bacterial
strains isolated during the study were common to both individuals, further accentuating the
inter-individual variations of these two microbial ecosystems (52). Subsequent work from
the same laboratory extended these investigations to a further eight healthy humans (four
males, four females) (51). Two separate samples were collected and processed for each
individual. The results of this secondary study confirmed the findings of the former, with
bifidobacterial levels remaining relatively stable and Lactobacillus numbers varying
greatly. Again, each individual harbored unique bifidobacterial and Lactobacillus strains
(at least in regard to the numerically predominant microbiota). Intriguingly, half of the
subjects were shown to harbor a complex bifidobacterial microbiota (five or more
predominant strains).
McBurney and colleagues (48) examined the perturbation of the enterobacterial
populations of the initial long-term study by McCartney and colleauges (52). Similar to the
bifidobacterial populations of these two individuals, the enterobacterial population of
subject one was relatively simple and stable (predominated by a single strain) whilst
subject two harbored a diverse and dynamic enterobacterial biota (27 distinct strains were
identified over 12 months). As mentioned previously, enterobacterial levels were below
detection for subject two during weeks 17 and 20. This individual undertook a 7-day
course of amoxicillin for a respiratory infection during weeks 21 and 22, after which time
the enterobacterial population re-emerged. Most interesting, though, was the antibiotic-
resistance profiles of this bacterial group before and after treatment. Strains isolated prior
to antibiotic administration were susceptible to a wide range of antibiotics tested, whereas
strains isolated following treatment were resistant to a number of antibiotics. Thirteen
weeks after amoxicillin administration, multiple drug-resistant enterobacterial strains
were still present. In the following 2 months, strains resistant to ampicillin were still
harbored, and only after 25 weeks post-treatment did the predominant enterobacterial
microbiota return to a simple, stable, susceptible composition.
Taken together, the above-mentioned work clearly demonstrates the value of
investigations at the subspecies level, as such studies afford more detailed analysis of the
diversity and dynamics of the gut microbiota. Furthermore, such strategies allow the
detection of microbial perturbations which are often not evident at the bacterial group,
genus or species levels (79).
CONCLUSION
The normal microbiota of the human GI tract is a complex microbial community whose
composition is defined by a number of factors (including host genomics, diet, age,
bacterial succession, immune function and health status). In general, the predominant
bacterial groups are relatively stable in healthy human adults. However, inter-individual
variations are evident, reflecting the unique equilibrium of each person's GI ecosystem. In
addition, examination of the microbial populations in more detail (i.e., investigations at the
subspecies level) further demonstrates the complexity and dynamics of this bacterial
community, and most probably reflects its adaptive nature. Interactions between the host
and the gut microbiota have led some researchers to acknowledge that the human intestine
is, indeed, "intelligent" — based on Alfred Binet's definition of intelligence: "intelligence
is the range of processes involved in adapting to the environment" (13).
70 McCartney and Gibson
REFERENCES
1. Simon GL, Gorbach SL. Intestinal flora in health and disease. Gastroenterology 1984;
86:174-193.
2. Macfarlane GT, Cummings JH. The colonic flora, fermentation, and large bowel digestive
function. In: Phillips SF, Pemberton JH, Shorter RG, eds. The Large Intestine: Physiology,
Pathophysiology, and Disease. New York: Raven Press Ltd, 1991:51-92.
3. Tannock GW. An Introduction to Microbes Inhabiting the Human Body. London: Chapman &
Hall, 1995.
4. Mitsuoka T. Intestinal flora and human health. Asia Pacific J Clin Nutr 1996; 5:2-9.
5. Hooper LV, Midtvedt T, Gordon JI. How host-microbial interactions shape the nutrient
environment of the mammalian intestine. Annu Rev Nutr 2002; 22:283-307.
6. Holzapfel WH, Haberer P, Snel J, Schillinger U, Huis in't Veld JHJ. Overview of gut flora and
probiotics. Int J Food Microbiol 1998; 41:85-101.
7. Rabiu BA, Gibson GR. Carbohydrates: a limit on bacterial diversity within the colon. Biol Rev
2002; 77:443-453.
8. Guarner F, Malagelada J-R. Gut flora in health and disease. Lancet 2003; 361:512-519.
9. Blaser MJ, Kirschner D. Dynamics of Helicobacter pylori colonization in relation to the host
response. Proc Natl Acad Sci USA 1999; 96:8359-8364.
10. Coconnier M-H, Lievin V, Hemery E, Servin AL. Antagonistic activity against Helicobacter
infection in vitro and in vivo by the human Lactobacillus acidophilus strain LB. Appl Environ
Microbiol 1998; 64:4573-4580.
1 1 . Gibson GR, McCartney AL. Modification of the gut flora by dietary means. Biochem Soc Trans
1998; 26:222-228.
12. Marshall BJ. Helicobacter pylori. Am J Gastroenterol 1994; 89:S116-S128.
13. Bourlioux P, Koletzko B, Guarner F, Braesco V. The intestine and its microflora are partners
for the protection of the host: report on the Danone Symposium "The Intelligent Intestine," held
in Paris, June 14, 2002. Am J Clin Nutr 2003; 78:675-683.
14. Macfarlane GT, Macfarlane S, Gibson GR. Validation of three-stage continuous culture system
for investigating the effect of retention time on the ecology and metabolism of bacteria in the
human colon. Microb Ecol 1998; 35:180-187.
15. Suau A, Bonnet R, Sutren M, et al. Direct analysis of genes encoding 16S rRNA from complex
communities reveals many novel molecular species within the human gut. Appl Environ
Microbiol 1999; 65:4799-4807.
16. Moore WEC, Holdeman LV. Discussion of current bacteriological investigations of the
relationships between intestinal flora, diet, and colon cancer. Cancer Res 1975;
35:3418-3420.
17. Salminen S, Bouley C, Boutron-Ruault M-C, et al. Functional food science and gastrointestinal
physiology and function. Br J Nutr 1998; 80:S147-S171.
18. Metges CC. Contribution of microbial amino acids to amino acid homeostasis of the host.
J Nutr 2000; 130:1857S-1864S.
19. Gordon JI, Hooper LV, McNevin MS, Wong M, Bry L. Epithelial cell growth and
differentiation. III. Promoting diversity in the intestine: conversations between the microflora,
epithelium, and diffuse GALT. Am J Physiol 1997; 273:G565-G570.
20. Borruel N, Casellas F, Antolin M, et al. Effects of nonpathogenic bacteria on cytokine secretion
by human intestinal mucosa. Am J Gastroenterol 2003; 98:865-870.
21. Perdigon G, Maldonado Galdeano C, Valdez JC, Medici M. Interaction of lactic acid bacteria
with the gut immune system. Eur J Clin Nutr 2002; 56:S21-S26.
22. Tannock GW. The acquisition of the normal microflora of the gastrointestinal tract. In:
Gibson SAW, ed. Human Health: The Contribution of Microorganisms. London: Springer-
Verlag, 1994:1-16.
23. Bezirtzoglou E. The intestinal microflora during the first weeks of life. Anaerobe 1997;
3:173-177.
The Normal Microbiota of the Human Gastrointestinal Tract 71
24. Mountzouris KC, McCartney AL, Gibson GR. Intestinal microflora of human infants and
current trends for its nutritional modulation. Br J Nutr 2002; 87:405-420.
25. Salminen S, Gibson GR, McCartney AL, Isolauri E. Influence of mode of delivery on gut
microbiota composition in seven year old children. Gut 2004; 53:1388-1389.
26. Biavati B, Sgorbati B, Scardovi V. The Genus Bifidobacterium. In: Balows A, Triiper HG,
Dworkin M, Harder W, Schleifer KH, eds. The Prokaryotes. A Handbook on the Biology of
Bacteria: Ecophysiology, Isolation, Identification, Applications. 2nd ed., Vol. 1. New York:
Springer- Verlag, 1992:816-833.
27. Scardovi V. Genus Bifidobacterium Orla-Jensen 1924, 472 AL . In: Sneath PHA, Mair NS,
Sharpe ME, Holt JG, eds. In: Bergey's Manual of Systematic Bacteriology, Vol. 2. Baltimore:
Williams and Wilkins, 1986:1418-1434.
28. Edwards CA, Parrett AM. Intestinal flora during the first months of life: new perspectives. Br
J Nutr 2002; 88:S11-S18.
29. Salminen S, Bouley C, Boutron Ruault M-C, et al. Functional food science and gastrointestinal
physiology and function. Br J Nutr 1998; 80:S147-S171.
30. Kleessen B, Bunke H, Tovar K, Noack J, Sawatzki G. Influence of two infant formulas and
human milk on the development of the faecal flora in newborn infants. Acta Paediatrica 1995;
84:1347-1356.
31. Mitsuoka T, Kaneuchi C. Ecology of the bifidobacteria. Am J Clin Nutr 1977; 30:1799-1810.
32. Stark PL, Lee A. The microbial ecology of the large bowel of breast-fed and formula-fed
infants during the first year of life. J Med Microbiol 1982; 15:189-203.
33. Yoshioka H, Fujita K, Sakata H, Murono K, Iseki K. Development of the normal intestinal flora
and its clinical significance in infants and children. Bifidobacteria Microflora 1991; 2:33-39.
34. Boehm G, Lidestri M, Casetta P, et al. Supplementation of a bovine milk formula with an
oligosaccharide mixture increases counts of faecal bifidobacteria in preterm infants. Arch Dis
Child 2002; 86:178-181.
35. Harmsen HJM, Wildeboer-Veloc ACM, Raangs GC, et al. Analysis of intestinal flora
development in breast-fed and formula-fed infants by using molecular identification and
detection methods. J Pediatr Gastroenterol Nutr 2000; 30:61-67.
36. Drasar BS, Jenkins DJA. Bacteria, diet, and large bowel cancer. Am J Clin Nutr 1976;
29:1410-1416.
37. Finegold SM, Sutter VL. Fecal flora in different populations, with special reference to diet. Am
J Clin Nutr 1978; 3LS116-S122.
38. Hill MJ, Drasar BS, Aries V, Crowther JS, Hawksworth G, Williams REO. Bacteria and
aetiology of cancer of large bowel. Lancet 1971; 1:95-100.
39. Aries V, Crowther JS, Drasar BS, Hill MJ, Williams REO. Bacteria and the aetiology of cancer
of the large bowel. Gut 1969; 10:334-335.
40. Moore WEC, Cato EP, Holdeman LV. Some current concepts in intestinal bacteriology. Am
J Clin Nutr 1978; 3LS33-S42.
41. Finegold SM, Attebery HR, Sutter VL. Effect of diet on human fecal flora: comparison of
Japanese and American diets. Am J Clin Nutr 1974; 27:1456-1469.
42. Holdeman LV, Good IJ, Moore WEC. Human fecal flora: variation in bacterial composition
within individuals and a possible effect of emotional stress. Appl Environ Microbiol 1976;
31:359-375.
43. Hentges DJ, Maier BR, Burton GC, Flynn MA, Tsutakawa RK. Effect of a high-beef diet on the
fecal flora of humans. Cancer Res 1977; 37:568-571.
44. Cummings JH. Dietary fibre and the intestinal microflora. In: Hallgren B, ed. Nutrition and the
Intestinal Flora. Stockholm: Almqvist and Wiksell International, 1983:77-86.
45. Bornside GH. Stability of human fecal flora. Am J Clin Nutr 1978; 3LS141-S144.
46. Hartley CL, Clements HM, Linton KB. Escherichia coli in the faecal flora of man. J Appl
Bacteriol 1977; 43:261-269.
47. Mason TG, Richardson G. A review. Escherichia coli and the human gut: some ecological
considerations. J Appl Bacteriol 1981; 51:1-16.
72 McCartney and Gibson
48. McBurney WT, McCartney AL, Apun K, McConnell MA, Tannock GW. Perturbation of the
enterobacterial microflora detected by molecular analysis. Microb Ecol Health Dis 1999;
11:175-179.
49. Shooter RA, Bettelheim KA, Lennox-King SMJ, O'Farrell S. Escherichia coli serotypes in the
faeces of healthy adults over a period of several months. J Hyg 1977; 78:95-98.
50. Wallick H, Stuart CA. Antigenic relationships of Escherichia coli isolated from one individual.
J Bacteriol 1943; 45:121-126.
51. Kimura K, McCartney AL, McConnell MA, Tannock GW. Analysis of fecal populations of
bifidobacteria and lactobacilli and investigation of the immunological responses of their human
hosts to the predominant strains. Appl Environ Microbiol 1997; 63:3394-3398.
52. McCartney AL, Wenzhi W, Tannock GW. Molecular analysis of the composition of the
bifidobacteria! and lactobacillus microflora of humans. Appl Environ Microbiol 1996;
62:4608-4613.
53. Matsuki T, Watanabe K, Fujimoto J, et al. Development of 16S rRNA-gene-targeted group-
specific primers for the detection and identification of predominant bacteria in human feces.
Appl Environ Microbiol 2002; 68:5445-5451.
54. Tannock GW. Analysis of the intestinal microflora using molecular methods. Eur J Clin Nutr
2002; 56:S44-S49.
55. Vaughan EE, Schut F, Heilig HGHJ, Zoetendal EG, de Vos WM, Akkermans ADL. A
molecular view of the intestinal microflora. Curr Issues Intest Microbiol 2000; 1:1-12.
56. Zoetendal EG, Akkermans ADL, de Vos WM. Temperature gradient gel electrophoresis
analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities
of active bacteria. Appl Environ Microbiol 1998; 64:3854-3859.
57. Blaut M, Collins MD, Welling GW, Dore J, van Loo J, de Vos W. Molecular biological
methods for studying the gut microflora: the EU human gut flora project. Br J Nutr 2002;
87:S203-S211.
58. Wilson KH, Blitchington RB. Human colonic flora studied by ribosomal DNA sequence
analysis. Appl Environ Microbiol 1996; 62:2273-2278.
59. Konstantinov SR, Fitzsimons N, Vaughan EE, Akkermans ADL. From composition to
functionality of the intestinal microbial communities. In: Tannock GW, ed. Probiotics and
Prebiotics. Where are we Going?. Norfolk, U.K.: Caister Academic Press, 2002:59-84.
60. Satokari RM, Vaughan EE, Akkermans ADL, Saarela M, de Vos WM. Bifidobacterial diversity
in human feces detected by genus-specific PCR and denaturing gradient gel electrophoresis.
Appl Environ Microbiol 2001; 67:504-513.
61 . Walter J, Hertel C, Tannock GW, Lis CM, Munro K, Hammes WP. Detection of Lactobacillus,
Pediococcus, Leuconostoc, and Weissella species in human feces by using group-specific PCR
primers and denaturing gradient gel electrophoresis. Appl Environ Microbiol 2001;
67:2578-2585.
62. Zoetendal EG, Akkermans ADL, Akkermans, van Vliet WM, de Visser JAGM, de Vos WM.
The host genotype affects the bacterial community in the human gastrointestinal tract. Microb
Ecol Health Dis 2001; 13:129-134.
63. Favier CF, Vaughan EE, de Vos WM, Akkermans ADL. Molecular monitoring of succession of
bacterial communities in human neonates. Appl Environ Microbiol 2002; 68:219-226.
64. Heilig HGHJ, Zoetendal EG, Vaughan EE, Marteau P, Akkermans ADL, de Vos WM.
Molecular diversity of Lactobacillus spp. and other lactic acid bacteria in the human intestine
as determined by specific amplification of 16S ribosomal DNA. Appl Environ Microbiol 2002;
68:114-123.
65. Zoetendal EG, von Wright A, Vilpponen-Salmela T, Ben- Amor K, Akkermans ADL, de
Vos WM. Mucosa-associated bacteria in the human gastrointestinal tract are uniformly
distributed along the colon and differ from the community recovered from faeces. Appl
Environ Microbiol 2002; 68:3401-3407.
66. Wang R-F, Cao W-W, Cerniglia CE. PCR detection and quantitation of predominant anaerobic
bacteria in human and animal fecal samples. Appl Environ Microbiol 1996; 62:1242-1247.
The Normal Microbiota of the Human Gastrointestinal Tract 73
67. Germond J-E, Mamin O, Mollet B. Species specific identification of nine human
Bifidobacterium spp. in feces. Syst Appl Microbiol 2002; 25:536-543.
68. Matsuki T, Watanabe K, Tanaka R, Fukuda M, Oyaizu H. Distribution of bifidobacterial
species in human intestinal microflora examined 16S rRNA-gene-targeted species-specific
primers. Appl Environ Microbiol 1999; 65:4506-4512.
69. Requena T, Burton J, Matsuki T, et al. Identification, detection, and enumeration of human
Bifidobacterium species by PCR targeting the transaldolase gene. Appl Environ Microbiol
2002; 68:2420-2427.
70. Harmsen HJM, Welling GW. In: Tannock GW, ed. Probiotics and Prebiotics. Where are we
going?. Norfolk, U.K.: Caister Academic Press, 2002:41-58.
71. Marteau P, Pochart P, Dore J, Bera-Maillet C, Bernalier A, Corthier G. Comparative study of
bacterial groups within the human cecal and fecal microflora. Appl Environ Microbiol 2001;
67:4939-4942.
72. Franks AH, Harmsen HJM, Raangs GC, Jansen GJ, Schut F, Welling GW. Variations of
bacterial populations in human feces measured by fluorescence in situ hybridization with
group-specific 16S rRNA-targeted oligonucleotide probes. Appl Environ Microbiol 1998;
64:3336-3345.
73. Harmsen HJM, Raangs GC, He T, Degener JE, Welling GW. Extensive set of 16S rRNA-based
probes for detection of bacteria in human feces. Appl Environ Microbiol 2002; 68:2982-2990.
74. Sghir A, Gramet G, Suau A, Rochet V, Pochart P, Dore J. Quantification of bacterial groups
within human fecal flora by oligonucleotide probe hybridization. Appl Environ Microbiol
2000; 66:2263-2266.
75. Suau A, Rochet V, Sghir A, et al. Fusobacterium prausnitzii and related species represent a
dominant group within the human fecal flora. Syst Appl Microbiol 2001; 24:139-145.
76. Zoetendal EG, Ben-Amor K, Harmsen HJM, Schut F, Akkermans ADL, de Vos WM.
Quantification of uncultured Ruminococcus obeum-\ike bacteria in human fecal samples by
fluorescent in situ hybridization and flow cytometry using 16S rRNA-targeted probes. Appl
Environ Microbiol 2002; 68:4225-4232.
77. Wang R-F, Beggs ML, Robertson LH, Cerniglia CE. Design and evaluation of oligonucleotide-
microarray method for the detection of human intestinal bacteria in fecal samples. FEMS
Microbiol Lett 2002; 213:175-182.
78. Wang R-F, Kim S-J, Robertson LH, Cerniglia CE. Development of a membrane-assay method
for the detection of intestinal bacteria in fecal samples. Mol Cell Probes 2002; 16:341-350.
79. Tannock GW. Molecular assessment of intestinal microflora. Am J Clin Nutr 2001;
73:410S-414S.
4
The Intestinal Microbiota of the Elderly
Fang He
Technical Research Laboratory, Takanashi Milk Products Co., Ltd, Yokohama,
Kanagawa, Japan
INTRODUCTION
With the significant progress in medical science and health care, the average life expectancy
has increased by nearly three decades over the last century (1). The old (>65 years) and
the "oldest" ( > 85 years) age groups are the fastest growing subpopulation in the world,
especially in industrialized societies referred to as "aged societies." World Health
Organization (WHO) figures indicate there are currently about 580 million people in the
world aged 60 or older, and this figure is expected to rise to over a billion within the next
20 years (2).
It has been well known that many physiological functions, such as immunity and gut
function, in humans usually decline progressively with age after approximately the 30th
birthday (1). The elderly are an increased-risk population with high rates of morbidity
and mortality due to their susceptibility to degenerative and infectious diseases. A major
consequence of people living longer is an increased incidence in health problems. In fact,
industrial societies are now suffering from a sharp increase in medical costs to the age-
related infectious and autoimmune diseases, malignancies, allergies, and digestive problems.
Therefore, effective measures to redress the age-related decline (or imbalance) in
physiological function should be much sought.
The intestinal microbiota mediates many crucial events towards the protection or
alteration of health. This chapter summarizes the current knowledge and findings about the
intestinal microbiota in the elderly, although a limited but growing body of literature on
this subject is available.
COLONIZATION AND SUCCESSION OF HUMAN INTESTINAL
MICROBIOTA WITH AGE
The gastrointestinal tract (GI tract) serves as one of the biggest interfaces between the
body and the external environment (3). This GI tract is a highly specialized organ system
that allows us to consume food in discrete meals as well as a very diverse array of
foodstuffs to meet our nutrient needs. The organs of the GI tract include the oral cavity,
75
76 He
esophagus, stomach, small and large intestine; in addition, the pancreas and liver secrete
into the small intestine. The system is connected to the vascular, lymphatic, and nervous
systems to facilitate regulation of the digestive response, delivery of absorbed compounds
to organs of the body, and regulation of the food intake.
One of the characteristic aspects of the GI tract is the presence of numerous
endogenous microbes colonizing the surface of the GI tract throughout the life of the host.
It consists of a complex community inside the host, known as the intestinal microbiota.
In healthy adults, the intestinal microbial cells have been estimated to outnumber the
host's somatic and germ cells by a ratio of 10:1 (4). The development of this microbiota is
initiated during the birth process. The fetus exists in a sterile environment until birth. After
being born, the infant is progressively colonized by bacteria from the mother's vagina and
feces and from the environment. As long as nutrients and space are not limited, the
commensals with high division rates predominate, e.g., enterobacteria (Escherichia coli)
and Enterococcus appear. The succession of microbes in an infant' s intestinal tract also
depends on the feeding mode. The fecal microbiota of breast-fed babies has been found to
be relatively simple, usually exclusively dominated by Bifidobacterium (5). However,
recent comparative studies showed that bifidobacteria were the predominate fecal bacteria
in both group of infants (6,7). In bottle-fed infants, the count and frequencies of occurrence
of Bacteroides, Enterobacteriaceae and streptococci were significantly higher than those
in the breast-fed infants (6,7). After weaning, when solid food is consumed, the stools of
infants begin to shift to an adult-like microbiota: bifidobacteria decrease remarkably and
constitute only 5% to 15% of total microbes. The number of Bacteroidacecea, eubacteria,
Peptococcaceae and usually Clostridia outnumber bifidobacteria, while aerobic bacteria
such as E. coli and streptococci, which have been regarded as the predominant species are
always detected, but account for less than 1% of the total bacterial count. Lactobacilli,
Megasphaerae and Veillonellae are often found in adult feces, but the counts are usually
less than 10 7 per gram of feces. By the end of the secondary year of life, the microbiota
becomes more stable and resembles that of an adult (see also the chapter by McCartney
and Gibson). As the microbial population increases nutrients become scarce and the
intestinal niches become occupied with more specialized species with an advanced
symbiotic relationship between the host and microbiota. Once the climax microbiota has
become established, the major bacterial groups in the intestine of an adult usually remain
relatively constant over time.
The habitats of the intestinal microbiota vary in different parts of the human GI tract (8).
In healthy persons, acid stomach contents usually contain few microbes. Immediately after
a meal, counts of around 10 5 bacteria per milliliter of gastric juice can be recorded:
bacteria including streptococci, enterobacteriaceae, Bacteroides and bifidobacteria
derived from the oral cavity and the meal. The microbiota of the small intestine is
relatively simple and no large numbers of organisms are found. Total counts are generally
10 4 or less per milliliter, except for the distal ileum, where the total counts are usually
about 10 6 /ml. In the duodenum and jejunum, streptococci, lactobacilli and Veillonellae are
mainly found. Towards the ileum, E. coli and anaerobic bacteria increase in number. In
the caecum, the composition suddenly changes and is similar to that found in feces, and the
concentration may reach 10 11 per gram of content.
As more than 400 species have been estimated to reside in the colon of healthy
1 ^)
adults, which may attain population levels nearly as high as 10 /g in the colon and may
make up almost half the content by weight (8,9). This bacterial community is dominated
by strict anaerobes, and contains less facultative anaerobes with a rate of anaerobes and
aerobes as 1000:1. In accordance with the metabolic activity, the major bacteria present in
the intestinal microbiota of the healthy adult can be divided roughly into three groups (10).
The Intestinal Microbiota of the Elderly 77
Group one is lactic acid-producing bacteria including Bifidobacterium, Lactobacillus and
Streptococcus (including Enter ococcus), which may possess a symbiotic relationship with
the host. Group two includes putrefactive bacteria such as Clostridium prefringens,
Clostridium spp. Bacteroides, Peptococcaceae, Veillonella, E. coli, Staphylococcus and
Pseudomonas aeruginosa. Others are like Eubacterium, Ruminococcus, Megasphaera,
Mitsuokello, C butyricum and Candida, group three. Normally, near-stability exists in
these habitats and each person has an individually fixed microbiota as far as qualitative
composition is concerned.
The intestinal microbiota play an important role in normal bowel function and
maintenance of host health, through the formation of short chain fatty acids, modulation of
immune responses, and development of colonization resistance (8,10). These functions of
the intestinal microbiota are the consequence of the activities of the numerous intestinal
bacteria as a whole community with a well-organized structure built on the balance among
the various bacterial members. Therefore, the functions of the intestinal microbiota are
very sensitive to factors that can alter the structure of the intestinal microbiota
qualitatively and quantitatively such as aging, physiological state, disease, medication,
diet, and stresses.
Age-Altered Aspects of the Intestinal Microbiota
Normal aging is associated with significant changes in the function of most organs and
tissues, such as decreased taste thresholds, hypochlorhydria due to atrophic gastritis, and
decreased liver blood flow and size (11). The GI tract is no exception, and there is
increased evidence of impaired gastrointestinal function with aging (3,11-13). In the
GI tract of the elderly, the age-related changes include decreased acid secretion by the
gastric mucosa, and greater permeability of mucosal membranes which have been linked
to increase in circulating antibodies to components of the intestinal microbiota in elderly
subjects. Therefore, certain microbes which can take advantage of new ecological niches
are assumed to become predominant inhabitants, leading to a dramatic shift in the
composition of the gut microbiota upon age.
Although the knowledge about the age-related alteration of the human intestinal
microbiota is still limited, the structure of the intestinal microbiota in the healthy elderly
has been suggested to be different from that of the healthy adults. This phenomenon is
considered to be a result of aging, but it may also accelerate senescence.
As early as in the 1960s, the scientific attention has been focused to characterize the
intestinal microbiota of the elderly. In several works conduced in the different geographic
regions, reduced presence of bifidobacteria was often observed in the fecal microbiota of
the elderly compared to that of the healthy adults, as well as more putrefactive bacteria
Enter obacteriaceae, Streptococcus, Staphylococcus, Proteus and C. perfringens (14-17).
Mitsuoka and his colleagues (18,19) analyzed the composition of the intestinal
microbiota in the various stages of life and observed an age-dependent change in the
composition of the fecal microbiota. Bifidobacteria were less present in the fecal
microbiota of senile (65- to 85-year-old) persons than in those of younger adults, while
more lactobacilli and Clostridia were found in the fecal samples of the elderly.
Mitsuoka and coworkers (20) compared the fecal flora of the elderly (61-95 years
old) with healthy adults (31.8 + 6.6 years old) using optimized culture procedures for
members of the anaerobic microbiota. Total bacterial count, Bidifobacterium Veillonella,
Eubacterium were decreased significantly, whereas C perfringens and Lactobacillus were
increased significantly. Furthermore, the frequencies of occurrence in Bifidobacterium,
78 He
Micrococaceae was decreased, while those of C perfringens, other Clostridium sp., and
yeasts were increased significantly in the elderly compared with that of the healthy adults.
Using the same method, Benno and Mitsuoka (21) did not find significant differences
in Bacteroidaceae, Eubacterium, Peptostreptococcus and Megasphaera between the
healthy elderly and healthy adults. However, Bifidobacterium (Bif. adolescentis and
Bif. longum), Enterococcus were less in the elderly compared with the healthy adults, while
lecithinase-negative Clostridium and C paraputrificum were increased in the elderly.
Recently, non-culture-dependent molecular methods have been used to investigate
the intestinal microbiota (22). The advent of these molecular methods, which do not rely
on our ability to culture bacteria prior to quantification, allow additional information to be
gained on the gut microbiota as a whole. Another method that allows ecological analysis
without the need to culture the organism is that of community cellular fatty acid (CFA)
analysis. Numerous environmental factors affect bacterial fatty acid synthesis, but certain
signature fatty acids have been used to indicate the presence of specific groups of
organisms in soil and marine environments, and have also been used to study community
structure in human fecal samples.
Direct polymerase chain reaction analysis was performed on elderly persons' fecal
samples (22). Over 280 clones were generated and characterized by sequence analyses,
providing a molecular taxonomic inventory. Phylogenetic analysis showed that the
microbiota of the elderly was more diversified than that of younger adults. The proportion
of unknown molecular species was very high among the clones derived from fecal samples
of elderly persons. It is evident from this study that the fecal microbiota of the elderly
person is very complex. The microbial diversity of the intestinal microbiota appears to be
increased with age. This is in contrast to the microbial diversity of babies, which was
found to be extremely low: only nine species were detected within each clone's library.
Hopkins et al. (23) studied fresh fecal samples obtained from seven adults, five
elderly individuals, and four geriatric patients diagnosed with C difficile-associated
diarrhea. Selected fecal bacteria were investigated using viable counting procedures, 16S
rRNA abundance measurements and community CFA profile. The principal micro-
biological differences between adults and the elderly were the occurrence of higher
numbers of enterobacteria and a lower number of anaerobe populations in the elderly
group. Another important finding of this study was the lower number of bifidobacteria
observed in the group of elderly patients.
Hopkins and Macfarlane (24) isolated bacteria from fecal samples of healthy young
adults, elderly subjects, and elderly patients with Clostridium difficile -associated diarrhea
(CD AD). The isolated bacteria were identified to species level on the basis of their CFA
profiles with Microbial Identification System (MIDI, Inc., Newark, DE) (MIDI). While
Bacteroides species diversity increased in the feces of the elderly individuals,
bifidobacteria diversity dramatically decreased with age.
These observations indicate that aging may diminish bifidobacteria, and
significantly increase Clostridia, including C. perfringens, and allow a slight increase of
lactobacilli, streptococci, and enterobacteriacea. The total bacterial counts and
anaerobes/aerobes in the intestinal microbiota of the elderly are relatively lower than
those of the healthy infants and young adults.
Historically, bifidobacteria have been considered to be the most important
organisms for infants while lactobacilli, especially L. acidophilus, were considered the
predominant beneficial bacterium for adults (5). However, bifidobacteria have recently
been suggested to be more important throughout life as beneficial intestinal bacteria than
lactobacilli (25,26). These ecological studies on the intestinal microbiota of the elderly
indicate that bifidobacteria rather than lactobacilli are often decreased upon age. Although
The Intestinal Microbiota of the Elderly 79
some changes also happen upon age in other groups of bacteria, they are non-specific, not
constant, and very individual. Furthermore, a decrease in bifidobacteria has often been
observed in the intestinal microbiota of various young patients (23,27,28). Therefore, a
decrease in bifidobacteria in the intestinal microbiota could be considered as an important
hallmark for aging and disease of the human GI tract.
BIFIDOBACTERIA IN THE ELDERLY
Taxonomic Species Placement of Bifidobacteria! Microbiota with Age
Bifidobacteria have been known since Tissier (5) first described a species from the feces of
breast-fed infants, which was later named as Lactobacillus bifidus by Orla- Jensen (29).
Since that time numerous studies have been published concerning the ecology and
importance of bifidobacteria in the intestine of humans, especially in infants.
A new taxonomic system was established by creating the genus Bifidobacterium
with the description of several new species besides B. bifidum, which was the only existing
species at that time (30,31). This was followed by an increasing number of new species
isolated from humans and animals (32-35). The new concept of the genus Bifidobacterium
taxonomy including 24 taxonomic species was summarized in special chapters of
Bergey's Manual (1986). Currently, a total of 26 well-established taxonomic species have
been described, among which are nine species which have been found to be exclusive
residents of the human intestine. These are B. bifidum, B. longum, B. infantis, B. breve,
B. adolescentis, B. angulatum, B. catenulateum, B. pseudocatenulatum, and B. dentium.
Bifidobacteria appear between the 2nd and 5th day of life and continue to be one of the
most numerous bacteria, amounting to about 10 10 /g of wet feces. Many studies indicated
that each healthy adult has and maintains its own specific composition of Bifidobacterium
microbiota during his/her life (33).
Interestingly, the bifidobacterial composition of a human can progressively vary
with aging, both qualitatively as well as quantitatively. The predominant species of
bifidobacteria in the human GI tract can be differentiated to indicate various stages of life.
However, lactobacilli, another of the important genus of endogenous bacteria considered
to contribute to host health and well being, are changing only quantitatively, and do not
express an apparent species diversity upon aging of the host.
Bifidobacterium was found as one of the predominate bacteria in the intestinal
microbiota of both infants and adults (19,32). However, the species and biotype
composition of the fecal bifidobacteria progressively varied with increasing age. Species
typical for infants were B. bifidium, B. infants, B. breve, and B. parvulorum. Typical for
adults were four different biovars of B. adolescentis. B. bifidum and B. longum could often
be found in both age groups, but in lower numbers. B. adolescentis biovar b was the
most common Bifidobacterium in the microbiota of the elderly. The frequency of the
occurrence of B. longum was 71% for infants, 62% and 33% for adults and the elderly,
respectively. B. adolescents occurred 100%, 91%, and 79% in the elderly, adults, and
infants, respectively. These results have been supported by studies conducted by other
research groups (36,37). It was found that B. adolescentis and B. longum dominated the
bifidobacteria of healthy adults, which is different from the bifidobacteria composition
of infants.
Mitsuoka (20) consistently observed that B. adolescentis biovar. b was significantly
higher in the elderly, even when Bifidobacterium counts were similar among children,
adults, and the elderly. The number of B. adolescentis and B. longum in healthy adults was
significantly higher than those in aged persons. From 1829 fecal bacterial isolates from 15
80
He
healthy adults, B. adolescentis, B. longum and B. bifidum were found to be the
predominant species of bifidobacteria of these healthy adults (21).
He and coworkers (38) isolated 51 Bifidobacterium strains from the feces of healthy
adults (30-40 years old) and seniors (older than 70 years of age). The isolates were
identified to species level based on the phenotypic characteristics. The isolates from the
adults belonged to B. adolescentis, B. longum, B. infantis, B. breve, while those from the
elderly were B. adolescentis and B. longum.
Studies with molecular methods indicate a similar distribution of bifidobacteria
species in the various stages of life. In a study using a non-culture-based method using
PCR and denaturing gradient gel electrophoresis, B. adolescentis was found to be the most
common species in feces of adult subjects as earlier indicated in the studies with traditional
culture-based methods (39).
Fecal bacteria from healthy young adults, elderly subjects, and elderly patients
with CD AD were identified to species level on the basis of their CFA profiles with
MIDI. Species diversity was found to decrease with age. B. angulatum was the most common
bifidobacterial isolate in the healthy young adults. B. bifidum, B. catenulateum,
B. pseudocatenulatum and B. infantis were not detected in the feces of the elderly
subjects (24).
Human Bifidobacterium species were identificated by Mullie and coworkers (40)
with three multiplex PCRs. B. bifidum, B. longum and B. breve species were commonly
recovered in infants, while B. adolescentis B. catenulateum/B. pseudocatenulatum and
B. longum were predominant in adults.
Matsuki and coworkers (41) applied species- and group-specific PCR directly to
fecal samples and found B. catenulatum (B. catenulatum and B. pseudocatenulatum)
in 92% of adult fecal samples and B. longum, B. adolescentis and B. bifidum in 65, 60,
and 38% of the samples from adults, respectively. Comparison of species-species PCR
method with the classical culture method revealed that some species, most frequently
B. adolescentis, were detected by the direct PCR method but not by culturing followed
by species-specific PCR of the isolates.
The bifidobacteria in the intestinal microbiota of the healthy elderly is characterized
by a reduced species diversity as well as quantitative decrease. The bifidobacteria in the
elderly are characterized by B. adolescentis as the predominant species as well as a
quantitative decrease within the whole intestinal microbiota.
Mucus Adhesion of Bifidobacteria
The reason for the age-related decrease in bifidobacteria numbers is still not well under-
stood. Adhesion to the intestinal mucosa is regarded as a prerequisite for colonization by
microbes and induction of the healthy promotion by them. It has therefore been proposed
as one of the selection criteria for probiotic strains (42-45).
Ouwehand and coworkers (46) tested four Bifidobacterium strains for adhesion to
mucus isolated from subjects of different age groups including healthy newborns, 2- and
6-month-old infants, adults (25-52 years) and elderly (74-93 years). The tested
bifidobacteria adhered less to the mucus isolated from the elderly subjects compared to
those from healthy infants and adults. The results suggest that the physiological condition
of the mucus could be altered by aging, which can reduce the affinity spectrum of
the mucus to bifidobacteria from various origins. This may be a factor involved in the
decreased colonization of the elderly subjects by bifidobacteria and fewer species of
Bifidobacterium present.
The Intestinal Microbiota of the Elderly 81
Twenty-four Bifidobacterium strains were examined for their ability to bind to
immobilized human and bovine intestinal mucus glycoproteins (47). Each of the tested
bacteria exhibited its characteristic adhesion to human and bovine fecal mucus. No
significant differences were found among the taxonomic species. Among the tested
bacteria, B. adolescentis, B. angulatum, B. bifidum, B. breve, B. catenulatum, B. infantis,
B. longum and B. pseudocatenulatum adhered to human fecal mucus better than bovine
fecal mucus, while the binding of B. animalis and B. lactis was not preferential. These
results suggest that the mucosal adhesive properties of bifidobacteria may be a strain
dependent feature, and the mucosal binding of the human bifidobacteria may be more host
specific.
Fifty-one Bifidobacterium strains were isolated from the feces of healthy adults
(30-40 years old) and seniors (older than 70 years of age) and were tested for their ability
to adhere to the mucus isolated from the healthy adults (30-40 years of age) (38). The
strains isolated from healthy adults, and especially B. adolescentis, bound better to
intestinal mucus than those isolated from seniors. These results indicate that the
bifidobacteria isolated from the healthy elderly may pose a reduced affinity to the intestinal
mucus from healthy adults. These results suggest that the poor colonization of
bifidobacteria in the intestinal microbiota of the elderly may also be related to the
development of a less adherent Bifidobacterium population as well as the reduced ability
of mucus from this age group to facilitate Bifidobacterium adhesion.
Laine and coworkers (48) investigated 30 Bifidobacterium strains isolated from the
feces of the healthy elderly (> 80 years of age) Japanese and Finnish subjects. These
strains were tested for their ability to adhere to the mucus only isolated from their own
feces. The better mucus adhesion was observed in the combination of Bifidobacterium
from the elderly and their fecal mucus rather than that of probiotic bifidobacteria from
adults and the mucus from the elderly.
The enhanced adhesion of B. adolecentis from the elderly to their mucus may, at the
least, partly explain that B. adolescentis is a predominant species in the fecal
Bifidobacterium microbiota. Therefore, there may be an advanced symbiotic relationship
between B. adolescentis and the elderly. The replacement of the predominant species of
bifidobacteria upon aging of the host may be one of the important events by which the
intestinal microbes affect the homeostasis of physiological functions on the basis of
the important contribution of bifidobacteria to human health and well being.
Influence of Age-Related Decline in Immune Function and Influence
on Intestinal Bifidobacteria! Microbiota
Immunosenescence is defined as the state of deregulated immune function that contributes
to the increased susceptibility of the elderly to infection and, possibly, to autoimmune
diseases and cancer (49,50). When immunosenescence appears, the functional capacity of
the immune system of the host gradually declines with age. The most dramatic changes in
immune function with age occur within the T cells compartment, the arm of the immune
system that protects against pathogens and tumors (51-54). The fact that T lymphocytes
are more severely affected than B cells or antigen-presenting cells is mainly due to the
involution of the thymus, which is almost complete at the age of 60. The host is then
dependent on the T cells of various specificities, which eventually leads to changes in the
T cell repertoire. CD45RA + "native" cells are replaced by CD45RA — "memory" cells, and
a T cell receptor oligoclonality develops. At the same time, T cells with signal transduction
defects accumulate. Age-related T cell alterations lead to a decreased clonal expansion
and a reduced efficiency of T cell effectors functions, such as cytotoxicity or B cell
82
He
functionality. Decreased antibody production and a shortened immunological memory are
the consequence. Efficient protection of elderly individuals by suitable vaccination
strategies is therefore a matter of great importance (51,55). Perhaps of greater
consequence to interpretation of immunosenescence in the elderly is the decline in cell-
mediated immunity (CMI). This is particularly important with respect to combating
infectious disease, but also to tumor surveillance, since anti-tumor effects of the immune
system are almost exclusively governed by the cell-mediated component.
Interleukin (IL)-12 is a cytokine produced by mononuclear phagocytes and dendritic
cells that serves as a mediator of the innate immune response to intracellular microbes and
is a key inducer of cell-mediated immune responses towards microbes (56). IL-12
activates natural killer (NK) cells, promotes interferon (IFN)-y production by NK cells
and T cells, enhances cytotoxic activity of NK cells and cytolytic T lymphocytes, and
promotes the development of TH1 cells. IL-10 and IL-12 are two cytokines secreted by
monocytes/macrophages in response to bacterial products which have largely opposite
effects on the immune system. IL-12 activates cytotoxicity and IFN-y secretion by T cells
and NK cells, whereas IL-10 inhibits these functions.
Many studies indicate that Gram-positive bacteria and their cell wall components
are potent inducers of IL-12 for human monocytes, while the Gram-negative bacteria can
promote more IL-10 (57-60). Karlsson and coworkers (61) also reported that Gram-
positive bacteria B. adolescentis, Enterococcus fecalis, Lactobacillus plantarum,
Streptococcus mitis can induce more IL-12 production by mononuclear cells from cord
and adult blood compared to the gram-negative bacteria, Bacteroides vulgatus,
Escherichia coli, Pseudomonas aeruginosa, Veillonella parvula and Nerisseria sicca. In
contrast, more IL-10 was secreted by the stimulation of mononuclear from cord and adults
with Gram-negative bacteria instead of gram-positive bacteria.
Furthermore, He and coworkers (62,63) characterized the ability of bifidobacteria to
affect the production of macrophage-like derived cytokines with a murine macrophage-
like cell line, J774.1 (Fig. 1 and Table 1). B. adolescentis and B. longum, known as
adult-type bifidobacteria, induced significantly more pro-inflammatory cytokine secretion,
IL-12, and TNF-a by the macrophage-like cells than did infant-type bifidobacteria,
c
50.00 r
40.00 -
30.00 -
20.00 -
10.00-
0.00
□ Adult type bifidobacteria
■ Infant type bifidobacteria
p<0.01
TNF-a
IL-12
Tested cytokine
Figure 1 Cytokine production by a murine macrophage cell line J774.1 after exposure to adult-
type bifidobacteria (B. adolescentis and B. longum) and infant-type bifidobacteria (B. bifidum and
B. breve, B. infantis). Abbreviations: IL, interleukin; TNF, tumor necrosis factor.
The Intestinal Microbiota of the Elderly
83
£2*
1
"oft
c_
(N
^H
1
l-H
^
|
W)
Oh
O
^H
1
l-H
^-^
£
W>
3
VO
i
l-H
^^
|
"oft
sS?
CQ.
T-H
d
C
•l-H
/ y— v
03
1— *
•fa
1
on
W>
g
_C
s
«
*»»«ii
|
k
Ph
vnj
z
H
"Q
o
~v3
CQ
O
■4— >
<D
5-H
3
g
(Z3
W>
O
Oh
X
o
PJ
?H
<D
<4-^
«c
<
<Z)
i «
^■^
<D
u
'-<
d
^t
c.
r-»
a
r--
•^
•— s
H
>^
■4— >
OO
X)
C
o
•4-i
<&
u
o
D
00
C/3
<d
0)
i
• 1-H
03
M
C
o
M
-4—"
<d
>^
• ^H
u
o
CD
D-
00
(0
d
1-
Z
hw^tnoo)fn^H^ H H\qooH\q^f f iNt s ;oo(nn\o^;Ni s ;
cocnrHcJriHNHrirHincnoo^o^^cndcoNdodcii-rHrHd
+1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1
CN CN CN CN CN CN ^h^h^h^h ,— i CN cn CN
cn rf o
^
o i> o — cn m on
^h f-- CN (N CN i— i i— i
+1 +1 +1 +1 +1 +1 +1
in oo in vo oo r- oo
O <N (N
. in
VO VO VO On
<N -h
oc
00
r^ininr^cncnr^in
■* ^ h \d n vi in <n
+1 +1 +1 +1 +1 +1 +1 +1
in cn vo in cn
CN
rf r-
cn
in
voincnincN^t-r-vo
h h ^ -t cn cn cn
CN On cn vO On 00 CN
^ i ^c^^o\a;in^qoofnrHio^fnQ'H'H| r jvqt^^a;f f |oo r j cs j
^ododH^in'in'incoin'^oc'iHHciHr^tsHoit^Hoo^ONHH
+1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1
ONCNcNO\cNONvor^^o\cncNcocNt^cnooovooNO^l-'xi-r---oocNvci
voo^ooocnincNOoovooNcn»nocNcNcnvocn^cncno^vot^r^
md^^oidmONhain'oddhNWin^^hri^mooind
r~cNr--'^--^-incncninin'^--HOcN'— ioONcnooooooor~- i or--oo'0
•n ^ o in o
H H rH H (S
+1 +1 +1 +1 +1
»n in r-; cn r-;
CN 00 t-^ 00 CN
00
r-
*-H OO
m
On
On
o
—
in cn
00
cn
— H
+1
+1 1
1 +1 +1
+1
+1
+ 1
00
T— 1
'sj- cn
in
T—t
rh
VO
o
in cn
00
T ~ '
On
CN
NO ^ t-^ 00 On
in ^ cn cn cn
+1 +1 +1 +1 +1
cn cn cn oq r~;
cn 'vj- -^j- cn — <
^
CN
00
O-
CN
cn
i— i
CN
+1
+1
+1 1
f-
^H
ON
^"
m
VO
cn
i
'
— -i
i— i
00
a.
Tt oo
OO On
^HOOONcncnoooocnooNNOin^i-ON'sfNO^©
vo^HT^-cNCNcNcncNcNOcNin-^-'vt-^tTfcncncn'^i-'sf^tOcNCN^Hcn
+1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1 +1
VO
— -cncnvocNONcnvooocNONr--invo^i-in— ^ooNcncnvovo
r-vocnoooo\OOooooN'^-r^cn — ooncnonvooo-^--— •
— < 00 On
in ^ oo
cnONONOOONOoooo-^-O'^i-
i—i cn cn cn ^ cn cn ^ — <
cN-HOcnoocNr~-oooN— ■
NO)M(Shhhhh(n|
vo in r- Ov o
i-H i— i m cn , ^-
3'3<££££<£££<£ £ £ £ £ £ £ 3 3 «S « «S
C3 C3 "H -i-l --H .i-l •— --H .iH -iH O O •— •-* '-H •— O O O •— "H O W C5 •— •" "-I
>^ >. .a .a .a .a .a .a .a .a «S ^2 >,>,>,>. ^2 <£ & >> >» «s >^ ^ .a .a .a
•S -S bJ)0D0Dti00X)0i)ti00X)-^^-£'S-S-£ -^ ^ -^ -S « ->. -S -S OOODOO
1313 <u <u i) i> d a> <u o .a ,a T3 ^ i 13 .a .a .a s s .a « s i> d <u
ffiK<<<<<<<<QQffiKffiffiQQQKKQKffi<<<
^t-inooo— -cnvor~oooN-^^^ooinvor~r~t^oovooor~-oooN^t-in'^i-
oo^cNCNcNcncncncnooo-H^H^-.o-H^-ooooo-H^cN
i^r--r-t^t^r^i^(^ONt--^H^H^--H^H^.cNCNCNONONVovovovovoin
cNcNcNcNcNcNcNcNcNCNincncncncncncncncncNcNcNcNcNcNcNcn
OUUUOUUOUOUUUUUOUOUUUUvJUUvJO
6a
6a
6a
6a
>I
6a
6a
6a
6a
6a
*~-
**
v*
+■*
■*-*
**
*~-
**
•>--
*-i
K
e
K
s
e
C
K
C
C
K
^j
^
'i.
^3
^
^3
^j
*j
^3
^j
VJ
VJ
VJ
VJ
VJ
o
VJ
: ^
VJ
VJ
6a
6a
6a
ua
6a
6a
6a
6a
>i
ua
^
*)
^j
*J
'^j
^
^
'^
<*}
<W
A J5 Jvj ^ _o o
"« "Q ~« "^3 "Q >• >
Q "3 Q v^ "3 Q v3 Q Q Q Q-C5-Cj-Ci-C5-Ci-C5-C)-C>-5s
&a
6a
:^2
a s s s s
60 50 OO Oo OO
K s c s e
VJ VJ VJ VJ VJ
CQI^CQCQI^I^CQI^CQCQI^CQI^I^I^I^I^I^CQI^I^CQCQ
2 *,
& 2
. o
CQ U
(Ncn^j-invor-oooNO
cNcn^i-invor~-oooNO'-HCNcn'^-invor-
hhhhhhhhMMOCJMMNM
a-
(N
7D
CN
60
r^
a.
cn
V
a
i
HH
7D
C
vo
col
i
HH
I— I
•—
a
— -
O
— '
Q
c3
• —
c
— <
o
t__
CQ
C
'—
O
CD
c
C
s
CD -^
*-» 3
^ •« ^
fa °
CD 5 M
09
C3
•—
W9
13
o
cd L. -jo
oc E; ^
6a
K
*3
r^
84
He
m
|
o
CO
QJ
• i-H
o
qj
Oh
o
• i-H
§
>
QJ
=1
o
Oh
X
W
<
CO
U
f-
X)
c
o
• i-H
QJ
o
QJ
C/3
or
QJ
C
• i-H
o
CM
0)
.Q
(N
i-H
o
i-H
00
w
CO.
J
61)
8
Ph
z
c
• i-H
■<— '
CO
QJ
• i-H
O
QJ
Oh
CO
V)
Tt"
•
I-H
On
co
I-H
I-H
+1
+1
+ 1
+
on
On
^t
,— i
o
CO
CN
^H
VO
^H
On
CN
r^
^O
(N
NO
r-»
o
i-H
1-H
CN
On
d °^ m'
1
+1
CN
i-H
m
i-H
+ 1
+1 -II
m
0>
in
NO
in
no
CN
m
i-H
^d
CO
i-H
i-H
On
no
CN
|
(N
i-H
c3
oq
CO
in
oo
CO
On
CO
OO
d
m
|
+1
+1
+1
+1 +1
(N
ON
od
o
CO
On
On
CN
On
CN
no
oo
no
•
CN
i-H
i-H
r "~ l
fib
a-
b0
D-
f-
Tt
_^"
o
CO
d
1 — 1
'-J
1
^
^r'
i-H
r^
r-
W)
+1
|
+1 h-I
+1 -II
Ph
in
^f
VO
m
(N
CO
^o
VO
>n
CN
06
V
^
in
i>
On
8
1
z
H
a
(N
i-H
CN
O
O
^T*
NO
•
00
m
•
CN
l-H
i-H
^t
CN
O
i-H
NO
+1
+1 -II || ||
cd
^O
CN
^
>n
I-H
O
1
CN
O
On
O
CO
in
J
00
2
On
\6
On
00
l-H
CN
i-H
CN
-: Detectable limit foi
r necrosis factor.
o
i-H
m
CO
(N
NO
an (SD); -
TNF, turn
0) . .
S .9
*> -3
* i
T3 1h
QJ S
1/3 _-
K
a) .a
*H
£
QJ >3
Su
03
S K
• »■«
3
i
GO
ts we
iatio
|
£
K
►s
~£ ^
Q
Q
*0.
"O.
C/3 ~
0) "Q
CQ
CQ
CQ
CQ
CQ
CQ
C^l
The Intestinal Microbiota of the Elderly
85
OX)
Oh
a
a
•c
o
+->
O
03
— '
O
D
CO
C/5
3
<
4— »
o
c3
•—
3
cc
o-
X
PJ
s-
<L>
<£
03
CO
a)
U
CN
i
C
o
u
x>
a
_o
<D
'—
O
a)
oo
I
>— <
73
3
c3
i
73
a
c3
OS
U
(N
i
C
o
03
u
"C
4-J
O
c3
CQ
73
O
<
4— '
o
c3
3
_o
"co
<D
73
<
CO
.Q
CO
00
I
OD
3
o
•<— I
aj
•—
o
i
a)
o
73
4—1
o3
_>
■4— '
o
cd
c
o
1
>
co
a)
o
CD
4— l
03
_>
'■4—'
o
o3
3
D
O
>
>>
■8
>
<D
-C
73
<
g
'5b
'G
O
E
03
d
cD
Oh
C/3
c
o
03
•—
*— i
C/3
o
73
in
3
co
^^^
+■*>
+1
VO
O
CO
CO — -
vd in
co r-
+1+1
CN O
CO "~
+1
CO
o
+1
©
r--
©
+1 +1
+1 +
+
+1 +1
+1 +
+
+
+1 +1 +1 +1
+1
+1 + +1
+
73
C
e
_S-C
'o3
Q
73
C
'o3
Q
73
C
_S-H
'o3
Q
73 T3
O O
J-H '—
c3 03
Q Q
73
O
,o
S-
03
Q
-a
o
,o
<4-H
S-
03
Q
a) <u
3 a
4—1 '
C/5 <*)
CD fli
4— < 4— <
c c
O c
03 03
s s
o
C
• pH
4—1
|
3
X
d
4—1
o
c
03
I
X
6<a
I
CO
CO
o
65
s
I
6?
5j
65
65
S
65
65
65
65
s
65
S
a
s
•s
6rj
6«]
65
c
■ -H
3
73
<
65
7§
55*
CD
d
■ -H
4—1
3
73
<
<D
3
•—>
3
• ^~
4—1
C/3
73
O
4—1
3
,0
3
•^H
4h
"""
4—*
>^
4—1
r
3
S-H
03
73
03
«H-H
<
Q
I— I
*--
K
^
^
65
CJ
"*^
65
65
65
a
■s
■S
Q
a
Q
^J
in
co
o
•~J
CN
o
o
U
Kj hj
On CO
O O
Tt in
o o
U U
«>J
in
o
-J
in
o
Kj Kj
CO
o
CO
in
o
o
-J
CN
o
o
^
CO
o
o
CQ CQ
CQ
Bo
o
in
—1
U
U
H
<
o o
CN CN
U U
% %
CQ CQ
1 vO
o o
^h on
in <N
U U
86
He
7?
^<
*-.
s
3
•c
j— -
CJ
PQ
73
O
<
O
4-J
o
c3
O
CO
O
X
W
•—
00
s
Oh
r±i
s *^ /
d
o
CO
•«-H
■4— 1
•— -^
<D
<1)
Vh
u
o
CO
CN
VO
O
o
1
rt
HH
U
C
o
4-J
u
00
00
i
»— <
73
C
c3
N£>
i
H-l
I— (
73
C
c3
CO
13
U
(N
6
o
a
U
c3
•c
4—1
O
73
o
<
CJ
• y—t
4— >
CJ
c
o
CO
O
<
CO
0)
.Q
re
60
O-
d
o
•f-H
4— <
o
■—
o
o
;o
00
I
-J
CO
13
o
-a
CD
4— <
>
4—1
CJ
d
co
13
CJ
CD
03
>
CO
13
CJ
73
CJ
4— I
>
•»-H
4— <
CJ
C3
d
CO
13
CJ
CD
03
>
>.
•S
CJ
>
CO
CJ
-C
•a
<
a
•i-H
W)
s—
o
CJ
E
c3
a
CO
CJ
CD
CJ
Oh
CO
co
en
+1
CN
m
in
+1
oo
in
no
o
+1
in
ON
CO
en
+1
ON
ON
o
OO
+1
+
oo
CN
CN
CN
nC
o
o
(N
+1
+1
in
r--
On
oo
<N
+1 +1
+1 + +
+ +
+1 +
+
+1 +1 +1 +1 +1 +1
CJ
d
■ -H
4—1
CO
CJ
c
.03
73
O
,o
5^
!—
03
Q
a)
d
• —
4—1
CO
CJ
3
-a
<
(1)
(D
d
4— <
CO
CJ
■J *
73
O
d
• —
co
CJ
4—1
r
O
d
. —
<-f— i
•■■"
-4—*
>>
4—-
r-
d
03
73
03
'■4—
<
Q
>— <
0) CD
d d
4— I — '
CO CO
CD CD
4— ' 4— >
d d
d d
<4— <4-<
d d
CD
d
■ -H
4—1
CO
d
.3
CJ
d
■ -H
4—1
CJ
d
.03
73
O
u
03
Q
73
O
=42
■—
03
G
73
O
b
03
G
CD
4—1
CD
d
d
&5
oq
B
g
~
g
g
g
g
g
a
s
s
a
S
s
s
s
c^
zc
CC 73
73
'^3
73
'73
---
a
o
">~1
-C3
-C)
-Ci
-Ci
-Ci
-G
cq
CQ
CQ
CQ
CQ
CQ
CQ
w
^
^
^
'-
■r-
■r-
^
^
^
^
^
^.
k,
k,
k,
-Ci
-C}
-Ci
-C}
s
■S
s
ft,
CQ CQ CQ CQ
i
OO
r-
oo
On
—- <
oo
in
NO
o
6
d
o
o
o
O
O
o
—
— —
— —
ON
vo
V£>
N£>
— H
—
—
^h
— —
(N
(N
(N
(N
en
en
en
en
en
d
U
U
u
U
U
U
U
U
U
C3
§
S
S
^
s s
s s
S
/)
H
H
H
h-
H
H
H
H
H
o
en
U
H
CN
en
oo
en
U U
H
H
On
CN
en
U
CQ
H
o
o
CN
U
CO
s
C^
•^H
g
b0
«
c
c
s-
#
CJ
o
o
CM
'-4-H
c
d.
o
C
—
c
• ^H
4— 1
^" "N
CJ
_CJ
+
O
+
u
+
CJ
N ^
CO
. r
CJ
O
d
in
od
l
Dh
i
03
CN
S
+
u
+
d
N '
c
O
4-i
CM
u
I
CJ
^■^
O
X~s
u
+1
CJ
^s
I-
#
s
O
w
3
u
^
E
. —
CJ
o-
CO
d
o
d
H
73
13
C4d
4—>
CJ
CJ
4— '
o
4— i
CJ
CJ
c3
CJ
• ^H
CJ
"B.
CJ
3
4— •
CJ
3
CJ
E
c
CJ
c*
|
|
<
c
Uh
«ao
D-
"oo
>.
CJ
Q-
U
U
1
c5
O
d
CJ
V
V
6
u
CO
c
-d
CJ
E
o
73
co d
73 O
O <N
Ph .S
^3 CD
^5 cj
CN
i
C
CJ
c3
.d
co
c3
d r ^
^ 2
t" 1 -a
*8 §
CD -d
CD CD
~d O
3 -a
MM
Q Q
c S
e3 03
CD CD
s s
co co
o3 03
73 TD
CD CJ
co co
co co
CD CJ
9- &
X X
CD CD
co co
03 03
CO CO
13 13
CD CJ
CN CN
d
d
CJ
O O
CJ o
03 03 CD
u u -s
^ X) j
d | -'
o ••
d
O
CD CD
CD CD
cd cj -a
co co
\C OO
The Intestinal Microbiota of the Elderly 87
B. bifidum, B. breve, and B. infantis. In contrast, B. adolescentis did not stimulate the
production of anti-inflammatory IL-10 as the other tested bacteria did. At the same time,
neither the adult-type nor the infant-type bifidobacteria were found to be likely to
trigger inflammatory responses in human enterocytes (Table 2) (64). The results suggest
that the adult-type bifidobacteria, especially, B. adolescentis, may be more potent to
amplify but less able to down-regulate the inflammatory responses (Table 3).
The intestinal microbiota of elderly people is in general different from those in
infants; the former is more diverse and stable (8). One of the distinct age-related events
in intestinal microbiology is the increase in numbers of facultative anaerobic Gram-
negative bacteria (8); these bacteria may be opportunistic infective agents. They have been
found to be the triggers of anti-inflammatory cytokine-production by macrophages and
monocytes (60,61). The anti-inflammatory effects of these bacteria are believed to be one
of the strategies required for their successful colonization of the host's intestine,
overcoming the natural defense barrier, including inflammation. Therefore, an increase in
bacteria, including bifidobacteria, which can enhance the intestinal inflammatory response
in aged people, can be considered beneficial to counterbalance the age-related changes in
their intestinal microecology. This may contribute to the homeostasis of the local
immunity by preventing local inflammation from being oversuppressed. These results
suggest that the dominance of the intestinal bifidobacteria by B. adolescentis may be one
of the events in the intestinal environment in response to the aging of the host.
These results can lead to a hypothesis that the age-related changes of the
predominant species of bifidobacteria in the human intestine is a kind of well-acquired
adaptation of the host to the changes in the intestinal microbiota, localizing the beneficial
microbes such as B. adolescentis to enhance the colonization resistance against the
exogenous infectious agents. For more information on the influence of the normal
intestinal microbiota on the immune system, see the chapter by Moreau.
Effects of Bifidobacteria! Probiotics on Immunosenescence
Probiotics have been defined as a live microbial food ingredient that are beneficial to the
health of the host (65,66). Most current probiotics are lactic acid bacteria, especially
Lactobacillus and Bifidobacterium species (66). Among the proposed health-promoting
effects of the probiotic strains are the enhancement of cell-mediated immune responses of
the host by stimulating the pro-inflammatory cytokine, particularly IL-12 (67,68). The
cell-mediated immune response, enhanced by the pro-inflammatory cytokine IL-12, has
been considered as one of the most important underlying mechanisms contributing to the
self-defense of the host a against tumors and allergy (56). Therefore, probiotics strains
with the ability to stimulate IL-12 secretion can exhibit apparent anti-tumor and anti-
allergic effects (69-71). Considering the fact that the reduced cell-mediated immune
response is the main component of immunosensence of the elderly, such probiotics can
be expected to benefit the elderly. After consumption of a probiotic B. lactis, increase in
the proportion of the total CD + 4 and CD25 T lymphocytes and NK cells in the blood
were observed (72,73). The ex vivo phagocytic and tumoricidal activity capacity of
polymorphonuclear and mononuclear cells were increased by an average of 101 and 62%,
respectively. These increases were significantly correlated with age, with volunteers
older than 70 years experiencing significantly greater improvement than those younger
than 70. In sight of the fact that the intestinal bifidobacteria are usually dominated by
B. adolescentis with an advanced affinity specific to the mucus from the elderly and the
ability to promote IL-12 production, B. adolescentis from the intestine of the healthy
elderly may be a more reasonable candidate for use as probiotics to help the seniors to
88
He
combat immunosenescence. Compared to other predominant species of bifidobacteria in
infants and young adults, B. adolescentis is usually less quantitatively. Therefore, a
strategy to increase senior-specific bifidobacteria, including B. adolescentis in the elderly
could be a more practical way to improve the immunomodulatory effect of the intestinal
flora. For more information on probiotics, see the chapter by Ouwehand and Khedkar.
CONCLUSION
With the progress in nutrition and medicine, the life-expectancy of people has increased.
In industrialized societies this has led to increasing costs and spending for health care and
medical treatment of their senior citizens. Growing scientific evidence suggests that aging
alters the intestinal microbiota qualitatively and quantitatively, generating a different
microbial community with an aberrant structure. The intestinal microbiota in the elderly is
colonized by fewer bifidobacteria, and more potentially infectious microbes compared to
infants and young adults. Furthermore, there is a decrease in the species diversity in
bifidobacterial population of the elderly which is dominated by Bifidobacterium
adolescentis and B. longum. The advanced affinity of B. adolescentis to mucus both
isolated from the elderly suggests a deep symbiotic relationship between this microbe and
host. The elevated ability of B. adolescentis to enhance the production of pro-
inflammatory cytokine, particularly IL-12, by macrophages and monocytes suggests
that this endogenous bacterium may play an important role in the maintenance of the CMI
which can be impaired by age-related immunosenescence. This evidence can be used as
the basis to consider B. adolescentis from the healthy elderly as a reasonable probiotic
candidate for targeting the elderly, a growing subpopulation more prone to infection and
autoimmune disease.
REFERENCES
1. Saunier K, Dore J. Gastrointestinal tract and the elderly: functional foods, gut microflora and
healthy ageing. Dig Liver Dis 2002; 34:19-24.
2. Kalache A. Active ageing makes the difference. Bull. WHO 1999; 77:299.
3. Schneeman BO. Gastrointestinal physiology and function. Br J Nutr 2002; 88: 159—163.
4. Savage DC. Microbial ecology of the gastrointestinal tract. Annu Rev Microbiol 1997;
31:107-133.
5. Tissier H. Recherches sur la flora intestinal des nourrisson. Theses Paris 1900; 1-253.
6. Benno Y, Sawada K, Mitsuoka T. The intestinal microflora of infants: composition of fecal
flora in breast-fed and bottle-fed infants. Microbiol Immunol 1984; 28:975-986.
7. Yuhara T, Isojima S, Tsuchiya F, Mitsuoka T. On the intestinal flora of bottle-fed infant.
Bifidobact Microflora 1983; 2:33-39.
8. Mitsuoka T. A Color Atlas of Anaerobic Bacteria. Tokyo: Sobunsya, 1980.
9. Mitsuoka T. Intestinal flora and aging. Nutr Rev 1992; 50:438-446.
10. Mitsuoka T. Significance of dietary modulation of intestinal flora and intestinal environment.
Biosci Microflora 2000; 19:15-25.
11. Russell RM. Changes in gastrointestinal function attributed to aging. Am J Clin Nutr 1992;
55:1203S-1207S.
12. Gill HS, Darragh AJ, Cross ML. Optimizing immunity and gut function in the healthy. J Nutr
Health Aging 2001; 5:80-91.
13. Holt PR. Gastrointestinal disease in the elderly. Curr Opin Clin Nutr Metab Care 2003;
6:41-48.
The Intestinal Microbiota of the Elderly 89
14. Haenel H. Uber die Mikrookologie alter Menschen. Zentralbl Bakteriol Hyg I Orgi 1963;
188:219-230.
15. Haenel H. Gesetzma(3igkeiten in der Zusammensetzung der fakalen Mikroflora. Eubiose und
Dysbiose der menschlichen Darmbesiedlung. Ernahrungsforschung 1965; 10:289-301.
16. Jantea F, Nicolae D, Bad-Oprisescu D, Voina P. Beitrag zur Darmmikroflora bei Menschen im
Alter von 45-100 Jahren. Ernahrungsforschung 1965; 10:352-362.
17. Gorbach SL, Nahas L, Lerner P, Weinstein L. Studies of intestinal microflora 1. Effects of diet,
age, and periodic sampling on number of fecal microrganisms in man. Gastroenterology 1967;
53:845-855.
18. Mitsuoka T, Hayagawa K. Die Faecalflora bei Menschen I: Mitteilung: Die Zusanmmenset-
zung der Faecalflora der verschiedenen Altersgruppen. Zbl Bakt Hyg I Abt Org 1972;
223:333-342.
19. Mitsuoka T, Hayagawa K, Kimura N. Die Faekalflora bei Menschen II: Mitteilung: Die
Zusammensetzung der Bifidobakterienflora der verschiedenen Altersgruppen. Zbl Bakt Hyg I
Abt Org 1973; 226:469-478.
20. Mitsuoka T, Ohno K, Benno Y, Suzuki K, Namba K. Die Faekalflora bei Menschen IV.
Mitteilung: Vergleich des neu entwickelten Verfahrens mit dem bisherigen ublichen Verfahren
zur Darmfloraanalyse. Zbl Bakt Hyg I Abt Org 1976; 224:219-233.
21. Benno Y. Mitsuoka Development of intestinal microflora in human and animal. Bifdobact
Microflora 1986;5:13-25.
22. Blaut M, Collins MD, Welling GW, Dore J, van Loo J, de Vos W. Molecular biological
methods for studying that gut microbiota: the EU human gut flora project. Br J Nutr 2002;
87:S203-S211.
23. Hopkins MJ, Sharp R, Macfarlane GT. Age and disease related changes in intestinal bacterial
population assessed by cell culture, 16S rRNA abundance, and community cellular fatty acid
profiles. Gut 2001; 48:198-205.
24. Hopkins MJ, Macfarlane GT. Changes in predominant bacterial population in human faces
with age and with Clostridium difficile infection. J Med Microbiol 2002;448-454.
25. Hopkins MJ, Sharp R, Macfarlane GT. Variation in human intestinal microbiota with age. Dig
Liver Dis 2002; 34:512-518.
26. Mitsuoka T. Intestinal Bacteria and Health. Japan: Harcourt Brace Jovanovich, 1978.
27. Bjorksten B, Naaber P, Sepp E, Mikelsaar M. The intestinal microflora in allergic Estonian and
Swedish 2-year-old children. Clin Exp Allergy 1999; 29:342-346.
28. Kuvaeva IB, Orlova NG, Veselova OL, Kuznezova GG, Borovik TE. Microecology of the
gastrointestinal tract and the immuneological status under food allergy. Nahrung 1984;
28:689-693.
29. Orla-Jensen S. La classification des bacteria lactiques. Lait 1924; 4:468-474.
30. Reuter G. Vergleichende Untersuchungen uber die Bifidus-Flora im Sauglings- und
Erwachsenenstuhl. Zbl Bakt I Orig 1963; 191:486-507.
31. Reuter G. Designation of type strains for Bifidobacterium-species. Int J Syst Bact 1971;
21:273-275.
32. Mitsuoka T. Vergleichende Untersuchungen iiber die Bifidobakterien aus dem Verdauung-
strakt von Menschen und Tieren. Zbl Bakt I Orig 1969; 210:52-64.
33. Mitsuoka T. Taxonomy and ecology of bifidobacteria. Bifidobacteria Microflora 1984;
3:11-28.
34. Lauer E, Kandler O. DNA-DNA homology, murein type and enzyme patterns in the type
strains of the genus Bifidobacterium. Syst Appl Microbiol 1983; 4:42-62.
35. Scardovi V. Genus Bifidobacterium. Orla-Jensen 1924. In: Sneath et al., eds. Bergey's Manual
of Systematic Bacteriology: Vol. 2 Section 15, Philadephia: The Williams & Wilkins
Company, 1986; 1418-1434.
36. Moore WE, Holdeman LV. Human fecal flora: the normal flora of 20 Japanese-Hawaiians.
Appl Microbiol 1974; 27:961-979.
37. Finegold SM. Normal human intestinal flora. Ann 1st Super Sanita 1986;73 1-737.
90
He
38. He F, Ouwehand AC, Isolauri E, Hosoda M, Benno Y, Salminen S. Differences in composition
and mucosal adhesion of bifidobacteria isolated from healthy adults and healthy seniors. Curr
Microbiol 2001; 43:351-354.
39. Satokari RM, Vaughan EE, Akkermans ADL, Saarela M, de Vos WM. Bifidobacterial diversity
in human feces detected by genus-speciic PCR and denaturing gradient gel electrophoresis.
Appl Environ Microbiol 2001; 67:504-513.
40. Mullie C, Odou MF, Singer E, Romond MB, Izard D. Multiplex PCR using 16 S rRNA gene-
targeted primers for the identifyication of bifidobacteria from human origin. FEMS Microbiol
Lett 2003; 222:129-136.
41. Matsuki T, Watanabe K, Fujimoto J, et al. Development of 16 S rRNA-gene-targeted group-
species primers fro the detection and identification of predominant bacteria in human feces.
Appl Environ Microbiol 2002; 68:5445-5451.
42. Isolauri E, Stitas Y, Kankaanpaa P, Arvilommi H, Salminen S. Probiotics: effects on immunity.
Am J Clin Nutr 2001; 73:444S-450S.
43. Ouwehand AC, Tuomola EM, Lee YK, Salminen S. Microbial interactions to intestinal
mucosal models. Methods Enzymol 2001; 337:200-212.
44. Kohler H, McCormick BA, Walker WA. Bacterial-enterocyte crosstalk: cellular mechanisms
in health and disease. J Pediatr Gastroenterol Nutr 2003 Feb; 36:175-185.
45. Salminen S, Laine M, von Wright A, Vuopio-Varkila J, Korhonen T, Mattila-Sandholm T.
Development of selection criteria for probiotic strains to acess their potential I n functional
food. A Nordic and European approach. Biosci Microflora 1996; 2:23-28.
46. Ouwehand AC, Isolauri E, Kirjavanen PV, Salminen SJ. Adhesion of four Bifidobacterium
strains to human intestinal mucus from subjects in different age groups. FEMS Microbiol Lett
1999; 172:61-64.
47. He F, Ouwehand AC, Hashimoto H, Isolauri E, Benno Y, Salminen S. Adhesion of
Bifidobacterium spp. to human intestinal mucus. Microbiol Immunol 2001; 45:259-262.
48. Laine R, Salminen S, Benno Y, Ouwehand AC. Performance of bifidobacteria in oat-based
media. Int J Food Microbiol 2003; 83:105-109.
49. Pawelec G. Immunosenescence: impact in the young as well as the old? Mech Ageing Dev
1999; 108:1-7.
50. Mishto M, Santoro A, Bellavista E, Bonafe M, Monti D, Franceschi C. Immunoproteasomes
and immunosenescence. Ageing Res Rev 2003; 2:419-423.
51. Ginaldi L, Martinis MD, D' Ostilio A, Marini L, Loreto MF, Quaglino D. Immunological
changes in the elderly. Ageing Clin Exp Res 1999; 11:281-286.
52. Lesourd B, Mazari L. Nutrition and immunity in the elderly. Proc Nutr Soc 1999; 58:685-695.
53. Castle SC. Clinical relevance of age-related immune dysfunction. Clin Infect Dis 2000;
31:578-585.
54. Effros RB. Ageing and immune system. Novartis Found Symp 2001; 235:130-145.
55. Grubeck-Loebenstein B. Changes in the ageing immune system. Biologicals 1997;
25:205-208.
56. Peakman M, Vergani D. Basic and Clinical Immunology. Hong Kong: Churchill Livingstone,
1997:1-388.
57. Fujimoto T, Duda RB, Szilvasi A, Chen X, Mai M, O'Donnell MA. Streptococcal preparation
OK-432 is a potent inducer of IL-12 and T helper cell 1 dominant state. J Immunol 1997;
158:5619-5629.
58. Haller D, Blum S, Bode C, Hammes WP, Schiffrin EJ. Activation of human peripheral blood
mononuclear cells by nonpathogenic bacteria in vitro: evidence of NK cells as primary targets.
Infect Immun 2000; 68:752-759.
59. Hessle C, Honson LA, Wold AE. Lactobacilli from human gastrointestinal mucosa are strong
stimulators of IL-12 production. Clin Exp Immunol 1999; 116:276-282.
60. Hessle C, Andersson B, Wold AE. Gram-positive bacteria are potent inducers of monocytic
interleukin-12 (IL-12) while gram- negative bacteria preferentially stimulate IL-10 production.
Infect Immun 2000; 68:3581-3586.
The Intestinal Microbiota of the Elderly 91
61. Karlsson H, Hessle C, Rudin A. Innate immune responses of human neonatal cells to bacteria
from normal gastrointestinal flora. Infect Immun 2002; 70:6688-6696.
62. He F, Morita H, Ouwehand AC, et al. Stimulation of the secretion of pro-inflammatory
cytokines by Bifidobacterium strains. Microbiol Immunol 2002; 46:781-785.
63. He F, Isolauri E, Morita H, et al. Bifidobacteria isolated from allergic and healthy infants:
differences in taxonomy, mucus adhesion and immune modulation effects. Microecol Ther
2002;29:103-108.
64. Morita H, He F, Fuse T, et al. Adhesion of lactic acid bacteria to Caco-2 cells and their effects
on cytokine secretion. Microbiol Immunnol 2002; 46:293-297.
65. Fuller R. Probiotics in man and animals. J Appl Bacteriol 1989; 66:365-378.
66. Salminen S, Ouwehand A, Benno Y, Lee YK. Probiotics: how should they be defined? Trends
Food Sci Technol 1999; 10:107-110.
67. Gill HS. Stimulation of the immune system by lactic culture. Int Dairy J 1998; 8:535-544.
68. Borchers AT, Keen CL, Gershwin ME. The influence of yogurt/ 'Lactobacillus on the innate and
acquired immune response. Clin Rev Allergy Immunol 2002; 22:207-230.
69. Matsuzaki T, Yamazaki R, Hashimoto S, Yokokura T. The effect of oral feeding of
Lactobacillus casei strain Shirota on immunoglobulin E production in mice. J Dairy Sci 1998;
81:48-53.
70. Aso Y, Akaza H, Kotake T, Tsukamoto T, Imai K, Naito S. BLP Study Group. Preventive
effects of a Lactobacillus casei preparation on the recurrence of superficial cancer in a double-
blind trial. Eur Urol 1995; 27:104-109.
71. Cross ML, Gill HS. Can Immunoregulatory lactic acid bacteria be used as dietary supplements
to limit allergies? Int Arch Allergy Immunol 2001; 125:112-119.
72. Gill HS, Rutherfurd KJ, Cross ML. Dietary probiotics supplementation enhances natural killer
cell activity in the elderly: an investigation of age-related immunological changes. J Clin
Immunol 2001; 21:264-271.
73. Gill HS, Rutherfurd KJ, Cross ML, Gopal PK. Enhancement of immunity in the elderly
supplementation with the probiotic Bifidobacterium lactis HN019. Am J Clin Nutr 2001;
74:833-839.
5
Immune Modulation by the Intestinal
Microbiota
Marie-Christiane Moreau
French Institute of Agronomical Research (INRA), Nancy, France
INTRODUCTION
Today, there is a growing interest in the intestinal microbiota and its relationship with the
host's immunity. This is mainly due to two causes: first, the results obtained with
probiotics, which have been defined as live micro-organisms that confer a health benefit on
the host when consumed in adequate amounts (1), have shown interesting immunomo-
dulatory properties in humans (1-3). Second, the studies by Dutchmann and coworkers
(4) demonstrated for the first time, some years ago, that we are tolerant to our own
digestive flora. A breakdown of this state leads to inflammatory bowel diseases (IBD).
Consequently, the digestive flora can be considered as an organ belonging to the host's just
as the spleen, heart, or brain. It plays an important role in the host's protection, especially
by its actions on the immune system.
The overall importance of the intestine, relating to health, is still not completely
understood. It is an extremely complex organ, which has to assure the function of
digestion of foods and absorption of nutrients. In addition to this, the intestine is the
largest lymphoid organ in the body by virtue of lymphocyte number and quantity of
immunoglobulin produced. It also harbors a huge reservoir of bacteria that colonize it
very early after birth and which is called "the commensal or resident or autochthonous
digestive microflora," and more recently the "intestinal microbiota." The relationships
between the intestinal microbiota and intestinal immune system (IIS), described in some
reviews (5-7) can be viewed in terms of "symbiosis" or "mutualism," which is the
association of symbiosis and commensalism as explained by Hooper and Gordon (8).
Indeed the IIS does not mount immune responses toward the intestinal microbiota that, in
turn, exert many effects on the immune system. These effects can be characterized as
activation, modulation, and regulation of immune responses and are effective at both
intestinal and peripheral levels.
In this chapter, effects of the intestinal microbiota on the host's immunity will be
described, and in some cases effects of probiotic bacteria will also be discussed.
93
94 Moreau
BRIEF REVIEW OF THE INTESTINAL MICROBIOTA
From birth to death, the gut is colonized by a diverse, complex, and dynamic bacterial
ecosystem that constitutes the intestinal microbiota. In newborns, it develops sequentially
according to the maturation of intestinal mucosa and dietary diversification. In healthy
conditions, the human baby's intestine is sterile at birth but, within 48 hours, 10 to 10
bacteria can be found in 1 g of feces (9-11). The bacteria colonizing the baby's intestine
come from the environment, where maternal vaginal and fecal microbes represent the
most important source of bacterial contamination. However, the infant conducts an initial
selection, since, out of all the bacteria present, only the facultative anaerobic bacteria such
as Escherichia coli and Streptococcus will be able to colonize the intestinal tract, whatever
the diet. Conditions under which this initial selection is operated have yet to be fully
elucidated. They are related to endogenous factors, such as maturation of intestinal
mucosa, mucus, growth promoters or inhibitors present in the meconium, or exogenous
factors such as delivery conditions (natural childbirth, caesarean section), mother's status
(antibiotic intake), and quality of the bacterial environment. Subsequently, obligate
anaerobes such as Bacteroides, Clostridium, and Bifidobacterium colonize over the first
week of life, following a second selection in which the diet factor plays a fundamental
role. It has long been known that Bifidobacteria are predominant in exclusively breast-fed
babies, while in bottle-fed babies it is not always present, or present at fluctuating levels
and, in contrast to breast-fed babies, often associated with other anaerobic bacteria such as
Bacteroides and Clostridia. Breast milk contains oligosaccharides enabling development
of Bifidobacterium and may also function as receptor analogues of the mucus influencing
the strains able to colonize the intestinal tract (12). A bacterial balance is obtained towards
the end of the second week of life in which Bifidobacterium and E. coli predominate in
exclusively breast-fed infants, while a more diverse microbiota, rich in E. coli,
Bacteroides and, possibly Clostridium, Bifidobacterium, Staphylococcus, and other
Enterobacteriaceae, is found in formula-fed infants. Thus the bacterial balance of the
infantile microbiota mainly depends on two important factors: bacterial environment at
birth and diet. During the last decade, some modifications of the microbiota balance in
babies whatever the feeding have been observed, namely, dominance of Staphylococcus,
low levels of E. coli, delayed colonization with anaerobic bacteria and absence or low
levels of bifidobacteria (MJ Butel, personal communication). Excessive aseptic conditions
present at birth, maternal antibiotic intake immediately before parturition or during
childbirth could be, among other factors, responsible for such differences (13). Because of
the fragility of the baby's digestive microbiota, which is poorly diversified, with about 10
bacterial species of micro-organism versus over 400 in adults, the consequences of its
modification have to be considered in terms of health. For example, recent studies suggest
that some infancy pathologies, such as food allergy, could be due to the modifications of
the intestinal microbiota of newborns. The latter will be discussed in chapter 10.
Thereafter, according to dietary diversification, the digestive microbiota, enriched
by the development of other strictly anaerobic bacteria, becomes more and more complex.
It is considered to have assumed adult characteristics toward the age of 2 years (9-11).
In adults, a complex and diverse digestive microbiota is present, mainly in the distal
parts of the gut. In the duodenum, the number of bacteria is approximately 10 4 bacteria/g
"7 R
of intestinal content while in the ileum, the number reaches 10 -10 . The large intestine is
the most densely colonized region (10-10 bacteria/g of content), essentially because of
digestive stasis. Bacterial species established at levels over 10 -10 bacteria/g
characterize the predominant microbiota, whereas those below such a threshold compose
the subdominant microbiota. In fact, it is proposed that only predominant bacteria are able
Immune Modulation by the Intestinal Microbiota 95
to exert a measurable function. The dominant microbiota of human feces is mainly
composed of strict anaerobic and extremely oxygen-sensitive bacteria. According to
several authors, 30% to 70% of the microbiota is not identified because it is uncultivable
with current techniques. The predominant species commonly isolated from the human
feces belong to the genera Bacteroides, Eubacterium, Bifidobacterium, Ruminococcus,
and Clostridium, and subdominant species include enterobacteria, particularly Escherichia
coli and streptococci (14). Lactobacilli are frequently subdominant in humans or cannot
even be detected. Some studies suggest that they may be abundant in the ileum.
Very little data exists on the evolution of intestinal microbiota in the elderly.
Nonetheless, bifidobacteria have been reported to decrease at old age, which may be
related to a reduced adhesion to the intestinal mucus (15).
Currently available molecular biology techniques should bring additional and
complementary approaches to those offered by the usual culture techniques. Recent
molecular methods have shown that every individual has his/her own gut microbial
balance, which has been described to be stable (studies over a period of 6-9 months) (16).
In conclusion, depending on the intestinal sites (duodenum, ileum, and colon) and
the various periods of life, childhood, adulthood, aging, the human's intestinal microbiota
also varies. This is discussed further in more detail in chapter 3 by McCartney and Gibson.
BRIEF REVIEW OF IMMUNE RESPONSES
Innate Immunity
Cells responsible for the innate immunity provide the first line of host defense: monocytes/
macrophages, dendritic cells (DC), natural killer cells (NK), and neutrophils. These are the
body's sentinels, able to detect danger and signal it to other cells, by the synthesis of
molecules, such as NO (nitric oxide) which displays antibacterial activity, cytokines, and
chemokines, which are small peptides acting by means of specific receptors expressed at
the surface of targeted cells. Some of them have pro-inflammatory properties, and increase
expression of surface markers on some cells allowing migration into neighboring
lymphoid organs. DCs and macrophages are able to display a phagocytic activity, and by
production of inflammatory chemokines and cytokines, to modulate other cells such as
neutrophils, polymorphonuclear cells and eosinophils in the case of hypersensitivity, which
increase the inflammatory action, and ultimately B and T cells, which will set up an
"acquired" immune response (see below). NK cells contribute to antitumor activity.
Innate immunity is fast, non-specific, and not endowed with memory. It also plays an
important role in acquired immunity by the process of antigen (Ag) presentation to T cells
and through the synthesis of some cytokines, which play an important role in the
orientation of the specific immune responses. Thus, innate immunity is the first to
intervene following exposure to an Ag. It also plays a fundamental role in acquired
immunity, as described below.
Macrophages and DCs are able to recognize "danger" by way of receptors called
Toll-like receptors (TLRs), which respond to several bacterial components (17,18). To date,
at least 10 TLRs have been found. TLR2 and TLR4 recognize cell wall structures:
peptidoglycan of Gram-positive bacteria and lipopolysaccharides (LPS) of Gram-
negative bacteria, respectively. TLR3 is found specifically in DCs, TLR5 is reported to
recognize bacterial flagella and TLR9 recognizes pro-inflammatory CpG dinucleotide
(cytosine phosphoryl guanine non-methylated) only found in the bacterial genome (19).
Another surface receptor that binds LPS, CD 14, is expressed on the surface of monocytes
and macrophages. In addition to macrophages and DCs, mucosal epithelial cells also
96 Moreau
express TLR2 and TLR4 (20). TLRs play an important role in the initiation of innate
responses and hence in acquired immunity. The binding of bacterial molecules such as LPS,
peptidoglycan and CpG motifs to TLRs results in the activation of the nuclear factor kP (NF-
kP) pathway. NF-kP is a transcriptional factor that intervenes in the synthesis of the pro-
inflammatory cytokines, TNF-a, IL-1 and IL-6, by cells of the innate immune system and
intestinal enterocytes; it further stimulates phagocytosis and adhesion molecule expression,
NO production and synthesis of IL-1 2 (21). In addition, NF-kP activation has an important
role in regulating the expression of anti-apoptotic proteins and affecting the susceptibility of
cells to apoptosis (22). Because of the importance of inhibiting the NF-kP pathway in certain
circumstances, such as those found in the gut, this pathway is regulated by several processes
as described elsewhere (21-25).
Acquired Immunity
Acquired responses consist of the Ag-specific humoral and cell-mediated immune
responses. They express by synthesis of antibodies (Abs) and cellular responses,
respectively. They involve three kinds of cells: Ag-presenting cells (APC) (mainly
macrophages and DCs), T cells, and B cells. For cellular responses only APC and mainly
CD8 + T cells are involved, while another population of T cells, CD4 + T cells, and B cells
are needed for Ab synthesis. Antibodies can belong to several kinds of immunoglobulin
isotypes: IgD, IgM, IgG, IgE, and IgA, and different subclasses including IgGl, IgG2,
IgG3, and IgG4 or IgAl, and IgA2 in humans. After an initial contact with the Ag,
acquired responses are slowly established (7-10 days) but are endowed with memory
enabling a very rapid response after a further contact with the same Ag (within one day).
The first step in the induction of the immune response is the presentation by APC, and
recognition of the epitope (small part of an Ag), associated with major histocompatibility
complex (MHC) molecules of class I or II, to the epitope-specific T cell receptor. In
addition, the binding of co-stimulation molecules and equivalent receptors expressed by
both APCs and T cells (CD40 and CD40 ligand, B7.2 and CD28, etc.), leads to the full
activation and proliferation of naive T cells. Subsequently, a large proportion of those
activated cells will die of apoptosis, the others surviving in the form of memory T cells.
All those "lock-and-key" mechanisms are important and greatly contribute to
modulate the immune responses. It has been shown that DCs play a key role in the
acquired immune responses. They exist in an immature form in tissues. The mature form
is obtained following contact with an Ag and phagocytosis. Mature DCs are able
to synthesize cytokines and migrate into the neighboring draining lymph nodes in order to
supply Ag information to the T cells. DC populations are heterogeneous (26) and, as will
be further described, subsets of intestinal DCs display specific properties in terms of Ag
presentation and cytokine secretion.
Th1/Th2 Balance
Several years ago Mosmann and coworkers (27) described different subsets of CD4 + T
cells that differ by the cytokine profiles produced after activation (Fig. 1). Three kinds
of T cells are now described from progenitor type helper T cells (ThO). The type 1
helper T cells (Thl) mainly secrete IFN-y, a pro-inflammatory cytokine, and IL-2. Thl
induce a weak synthesis of Abs by B cells (subclass IgG2a) and are recruited more in the
event of a cell-mediated response. In contrast, activation of type 2 helper T cells (Th2)
induces synthesis of cytokines IL-4, IL-5, IL-10, and IL-13, which have anti-
Immune Modulation by the Intestinal Microbiota
97
Macrophages,
Dendritic cells /" X
( NK )
Cytokines: IFN-yJL-2
I
Weak antibody
Production
lgG2a
Cytokines: IL-4, IL-5, IL-10.
1
Important antibody
Production
lgG1, lgG2b, IgE, IgA
Figure 1 Schematic representation of the Thl/Th2 balance. Abbreviations: IFN, interferon; Ig,
immunoglobulin; IL, interleukin; NK, natural killer cells; Th, T-helper cell.
inflammatory properties. They induce a large production of Abs by B cells belonging to
the isotypes and subclasses of IgGl, IgG2b, IgA, and IgE, the latter being involved in
allergy. Activation of one population inhibits that of another. One of the major
determinants of the Thl/Th2 differentiation is the cytokine environment at initial
sensitization. Indeed the transition from ThO to Thl or Th2 depends on environmental
factors, among which the innate immune cells, macrophages, DCs, and NK cells, play a
considerable role through synthesis of some cytokines, especially IL-12, and IFN-y,
acting on the orientation toward a Thl profile (Fig. 1).
Another subset of T helper cells has been described in mice, the Th3 cells. They
could play an important role in tolerance by suppressing the immune response through
production of transforming growth factor- P (TGF-P) after Ag-specific triggering (28).
The Thl/Th2 balance is an example of the complexity of the host's immune system,
which has to respond to various immune stimuli by an appropriate immune response. In
fact, according to the situation, an inflammatory immune response involving Thl and/or
CD8 + T cells will be activated in intracellular infections needing cell-mediated responses.
In contrast, a Th2 response producing a low inflammatory response with marked synthesis
of IgGl or IgA Abs, will be more activated in other situations. With regard to the IgE
response (Th2 response), it must remain moderate in order to not give rise to adverse
allergic reactions. A balance between 11-4 and IL-10 may intervene in that regulation, in
which IL-10 is believed to play a very important anti-inflammatory role (29).
THE INTESTINAL IMMUNE SYSTEM
The IIS is a particular immune system anatomically and functionally distinct from that
present at the peripheral level (30-32). It is in contact with an enormous quantity of Ags,
food proteins and intestinal bacteria, and does not mount an inflammatory response
against them. At the same time, it has to protect against enteric pathogens and toxins.
The IIS is mainly located in the small intestine and colon with differences in the
anatomical patterning and physiological functions. It is important to be aware of the
compartmentalization of the intestine even if the IIS associated with the small intestine
98
Moreau
has been subject to more studies and is the most widely described. According to the
compartment, differences in immune regulations in response to local Ags can be easily
understood: food Ags are more numerous in the small intestine while in the ileum and
colon they have essentially been digested and absorbed. In contrast, commensal microbes
are scarce in the duodenum but more numerous in the ileum and above all in the colon.
Three lines of defense are present: (i) natural defenses: stomach acidity, bile salts,
mucus, motility, permeability, (ii) innate immune responses: Ag capture, cytokine
secretion, TLRs, and (iii) acquired immune responses namely oral tolerance (OT) and
secretory IgA (slgA) response. All of them interact together.
Many results presented in this review are derived from studies with mice. Note for
some results, it is not certain whether they reflect what is happening in humans (33,34).
Anatomy
The immune system associated with the small intestine is currently described according to
two compartments: (i) the inducing sites, named the gut associated lymphoid tissue
(GALT), consisting of organized aggregated lymphoid tissue, scattered small nodules,
Peyer's patches (PPs), and mesenteric lymph nodes (MLN); and (ii) the effector sites, i.e.,
the lamina propria tissue where numerous mature B and T small lymphocytes (60%
CD4 + T cells), plasma cells of which about 90% synthesize IgA are present, and the
epithelium richly endowed with intra-epithelial lymphocytes (IEL) (CD8 + T cells)
present between the tight junctions of some enterocytes (Fig. 2) (30-32,35).
PPs are the first important inductive sites. They are macroscopic lymphoid
aggregates that are found in the submucosa along the length of the small intestine.
They consist of large B-cell follicles and intervening T-cell areas which are separated from
the single layer of intestinal epithelial cells, known as the follicle-associated epithelium
(FAE), by the subepithelial dome region where APCs are numerous (31). An important
feature of the FAE is the presence of microfold (M) cells, which, in contrast to enterocytes,
lack the surface microvilli, the normal thick layer of mucus, and cellular lysosomes.
Thus, M cells are distinctive epithelial cells that occur only in the FAE. It is believed that
they play a central role in the initiation of mucosal immune responses by transporting Ags,
and microorganisms, to the underlying organized lymphoid tissue within the mucosa.
© Peyer's Patch
Villus
2) Lamina propria
©Epithelium
-®GALT= PP and MLN
-©LP
-(§) Epithelium
o T and B lymphocytes
# IgA Plasmocytes
O CD4+Tcell
c£iEL(CD8 + ) Mesenteric
t-> Antigen-presentating cell ,
a Mastocytes Lymph Node
Goblet cell
Figure 2 Schematic representation of the intestinal immune system. Abbreviations: GALT, gut-
associated lymphoid tissue; IEL, intraepithelial lymphocytes; LP, lamina propria; MLN, mesenteric
lymph nodes; PP, Peyer's patches.
Immune Modulation by the Intestinal Microbiota 99
Most of the mature cells found in the effector sites, T cells, plasma cells, epithelium
CD8 a-P thymus-dependent IEL, derive from PPs. After oral Ag stimulation, the Ag-
activated immature T and B cells present in PPs leave the PP, and migrate into the
systemic compartment via the MLN, and the lymph, then enter the bloodstream via the
thoracic duct. Subsequently the expression of a4P7 integrin, expressed at the surface of
cells, allows them to bind the gut-specific vascular addressin, MadC AM- 1 , which is
expressed at high levels by the vasculature of mucosal surfaces, inducing the cells to
migrate across the endothelium into the lamina propria. Within the intestinal lamina
propria, B cells differentiate into IgA-secreting plasma cells with a half-life of about 4!/ 2
days, and most of the T cells undergo apoptosis. This fact has been suggested to be
important to maintain the gut homeostasis preventing immune responses to luminal Ags
(36). This cellular traffic, between the PP and lamina propria, has been particularly
described for IgA plasmocytes. After antigenic stimulation at the PP, B cells undergo Ig
class switching from expression of IgM to IgA which is under the influence of several
factors, including cytokines, TGF-P, IL-4, and IL-10, and cellular signals delivered by DC
and T cells present in PPs. After returning to the lamina propria, IgA plasmocytes
synthesize and assemble two IgA units and the J chain. Then, a polymeric-Ig receptor
(plgR) expressed by enterocytes allows selective transcytosis through the epithelial cells,
and dimeric IgA are excreted in the lumen associated with the secretory component, a
protein derived from the plgR, which confers to slgA interesting properties such as
resistance to proteolytic enzymes present in the intestinal lumen (37).
The physiological significance of the entero-enteric cell circulation is important.
The induction of an immune response at a PP level propagates distally relative to the
induction site, not only throughout the intestine but also to other mucosa. It has been
shown that T and B cells, which have been activated in the GALT, are able to reach
other mucosal surfaces, which together compose the mucosa-associated lymphoid tissue
(MALT; vagina, breast during pregnancy and lactation, respiratory tract) by the way of
homing receptors. This is known as the "common immune system of the mucosa." The
cycle also shows that there are relationships between the IIS and systemic compartment,
even though they have, as yet, not been fully elucidated.
The APCs play a crucial role in the initiation and regulation of the immune
responses, and are present in all the parts of IIS. In PPs we found immature DCs located in
close proximity to M cells, which have the capacity to migrate into the interfollicular areas
of the PP (T areas) and also via the lymphatic to T-cell areas of MLN, thereby stimulating
T cells in both locations. In all these locations where T cells are stimulated by a given gut
Ag, the resulting blasts have the capacity to move via the lymph to the thoracic duct and
the blood to finally home in the gut wall. Ag-specific effector and memory cells thereby
become disseminated along the whole gut wall, in the lamina propria, and the epithelium.
Several and unusual subsets of DCs have been described in the murine PP. They are
located either in the subepithelial dome (CDllb + /CD8 — ), or in the intrafollicular
regions (CDllb-/CD8 + ) or at both sites (CDllb-/CD8-) (38). It has been described
in mice that CD1 lb + /CD8 — DC, present in the subepithelial dome of PP, have unusual
functional characteristics and differ from their peripheral counterparts. Upon antigenic
stimulation, they secrete IL-10 and induce naive T cells to differentiate into Th2 with IL-4
and IL-10 production (38). In contrast, in the spleen, the same DC subset secretes IL-12
after antigenic stimulation under the same experimental conditions, and consequently
drives the immune response to a Thl orientation with production of IFN-y. However the
authors showed that the double negative population CD1 lb — /CD8— of DCs, is capable
of secreting 11-12 upon recognition of microbial stimuli. These functional differences in
the different PP DC populations may come from the type of Ag stimulation. Indeed, T cells
100 Moreau
in PP of mice immunized orally with live Salmonella typhimurium secrete large quantities
of IFN-y (39). In these studies, it also seems to be important to consider the intestinal site
from which PPs originate. In fact recent studies have shown that the presence of intestinal
bacteria in the ileum influence the cytokine profile secreted by DCs in PPs (40).
DCs are also found in the intestinal villi at the subepithelial level in lamina propria.
When activated, they can penetrate the epithelium, and send dendrites to the epithelium
surface, thus being able to directly sample luminal Ags and to present them to IEL and
lamina propria lymphocytes (31,35). Unusual subsets of DCs are also found, including
some that are similar to the IL-10 inducing DCs that have been described in PPs. This
characteristic constitutes a particularity of DCs present both in PPs, lamina propria, and
epithelium, with functional consequences as presented below for the section on oral
tolerance.
Another characteristic of the IIS is the presence of large numbers of activated
memory CD4+ and CD8 + T cells throughout the lamina propria, expressing the
chemokine receptor CCR5, probably because of the continuous exposure to environmental
antigens (41). By contrast, the majority of CD4 + T cells in the peripheral blood and nodes
are naive T cells (lack of CCR5 expression). It has been reported that PP contains naive T
cells, expressing chemokine receptor CXCR4, but also activated and memory T cells, a
phenomenon which is not found in other inductive lymphoid tissue such as MLN or
peripheral lymph nodes (42). The reasons for this are unknown.
Physiology
The IIS generates two important immune functions. First is a suppressive function, also
termed oral tolerance (OT), characterized by regulatory mechanisms avoiding local and
peripheral immune responses to harmless environmental Ags present in the intestine, such
as dietary proteins and bacterial Ags of the intestinal microbiota. Second is the immune
exclusion performed by slgA Abs to protect the mucosa against pathogen microorganisms
but also against bacterial translocation of commensal bacteria. Now, it is still unclear
whether OT induction is accompanied by local slgA production or not. The knowledge of
regulatory mechanisms that govern the IIS functions are important to understand. When
the IIS is not functioning well, diseases can develop: enteric and/or systemic infections,
hypersensitivities to dietary proteins, and IBD.
Tolerance to Soluble Proteins: Oral Tolerance
In healthy conditions, the IIS does not mount immune responses to food proteins and
commensal bacterial Ags. Because two kinds of studies have been reported in the literature
dealing with the mechanisms involved in OT either to food proteins or to intestinal
microbiota, we distinguish the mechanisms described, and postulate that they may be
different according to soluble proteins, such as food proteins, or to bacterial component
Ags present in the intestinal microbiota.
Oral tolerance is defined by the state of both systemic and mucosal immune
unresponsiveness induced after soluble protein feeding. It is a long-lasting phenomenon,
which affects suppression of both cellular and humoral Ag-specific immune responses.
Despite the absence of direct evidence in infants, it is believed that OT, which has been
shown to exist in adult humans (43), certainly plays an important role in the protection
against hypersensitivity reactions to food proteins [hypersensitivities type I and IV, either
IgE Abs (allergy) and cellular immune responses, respectively]. Studies on mice have
shown that suppression of cellular responses lasts up to 17 months after one feeding of
Immune Modulation by the Intestinal Microbiota 101
20-mg ovalbumin (OVA) and the suppression of the IgG antibody response lasts more than
3-6 months (44).
A number of factors affect OT induction or its persistence (7,31,45). Briefly, they are
linked to the Ag (nature, doses), the host (genetic, age, inflammatory diseases which affect
the permeability of intestinal mucosa), intestinal microbiota (described below), and
bacterial toxins (7).
The sites where OT is generated, the different mechanisms, and the conditions in
which they are operating are still a matter of debate (31). Discussion persists as to where
primary immune responses are initiated: the PP, lamina propria or MLN. It has been
assumed for many years that PPs are the principal site in which T cells encounter Ags
derived from food and presented by several distinct potential APCs: macrophages, B
lymphocytes and DCs. However, some studies suggest that M cells and PPs might not be
necessary for the uptake and processing of Ags in the induction of OT. For instance, study
in deficient uMT mice which do not possess B cells, M cells, and PPs because of the lack
of B cells, showed that these mice are nevertheless able to induce a normal suppressive T
cell response to oral Ag at the systemic level (46). They concluded that systemic T cell
responses to orally administered soluble Ags requires neither the specialized Ag
presentation properties by B cells, nor the microenvironment provided by M cells nor PPs,
but most likely, are due to characteristics of professional APCs, especially DCs. In recent
years, some in vitro studies on intestinal epithelial cell-lines have shown that Ags may be
incorporated into MHC class-II positive exosomes derived from enterocytes (31). These
vesicles, also called "tolerosomes," can be found in the bloodstream after Ag feeding, and
are able to induce systemic tolerance when transferred into naive recipients. The
mechanisms by which exosomes are able to tolerize T cells are under investigation. It has
been postulated that exosomes can transmit MHC class II/peptide complexes to APCs such
as DCs. Indeed, incubation of free exosomes bearing MHC class II complexes with DCs
resulted in a highly efficient stimulation of specific T cells (47).
Mechanisms implicated in OT are not completely elucidated (7,30,32,45). Studies in
mice have supported the important roles of intestinal regulatory T cells (reg T cells) and
DCs in the OT process. The key role of Ag presentation by DCs was provided by
Viney and coworkers (48). In the study, they showed, in vivo, that administration of
a hemopoietic growth factor, Flt3 ligand, to mice dramatically expands the number
of functionally mature DCs in intestine and other lymphoid organs, and increases the
susceptibility to induction of tolerance by feeding OVA. DCs recruited by Flt3L express
only low levels of co- stimulatory molecules, supporting the view that intestinal DCs may
normally be in a resting state without the ability to prime T cells. This mechanism has been
called "anergy" and it was postulated that only high doses of Ag given to normal mice
induce this mechanism.
In addition to the OT, other active suppressor mechanisms, globally named Ag-
driven suppression, or bystander suppression, have been described. They involve several
subsets of reg T cells. Indeed, repeated oral administration of low-dose Ag leads to the
development of Th2 CD4 + T cells secreting IL-4 and IL-10 and Th3 CD4 + T cells
secreting TGF-(3 cytokines, with anti-inflammatory and suppressive properties. In
addition, two other reg T cell subsets have recently been described: CD4 + CD25 + reg
T cells, which could have an important role to prevent intestinal inflammation diseases and
another reg T cell subset, named Trl, which has been demonstrated to suppress Ag-
specific immune responses and actively down-regulate a pathological immune response in
vivo, through production of 11-10 (49). This last finding suggests that Ag-specific Trl are
capable of producing suppressor cytokines which exert an effect through a local bystander
suppression. It has been shown that Trl reg T cells can be generated from repetitive
102 Moreau
stimulation of CD4 + T cells in the presence of IL-10 (49). Intestinal unusual subsets of
DC-secreting-IL-10 present in both PP and lamina propria could be implicated in the
genesis of some of these reg T cells. Indeed, they could drive the T cells towards
suppressive Trl and reg Trl cells in the intestine and may be crucial for the induction
of OT.
Tolerance to the Intestinal Microbiota
Tolerance to our intestinal microbiota is important to prevent IBD. Some of the OT
mechanisms may play a role in the tolerant state, but evidence is scarce. It has been
described that intestinal CD4 + T cells normally recognize the local commensal bacteria,
but that their responses are inhibited by local reg T cells in an IL-10 and/or TGF-(3-
mediated manner (50). CD4 + CD25 + reg T cells also play an important role to suppress
immune responses to bacterial Ags. However, other regulatory mechanisms, involving the
regulation of immune responses specifically directed towards bacterial components, are
now suggested. They mainly concern the regulation of the NF-kB pathway, as described
previously, and where several inhibitory molecular mechanisms intervene (21-25).
Recently, it has been shown that the functionality of intestinal macrophages and DCs
is different from that of the peripheral compartment. In humans, and under physiological
conditions, neither macrophages nor enterocytes express CD 14, a surface receptor
involved in the response to bacterial LPS, and CD89, the receptor for IgA (51).
Consequently, they do not respond to LPS by inflammatory cytokine production. The
absence of CD89 on lamina propria macrophage down-regulates IgA-mediated
phagocytosis, an activity that normally induces the release of pro-inflammatory mediators
including reactive oxygen intermediates, leukotrienes, and prostaglandins. This fact
contributes to maintain the low inflammatory level in normal human intestinal mucosa.
Modifications of the intestinal homeostasis may modify the inhibitory factors of the
NF-kB pathway leading to secretion of pro-inflammatory cytokines (20), and/or up-
regulated CD 14 expression. During the inflammatory process in the intestinal mucosa,
CD 14 + blood monocytes are probably recruited to the mucosal increasing inflammatory
reactions. This is the situation prevailing in IBD, in which intestinal tolerance of its
microbiota has been shown to be deficient (4).
Antibody slgA Responses
Another important function elicited by the IIS is the secretion of slgA Abs, which
represent the most prominent Ab class at the mucosal surface. Secretory IgM Abs can also
contribute to surface protection in the case of selective IgA deficiency. Secretory IgA
perform "immune exclusion," which is a non-inflammatory immune response playing an
important protective role against enteropathogenic opportunistic microorganisms
(rotavirus, Salmonella, Shigella, Toxoplasma, etc.) for which the intestine constitutes an
important portal of entry. Thus, they prevent microbial adhesion, especially in the
duodenum where some pathogenic bacteria such as enterogenic E. coli can adhere.
Furthermore, they prevent viral multiplication in enterocytes and perform neutralization of
toxins. They also prevent the translocation of pathogenic and non-pathogenic bacteria
towards the systemic compartment and concomitantly prevent any damage to the
epithelium (52). Recently, it has been shown in mice, that dimeric IgA, when bound to the
secretory component (SC), are more efficient in protection against bacterial respiratory
infection (53). This effect is due to an appropriate tissue localization of slgA to mucus,
conferred by carbohydrate residues present in SC. This feature results in an optimal
protective effect of slgA at mucosal surface by immune exclusion.
Immune Modulation by the Intestinal Microbiota 103
In mice, a dual origin for IgA plasma cells in the small intestine has been shown. IgA
plasma cells originate from two lineages of B cells designated B-l and B-2, which differ
according to their origins, anatomical distribution, cell surface markers, Ab repertoire and
self-replenishing potential. B-l cells are maintained by self-renewal of cells resident in the
peritoneal cavity, and they utilize a limited repertoire that is mostly directed against
ubiquitous bacterial Ags. B-2 cells, originated from bone-marrow precursors, are present
in organized follicular lymphoid tissues, within PP, as precursors of plasma cells, and use a
large repertoire of Abs. Thus the slgA response to specific proteins Ags requires a classical
costimulation by Ag-specific T cells, an entero-enteric cycle as described previously, and
are secreted by IgA plasma cells derived from B2 lineage precursors in the PP. By contrast,
slgA Abs against Ags from commensal bacteria are T cell independent, polyspecific, and
are secreted by IgA plasma cells derived from the peritoneal cavity B-l cells (54). They
protect the host from the penetration of commensal bacteria. In mice, B-l lineage could
represent 40% of total IgA plasma cells. The contribution of peritoneal B cells to the
intestinal lamina propria plasma cell population in humans is still a matter of debate (33).
In conclusion, IIS have some phenotypic and functional characteristics, which
profoundly differ from those found in the peripheral immune system. An important
finding, which has emerged from recent studies, is the importance of the MLN in the
induction of both OT and active immunity (slgA secretion), where trafficking of DCs from
PP and lamina propria, after being loaded with Ag, could prime naive T cells. Indeed, total
and specific IgA-Ag responses, as well as OT induction are absent in mice that lack MLNs
(31). Many studies are, however, needed to get a better understanding of the mechanisms
involved in intestinal immune responses, and the conditions in which they are elicited.
They are important for the maintenance of the intestinal homeostasis, and are based on
a continual cross talk between all the immune cells of both IIS (including enterocytes) and
peripheral immune system and external events in which the digestive microbiota plays an
important role.
RELATIONSHIPS BETWEEN THE INTESTINAL IMMUNE SYSTEM
AND INTESTINAL MICROBIOTA
The intestinal microbiota has marked influences on the intestinal and peripheral host's
immunity. In some cases, the effects are produced by the whole intestinal microbiota,
whereas in other cases only one predominant bacterium is capable of producing a certain
immunostimulatory effect that is as effective as that of the whole microbiota. Moreover,
the post-natal period seems to play a crucial role in the cross talk between the intestinal
microbiota and the development of some important immunoregulatory processes,
especially those involved in the suppressive responses.
Most of the data come from original experimental animal models of germ-free (GF)
mice and gnotobiotic mice, i.e., GF mice colonized with known bacteria. The role of
intestinal microbiota in humans has largely been extrapolated from studies conducted on
probiotic bacteria, mainly Bifidobacterium and Lactobacillus strains, and from
epidemiological studies.
The intestinal microbiota acts on the three lines of defense of IIS. Recently,
very interesting papers have been published on the role of intestinal bacteria on natural
defenses, which are more or less related to innate defenses, especially on epithelium, which
belong to the IIS. Thus intestinal microbiota should act on: intestinal permeability (55),
production of fucosylated glycoconjugates (56), glycosylation of the intestinal cell layer
which is involved in resistance or susceptibility to intestinal infections by the presence or
104 Moreau
absence of appropriately glycosylated receptors (57) and, expression of angiogenins,
especially angiogenin 4 which may have microbiocidal properties (58). These results and
others, showing that the intestinal microbiota influence the gene expression in epithelial
cells (59), give new insights in the wonderful cross talk existing between bacteria
and epithelium.
The intestinal microbiota also interacts with the other lines of defense, innate and
acquired immunities. These effects can be of particular importance during the early
postnatal life that is a period of high risk for intestinal disorders due to enteric pathogens
and/or food hypersensitivities. During the neonatal period, mammalian species exhibit
some degree of reduced immunocompetence that could be attributed to a functional
immaturity in cells involved in immune intestinal responses. It could be also attributed to
the lack of bacterial stimulation given by the intestinal microbiota which is absent during
the fetal life. After birth, a well-balanced bacterial colonization will "educate" the IIS in
a good manner allowing immunoregulatory mechanisms governing IIS functions to
operate rapidly.
As already mentioned in the introduction, the activation, modulation and regulation
of the IIS are the main effects exerted by the intestinal microbiota. Gnotobiotic animal
models are useful in analyzing such effects of intestinal microbiota on IIS activities.
Experimental Animal Models: Gnotobiotic Mice
In experimental studies, the role of the digestive microbiota is determined by comparison
between GF and conventional (CV) animals, or GF mice colonized with a human fecal
microbiota, the humanized-mice. Several results show that the human fecal microbiota
reproduces the same immunostimulatory effects as those produced by the mouse intestinal
microbiota (60,61), and consequently, this mouse model is a very interesting tool for human
studies. The first step is the demonstration of the effect of the entire intestinal microbiota on
a specific immune response by comparison between GF and CV or humanized-mice. The
second step is to determine the bacteria that are responsible for the immunomodulatory
effect observed. For this purpose, GF mice are colonized with only one or several known
bacteria originated from mice or human microbiota. These "gnotobiotic mice," such as GF
mice, are reared in isolators under microbial controlled conditions. After oral colonization,
the bacteria expand rapidly to colonize the intestine to a very high level within one day.
A period of 3 weeks is estimated to be the time required for an optimal stimulatory effect of
the intestinal microbiota. Thus gnotobiotic models allow in vivo analysis of the specific
role played by the various bacteria composing the intestinal microbiota with respect to
immune responses. This has enabled demonstration that the bacterial immunomodulatory
effect is sometimes "strain-dependent." A more detailed discussion on the use of GF in the
study of the intestinal microbiota is described in chapter 15 by Norin and Midtvedt.
Activation of the Intestinal Immune System
It has been shown that the presence of intestinal microbiota plays an important role in the
development and activation of IIS even if many effects are still ignored. Its role may be of
particular importance in the neonatal period and could determine many of the outcomes
in later life.
As newborns, GF animals exhibit an underdeveloped IIS, which can be normalized by
bacterial colonization of the intestine with the fecal microbiota from a CV animal or human,
within 3 weeks. In GF mice, PPs are poorly developed, and germinal centers are absent. The
absence of digestive microbiota only affects some subsets of thymus-dependent IEL, the
Immune Modulation by the Intestinal Microbiota
105
single positive thymo-dependent CD4 + or CD8 + af3 IEL, the other thymo-independent
homodimeric aa CD8 + subpopulations of IEL (all the y5-IEL and part of the aP IEL)
being always present in GF mice (35). Cellularity of the LP is greatly reduced in GF mice
and it has been demonstrated that the intestinal microbiota is the major target of the IgA
plasmocyte development.
IgA-Secreting Cells
As in the neonate, the intestinal IgA-secreting cell (IgA-SC) number is much reduced in
adult GF mice. Three weeks after bacterial colonization of the intestine, GF mice have
an IgA-SC number equivalent to that found in CV mice. In the young, the adult number of
IgA-SC is reached at the age of 6 weeks in mice and between 1 and 2 years in babies (7).
This important delay might be attributed to the immaturity of the IIS of the newborn and/or
the suppressive effect of Abs present in the mother's milk. However, it might also be
due to the stimulatory effect of the intestinal microbiota that has been established
according to a sequential manner from birth to after weaning as described previously. To
test the later hypothesis, several models of adult gnotobiotic mice were colonized by the
entire digestive microbiota obtained from growing CV mice from one day after birth to
25 days of age (i.e., 6 days after weaning; 62). In these experimental adult models, the
effect of maternal milk, and the possible immaturity of the neonate were excluded, and
only the stimulatory effect of the digestive microbiota was tested. After 4 weeks, adult
recipients were sacrificed, and the immunostimulatory effect of the digestive microbiota
evaluated by the IgA-SC numbers present in intestinal villi by immunohistochemical
observations. Digestive microbiota of mice 3 to 21 days old exerted only a partial
stimulatory effect on the intestinal IgA-SC number in gnotobiotic recipients (Table 1).
However, gnotobiotic recipients colonized with the digestive microbiota of 25-day-old
mice had a similar IgA-SC number to that found in adult CV mice.
These results obviously show the important role played by the sequential
establishment of the digestive microbiota in full development of the intestinal IgA-SC
number and the pivotal role played by the bacterial diversification present after weaning in
this process. Results have been confirmed by other studies (7). Moreover, taking into
account the 3 -week delay between the bacterial stimulus and the intestinal IgA-SC
response, these results showed that the neonate is capable of developing a slgA response at
birth, the intensity of which depends on the stimulatory capacity of the intestinal bacteria
present in the intestine. It is tempting to project such results onto infants where the full
development of the intestinal IgA-SC number observed at 2 years of age is correlated to
the stabilization of the intestinal microbiota.
Table 1 Effect of the Sequential Establishment of Intestinal Microbiota of Growing CV Mice on
the Maturation of Intestinal IgA Plasma Cells Measured in Gnotobiotic Mice
Gnotobiotic mice harboring the digestive flora of:
IgA plasma cell number/villus
Adult conventional mice
Adult germ-free mice
Growing conventional mice 1-4 days old
Growing conventional mice 7-23 days old
Growing conventional mice 25 days old
41 + 1
4 + 0.5
15 + 2
23 + 1
43 + 1
Source: From Refs. 62, 63.
106 Moreau
Attempts have been made to elucidate the role played by individual bacterial strains
present in the digestive microbiota of CV growing mice (63). Results showed that some
Gram-negative bacteria such as E. coli or Bacteroides play an important adjuvant role on
this immunological non-specific effect, probably due to the LPS present in the cell wall of
these bacteria (7). These studies have shown the importance of the intestinal microbiota
diversification on the complete development of IIS in young. They promote insight into
the close correlation between dietary modification and intestinal microbiota diversification
and consequently its effect on the infantile IIS. Excessively early or late dietary
modification may have consequences on quality of the intestinal microbiota equilibrium
and, consequently, may affect the development of the IIS.
Dendritic Cells
As described above, the intestine is populated by some characteristic subsets of DCs,
which are believed to play a pivotal role in the orientation of the acquired immune
responses towards tolerance. Is the intestinal microbiota the main factor that determines
such characteristics? Currently, only few studies exist in this field.
From some studies, it appears that inflammatory stimuli are very important for
maturation of DCs in GF mice as well as in neonates, and the intestinal microbiota could
afford such stimuli. It has been demonstrated that the rapid and constitutive trafficking of
DCs from the IIS to the MLNs can be increased by the presence of inflammatory stimuli,
such as LPS (64). Other studies have shown that it is possible to increase the rate of
postnatal development of the intestinal DC population in rats by intra-peritoneally
administration of IFN-y (65). We can conclude that these inflammatory factors are
physiologically important to maintain activation of DCs and the intestinal microbiota may
have an important part in this process.
Another question concerns the specific functions of intestinal DCs. Are there
specific distinct lineages of DCs attracted into the intestinal mucosa under the control of
specific chemokines or adhesion molecules, or are precursor DCs modified after their
arrival in the tissue? In his interesting review (31), Mowat explains that, given the
plasticity of DCs in other tissues, it is reasonable to believe the latter hypothesis, and
mucosal DCs are the cells that integrate the genetic and environmental factors to shape
T-cell responses to local Ags in ways such that homeostasis is maintained. Intestinal
epithelial cells, by the ability to constitutively produce TGF-(3 and by the regulatory
factors controlling inflammatory cytokine secretion, could be the first level of regula-
tory control. Moreover, recent studies have shown that lamina propria stromal cells
constitutively produce cyclo-oxygenase 2 (COX2)-dependent protaglandin E2 (PGE2)
under the influence of the physiological levels of LPS that are absorbed from intestinal
microbiota. These metabolites act as down-regulators of the immune response to dietary
Ags (66). Moreover, DCs themselves might also express COX2 and produce PGE2 in
response to LPS. As PGE2 is known to polarize DC differentiation towards an IL-10-
producing inhibitory phenotype, this would explain the prevalence of such DCs in the
normal gut (67).
The subunit p40 is present in IL-12 and IL-23, which are both Thl -inducing
cytokines. In a elegant study, Becker and coworkers (40) using transgenic mice expressing
a reporter under the control of the IL-12p40 subunit promoter, showed that some subsets of
lamina propria DCs, present in the small intestine but not in the colon, constitutively
exhibited transgene expression. This expression was restricted to the ileum, associated
with the intracellular nondegraded bacteria as revealed by fluorescent in situ hybridization
(FISH), and was not found in the ileum of GF mice. In addition to supporting literature
Immune Modulation by the Intestinal Microbiota 107
elsewhere (68), these results obviously show how the presence of the intestinal microbiota,
which become more abundant in the ileum, can influence the immune responses elicited
at this specific area of the intestine. They afford new data on the compartmentalization of
the IIS, which have to be considered carefully to avoid erroneous conclusions.
In conclusion, GF, and gnotobiotic animal models are very useful tools to gain new
insight into the fundamental role played by the intestinal microbiota on the complete
activation of the IIS, with functional consequences. In certain aspects, adult GF mice, in
which the IIS is poorly developed, may be considered as similar to that of the neonate and
immunological immaturity of neonates can be questioned.
Modulation of Specific Immune Responses:
The IgA Anti-Rotavirus Response
Little information is available regarding the role of intestinal microbiota composition on
the modulation of the specific slgA Ab response against enteropathogens. Indeed, it can be
assumed that, according to the composition of the digestive microbiota and the presence,
or not, of some bacteria in the dominant microbiota, the specific immune responses might
be different.
This fact is of particular importance in babies where the poorly diversified intestinal
microbiota is strongly influenced by the type of milk. Indeed, it is well known that breast-
fed babies are more resistant to enteric infections than formula-fed babies (69,70). Human
breast milk contains abundant bioactive components that may provide direct protective
effects to infants against enteric pathogens (71), but breast-feeding also influences the
intestinal microbiota composition enhancing Bifidobacterium development. To test the
influence of the intestinal microbiota on the modulation of a specific intestinal slgA-Ab
response, a slgA anti-rotavirus response was established in a mouse model. This involved
an original model of adult gnotobiotic mice colonized with the fecal microbiota of a
breast- or a bottle-fed infant and then orally inoculated with a heterologous simian
rotavirus strain S A- 1 1 . As previously described, the adult mouse model described here
excluded breast milk effects and the possible immaturity of the neonate immune system
[(72) and manuscript in preparation].
Bacterial strains found in the dominant fecal microbiota of a breast- or formula-fed
baby were isolated and inoculated in the digestive tract of the gnotobiotic mice. They
established in a similar manner as in babies. "Breast-fed mice" were colonized with
Bifidobacterium, Escherichia coli and Streptococcus, while only two Gram-negative
bacteria, E. coli and Bacteroides, colonized the digestive tract of "formula-fed" mice. The
two groups of gnotobiotic mice were similar in all respects except for the intestinal
microbiota and especially by the presence or absence of Bifidobacterium. They were orally
inoculated with rotavirus 3 weeks after bacterial colonization to allow the bacteria time to
affect the immune system of the host. The kinetics of slgA anti-rotavirus Ab responses
were measured in feces by enzyme linked immunosorbent assay (ELISA) over a one
month period of time and at sacrifice, numbers of slgA-anti-rotavirus secreting cells were
evaluated in the small intestine by solid phase enzyme-linked immunospot (ELISPOT)
assay.
Kinetics of the slgA anti-rotavirus response were similar in the two groups of
gnotobiotic mice, but the maximal level, that was reached 20 days after viral inoculation,
was approximately 4-fold higher in "breast-fed" than in "formula-fed" gnotobiotic
mice (Fig. 3). The same difference was measured for the slgA-anti-rota virus secreting cell
numbers. To assess the respective immunomodulatory role of two bacteria present
in the baby's intestine, Bifidobacterium bifidum (Gram-positive bacteria) and E. coli
108
Moreau
Gnotobiotic mice : « Breast-fed baby »
(Bifidobacterium, Escherichia coii,
Streptococcus)
Gnotobiotic mice « Formula-fed baby »
(Escherichia coii, Bacteroides)
Oral Inoculation with rotavirus
Three weeks later; level of anti-rotavirus slgA antibodies in feces
18 AU 5AU
Abbreviation: AU, arbitrary units
Figure 3 Adjuvant effect of the fecal microbiota of breast-fed babies on the intestinal anti-
rotavirus antibody response measured in gnotobiotic mice. Source: From Ref. 72.
(Gram-negative bacteria), two other groups of gnotobiotic mice were created. Results
presented in Table 2 obviously show the adjuvant capacity of the strain of Bifidobacterium
bifidum on the intestinal slgA anti-rotavirus response while, in contrast, E. coii exerted a
suppressive effect, as compared with GF mouse response. These results show how the
presence of Bifidobacterium bifidum in the fecal microbiota of babies modulates the
suppressive effect exerted by the presence of E. coii. Given the importance of rotavirus
infections as a cause of infantile diarrhea worldwide, the presence of Bifidobacterium in
the intestinal microbiota of babies is of great interest to stimulate this protective Ab slgA
response. These results can be compared to those found previously, which showed that a
strain of Lactobacillus rhamnosus GG, used as a probiotic, and given to babies suffering
from rotavirus diarrhea, shortened the diarrhea duration, and stimulated the specific IgA
anti-rotavirus response (73,74). Other studies have shown an enhancement of serum or
intestinal Ab response to orally administered Ags by Gram-positive bacteria (75),
especially lactic acid producing bacteria used as probiotics (76).
These results also showed that GF mice are able to mount a slgA anti-rotavirus
response while its IIS is poorly developed suggesting a lack of correlation between the
non-specific IgA response induced after bacterial colonization and the specific anti-
rotavirus Ab response. The latter findings confirm previous results from Cebra and
coworkers (77). Such data have also been described in humans where one- week-old
babies are capable of developing protective immunity following oral vaccination with
poliovirus or hepatitis B virus while the complete development of natural slgA is only
achieved several months later (78). Consequently, the ability to give a highly specific
slgA anti-rotavirus Ab response could be correlated with the modulatory effect of
intestinal bacteria rather than with the development of IIS. Mechanistic studies are
required to clarify the molecular basis upon which some digestive bacteria modulate the
slgA Ab response to enteric pathogens.
The adjuvant effect of Bifidobacterium sp. may be strain-dependent. In a recent study
we have shown that four different species of Bifidobacterium isolated from the fecal
Immune Modulation by the Intestinal Microbiota 109
Table 2 The Gut Colonization of Different Bacterial Strains Modulates the Intestinal
Anti-rotavirus IgA Antibody Response Measured in Gnotobiotic Mice
Anti-rotavirus slgA antibody
Intestinal microflora of gnotobiotic mice level (AU/g of feces)
Bifidobacterium bifidum (from baby) 3 1 + 7 a f
Bifidobacterium DN 173 010 (a commercial strain) 21 ±3 a t
Germ-free (control) 11+2
Bifidobacterium infantis + B. pseudocatenulatum + 4 ± 1 a |
B. angulatum + B. sp (from human adult)
E. coli (from infants) or Bacteroides vulgatus (from 4 + l a J,
human adult)
a Significant difference with germ-free mice (/?<0.01).
Abbreviation: AU, arbitrary units.
Source: From Refs. 72, 79.
microbiota of an adult human lacked the adjuvant ability to stimulate the slgA anti-
rotavirus response in gnotobiotic mice but, on the contrary, exerted a suppressive effect as
do E. coli (Table 2) (79). Thus, the modulating effect of Bifidobacterium is strain-
dependent, as it has also been described for different Lactobacillus strains used as
probiotics in other mice studies (80). Taken together, these data suggest that it is important
to define the modulatory effect of the strains of bifidobacteria either normally colonizing
the digestive tract of babies after birth or given as probiotics, to modulate in a good
protective way a specific intestinal immune response.
In conclusion, and on the basis of the experimental and clinical data, we may
consider that the presence of certain bacterial strains in the infantile intestinal microbiota,
namely some strains of Bifidobacterium, or some transiting strains of probiotics, enable
activation of the mechanisms that result in optimization of the anti-rotavirus protective
IgA Ab response. Elucidation of the immunomodulatory mechanisms must now
be pursued.
Regulation of the Immune Responses
Tolerance to Soluble Proteins: Oral Tolerance
The role of the intestinal microbiota on the OT process has been demonstrated by various
experimental studies using GF mice. Results depend on the immune response considered,
oral Ag, and experimental schedule used. In these experiments, immune responses to
a specific Ag are compared in two groups of mice: the tolerant group where mice are fed
with an Ag prior to the peripheral immunization with the same Ag, and the control group
fed with only the buffer before the same peripheral immunization. Specific immune
responses to the Ag used are then evaluated (Ab responses in serum or cellular response
by delay ed-type hypersensitivity) in both groups. The tolerant state is present when
peripheral immune responses to the Ag are abolished or significantly decreased in the
group Ag-fed as compared with the control group.
In an initial study, Wannemuehler and coworkers (81) showed that, in contrast to
what is observed with the CV mice, gavage of GF mice with a particular antigen, sheep red
blood cells (SRBC), does not enable suppression of immune responses to SRBC in serum.
However, the OT process was re-established when LPS was administered orally prior
to gavage. The authors concluded that Gram-negative bacteria play a fundamental role in
110 Moreau
the mechanisms responsible for OT. Subsequently, other experiments using adult GF mice
fed with a soluble protein, OVA, in order to study the immune suppression of anti-OVA
serum IgG response, demonstrated that it was possible to induce OT in GF mice. However,
in contrast to what is observed with CV mice, the suppression was of very short duration,
about 10-15 days, versus more than 5 months in CV mice (82). Similar results were
obtained in human-microbiota-associated gnotobiotic mice (60). Colonization of the
intestinal tract with E. coli alone prior to gavage was sufficient to restore lasting
suppression (83), and the same results were obtained with another Gram-negative bacteria,
Bacteroides (unpublished personal data), while in our experimental conditions, adult GF
colonized with the strain of Bifidobacterium bifidum isolated from a baby's feces, had no
effect on the serum IgG anti-OVA suppression (83).
Recently, in their experimental conditions, Sudo and coworkers (84) showed that in
OVA-fed mice, the GF state does not allow suppression of the systemic anti-OVA IgE
response in serum in contrast to what is observed with CV mice. Colonization of the
intestinal tract by a strain of Bifidobacterium infantis restored the suppression but only
when the strain colonized the intestinal tract of the mouse from birth. The importance of
the presence of intestinal bacteria from birth in the optimization of the immune processes
has also been suggested in a more recent study (60).
It is interesting to compare these experimental results to those described in human
neonates by Lodinova-Zadnikova and coworkers (85). In their study, they colonized
the digestive tract of babies just after birth with a given strain of E. coli. In these conditions
E. coli is able to establish durably in the digestive tract of newborns as described
previously (86). After 10 years (preterm infants) and 20 years (full-term infants),
differences in occurrence of food allergies between colonized and control subjects were
statistically significant; 21% versus 53%, and 36% versus 51% respectively. Furthermore,
recent clinical trials using ingestion of a strain of probiotic, Lactobacillus rhamnosus GG,
during the last month of pregnancy to women and after birth to babies during 6 months,
reduced the incidence of atopic eczema in at-risk children during the first 4 years of
life (87). However, in this case, IgE levels were not decreased in the treated group as
compared with the placebo group. The protective mechanisms of these interventions are
not elucidated.
All these experimental data show the importance that a single bacterial strain present
in the intestinal digestive microbiota of infants may have with respect to the establishment
of tolerance mechanisms. Are there E. coli, Bacteroides or some strains of Bifidobacterium
which play this important role? First, as suggested by previous studies, it is not sure
whether the mechanisms are the same for suppression of the various isotypes IgG and IgE
(45,88), and consequently that the same bacteria are operating on them. Secondly, as
described previously, all the strains belonging to the same bacterial genus have not the
same immunoregulatory properties and it is conceivable that some Bifidobacterium strains
may have regulatory properties on suppressive immune processes.
The cellular ways by which the bacteria are acting, and the exact bacterial
components involved are not known. However, from an ecological point of view, it is
important to note that some experimental data point out the importance of the neonatal
period with respect to the ability to recognize bacterial messages.
Tolerance to the Intestinal Microbiota
An important question is why the intestinal microbiota does not mount an inflammatory
response in the gut while this state is broken in pathologic conditions such as IBD?
Immune Modulation by the Intestinal Microbiota 111
The mechanisms by which commensal and non-pathogenic bacteria are tolerated
by the IIS is beginning to be understood and may result from a cross-talk between
bacteria, epithelium, and immune cells. In an interesting experimental study, Neish
and co-workers (89) demonstrated, using an in vitro model of cultured human intestinal
epithelial cells, that a non-pathogenic strain of Salmonella directly influenced the
intestinal epithelium to limit inflammatory cytokine production. They showed that the
immunosuppressive effect was due to the inhibition of the NFk-B activation pathway by
blockage of IkB-oc degradation. Another interesting conclusion from this study was that
non-pathogenic bacteria, which do not belong to the commensal intestinal microbiota,
are unable to induce inflammatory responses. Another study converges to an opposite
conclusion (90). In several intestinal epithelial cell lines, the authors demonstrated that
a commensal bacterial strain, Bacteroides vulgatus, was able to activate the NF-kB
signaling pathway through IkB-gc degradation and RelA phosphorylation. However, the
presence of TGF-P1 cytokine inhibits B. vw/ga to-mediated NF-kB transcriptional
activity showing that the responsiveness of intestinal epithelial cells to luminal enteric
bacteria depends on a network of communication between immune and epithelial cells
and their secreted mediators.
Recently, it was shown in vivo in mice, that the intestinal microbiota itself plays
a regulatory role with respect to inhibition of the NFk-B activation pathway, by the way of
another inhibitory factor, the peroxisome proliferator-activated receptor (PPARy) (61).
The latter is highly expressed in the colon and its activation has anti-inflammatory effects,
with protection against colitis. PPARy activators are able to limit inflammatory cytokine
production through the inhibition of the NF-kB pathway. It has been suggested that PPARy
could play an important role in homeostasis of the gut, especially in the colon. In patients
with IBD, impaired expression of PPARy in colon epithelial cells was observed (61).
In the same work, in vivo observations showed that the intestinal microbiota and TLR-4
regulates PPARy expression by epithelial cells of the colon. Indeed, it is highly expressed
in CV mice while it is barely detectable in GF mice. When TLR-4 transfected CaCo-2 cells
were incubated with LPS, an increase of PPARy expression was observed showing
the involvement of TLR-4 in this process and suggesting that PPARy may be a regu-
latory factor able to shut down the TLR-4 signaling given by bacterial LPS abundant in
the colon (61).
Taken together, these data provide evidence that the cross-talk existing between the
IIS and intestinal microbiota pass through regulatory processes preventing inflammatory
responses induced by activation of some nuclear factors, such as NF-kB, which could be
different, or predominant, according to the intestinal site. They are mediated through the
actions of commensal bacteria, but also through exogenous non-pathogenic bacteria action
and this data is of importance in terms of nutrition. Indeed, we can ingest billions of
exogenous bacteria in some foods such as fermented milks and some cheeses, without
detrimental consequences. In terms of pathology, a lot of other questions concerning the
mechanisms and origin of IBD have yet to be answered. Why is an activation of the NF-kB
pathway observed in IBD? Is it due to some subsets of the intestinal microbiota, which are
suddenly dominant in an unbalanced microbiota? Is it due to enteropathogens which can
interact with the NF-kB pathway during infection? Or, is it due to a decrease and
modification of mucus secretion allowing excessive adhesion of commensal bacteria?
All these factors, and others, may be responsible.
It is interesting to give recent clinical results concerning oral administration of
probiotics on the maintenance of the remission phase in IBD, either the use of a mixture
of 8 strains of lactic-acid bacteria used as probiotics (VSL#3) in chronic pouchitis (91), or
a yeast strain, Saccharomyces boulardii (92) or the E. coli Nissle 1917 (93) in ulcerative
112 Moreau
colitis. The mechanisms underlying such beneficial effects are still not known and they are
multifactorial. From experimental data it has been suggested that a stimulation of the non-
inflammatory IL-10 cytokine production by ingestion of probiotics may be involved
in such protective effect (94). Further experimental and clinical studies need to be
conducted to further elucidate the mechanisms involved in the epithelium-bacterial
cross talk.
RELATIONSHIPS BETWEEN THE PERIPHERAL IMMUNE SYSTEM
AND INTESTINAL MICROBIOTA
Activation of the Immune System
Innate immunity plays a very important role in the activation of the immune system and
the ability to develop specific acquired immune responses. Through their Ag-presenting
activity and the synthesis of numerous pro-inflammatory chemokines and cytokines (IL-8,
IL-1, IL-6, TNF-a, and IL-12), macrophages, and DCs play a key role in the regulation
of immune responses. They are the gatekeepers of the host, generating innate resistance to
pathogens, and specific immune responses by the stimulation of T-cell-acquired immunity
and regulation of the TH1/Th2 balance.
It has been postulated that the immune defects in neonates may result from
a developmental immaturity of APC functions (78), and bacterial components resulting
from intestinal colonization could be an important factor for maturation of APCs (95).
Recently, Sun and coworkers (96) investigated the ontogeny of peripheral DCs and their
capacity to provide innate responses to microbial stimuli in early life. They show that
neonatal murine spleen DCs have intrinsic capacity to produce bioactive IL-12. Moreover,
after microbial stimulation given in vitro by LPS, they are able to up-regulate MHC and
costimulatory molecule expression required for productive interaction with naive T cells.
Thus, neonatal DCs could be fully competent in their innate functions but they need to be
activated, through TLR recognition as described previously, by bacterial stimuli afforded
by the intestinal microbiota. Another interesting study supports this hypothesis. Nicaise
and coworkers (97) demonstrated that the presence of the intestinal microbiota underlies
IL-12 synthesis by macrophages derived from splenic precursors.
On the basis of those experimental data, one can wonder whether the first bacteria
colonizing the intestinal tract, E. coli, rich in LPS, and subsequently bifidobacteria rich
in peptidoglycan and CpG dinucleotides, do not play such crucial activating roles? It is
conceivable that in newborns, the abrupt colonization of the intestinal tract by the
microbiota may induce a physiological inflammatory reaction with, as a consequence, an
increase in intestinal permeability, bacterial translocation and systemic activation of
immune cells, especially APCs. Experimental evidence supports that hypothesis. Studies
in mice have shown that the presence of the intestinal microbiota induces the synthesis of
pro-inflammatory cytokines IL-1, IL-6, and TNF-a by peritoneal macrophages. Such
effects can be reproduced in gnotobiotic mice colonized with E. coli alone while
a Bifidobacterium bifidum strain isolated from baby's feces had no effect (Table 3) (98).
Other non-specific resistance factors play an important role in host defense
mechanisms to infection. GF and gnotobiotic animal models have showed that some
functional parameters involved in innate immunity, phagocytosis, complement system,
and opsonins, are expressed to a lesser extent than in CV animals (99).
IL-6
TNF-a
6,33
72
2,62 a
<50 a
2,46 a
<50 a
7,24 b
108 b
Immune Modulation by the Intestinal Microbiota 113
Table 3 Influence of Intestinal Bacteria on the Inflammatory Cytokine Production by Peritoneal
Macrophages
Gnotobiotic mice Cytokines (units/ml)
IL-1
Conventional 18200
Germ-free 8300 a
Bifidobacterium bifidum 8000 a
Escherichia coli 15350
a Significant difference with conventional mice (/?<0.01).
Not significant.
Abbreviations: IL, interleukin; TNF, tumor necrosis factor.
Source: From Ref. 98.
Modulation and Regulation of Immune Responses
Balance Thl/TKl
Experimental results, epidemiological studies and clinical trials strongly argue for the fact
that bacterial environment plays a crucial role in the Thl/Th2 balance via different
mechanisms of which cytokine synthesis by innate immune cells, especially IL-1 2, and
IFN-y, could play a decisive role.
The prenatal period and early childhood are considered to be critical for the
establishment and maintenance of a normal Thl/Th2 balance. It has been described that
the immune context at birth is mainly Th2, while Thl responses are partially suppressed,
enabling non-rejection of the fetus during gestation. After birth, neonates must rapidly
restore the balance by developing the potential to induce Thl -type responses (100).
Various studies have shown that, in atopic infants, the switch does not occur, and the infant
is in a context of an imbalance toward Th2 with a predisposition to development of IgE
responses (101,102). The neonatal period is thus considered to be extremely important in
enabling regulation of the Thl/Th2 balance to become operative, and the switch could
occur during the first 5 years of life especially during the first year of life (103).
The Th2— >Thl switch is dependent on multiple factors whose relative importance
has yet to be elucidated. Bacterial stimuli are considered to play a considerable role, and
some years ago it had been claimed that infections might prevent the development of atopic
diseases. This is referred to as the "hygiene hypothesis" (13), but it is now a matter of
debate. From a recent study (104), authors did not find any evidence that exposure
to infections in infants reduces the incidence of allergic disease, but, in contrast, exposure to
antibiotics may be associated with an increased risk of developing allergic disease. Today,
accumulating evidence suggests that rather than infections, alteration of the composition of
the intestinal microbiota early in life may be an important determinant of atopic status
(13,105). Experimental studies have supported this hypothesis. Thus, in one-week-old rats,
peripheral immunization leads to a Th2-biased memory response. However, when the rats
are concomitantly administered a bacterial extract by the oral route with immunization, the
memory response switches to both Thl and Th2 (106). Another study showed how, in three-
week-old mice, the disturbance in intestinal bacterial equilibrium following ingestion of an
antibiotic, kanamycin, promoted a shift in the Thl/Th2 balance toward a Th2-dominant
immunity, while it became Thl and Th2 in non-treated growing CV mice (107). Ingestion
of intestinal bacteria such as Enterococcus faecalis five days after antibiotic treatment
again permitted the shift back towards the Thl/Th2 balance (108).
114 Moreau
From an epidemiological point of view, very interesting studies argue in favor of
the important role of the bacterial environment in the first year of life in order to ensure the
good orientation of immune responses preventing the short- and long-term development of
atopic diseases (13,101,103,109-111). Recent comparative studies have been conducted
in children living in the same allergenic environment but under different life- style
conditions, urban and farming environments. Results showed that substantial protection
against development of asthma, hay fever, and allergic sensitization was seen only in
children exposed to stables, farm raw milk, or both in their first year of life (103). Authors
also found that prenatal exposure of women had a substantial protective effect.
Bacteria that are responsible for such effects are not known. Gram-negative bacteria
rich in LPS have been suggested to be important in that phenomenon (85,109,1 12) but it is
also possible that Gram-positive bacteria, such as bifidobacteria and Lactobacillus, are
involved. The comparative study between Swedish and Estonian children (105) has
suggested a specific role of the intestinal microbiota, regarding its nature, diversity and
changes with time. Besides genetic factors, which are known to play an important role in
the development of allergic diseases, all these data suggest that the infant intestinal
microbiota normally rich in Gram-negative (LPS-producing) and Gram-positive bacteria
may not be well-balanced in atopic children. Depending on the microbial environment
associated with the life-style, especially during the first year of life, a restoration of the
normal balance could be achieved.
Clinical trials using probiotics to treat or prevent atopic eczema in infants have also
generated arguments suggesting that the infantile intestinal microbiota balance plays an
important role in the good orientation of immune responses. In a recent double-blind trial,
Kalliomaki and coworkers (87) have shown that the supplementation of pregnant women
one month before delivery followed by 6 months post-parturition (mother or baby) with
a probiotic strain, Lactobacillus rhamnosus GG, lead to a significant decrease in the
incidence of atopic eczema in babies with a family history of atopic disease. At two years
of age, atopic eczema was diagnosed in 23% of treated babies versus 46% in the placebo
group. The preventive effect of L. rhamnosus GG extends to the age of 4 years follow-up
treatment (87). The mechanisms involved in such a protection are unknown. Indeed, the
frequencies of positive skin-prick test reactivity (measuring the specific IgE levels) were
comparable between treated and placebo groups. Further studies are necessary to elucidate
the mechanisms responsible for these interesting protective effects.
On the basis of all the above data, questions arise with respect to delivery conditions,
infant feeding, and antibiotic treatments to be administered during infancy in order to
enable and optimally establish and maintain integrity of the intestinal microbiota.
Probiotics may also be considered as good palliative agents with respect to impaired
equilibrium of the intestinal microbiota. Knowledge of the immunoregulatory
mechanisms driven by the intestinal microbiota of infants, as well as the bacterial
components which are involved, are crucial to prevent some pathologies which are
dramatically increasing today.
Natural IgG
In the absence of immunization, there is a natural level of immunoglobulins (Ig) in serum
named "natural Ig" or "natural Abs." The roles of those Abs in the immune responses have
yet to be completely elucidated but it is known that they play important regulatory roles in
humoral immune responses, especially in immune responses to self-Ag (113). It has also
been demonstrated in mice that they intervene with the development of the B
repertoire at peripheral level (spleen), enabling expansion of the Ab response towards
Immune Modulation by the Intestinal Microbiota 115
thymo-dependant Ags (114,115). In man, the role of these natural Abs is under
investigation in the context of research on certain autoimmune disease (116).
Intrinsic and extrinsic factors, especially the intestinal microbiota, act on the natural
Ig levels, depending on isotypes and sub-classes. Thus, GF mice had normal serum IgM
levels, but IgG, and IgA levels are approximately 5% of conventionally reared littermates
(1 14). It has been established in mice that one of the roles of the natural IgG is to expand
B cell repertoire. The latter can be evaluated through the expression of some genes coding
for the variable part of the heavy chain of Ig (VH gene) using probes. Analysis of a VH
gene expression has provided a quantitative tool for the global assessment of Ab
repertoire, and a preferential use of the gene means that the repertoire is poorly diversified.
Early in ontogeny, a high frequency of B cells could bind to multiple Ags, among
which auto-Ags are found, in neonatal CV mice. This fact has been correlated with
preferential use of VH gene family, namely VH7183. In CV adult mice these multi-
reactive B cells are much less frequent coinciding with a random usage of VH genes, as
seen by the decreased utilization of VH7173 gene family, showing a diversified repertoire.
Thus, there is a maturation of the immune system of adult CV mice. This fact is not present
in adult GF mice where a high percentage of B cells expressing VH 7138 genes is found as
in neonatal CV mice (115). The injection of purified natural IgG Ig from serum adult CV
mice into GF mice reduced the use of the VH7183 gene family in the peripheral B-cells, as
in CV mice (115). From these data authors concluded that if a genetic program leading to
non-random position-dependent preference of rearrangement and expression initially
controls the establishment of the VH repertoire, a broader utilization of the B-cell
repertoire is thereafter stimulated by environmental Ags and Igs. The finding that GF mice
maintain a "fetal-like" VH repertoire that can be modified by the administration of pooled
Igs from normal unimmunized CV mice establishes the crucial role of the intestinal
microbiota in this function.
This data may have clinical relevance. Many reports have described the beneficial
results of intravenous injection of normal human IgG in treatment of autoimmune
disease (116).
The mechanism by which exogenous antigenic stimulation can influence the
expression of VH gene remains unclear. Exogenous Ags may play an important role in
the final modulation of the expressed repertoires either by direct stimulation of Ag-specific
clones or indirectly by idiotype interactions mediated by the Abs produced in those
responses (113-115).
Autoimmune Diseases
One example of the regulatory effect exerted by intestinal microbiota on an autoimmune
disease has been reported by Van der Broek and co-workers (117). Streptococcal cell wall
(SCW)-induced arthritis is a chronic erosive polyarthritis, which can be induced in
susceptible rats by a single intra-peritonal injection of a sterile aqueous suspension of
SCW. The acute phase of the disease develops within a few days, the second, chronic
phase, which mainly involves peripheral joint inflammation, develops from 10 days after.
The second phase is dependent on functional T lymphocytes. F344 rats are genetically
described as resistant to the second chronic phase, while in contrast another strain of rats,
Lewis rats, are described as susceptible. These data suggest that a T-cell unresponsiveness
due to immune tolerance to SCW may be the mechanism underlying resistance to SCW-
induced arthritis of F344 rats, while Lewis rats are defective in their tolerance. When
F344 rats are reared in GF conditions, they become susceptible to SCW-induced arthritis
as are Lewis rats. There was a correlation between the susceptibility of the disease and the
116 Moreau
T cell proliferation response to SCW measured in vitro. In CV Lewis and GF-F344 rats,
a proliferation was measured while it was not present in CV F-344 rats. This concept that
disease might result from a similarity between naturally occurring cell surface Ags of the
host and those expressed on some commensal or pathogenic micro-organisms have been
referred to as the "molecular mimicry hypothesis." Mono-association of GF F344 rats
with E. coli resulted in resistance, which equaled that in CV F344 rats whereas
mono-association with a Lactobacillus strain did not really affect susceptibility. Thus,
in CV F-344 rats, a state of tolerance to arthritogenic epitopes is induced during the
neonatal period of life and maintained through life by the bacterial microbiota, resulting
in resistance to SCW-induced arthritis. In Lewis rats, this tolerant state is deficient and/or
easily broken.
Bacterial effects have been suggested in other autoimmune diseases. Thus, oral
antibiotic treatment after adjuvant-induced arthritis (AIA) induction in rats significantly
decreased clinical symptoms of AIA while, concomitantly, E. coli levels increased in the
distal ileum of antibiotic-treated rats (118). In addition, it has been described that
Mycobacterial infections profoundly inhibit the development of diabetes in non-obese
diabetic (NOD) mice (119).
CONCLUSION
From all the experimental epidemiological and clinical results presented here, the
digestive microbiota can be considered as an organ: it is specifically tolerated by
the host and in turn, it exerts many continuous regulatory effects on intestinal and
peripheral host's immune responses. Consequently, it plays fundamental roles in health.
It is very important to develop knowledge about its composition, the bacterial components
and metabolites that participate to such immunoregulatory effects, and the exact
mechanisms involved.
Studies from GF animals have demonstrated the importance of the digestive
microbiota on intestinal and peripheral immune systems. In some cases, the entire
digestive microbiota is needed to obtain the complete effect while other immunoregulatory
effects can be reproduced with only one bacterium and sometimes with only specific
strains. Because the intestinal microbiota is a dynamic community which modifies from
birth to old age in predominant bacteria composition, specific targeted interests have to be
defined for the study of relationships between the intestinal microbiota and the host,
according to age. Indeed, bacterial species found in the predominant microbiota are not
constantly the same throughout life and several studies have demonstrated the strain-
dependant immunomodulatory effect of bacteria. For instance, some strains of
bifidobacteria, such as B. breve, are more commonly found in infants but less in adults
(120). Other studies from adult GF animals have demonstrated that some bacterial effects
are only obtained when the bacteria colonized the intestinal tract from birth indicating that
the bacterial effects need some characteristics of the neonate immune system. A number of
indirect findings converge toward the idea that the neonatal period is crucial for the infant
with respect to setting up the regulatory mechanisms which will play an important role in
the good orientation of immune responses throughout life. Because of the long-term
consequence of the establishment of appropriate immunoregulatory networks, it is very
important to develop knowledge on the cross-talk between the intestinal microbiota and
immune system early in life. In this context, recent studies of the innate responses to
bacterial constituents should generate decisive information in support of the role of the
intestinal microbiota.
Immune Modulation by the Intestinal Microbiota 117
In adults, regulation of immune responses seems to be constantly reshaped by
persistent interactions between the host and its digestive microbiota.
Today, an increasing challenge for researchers studying immunity (IIS as well as
oral or peripheral immune responses after Ag vaccination, pro-, and prebiotic effects) is
that the intestinal microbiota of experimental rodents used is not defined and can differ
between breeders because of the great variety in housing conditions. Since the
development of knock-out mice, which are very sensitive to infections, the microbial
status required by experimenters has led to the production of highly clean animals which
carry a commensal microbiota with reduced diversity. This fact has probably a significant
impact on the development of the immune responses. Thus, because results could not
reflect the exact conditions of microbial stimulation, the interpretation of experiments
may be completely different according to different laboratories. Some controversial
results obtained in mice and humans might also be explained by such paucity of mouse
microbiota existing in pathogen-free mouse breeding-care units. Now, it is crucial to
develop animal models in which the commensal microbiota will be better defined and
designed to allow the maintenance of biological features relevant in the field of
immunological investigations.
A more comprehensive understanding of the relationships between the intestinal
microbiota and innate and acquired immune systems should offer new approaches for the
therapy of some diseases such as allergies and IBD and for the design of oral vaccinations,
and the maintenance of health. Beneficial micro-organisms such as probiotics, and dietary
ingredients such as prebiotics, that act on the digestive microbiota, show promise for
treatment in these immune-related intestinal disorders. Researchers addressing those
subjects have to consider the digestive microbiota in their investigations.
All of the studies presented here clearly indicate the close relationship between the
prokaryotic and eucaryotic worlds, and the intricacy and complexity of the relationships.
Much work remains to be done and much is left to discover about our intestinal microbiota
and immunity. It is to be hoped that the current enthusiasm with respect to the interest in
the action of intestinal microbiota on immunity will continue to increase. The practical
applications that can emerge in terms of human health can be highly significant.
REFERENCES
1. Sanders ME. Probiotic bacteria: implications for human health. J Nutr 2000; 130:384S-390S.
2. Isolauri E, Sutas Y, Kankaanpaa P, Arvilommi H, Salminen S. Probiotics: effects on
immunity. Am J Clin Nutr 2001; 73:444S-450S.
3. Erickson KL, Hubbard NE. Probiotic immunomodulation in health and disease. J Nutr 2000;
130:403S-409S.
4. Dutchmann R, Kaiser I, Hermann E, Mayet W, Ewe K, Meyer zum Buschenfelde KH.
Tolerance exists towards commensal intestinal flora but is broken in active inflammatory
bowel disease. Clin Exp Immunol 1995; 102:448-455.
5. Guaner F, Malagelada JR. Gut flora in health and disease. The Lancet 2003; 360:512-519.
6. Umesaki Y, Setoyama H. Structure of the intestinal flora responsible for development of the
gut immune system in a rodent model. Microbes Infect 2000; 2:1343-1351.
7. Moreau MC, Gaboriau-Routhiau V. Influence of commensal intestinal microflora on the
development and functions of the gut-associated lymphoid tissue. Microb Ecol Health Dis
2001; 13:65-86.
8. Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science 2001;
292:1115-1118.
9. Rubaltelli FE, Biadaioli R, Pecile P, Nicoletti P. Intestinal flora in breast-fed and bottle-fed
infants. J Perinat Med 1998; 26:186-191.
118 Moreau
10. Raibaud P. Factors controlling the bacterial colonization of the neonatal intestine. In:
Hanson LA, ed. Biology of human milk. New- York Nestec Ltd.: Vevey /Raven Press,
1988:205-219.
1 1 . Favier CF, Vaughan EE, DeVos WM. Akkermans ADL. Molecular monitoring of succession
of bacterial communities in human neonates. Appl Environ Microbiol 2002; 68:219-226.
12. Kelly D, Coutts AGP. Early nutrition and the development of immune function in the neonate.
Proc Nutr Soc 2000; 59:177-185.
13. Wold AE. The hygiene hypothesis revised: is the rising frequency of allergy due to changes
in the intestinal flora ? Allergy 1998; 46:20-25.
14. Salminen S, Bouley C, Boutron-Ruault MC, et al. Functional food science and gastrointestinal
physiology and function. Br J Nutr 1998; 80:S147-S171.
15. Hopkins MJ, Sharp R, Macfarlane GT. Age and disease related changes in intestinal bacterial
populations assessed by cell culture, 16S rRNA abundance, and community cellular fatty acid
profiles. Gut 2001; 48:198-205.
16. Tannock GW. Molecular assessment of intestinal microflora. Am J Clin Nutr 2001;
73:410S-414S.
17. Vasselon T, Detmers PA. Toll receptors: a central element in innate immune responses.
Inf Immun 2002; 70:1033-1041.
18. Uderhill DM, Ozinsky A. Toll-like receptors: key mediators of microbe detection. Curr Opin
Immunol 2002; 14:103-110.
19. Hemmi H, Takeuchi O, Kawai T, et al. A toll-like receptor recognizes bacterial DNA. Nature
2000; 408:740-745.
20. Cario E, Rosenberg IM, Brandwein SL, Beck PL, Reinecker HC, Podolsky DK.
Lipolopysaccharide activate distinct signaling pathways in intestinal epithelial cell lines
expressing toll-like receptors. J Immunol 2000; 164:966-972.
21. Neish AS. The gut microflora and epithelial cells: a continuing dialogue. Microbes Infec
2002; 4:309-317.
22. Wu MX, Ao Z, Prasad KV, Wu R, Schlossman SF. IEX- 1L, an apoptosis inhibitor involved in
NF-KB-mediated cell survival. Science 1998; 281:998-1001.
23. Xavier RJ, Podolsky DK. How to get along-friendly microbes in a hostile world. Science
2000;289:1483-1484.
24. Ricote M, Li AC, Willson TM, Kelly CJ, Glass CK. The peroxisome proliferator-
activated receptor gamma is a negative regulator of macrophage activation. Nature 1998;
391:79-82.
25. Tato CM, Hunter CA. Host-pathogen interactions: subversion and utilization of the NF-kappa
B pathway during infection. Inf Immun 2002; 70:331 1—3317.
26. Rescigno M, Granucci F, Cittero S, Foti M, Ricciardi-Castagnoli P. Coordinated events during
bacteria-induced DC maturation. Immunol Today 1999; 20:200-204.
27. Mosmann TR, Cherwinski H, Bond W, Giedlin A, Coffman RL. Two types of murine helper T
cell clone. Definition according to profiles of lymphokine activities and secreted proteins.
J Immunol 1986; 136:2348-2357.
28. Miller A, Lider O, Roberts AB, Spom MB, Weiner HL. Suppressor T cells generated by oral
tolerization to myelin basic protein suppress both in vitro and in vivo immune reponses by the
release of transforming growth factor (3 after antigen-specific triggering. PNAS USA 1992;
89:421-425.
29. Pretolani M, Goldman M. IL-10: a potential therapy for allergic inflammation? Immunol
Today 1997; 6:277-280.
30. Mowat AMc, Viney JL. The anatomical basis of intestinal immunity. Immunol Rev 1997;
156:145-166.
31. Mowatt AMc. Anatomical basis of tolerance and immunity to intestinal antigens. Nat Rev
Immunol 2003; 3:331-341.
32. Brandtzaeg P. Development and basic mechanisms of human gut immunity. Nutr Rev 1998;
56:S5-S18.
33. Boursier L, Farstad IN, Mellembakken JR, Brandtzaeg P, Spencer J. IgVH gene analysis
suggests that peritoneal B cells do not contribute to the gut immune system in man.
Eur J Immunol 2002; 32:2427-2436.
Immune Modulation by the Intestinal Microbiota 119
34. MacDonald TT, Monteleone G. IL-12 and Thl immune responses in human Peyer's patches.
Trends Immunol 2001; 22:244-247.
35. Guy-Grand D, Vassali P. Gut intraepithelial lymphocyte development. Curr Opin Immunol
2002; 14:255-259.
36. Bu P, Keshavarzian A, Stone DD, et al. Apotosis: one of the possible mechanisms that
maintains unresponsiveness of the intestinal mucosal immune system. J Immunol 2001;
166:6399-6403.
37. Johansen FE, Braathen R, Brandtzaeg P. The J chain is essential for polymeric Ig recepetor-
mediated epitheliall transport of IgA. J Immunol 2001; 167:5185-5192.
38. Iwasaki A, Kelsall BL. Unique functions of CDllb + CD8 + , and double negative Peyer's
patch dendritic cells. J Immunol 2001; 166:4884-4890.
39. George A. Generation of gamma interferon responses in murine Peyer's patches following
oral immunisation. Infect Immun 1996; 64:4606-4611.
40. Becker C, Wirtz S, Blessing M, et al. M.F. Constitutive p40 promoter activation and IL-23
production in the terminal ileum mediated by dendritic cells. J Clin Invest 2003; 1 12:693-706.
41. Veazey RS, Marx PA, Lacker AA. The mucosal immune system primary target for HIV
infection and AIDS. Trends Immunol 2001; 22:626-633.
42. Jump RL, Levine AD. Murine Peyer's patches favor development of an IL-10 secreting,
regulatory T cell population. J Immunol 2002; 168:6113-6119.
43. Husby S, Mestecky J, Moldoveanu Z, Holland S, Elson CO. Oral tolerance in humans — T cell
but not B cell tolerance after antigen feeding. J Immunol 1994; 152:4663-4670.
44. Strobel S, Ferguson A. Persistence of oral tolerance in mice fed ovalbumin is different for
humoral and cell-mediated immune responses. Immunology 1987; 60:317-318.
45. Strobel S, Mowat AMc. Immune responses to dietary antigens: oral tolerance. Immunol
Today 1998; 19:173-181.
46. Alpan O, Rudomen G, Matzinger P. The role of dendritic cells, B cells, and M cells in gut-
oriented immune responses. J Immunol 2001; 166:4843-4852.
47. Vincent-Schneider H, Stumptner-Cuvelette P, Lankar D. Exosomes bearing HLA-DR1
molecules need dendritic cells to efficiently stimulate specific T cells. Int Immunol 2002;
14:713-722.
48. Viney JL, Mowat AM, O'Malley JM, Williamson E, Fanger NA. Expanding dendritic cells
in vivo enhances the induction of oral tolerance. J Immunol 1998; 160:5815-5825.
49. Groux H, O'Garra A, Bigler M, et al. A CD4 + T-cell subset inhibits antigen-specific T-cell
responses and prevent colitis. Nature 1997; 389:737-742.
50. Khoo UY, Proctor IE, Macpherson AJ. CD4- Tcells down-regulation in human intestinal
mucosa: evidence for intestinal tolerance to luminal bacterial antigens. J Immunol 1997;
158:3626-3634.
51. Smith PD, Smythies LE, Mosteller-Barnum M, et al. Intestinal macrophages lack CD 14 and
CD89 and consequently are down-regulated for LPS- and IgA-mediated activities. J Immunol
2001; 167:2651-2656.
52. Macpherson AJ, Hunziker L, McCoy K, Lamarre A. IgA responses in the intestinal
mucosa against pathogenic and non-pathogenic microorganisms. Microbes Infect 2001;
3:1021-1035.
53. Phalipon A, Cardona A, Kraehenbuhl JP, Edelman L, Sansonetti PJ, Corthesy B. Secretory
component: a new role in secretory IgA-mediated immune exclusion in vivo. Immunity 2002;
17:107-115.
54. Macpherson AJ, Gatto D, Sainsbury E, Harriman GR, Hengartner H, Zinkernagel RM.
A primitive T cell-independant mechanism of intestinal mucosal IgA response to commensal
bacteria. Science 2000; 288:2222-2226.
55. Madsen K, Cornish A, Soper P, et al. Probiotic bacteria enhance murine and human intestinal
epithelial barrier function. Gastroenterology 2001; 121:580-591.
56. Bry L, Falk PG, Midtvedt T, Gordon JL A model of host-microbial interactions in an open
mammalian ecosystem. Science 1996; 273:1380-1383.
57. Freitas M, Axelsson LG, Cayuela C, Midtvedt T, Trugnan G. Microbial-host interactions
specifically control the glycosylation pattern in intestinal mouse mucosa. Histochem Cell Biol
2002; 118:149-161.
120 Moreau
58. Hooper LV, Stappenbeck TS, Hong CV, Gordon JI. Angiogenins: a new class of microbicidal
proteins involved in innate immunity. Nature Immunol 2003; 4:269-273.
59. Hooper LV, Wong MH, Thelin A, Hansson L, Falk PG, Gordon JI. Molecular
analysis of commensal host-microbial relationships in the intestine. Science 2001;
291:881-884.
60. Gaboriau-Routhiau V, Raibaud P, Dubuquoy C, Moreau MC. Colonization of gnotobiotic
mice with human microflora at birth protects against Escherichia coli heat-labile enterotoxin-
mediated abrogation of oral tolerance. Pediatr Res 2003; 54:739-746.
61. Dubuquoy L, Jansson EA, Deeb S, et al. Impaired expression of peroxisome proliferator-
activated recepetor y in ulcerative colitis. Gastroenterology 2003; 124:1265-1276.
62. Moreau MC, Raibaud P, Muller MC. Relation entre le developpement du systeme
immunitaire intestinal a IgA et l'etablissement de la flore microbienne dans le tube digestif
du souriceau holoxenique. Ann Immunol (Inst Pasteur) 1982; 133D:29-39.
63. Moreau MC, Ducluzeau R, Guy-Grand D, Muller MC. Increase in the population of duodenal
IgA plasmocytes in axenic mice monoassociated with different living or dead bacterial strains
of intestinal origin. Infect Immun 1978; 21:532-539.
64. Macpherson GG, Liu MM. Dendritic cells and Langherans cells in the uptake of mucosal
antigens. Curr Top Microbiol Immunol 1999; 236:33-53.
65. Mac William AS, Holt PG. Mucosal dendritic cells in the respiratory tract. Mucosal Immunol
Update 1997; 5:21-25.
66. Newberry RD, Stenson WF, Lorenz RG. Cyclooxygenase-2-dependent prostaglandin E2
production by stromal cells in the murine small intestine lamina propria: directing the tone of
the intestinal immune response. J Immunol 2001; 166:4465-4472.
67. Harizi H, Jusan M, Pitard V, Moreau JF, Gualde N. Cyclooxygenase-2- issued prostaglandine
E2 enhances the production of endogenous IL-10, which down-regulates dendritic cell
functions. J Immunol 2002; 168:2255-2263.
68. Uhlig HH, Powrie F. Dendritic cells and the intestinal bacterial flora: a role for localized
mucosal immune responses. J Clin Invest 2003; 112:648-651.
69. Wold AE, Hanson LA. Defense factors in human milk. Curr Opin Gastroenterol 1994;
10:652-658.
70. Mastretta E, Longo P, Laccisaglia A, et al. Effect of Lactobacillus GG and breast-feeding in
the prevention of rotavirus nosocomial infection. J Pediatr Gastroenterol Nutr 2002;
35:527-531.
7 1 . Goldman AS. Modulation of the gastrointestinal tract of infants by human milk. Interfaces and
interactions. An evolutionary perspective. J Nutr 2000; 130:426S-431S.
72. Moreau MC. Effet immunomodulateur des bacteries intestinales: role des bifidobacteries.
J Pediatr Puericulture 2001; 14:135-139.
73. Isolauri E, Juntenen M, Rautanen T, Sillanaukee P, Koivula T. A human Lactobacillus strain
{Lactobacillus casei sp strain GG) promotes recovery from acute diarrhea in children.
Pediatrics 1991; 88:90-97.
74. Kaila M, Isolauri E, Soppi E, Virtanen V, Laine S, Arvilommi H. Enhancement of the
circulating antibody secreting cell response in human diarrhea by a human Lactobacillus
strain. Pediatr Res 1992; 32:141-144.
75. Herias MV, Midtvedt T, Hanson LA, Wold AE. Increased antibody production against gut-
colonizing. E. coli in the presence of the anaerobic bacterium Peptostreptococcus. Scand
J Immunol 1998; 48:277-282.
76. Flo J, Goldman H, Roux ME, Massoud E. Oral administration of a bacterial immunomodulator
enhances the immune response to cholera toxin. Vaccine 1996; 14: 1 167—1 173.
77. Cebra JJ, Bos NA, Cebra ER, Kramer DR, Kroese FGM, Schrader CE. Cellular and molecular
biologic approaches for analyzing the in vivo development and maintenance of gut mucosal
IgA responses. In: Mestecky et al. eds. Advances in Mucosal Immunology. New- York:
Plenum press, 1995:429-434.
78. Bona C, Bot A. Neonatal immunoresponsiveness. Immunologist 1997; 5:5-9.
79. Moreau MC, Gaboriau-Routhiau V, Guiard G, Bouley. Strain-dependent immunomodulatory
properties of lactic acid bacteria: experimental data from Bifidobacterium strains and
Lactobacillus strains. 17th International Congress of Nutrition, Modern aspects of nutrition,
Vienna, 27-31 August 2001.
Immune Modulation by the Intestinal Microbiota 121
80. Maassen CBM, Van Holten-Neelen C, Balk F, et al. Strain-dependent induction of cytokine
profiles in the gut by orally administered Lactobacillus strains. Vaccine 2000; 18:2613-2623.
81. Wannemuehler MJ, Kiyono H, Babb JL, Michalek SM, McGhee JR. Lipopolysaccharide
(LPS) regulation of the immune response: LPS converts germfree mice to sensitivity to oral
tolerance induction. J Immunol 1982; 129:959-965.
82. Moreau MC, Gaboriau-Routhiau V. The absence of gut flora, the doses of antigen ingested,
and aging affect the long-term peripheral tolerance induced by ovalbumin feeding in mice.
Immunol Res 1996; 147:49-59.
83. Moreau MC, Gaboriau-Routhiau V, Dubuquoy C, Bisetti N, Bouley C, Prevoteau H.
Modulating properties of intestinal bacterial strains, Escherichia coli, and Bifidobacterium, on
two specific immune responses generated by the gut, i.e., oral tolerance to ovalbumin, and
intestinal IgA anti-rotavirus response, in gnotobiotic mice. The 10th International Congress of
Immunology, New-Dehli. In: Talwar GP, Nath I, Ganguly NK, Rao KVS, eds. Bologna:
Monduzzi Editore, 1998:407-411.
84. Sudo N, Sawamura SA, Tanaka K, Aiba Y, Kubo C, Koga Y. The requirement of intestinal
bacterial flora for the development of an IgE production system fully susceptible to oral
tolerance induction. J Immunol 1997; 159:1739-1745.
85. Lodinova-Zadnikova R, Cukrowska B, Tlaskalova-Hogenova H. Oral administration of
probiotic Escherichia coli after birth reduces frequency of allergies and repeated infections
later in life (after 10 and 20 years). Int Arch Allergy Immunol 2003; 131:209-211.
86. Duval-Iflah Y, Ouriet MF, Moreau MC, Daniel N, Gabilan JC, Raibaud P. Implantation
precoce d'une souche de Escherichia coli dans l'intestin de nouveau-nes humains: effet de
barriere vis-a-vis de souches de E. coli antibioresistantes. Ann Microbiol (Inst Pasteur), 133 A
1982; 133A:393-408.
87. Kalliomaki M, Salminen S, Poussa T, Arvilommi H, Isolauri E. Probiotics and prevention of
atopic disease: 4-year follow-up of a randomised placebo-controlled trial. Lancet 2003;
361:1869-1871.
88. McMenamin C, McKersey M, Kuhnlein P, Hunig T, Holt PG. Gamma-delta T cells down-
regulate primary IgE responses in rats to inhaled soluble protein antigens. J Immunol 1995;
154:4390-4394.
89. Neish AS, Gewirtz A, Zeng H, et al. Procaryotic regulation of epithelial responses by
inhibition of iKB-aubiquition. Science 2000; 289:1560-1563.
90. Haller D, Russo MP, Sartor RB, Jobin C. IKK beta and phosphatidylinositol 3-kinase/Akt in non-
pathogenic Gram negative enteric bacteria-induced RelA phosphorylation and NF-kB activation
in both primary and intestinal epithelial cell lines. J Biol Chem 2002; 277:38168-38178.
91. Gionchetti P, Amadini C, Rizello F, Venturi A, Poggioli G, Campieri M. Probiotic for the
treatment of postoperative complications following intestinal surgery. Best Pract Res Clin
Gastroenterol 2003; 17:821-831.
92. Guslandi M, Giollo P, Testoni PA. A pilot trial of Saccharomyces boulardii in ulcerative
colitis. Eur J Gastroenterol Hepatol 2003; 15:697-698.
93. Rembacken BJ, Snelling AM, Hawkey P, Chalmers DM, Axon TR. Non pathogenic
Escherichia coli versus mesalazine for the treatment of ulcerative colitis: a randomised trial.
Lancet 1999; 354:635-639.
94. Madsen K, Doyle JS, Jewell LD, Tavernini M, Fedorak RN. Lactobacillus species prevents
colitis in interleukin-10 gene-deficient mice. Gastroenterology 1999; 116:1107-1114.
95. Ridge JP, Fuchs EJ, Matzinger P. Neonatal tolerance revisited: turning on newborn T cells
with dendritic cells. Science 1996; 271:1723-1726.
96. Sun CM, Fiette L, Tanguy M, Leclerc C, Lo-Man R. Ontogeny and innate properties of
neonatal dendritic cells. Blood 2003; 102:585-591.
97. Nicaise P, Gleizes A, Sandre C, et al. The intestinal microflora regulates cytokine production
positively in spleen-derived macrophages but negatively in bone marrow-derived
macrophages. Eur Cytokine Net 1999; 10:365-372.
98. Nicaise P, Gleizes A, Forestier F, Sandre C, Quero AM, Labarre C. The influence of E. coli
implantation in axenic mice on cytokine production by peritoneal and bone marrow-derived
macrophages. Cytokine 1995; 7:713-719.
99. Podoprigora G. The role of microbial factors in non-specific resistance of the host to infection.
Microecol Ther 1996; 24:207-217.
122 Moreau
100. Adkins B, Bu YR, Guevara P. Murine neonatal CD4 + lymph nodes are highly deficient in the
development of antigen-specific Thl function in adoptive adult hosts. J Immunol 2002;
169:4998-5004.
101. Renz H, vonMutius E, Mi S, Wolkers F, Hirsh T, Wieland SK. T(H)1/T(H)2 immune
responses profiles differ between atopic children in eastern and western Germany. J Allergy
Clin Immunol 2002; 109:338-342.
102. Marodi L. Down-regulation of Thl responses in human neonates. Clin Exp Immunol 2002;
128:1-2.
103. Riedler J, Braun-Fahrlander C, Eder W, et al. The ALEX study team. Exposure to farming in
early life and development of asthma and allergy: a cross-sectional survey. Lancet 2001;
358:1129-1133.
104. McKeever TM, Lewis SA, Smith C, et al. Early exposure to infections and antibiotics and the
incidence of allergic disease: a birth cohort study with the West Midlands general practice
research database. J Allergy Clin Immunol 2002; 109:43-50.
105. Bjorksten B, Naaber P, Sepp E, Mikelsaar M. The intestinal microflora in allergic Estonian
and Swedish 2-year-old children. Clin Exp Allergy 1999; 29:342-346.
106. Bowman LM, Holt PG. Selective enhancement of systemic Thl immunity in immunologically
immature rats with an orally administered bacterial extract. Infect Immun 200 1; 69:371 9-3727 .
107. Oyama N, Sudo N, Sogawa H, Kubo C. Antibiotic use during infancy promotes a shift in the
Thl/Th2 balance towards Th2-dominant immunity in mice. J Allergy Clin Immunol 2001;
107:153-159.
108. Sudo N, Yu XN, Aiba Y, et al. An oral introduction of intestinal bacteria prevents the
development of a long-term Th2-skewed immunological memory induced by neonatal
antibiotic treatment in mice. Clin Exp Allergy 2002; 32:1112-1116.
109. Braun-Fahrlander C, Riedler J, Herz U, et al. Environmental exposure to endotoxin and its
relation to asthma in school-age children. N Engl J Med 2002; 347:869-877.
110. Strannegard O, Strannegard IL. The causes of the increasing prevalence of allergy: is atopy
a microbial privation? Allergy 2001; 56:91-102.
111. Von Mutius E. Environmental factors influencing the development and progression of
pediatric asthma. J Allergy Clin Immunol 2002; 109:525S-532S.
112. Cukrowska B, Lodinova-Zadnikova R, Enders C, Sonnenborn U, Schulze J, Tlaskalova-
Hogenova H. Specific proliferative and antibody responses of premature infants to intestinal
colonization with non-pathogenic E. coli strain Nissle 1917. Scand J Immunol 2002;
55:204-209.
113. Avrameas S. Natural antibodies: from "horror autotoxicus" to "gnothi seauton". Immunol
Today 1991; 123:154-159.
1 14. Bos NA, Meeuswen CG, Wostmann BS, Pleasants JR, Benner R. The influence of exogenous
stimulation on the specificity repertoire of background immunoglobulin-secreting cells of
different isotypes. Cell Immunol 1988; 112:371-380.
115. Freitas AA, Viale AC, Sunblad A, Heusser C, Coutinho A. Normal serum immunoglobulins
participate in the selection of peripheral B-cell repertoires. PNAS 1991; 88:5640-5644.
116. Kaveri SV, Lacroix-Desmazes S, Mouthon L, Kazatchine MD. Human natural antibodies:
lessons from physiology and prospects for therapy. Immunologist 1998; 6:227-233.
117. Van der Broek MF, Van Bruggen MCJ, Koopman JP, Hazenberg MP, Van den Berg WB. Gut
flora induces and maintains resistance against streptococcal cell wall-induced arthritis in F344
rats. Clin Exp Immunol 1992; 88:313-317.
118. Nieuwenhuis EES, Visser MR, Kavelaars A, et al. Oral antibiotics as novel therapy for arthritis.
Evidence for a beneficial effect of intestinal E. coli. Arthritis Rheum 2000; 43:2583-2589.
119. Martins TC, Aguas A. Mechanisms of Mycobacterium aWwra-induced resistance against
insulin-dependant diabetes melitus (DDM) in non-obese diabetic (NOD) mice: role of Fas and
Thl cells. Clin Exp Immunol 1999; 115:248-254.
120. Gavini F, Cayuela C, Antoine JM, et al. Differences on the distribution of bifidobacterial and
enterobacterial species in human faecal microflora of three different (children, adults, elderly)
age groups. Microb Ecol Health Dis 2001; 13:40-45.
6
Mucosal Interactions and Gastrointestinal
Microbiota
Wai Ling Chow and Yuan-Kun Lee
National University of Singapore, Department of Microbiology,
Faculty of Medicine, Singapore
INTRODUCTION
The human gut harbors a complex and diverse microbiota. The numbers of microorganisms in
the upper gastrointestinal (GI) tract are kept low by the actions of gastric acid, pancreatic
enzymes, bile, and a propulsive motor pattern. The colonic population of microbes is
estimated to be 10 organisms/gram with at least 400 possible species. The above figure
was obtained by traditional culture-based methods. Modern molecular methods such as 16S
ribosomal RNA clone libraries that are discussed in Chapter 1 indicate that the number of
species will be even higher. The composition of the intestinal microbiota varies from human
to human. These differences in the composition of the microbiota are affected by
physiological, chemical, and environmental factors. The common intestinal microbiota in
humans includes predominantly members of genera Clostridium, Eubacterium, Bacter-
oides, Atopobium and Bifidobacterium spp. and many others to a lesser extent. There is an
approximation that almost 90% of the cells in our body are microbial, whereas only 10%
are human.
The bacteria that colonize the gut must be able to proliferate at a rate that resists
washout. Adherence to the intestinal mucosal surface is an important factor in intestinal
bacterial colonization. In healthy individuals, a layer of mucus is found to line the gut. It is
composed mostly of glycoproteins and serves as a lubricant and a protective lining over
the mucosa. Microbiota degradation of the mucin polymeric glycoprotein results in the
release of monosaccharides such as N-acetylglucosamine and fucose amongst others,
which the microbiota use to support their growth (2). Furthermore, under the mucus the
surfaces of intestinal epithelial cells are covered with an abundance of terminally
fucosylated glycoproteins and glycolipids which are induced by members of the intestinal
microbiota (3). In particular, it was demonstrated that Bacteroides thetaiotaomicron
cleaves L-fucose moieties from the host's surface and internalizes them for use as an
energy source. This commensal microbe modulates the production of the fucose by the
host with its requirement needs, which gives it a competitive colonization advantage
123
124
Chow and Lee
within the intestinal niche (68). Thus, the interaction of microorganisms with the mucosa
is a complex one, which involves cross-talk between the microbes, and between the
microbes and the host.
In this chapter, we provide some insights about the development and regulation of
the gastrointestinal microbiota as well as the interaction of the microbes with the intestinal
mucosal layer. The majority of research on the molecular interactions between microbes
and the mucosa relate to pathogen-enterocyte interaction, and consequently, this field is
also occasionally referred to.
FEATURES OF THE GASTROINTESTINAL TRACT
Structure and Function of the Small Intestine
The small intestine is the principal site of food digestion, nutrient absorption as well as
endocrine secretion. It is the longest component of the alimentary tract, measuring over
6 meters, and is divided into three anatomic regions: duodenum, jejunum and ileum. The
duodenum begins at the pylorus of the stomach and is the proximal 20-25 cm of the small
intestine. The jejunum spans about 2.5 meters in length. The ileum is approximately
3.5 meters long and an extension of the jejunum.
The absorptive surface area of the small intestine is greatly increased by tissue and
cell specializations such as plicae circulares, villi and microvilli (Fig. 1). Plicae circulares
are permanent transverse folds of the mucosa, forming semicircular or spiral elevations.
They are abundant in the distal duodenum and beginning of the jejunum. Intestinal villi are
finger-like outgrowths of mucosa protruding into the lumen of the small intestine.
Microvilli are protrusions of the apical plasmalemma of the epithelial cells covering the
intestinal villi, increasing the surface area of the small intestine 20 times. Therefore, these
modifications immensely amplify the absorptive and interactive (with intestinal content,
including the microbiota) surface area of the small intestine.
The mucosa comprises the lining epithelium, a lamina propria that houses glands and
muscularis mucosa. There are at least 5 types of cells found in the intestinal mucosal
r
Villi
Lymphoid
cell
Paneth
cell
Mucous
epithelium of
pylorus
Goblet cell
Lamina
propria
Muscularis -
mucosae
Figure 1 Schematic diagram of the mucosa, villi, and component cells of the small intestine.
Mucosal Interactions and Gastrointestinal Microbiota 125
epithelium. They include enterocytes, goblet cells, Paneth cells, enteroendocrine cells and
M cells (microfold cells). Both the enterocytes and the goblet cells line the villus and are the
major cell types in the epithelium. The enterocytes are columnar in shape and have brush
borders composed of microvilli which help to enhance the water ions and nutrient absorbing
surface area. Goblet cells are unicellular mucin-secreting glands which produce mucinogen
and mucin, a component of mucus. The number of goblet cells increases progressively down
the gastrointestinal tract from the duodenum, to jejunum, ileum and colon, where they are
most abundant. The Paneth cells' role is to maintain the innate immunity by secreting
antimicrobial substances such as a-defensins (4,69). Enteroendocrine cells are present only in
small numbers ( ~ 1 %) and their functions include the production of panacrine and endocrine
hormones (5). M cells are modified enterocytes overlying the enlarged lymphatic nodules in
the lamina propria. Their function is to phagocytose and transport antigens present in the
intestinal lumen to the underlying macrophages and lymphoid cells, which then migrate to
other compartments of the lymphoid nodes, where immune responses to foreign antigens are
initiated (5).
The lamina propria is rich in lymphoid cells, which will protect the intestinal lining
from bacterial invasion. The loose connective tissue of lamina propria forms the main part
of the villi, extending down to the muscularis mucosa. The epithelium may invaginate into
the lamina propria between the villi to form glands, termed the crypts of Lieberkuhn.
These tubular glands consist of enterocytes, goblet cells, regenerative cells, enteroendo-
crine cells and Paneth cells. The rate at which the regenerative cells proliferate is high and
they are capable of replacing other cell types in the intestinal epithelium. As mentioned
above, the pyramidal-shaped Paneth cells secrete antibacterial agents, such as lysozyme
and a-defensins or cryptdins, and internalized extracellular matter such as bacteria and
immunoglobulin. Therefore, it is postulated that these cells help in regulation of the
bacterial microenvironment in the small intestine.
Structure and Function of the Large Intestine
The large intestine is a continuation of the ileum and is usually divided into three
regions: the colon, rectum and anal canal. The colon accounts for nearly the full length
of the large intestine. The colon absorbs water and electrolytes (approximately 1400 ml
per day). It also compacts and eliminates feces (about 100 ml per day). Feces are
composed of water (75%), dead bacteria (7%), roughage (5%), inorganic substances
(5%), and undigested protein, dead cells and bile pigment (1%). Bacterial products,
including the vitamins riboflavin, thiamin, vitamin B12 and vitamin K, are also
excreted in the feces (5).
The colonic mucosal membrane does not have any folds due to an absence of villi
(Fig. 2). The intestinal glands are long and characterized by a great abundance of goblet
and absorptive cells, and a small number of enteroendocrine cells. The large intestinal
epithelium is specialized for mucos secretion, salt and water absorption.
The histology of the rectum is identical to that of the colon except that the crypts of
Lieberkuhn are deeper and fewer in number. The rectum is about 12-18 cm in length and
is continuous with the anal canal, which spans about 3 to 4 cm. The mucosa of the anal
region displays a series of longitudinal folds, the rectal columns of Morgagni. These rectal
columns meet one another to form pouch-like outpocketings, the anal valves with
intervening anal sinuses. The anal valves assist in supporting the column of feces (5). The
epithelial cells of the entire gastrointestinal tract are constantly shed. They are replaced
with stem cells that have undergone mitosis. The high turnover rate of the epithelial cells
may explain why the small intestine is affected rapidly by the administration of
126
Chow and Lee
°0* O N *
Colonic
epithelium
Lamina
propria
^ Muscularis
mucosae
•4| — Submucosa
uscularis
externa
Figure 2 Schematic diagram of the colonic epithelium and associated cells.
anti-mitotic drugs, as in cancer chemotherapy. The epithelial cells continue to be lost at the
tip of the villi, but drugs inhibit cell proliferation (6).
Mucus
The gastrointestinal tract contains tremendous numbers of microorganisms and some of
these microorganisms are pathogenic in nature under certain conditions. Therefore a
function of the mucus is to protect the underlying epithelial cells by keeping the microbes
and toxins at bay, on the outer mucosal surfaces. The mucus layer is comprised of various
mucosal secretions including mucins, trefoil peptides, and surfactant phospholipids.
Mucus occurs in two distinct physical forms: (1) a thin layer of stable, water
insoluble mucus gel firmly adhering to the gastroduodenal mucosal surface, (2) and as
soluble mucus which is quite viscous but mixes with the luminal juice (7).
The layer of mucus that is bound to the surface of the gastrointestinal tract is
resistant to its removal from the mucosa. It is approximately 50-450 Jim thick in humans
and about twofold less in rats. This adherent mucus functions to support and define
the mucosal ecosystem since it is the outermost sensory "organ" of the mucosal immune
system. The mucus gel plays a role in providing surface neutralization by having the
HCO^~ barrier to the gastric acid. The surfactant lipids maintain surface hydrophobicity on
the mucus. The adherent mucus also serves as a stable protective barrier that prevents the
entry of luminal pepsin to the underlying epithelial cells.
The soluble mucus plays a role in maintaining the protective barrier because it is not
physically attached to the mucosa and can be removed from the mucosa by gentle washing.
Due to the viscous nature of the soluble mucus, the soluble mucus makes an excellent
lubricant which allows easy movement of solid material in the lumen. This helps to
prevent the damage to the underlying epithelial cells as well as minimize the tearing of the
adherent layer of mucus from the mucosal surface (7).
Mucosal Interactions and Gastrointestinal Microbiota 127
The main structural component of the mucus layer are the mucins or glycoproteins
of molecular weight ranging from one to several million daltons. When concentrated,
these glycoprotein macromolecules (M r >2X10 6 ) polymerise to form gels. Mucin
molecules consist of carbohydrate side chains (70-80%) bound to a protein skeleton. The
O-linked oligosaccharide chains contain a restricted number of monosaccharides,
including galactose, fucose, N-acetylgalactosamine, N-acetylglucosamine and often
terminated with sialic acids or sulfate groups, which account for the poly anionic nature of
mucins at a neutral pH (7,8). Oligosaccharides chains are successively added on to mucins
specifically by membrane bound gly cosy ltransf erases. The biochemistry of the intestinal
mucins confers their protective nature: the protein backbone has a high O-linked
oligosaccharide content ( > 80% carbohydrate by mass) that provides lectin-binding
capacity, whereas the ability of the protein core to form multimers (through disulphide
bonds) causes polymerization into gels and bestows viscoelasticity and lubrication (9).
The trefoil peptides also facilitate the mucins to confer visoelasticity on the mucus (10).
The composition of the mucus is constantly regulated by the varying secretion rates
of the mucin types, ions, lipids, proteins and water. The variation in the composition of the
mucus is also dependent on the development stage of the host as well as the host's diet and
the interaction of the commensals and pathogens (10). Commensals rapidly colonize the
individual soon after birth and some play a role in inhibiting the growth of pathogenic
bacteria. However, many commensals are capable of becoming opportunistic pathogens
by overgrowing when the stable gastrointestinal ecosystem is disturbed. Thus, the mucus
has to be continuously secreted and then shed, discarded, digested or recycled. This form
of protective mechanism keeps the numbers of both pathogens and commensals in check
by blocking the bacterial adherence to the epithelial cells.
MICROBIOTA AND GASTROINTESTINAL SYSTEM
Distribution of Microbiota
The mucosal surface of the human body, including the gastrointestinal tract, the
respiratory tract and the urogenital tract, has a total surface area of more than 400 m (11).
The gastrointestinal tract's surface area is about 200-300 m 2 and is colonized by 10 13-14
bacteria with hundreds of bacterial species and subspecies.
The normal microbiota of the gastrointestinal tract has been grouped and defined into
two categories, the autochthonous (indigenous) and the allochthonous (nonindigenous)
species (12). The autochthonous microbes (1) are always present in the normal adult's
gastrointestinal tract, (2) play a role in maintaining the stable bacterial populations in
the gastrointestinal tract, (3) colonize particular parts of the tract, (4) can grow
anaerobically, (5) colonize their habitats in succession in infants, and (6) often associate
intimately with the gastrointestinal mucosal epithelium.
On the other hand, allochthonous species are not characteristic of the normal habitat.
Allochthonous microbiota is defined as transient microbes which will not be established
but would just be passing through, having arrived in the habitat in food, in water, from
another habitat in the gastrointestinal tract, or from elsewhere in the body. These microbes
either cannot or find it very challenging to establish themselves since they cannot compete
in the various niches or may be killed by host or bacterial factors.
However, the allochthonous microorganisms might colonize the habitats vacated by
the autochthonous microbes in the disturbed gastrointestinal system (13). This was
evidently seen in the administration of antibiotics which caused severe disturbance in the
gastrointestinal microbiota leading to undesirable effects, such as the overgrowth and
128 Chow and Lee
superinfection with allochthonous microorganisms like yeast (14,15); see also chapter 18
by Sullivan and Nord in this book.
Thus, the main difference between autochthonous and allochthonous species is that
an autochthonous microbe naturally colonizes the habitat, whereas an allochthonous one
cannot colonize it except under abnormal or atypical situations (13).
In a steady gastrointestinal ecosystem, all the niches are probably occupied by
indigenous microbes. The number of microorganisms in the stomach and the upper
two-thirds of the small intestine is very scarce: a maximum of 10 4 per milliliter of intestinal
contents. The relatively low number of microbes is due to the low pH (approximately pH 2)
of the intestinal contents resulting from gastric acid production and the relatively swift flow
(transit time of 4-6 hours) of digesta through the stomach and small intestine. Culturing
studies indicate that lactobacilli and streptococci are commonly found microbes in the small
intestine (16). Unlike the bulk of the microbes within the gastrointestinal tract, both the
lactobacilli and streptococci are acid-tolerant bacteria, and are capable of surviving the
passage through the stomach.
The ileum contains larger numbers of microbes (10 - 1 bacteria per ml of intestinal
contents) in comparison to the upper regions of the gastrointestinal tract. The higher
bacterial numbers in the ileum are the result of a lower peristalsis and low
oxidation-reduction potential. Therefore, lactobacilli, streptococci, enterobacteriacae
and anaerobic bacteria are able to establish themselves in the distal region of the small
intestine. The main site of microbial colonization in the gastrointestinal tract is the colon.
The slow intestinal motility in the colon with a transit time of up to 60 hours and low
oxidation-reduction potential are responsible for the large numbers of bacteria present.
The colon contains 10 -10 bacteria per gram of intestinal contents. More than 99% of
the colonic microbiota are obligate anaerobes such as Bacteroides spp., Eubacterium,
Bifidobacterium and Clostridium spp. (17).
Enteric Pathogens
Most intestinal bacterial infections are caused by enteric pathogens. The clinical
symptoms usually associated with the intestinal infections include fever, abdominal pain
and diarrhea. Enteric bacteria are capable of evading host defense factors such as gastric
acidity, intestinal motility, the normal indigenous microbiota, mucus secretion, and
specific mucosal and systemic immune mechanisms.
In order for ingested pathogenic bacteria to infect the colon, they produce virulence
factors. Enteric bacteria can be divided into four main categories based on the virulence
factors that enable them to overcome the host defense. The first group of bacterial
pathogens consists of Campylobacter jejuni, Yersinia enterocolitica, Shigella and
Salmonella species. Their mechanism of virulence involves the mucosal invasion with
intraepithelial cell multiplication resulting in cell death. The second group comprises
enteric pathogens that produce cy to toxins which will in turn cause cell injury and
inflammation. Microorganisms that produce cytotoxins include Clostridium difficile,
enteropathogenic Escherichia coli (EPEC) and enterohemorrhagic E. coli (EHEC). The
third class of pathogens secretes enterotoxins which will alter intestinal salt and water
balance without affecting mucosal morphology. Vibrio cholerae, Shigella and
enterotoxigenic E. coli produce such enterotoxins. The last category of enteric pathogens
can only cause disease when they tightly adhere to the intestinal surface. The classic
enteropathogenic E. coli as well as the enteroadherent E. coli is typical of this group. Both
the small intestine and colon are primary sites for enteroadhesion (18).
Mucosal Interactions and Gastrointestinal Microbiota 129
DEVELOPMENT OF Gl TRACT NORMAL MICROBIOTA IN HUMANS
The fetus in utero is sterile until birth. Colonization of the human body with a heterogenous
collection of microorganisms from the birth canal begins at delivery. The Lactobacillus
species constitute the major population of the vaginal microbiota and thus provide the initial
inoculum to the infant during birth. In the case of caesarean section or premature infants,
most microbes that are transferred to the newborn can be traced from the environment, i.e.,
from other infants via the air, equipment and nursing staff (19). Therefore, the type of
delivery (passage through the birth canal versus caesarean section) as well as the type of diet
(breast versus formula feeding) might affect the pattern of microbial colonization.
The general pattern observed was that the facultative microorganisms appeared first
and were subsequently followed by a limited number of anaerobes during the first two
weeks (20). The types of bacterial strains that are capable of populating the GI tract are
regulated through the limitation of the intestinal milieu, which changes with the successive
establishment of the different bacteria. Hence, bacteria that are capable of oxidative
metabolism, such as enterobacteria, streptococci and staphylococci, are among the first to
proliferate in the gut. As the numbers of the facultative bacteria increase, they consume
oxygen and lower the redox potential to negative values. These conditions are favorable
for the anaerobic bacteria to multiply and reach much higher levels than that of the first
week. Populations of bifidobacteria, Bacteroides and Clostridia, the commonly found
anaerobes, increase with subsequent change of conditions in the GI tract. By the fourth
week, the fecal microbiota of the breast-fed infants consists mainly of bifidobacteria and
other groups to a lesser extent including enterobacteria, Clostridia, and Bacteroides.
However, in formula-fed infants, bifidobacteria do not beome so dominant and a more
complex microbiota develops. The differences between the breast-fed and formula-fed
infants gradually disappear with the intake of solid food. By the twelfth month, the number
of facultative anaerobes declines as the anaerobes begin to increase and form a stable
population, resembling that of adults in numbers and in composition. By the age of two,
the profile resembles that of an adult (19). In adults, the ratio of anaerobic to aerobic
bacteria is 1000:1 (21).
Adhesion of Bacteria
The colonization of microorganisms in various niches is dependent on their ability to
adhere to surfaces and substratum. Adhesion or adherence is defined as the measurable
union between a bacterium and substratum. A bacterium is considered to have adhered to a
substratum when energy is required to separate the bacterium from the substratum (22).
Adhesion of a bacterium to a substratum, its colonization and finally possible invasion
of the tissue is a multi-step process. It usually involves two or more kinetic steps. Firstly, the
bacterium approaches the substratum via long distance interactions, such as van der Waals
forces and electrostatic forces and becomes loosely attached (22). Complementary
adhesion-receptor interaction leads to the formation of a bacterium-cell complex:
Bacteria + Intestinal cell <=^ Bacterium — Intestinal cell complex (1)
where k t and k_! are dissociation constants for the above reaction. At equilibrium, the
concentration of the adhered bacteria (e x ) can be expressed as:
e x = e m • x/(k x + x) (2)
where e m is the maximum value of e x at saturated bacterial concentration (23). The value
130 Chow and Lee
of e m is equivalent to the concentration of adhesion sites on the mucosal surface and x is the
concentration of bacterial cells present around the adhesion site. The dissociation constant,
k x determines the affinity the bacterial cells have for the adhesion sites on the mucosal
surfaces. Thus, the adhesion of a bacterium to the substratum is determined by two major
properties: the concentration of the bacterium in the vicinity of the cell receptor (x in the
above equation) and the affinity of the bacterium for the receptor (k x in the equation).
Bacterial adhesion is crucial for invasive pathogenic microbes and may be important
for certain commensals, prior to colonization of the intestinal mucosa. The receptors for
bacterial adhesins are found in three groups of membrane consitituents: integral, peripheral
and cell surface coat components. These receptors are chemically proteins, glycoproteins or
glycolipids. They fulfill the criteria of a biological receptor because they exhibit specific
binding followed by physiologically relevant responses. An example would be membrane-
associated fibronectin acting as a receptor molecule for streptococci (22).
Bacterial adhesion to substrata receptors could involve the specific adhesin-receptor
interaction and non-specific interactions. The specific adhesion is defined as the association
between the bacteria and substratum that requires rigid stereochemical constraints (22).
Many bacteria have the ability to produce lectins (24), carbohydrate-specific proteins,
which are usually expressed on the bacterial surfaces. Lectins are a subset of adhesins that
recognize and bind to a defined carbohydrate sequence present on host glycoproteins.
Previous studies reported that there were three main types of adhesin-receptor interactions.
The first type was based on the carbohydrate-lectin recognition, the second kind involved
protein-protein interaction and the third class, which is the least characterized, involved the
binding interactions between hydrophobic moieties of proteins and lipids (25).
A well-established example is the type 1 fimbriae (carrying adhesins) of E. coli which
recognize D-mannose as the receptor site on the host mucosal surface (26). Binding
of some Lactobacillus to human colonic cells is a mannose-specific adherence mechanism
(27,28). Their similarity in binding specificity may contribute to competitive exclusion of
enteropathogens by some strains of probiotic lactic acid bacteria. Lactic acid bacteria
have been shown to exclude enteropathogens from the mucosal surface in in vitro
studies (29-32).
On the other hand, the non-specific adhesion is also an association between a
bacterium and substratum that may involve the same forces involved in the specific
adhesion. However, in non-specific adhesion, a precise stereochemical fit is not necessary.
Non-specific interaction comprises the physiochemical forces such as van der Waals,
electrostatic forces (33), hydrogen bonding (34), and hydrophobic interactions (35).
The synthesis of adhesins can be switched on and off by the bacteria, depending on
the environmental conditions, a process called phase variation (36). Phase variation has
been demonstrated in Gram-negative bacteria. However, the environmental regulation of
adhesin expression is likely to be present in some commensal and lactic acid bacteria also,
since bacteria that are unable to regulate their adhesin expression are often inefficient
colonizers (37,38). It has been suggested that the mucosal adhesive properties of the
lactic acid bacteria is strain and host dependent, and the mucosal binding of human lactic
acid bacteria are strain- and host specific (39,40). The adhesion and colonization of
bifidobacteria have been suggested to be disease (allergy, cancer) dependent (41,42). The
adhesion to the intestinal mucus of the fecal bifidobacteria from healthy infants was
significantly higher than for allergic infants, suggesting a correlation between allergic
disease and the composition of the bifidobacteria (41). Surprisingly, bifidobacteria,
amongst other bacteria, were generally positively associated with increased risk of colon
cancer in a study involving native Japanese and African patients (42). The ability of
intestinal bacteria to persist on the intestinal mucosal surface may ultimately be determined
Mucosal Interactions and Gastrointestinal Microbiota 131
by their doubling time in the intestine to maintain a high local concentration. Slowly-
dividing bacteria would be expected to be out-competed or washed-out with the intestinal
contents (43).
CROSS-TALK BETWEEN BACTERIA AND INTESTINAL
EPITHELIAL CELLS
As discussed in chapter 5, some ingested probiotic bacteria have shown immunomo-
dulatory properties (44-46). Both commensal and pathogenic bacteria possess recognized
structures named pathogen-associated molecular patterns (PAMPS). These recognized
structures are essential for the microbe, mostly constitutively expressed and shared by the
same group of microorganisms. PAMPS that are characterized to date include
N-formylated peptide (47), lipopolysaccharides (LPS) (48), and lipopeptides (49), more
recently described PAMPS are flagellin (50) and unmethylated segments of CpG DNA
(51). Even though unmethylated segments of CpG DNA are not a cell surface structure, it
serves to differentiate the microorganism from the host. Therefore, they epitomize the
ideal targets for the innate immune system to identify the presence of infectious agents
with a limited numbers of receptors.
The best studied of the PAMPS is the glycolipid LPS, an important component of the
outer membrane of Gram-negative bacteria. LPS is recognized by Toll-like receptor
(TLR) 4, the first described member of the family of transmembrane TLR molecules that
play a central role in the transcription activation of host defense mechanisms, such as
chemokine and cytokine secretion, and the expression of costimulatory molecules (52).
TLRs are transmembrane receptors defined by the presence of leucine-rich repeats in the
extracellular portion of the molecule and a Toll/IL-IR/resistance (TIR) cytoplasmic
domain. The extracellular leucine-rich repeats are thought to function in ligand recognition,
whereas the TIR domain works in signaling. Leucine-rich repeat domains are common to
proteins that are involved in the recognition of foreign proteins. There are currently 10
identified members of the mammalian TLR family (52). From recent publications (53), it
has been shown that some types of intestinal epithelial cells express TLR 4.
Upon activation of TLR 4 by LPS, a series of events lead to the activation of
ubiquitin ligase TRAF6 by a unique self-polyubiquitination reaction. TRAF6 then
activates the TAK1 complex (54). This step leads to the phosphorylation and activation of
mitogen-activated protein kinase and the inhibitor kB kinase (IKK) complex (54,55). The
IKK complex comprises two kinases, IKKa and IKKP, and one protein, NEMO. When
activated, IKKP phosphorylates IkBoc, triggering its polyubiquitination and degradation
(56,57). In the unstimulated state, the IkBoc interacts and traps NFkP in the cytosol.
Degradation of IkBoc releases the NFkP to translocate into the nucleus and to activate
proinflammatory and prosurvival gene expression. Therefore, TLR 4 activates multiple
signaling pathways which will eventually lead to the production of cytokines and other
factors to protect the host against infection (58). The expression level of TLR 4 in the
intestine of patients with inflammatory bowel disease was found to be strongly
up-regulated compared to the TLR 4 expression in healthy individuals.
As for the other PAMPS such as N-formylated peptides, the cell surface receptors
that recognized them are the heterotrimeric G-protein coupled receptors (59).
N-formylated peptides play an important role in recruiting and activating inflammatory
cells (60). They will eventually activate the NFkP pathway the same way as the TLR.
On the other hand, enteric pathogens have also evolved mechanisms to evade the
immune recognition and defense. Helicobacter pylori, the etiological agent of gastritis and
132 Chow and Lee
stomach cancer, expresses hypoacylated LPS to avoid recognition by the human
TLR4/MD2 module (61). Other pathogens like Yersinia pseudotuberculosis have
developed ways to down-regulate TLR 4 signaling by injecting proteins to abolish the
signaling leading to NFk(3 activation (52).
At the beginning of the chapter, we mentioned that the gastrointestinal tract is
colonized by huge, complex and dynamic populations of microorganisms. Hence, the
molecular pattern recognition of the epithelial cells of the gastrointestinal mucosa needs to
be tightly regulated so as to avoid an extreme immune response and uncontrolled
inflammatory reaction. The exact mechanism by which they do this still remains to be
elucidated. However, recent studies have shed light into this area of interest. The
mechanism by which one TLR, TLR 5, achieved this feat is due to the fact that gut
epithelial cells express TLR 5 only on their basolateral surfaces. Therefore only those
bacteria that breached the epithelial cells or have translocated flagellin across the epithelia
will activate the receptor (62).
Using a gnotobiotic mouse model it was shown that Bacteroides thetaiotaomicron is
able to induce the production of oc-L fucose on intestinal epithelial cells via a regulator,
FucR, as a molecular sensor of L-fucose availability (3,68). FucR coordinates expression
of an operon encoding enzymes in the L-fucose metabolic pathway in the bacteria with
expression of another locus that regulates production of fucosylated glycans in the
intestinal enterocytes. By tightly coordinating presentation of host-derived fucose with
the rate of fucose utilization, an excess of epithelial fucose is avoided. This may minimize
the risk of encroachment by pathogens that use fucosylated glycans as receptors for their
adhesins (69).
Certain pathogenic bacteria require intimate contact with the host to cause disease.
E. coli (EPEC) is one such pathogen which requires intimate attachment to the host cells for
maximum virulence to occur. There are a few factors which facilitate the cross-talk between
the microorganism and the host epithelial cells and this involves the EPEC-secreted
proteins, the type-three secretion system and the expression of outer membrane protein,
intimin (64,65). The release of extracellular protein via the type-three secretion system is
necessary for the formation of attaching lesions by EPEC. The attachment of bacteria is by
means of intimin binding to a 90 kDa tyrosine phoshorylated protein in the host membrane.
This receptor is known as translocated intimin receptor (Tir) and is of bacterial origin; it is
translocated on to the host membrane where its tyrosine residues become phosphorylated
and binds to intimin. Subsequent signal transduction events that occur within the host cells
are the activation of protein kinase C, inositol triphosphate and calcium release. This leads
to the formation of an actin-rich pedestal that forms a dome-like anchoring site for the
bacteria which is an essential feature of EPEC pathogenesis (63).
There is evidence to suggest that in some strains of Lactobacillus reuteri, mucus-
binding adhesion could be induced by the presence of mucin glycoproteins and solid
substratum (66).
CONCLUSION
The gastrointestinal tract is a highly dynamic ecosystem where interaction of the
microbiota with the host mucosa plays an important role. Thus, it not only functions to
digest food and absorb nutrients; it is also the major site where communication between
microbes, and also between microbiota and their host takes place.
Probiotics and prebiotics offer dietary means to support the balance of intestinal
microbiota. They may be used to counteract local immunological dysfunctions, to stabilize
Mucosal Interactions and Gastrointestinal Microbiota 133
the gut mucosal barrier function, to prevent infectious succession of pathogenic
microorganisms or to influence intestinal metabolism. However, many of the proposed
mechanisms still need to be validated in human clinical trials (67). Future research on
commensal microbiota interactions with mucosal surfaces of the host should focus on the
cross-talk and determining the signaling mechanisms involved.
REFERENCES
1 . Mitsuoka T. The human gastroinstestinal tract. In: Brian JB Wood, ed. In: Lactic Acid Bacteria,
Vol. 1. London and New York: Wood Publisher Elseivier Applied Science, 1992:69—1 14.
2. Hoskins LC. Mucin degradation in the human gastrointestinal tract and its significance to
enteric microbial ecology. Eur J Gastroenterol Hepatol 1993; 5:205.
3. Bry L, Falk PG, Midtvedt T, Gordon JI. A model of host- microbial interactions in an open
mammalian ecosystem. Science 1996; 273:1380-1383.
4. Ross MH, Kaye GI, Pawlina W. Digestive system III: esophagus and gastrointestinal tract.
Histology: A Text and Atlas. Philadelphia: Lippincott Williams & Wilkins, 2003 pp. 474-531.
5. Gartner LP, Hiatt JL. Digestive system III — alimentary canal. Color Textbook of Histology.
Philadelphia: W.B. Saunders Company, 1997 pp. 325-335.
6. Junqueria LC, Carneiro J, Contopoulos AN. Digestive tract. In: Junqueria LC, Carneiro J,
Contopoulos AN, eds. Basic Histology: Text and Atlas. Los Altos. CA: Lange Medical
Publications, 1998 pp. 272-303.
7. Allen A, Carroll NJ. Adherent and soluble mucus in the stomach and duodenum. Dig Dis Sci
1985; 30:55S-62S.
8. Forstner JF, Oliver MG, Sylvester FA. Production, structure, and biologic relevance of
gastrointestinal mucins. In: Blaser MJ, Smith PD, Ravdin JI, Greenberg HB, Guerrant RL, eds.
Infections of the Gastrointestinal Tract. New York: Raven Press, 1995:71-88.
9. Belley A, Keller K, Gottke M, Chadee K, Gottke M. Intestinal mucins in colonization and host
defense against pathogens. Am J Trop Med Hyg 1999; 60:10-15.
10. Cone RA. Mucus. In: Orga PL, Mestecky J, Lamm ME, Strober W, Bienenstock J, McGhee JR,
eds. Mucosal Immunology. New York: Academic Press, 1999:43-60.
1 1 . Kraehenbuhl JP, Neutra MR. Molecular and cellular basis of immune protection of mucosal
surfaces. Physiol Rev 1992; 72:853-879.
12. Savage DC. Microbial ecology of the gastrointestinal tract. Ann Rev Microbiol 1977;
6:155-178.
13. Alexander M. Microbial Ecology. New York: Wiley, 1971 pp. 3-21.
14. Nord CE, Hermdah I A, Kager L. Antimicrobial induced alteration of the human oropharyngeal
and intestinal microflora. Scand J Infect Dis Suppl 1986; 49:64-72.
15. Trenschel R, Peceny R, Runde V, et al. Fungal colonization and invasive fungal infections
following allogeneic BMT using metronidazole, ciprofloxacin and fluconazole or ciprofloxacin
and fluconazole as intestinal decontamination. Bone Marrow Transplant 2000; 26:993-997.
16. Tannock GW. Normal Microflora: An Introduction to Microbes Inhabiting the Human Body.
U.K.: Chapman and Hall, 1995.
17. Herbert MK, Holzer P, Roewer N. Problems of the Gastrointestinal Tract in Anesthesia, the
Perioperative Period, and Intensive Care. New York; Berlin: Springer, 1999.
18. Cohen MB, Giannella RA. Bacterial infections: pathophysiology, clinical features and
treatment. In: Philips SF, Permberton JH, Shorter RG, eds. The Large Intestine: Physiology,
Pathophysiology and Disease. New York: Raven Press, 1991:395-428.
1 9. Conway PL. Microbial ecology of the human large intestine. In: Gibson GR, Macfarlane GT, eds.
Human Colonic Bacteria: Nutrition, Physiology, and Pathology. Boca Raton: CRC, 1995:1-24.
20. Stark PL, Lee A. The microbial ecology of the large bowel of the breast-fed and formula-fed
infants during the first year of life. J Med Microbiol 1982; 15:189-203.
21. Berg RD. The indigenous gastrointestinal microflora. Trends Microbiol 1996; 4:430-435.
134 Chow and Lee
22. Ofek I, Doyle R. Recent developments in bacterial adhesion to animal cells. In: Ofek I,
Doyle R, eds. Bacterial Adhesion to Cells and Tissues. London: Chapman and Hall,
1994:321-512.
23. Lee YK, Lim CY, Teng WL, Ouwehand AC, Tuomola EM, Salminen S. Quantitative approach
in the study of adhesion of lactic acid bacteria to intestinal cells and their competition with
Enterobacteria. Appl Environ Microbiol 2000; 66:3692-3697.
24. Mirelman D, Ofek I. Microbial lectins and agglutinins. In: Mirelman D, ed. Microbial Lectins
and Agglutinins. New York: J. Wiley and Sons, 1986:1-19.
25. Abraham SM, Sharon N, Ofek I. Adhesion of bacteria to mucosal surfaces. In: Orga PL,
Mestecky J, Lamm ME, Strober W, Bienenstock J, McGhee JR, eds. Mucosal Immunology.
New York: Academic Press, 1999:31-42.
26. Schembri MA, Kjaergaard K, Sokurenko EV, Klemm P. Molecular charcterisation of the
Escherichia coli FimH adhesion. J Infect Dis 2001; 183:S28-S31.
o
27. Adlerberth I, Ahrne S, Johansson ML, Molin G, Hanson LA, Wold AE. A mannose-specific
adherence mechanism in Lactobacillus plantarum conferring binding to the human colonic cell
line HT-29. Appl Environ Microbiol 1996; 62:2244-2251.
28. Neesen J-R, Granato D, Rouvet M, Servin A, Teneberg S, Karlsson K-A. Lactobacillus
johnsonii Lai shares carbohydrates-binding specificities with several enteropathogenic
bacteria. Glycobiology 2000; 10:1193-1199.
29. Bernet MF, Brassart D, Neeser JR, Servin AL. Lactobacillus acidophilus LAI binds to cultured
human intestinal cell lines and inhibits cell attachment and cell invasion by enterovirulent
bacteria. Gut 1994; 35:483-489.
30. Chauviere G, Coconnier MH, Kerneis S, Darfeuille-Michaud A, Joly B, Servin AL.
Competitive exclusion of diarrheagenic Escherichia coli (ETEC) from human enterocyte-
like Caco-2 cells by heat-killed Lactobacillus. FEMS Microbiol Lett 1992; 70:213-217.
3 1 . Gopal PK, Prasad J, Smart J, Gill HS. In vitro adherence properties of Lactobacillus rhamnosus
DR20 and Bifidobacterium lactis DR10 strains and their antagonistic activity against an
enterotoxigenic Escherichia coli. Int J Food Microbiol 2001; 67:207-216.
32. Tuomola EM, Ouwehand AC, Salminen SJ. The effect of probiotic bacteria on the
adhesion of pathogens to human intestinal mucus. FEMS Immunol Med Microbiol 1999;
26:137-142.
33. Busscher HJ, Weerkamp AH. Specific and non-specific interactions in bacterial adhesion to
solid substrata. FEMS Microbiol Rev 1987; 46:165-173.
34. Pimentel GC, McClellan AL. In: Freeman WH, ed. The Hydrogen Bond. San Francisco; New
York: Reinhold Pub. Corp, 1960.
35. Reid G, Servin AL, Bruce AW, Busscher HJ. Adhesion of three lactobacillus strains to human
urinary and intestinal epithelial cells. Microbios 1993; 75:57-65.
36. Klemm P. Fimbrial adhesions of Escherichia coli. Rev Infect Dis 1985; 7:321-340.
37. Adlerberth I. Establishment of a normal intestinal microflora in the newborn infant. In:
Hanson L, Yolken RH, eds. Probiotics, Other Nutritional Factors, and Intestinal Microflora.
Philadelphia: Vevey/Lippincott-Raven Publishers, 1999:63-78.
38. Duguid JP, Old DC. Adhesive properties of enterobacteriaceace. In: Beachey EC, ed. In:
Bacterial Adherence, Receptors and Recognition, Vol. 6. London: Chapman and Hall,
1980:185-216.
39. He F, Ouwehan AC, Hashimoto H, Isolauri E, Benno Y, Salminen S. Adhesion of
Bifidobacterium spp. to human intestinal mucus. Microbiol Immunol 2001; 45:259-262.
40. Kirjavainen PV, Ouwehand AC, Isolauri E, Salminen SJ. The ability of probiotic bacteria to
bind to human intestinal mucus. FEMS Microbiol Lett 1998; 167:185-189.
41. He F, Ouwehand AC, Isolauri E, Hashimoto H, Benno Y, Salminen S. Comparison of mucosal
adhesion and species identification of bifidobacteria isolated from healthy and allergic infants.
FEMS Immunol Med Microbiol 2001; 30:43-47.
42. Moore WE, Moore LH. Intestinal floras of populations that have a high risk of colon cancer.
Appl Environ Microbiol 1995; 61:3202-3207.
Mucosal Interactions and Gastrointestinal Microbiota 135
43. Lee YK, Ho PS, Low CS, Arvilommi H, Salminen S. Permanent colonization by Lactobacillus
casei is hindered by low rate of cell division in mouse gut. Appl Environ Microbial 2004;
70:670-674.
44. Link-Amster H, Rochat F, Saudan KY, Mignot O, Aeschlimann JM. Modulation of a specific
humoral immune response and changes in intestinal flora mediated through fermented milk
intake. FEMS Immunol Med Microbiol 1994; 10:55-63.
45. Schiffrin EJ, Rochat F, Link-Amster H, Aeschlimann JM, Donnet-Hughes A. Immunomodula-
tion of human blood cells following the ingestion of lactic acid bacteria. J Dairy Sci 1995;
78:491-497.
46. Haller D, Blum S, Bode Ch, Hammes WP, Schiffrin EJ. Activation of human PBMC by non-
pathogenic bacteria in vitro: evidence of NK cells as primary targets. Infect Immun 2000;
68:752-759.
47. Anton P, O' Conell J, O'Conell D, et al. Mucosal binding sites for the bacterial chemotactic
peptide, formyl-methionyl-leucyl-phenylalanine (FMLP). Gut 1998; 42:374-379.
48. Poltorak A, He X, Smirnova I, et al. Defective LPS signaling in C3H/HeJ and C57BL/10ScCr
mice: mutations in Tlr4 gene. Science 1998; 282:2085-2088.
49. Takeuchi O, Sato S, Horiuchi T, et al. Cutting edge: role of Toll-like receptor 1 in mediating
immune response to microbial lipoproteins. J Immunol 2002; 169:10-14.
50. Gerwitz AT, Simon PO, Jr., Schmitt CK, et al. Salmonella typhimurium translocates flagellin
across intestinal epithelia inducing a proinflammatory response. J Clin Invest 2001;
107:99-109.
51. Di Martino P, Girardeau JP, Der Vartanian M, Joly B, Darfeuille-Michaud A. The central
variable V2 region of the CS31A major subunit is involved in the receptor-binding domain.
Infect Immun 1997; 65:609-616.
52. Backhed F, Hornef M. Toll-like receptor 4-mediated signaling by epithelial cell surfaces:
necessity or threat? Microbes Infect 2003; 5:951-959.
53. Abreu MT, Arnold ET, Thomas LS, et al. TLR4 and MD-2 expression is regulated by
immune-mediated signals in human intestinal epithelial cells. J Biol Chem 2002;
277:20431-20437.
54. Wang C, Deng L, Hong M, Akkaraju GR, Inoue J, Chen ZJ. TAK1 is a ubiquitin-dependent
kinase of MKK and IKK. Nature 2001; 412:346-351.
55. Ninomiya-Tsuji J, Kishimoto K, Hiyama A, Inoue J, Cao Z, Matsumoto K. The kinase TAK1
can activate the NIK-I kappa B as well as MAP kinase cascade in the IL-1 signaling pathway.
Nature 1999; 398:252-256.
56. Delhase M, Hayawaka M, Chen Y, Karin M. Positive and negative regulation of IkappaB
kinase activity through IKKbeta subunit phosphoryation. Science 1999; 284:309-313.
57. Hu Y, Baud V, Delhase M, et al. Abnormal morphogenesis but intact IKK activation in mice
lacking the IKKalpha subunit of IkappaB kinase. Science 1999; 284:316-320.
58. Zhang Y, Bliska JB. Role of toll-like receptor signaling in the apoptotic response of
macrophages to Yersinia infection. Infect Immun 2003; 71:15 13—1519.
59. Radel SJ, Genco RJ, De Nardin E. Structural and functional characterization of the human
formyl peptide receptor ligand-binding region. Infect Immun 1994; 62:1726-1732.
60. Snyderman R, Fudman EJ. Demonstration of a chemotactic factor receptor on macrophages.
J Immunol 1980; 124:2754-2757.
61. Chaudhary PM, Ferguson C, Nguey V, et al. Cloning and characterization of two
Toll/Interleukin- 1 receptor-like genes TIL3 and TIL4: evidence for multi-gene receptor
family in human. Blood 1998; 91:4020-4027.
62. Gewirtz AT, Liu Y, Sitareman SV. Madara. Intestinal epithelial pathobiology: past, present,
future. Best Pract Res Clin Gastroenterol 2002; 16:851-867.
63. Lu L, Walker WA. Pathologic and physiologic interactions of bacteria with the gastrointestinal
epithelium. Am J Clin Nutr 2001; 73:1124S-1130S.
64. Luo Y, Frey EA, Pfuetzner RA, et al. Crystal structure of enteropathogenic Escherichia coli
intimin-receptor complex. Nature 2000; 405:1073-1077.
136 Chow and Lee
65. Sinclair J, O' Brien AA. Cell surface-localized nucleolin is a eukaryotic receptor for the
adhesion intimin-y of enterohemorrhagic Escherichia coli 0157: H7. J Biol Chem 2002;
277:2876-2885.
66. Jonsson H, Strom E, Ross S. Addition of mucin to the growth medium triggers mucus-binding
activity in different strains of Lactobacillus reuteri in vitro. FEMS Microbiol Lett 2001;
204:19-22.
67. Holzapfel WH, Haberer P, Snel J, Schillinger U, Huis in't Veld JHJ. Overview of gut flora and
probiotics. Int J Food Microbiol 1998; 41:85-101.
68. Hooper LV, Xu J, Falk PG, Midtvedt T, Gordon JI. A molecular sensor that allows a gut
commensal to control its nutrient foundation in a competitive ecosystem. Proc Natl Acad Sci
U.S.A. 1999; 96:9833-9838.
69. Ayabe T, Satchell DP, Wilson CL, Parks WC, Selsted ME, Ouellette AJ. Secretion of
microbicidal alpha-defensins by intestinal Paneth cells in response to bacteria. Nat Immunol
2000; 1:113-118.
7
The Metabolism of Nutrients and Drugs
by the Intestinal Microbiota
Barry R. Goldin
Department of Public Health and Family Medicine, Tufts University School of Medicine,
Boston, Massachusetts, U.S.A.
INTRODUCTION
The intestinal microbiota of humans is comprised of a complex ecosystem of metabolically
active microorganisms that reside close to the mucosal surface of the intestine. The bacteria
of the intestine can interact with substrates introduced orally or compounds entering the
intestinal lumen via the bile, mucosal secretions, or systemically from the circulatory
system. This chapter will review the bacterial reactions performed on nutrients and drugs
entering the intestine. The composition and distribution of the intestinal microbiota will not
be discussed, and the readers are referred to other chapters in this book and review articles
that address this topic (1-4). It is, however, important to note that the intestinal microbiota at
any given time weighs approximately 1 10 to 200 grams and consists of at least 400 different
species. The number of bacterial cells is approximately ten times greater than the total
number of cells comprising the human body. Although the mass of the intestinal
microbiome is equivalent to that of a single kidney, the number and diversity of species
affords the microbiota a diverse metabolic role in the human body. This chapter will review
some of these reactions and implications of these transformations to the host; however, no
attempt will be made to exhaustively review all known reactions carried out by the
microorganisms that inhabit the gastrointestinal tract of humans and animals.
GENERAL METABOLISM AND FUNCTION OF THE MICROBIOTA
The bacteria of the intestinal microbiota are predominantly anaerobic with a small
percentage of facultative anaerobes. Therefore, intestinal bacteria do not use oxygen as a
terminal election acceptor, and derive their energy from anaerobic respiration or substrate
level phosphorylation. The magnitude of energy derived is the difference in redox
potential between the substrate, and the products formed (5,6). The major overall balance
of the intestinal microbiota derives from the ability to convert available substrates,
principally originating from oral ingestion by the host of nutrients, fiber, and intestinal
137
138
Goldin
secretions or endogenously host synthesized compounds entering the intestine via the bile
into the biomass that makes up the microorganisms in the intestine. The total biomass is
principally controlled by space constraints, transit time of the digesta, and substrate
availability. In general, approximately 50% of the fecal mass is composed of intestinal
microorganisms. In addition to the utilization of substrates derived from the host, the
intestinal microbiota can provide the host with energy mainly in the form of short chain
fatty acids, and nutritive benefit by producing certain vitamins.
Metabolic Reactions of the Intestinal Microbiota
In Table 1 the major chemical reactions performed by the microbiota are listed. Most of
the bacterial reactions can be classified as reductive, hydrolytic, or removal of functional
groups such as dehydroxylation and decarboxylation. These reactions are often catalyzed
by specific bacterial enzymes.
NUTRIENTS AND DIETARY PLANT COMPOUNDS
Fermentation of Carbohydrates
Carbohydrate fermentation is a major source of energy for the intestinal microbiota. It has
been estimated based on the biomass of the microbiota in the intestine that 20-70 grams of
carbohydrate or equivalent substrates based on similar energy density would be required to
be fermented to provide a biomass steady state (5-8). This calculation takes into account
Table 1 Reactions Performed by the Intestinal Microflora
Types of reaction
Example of substrate
Hydrolytic reactions
Glucuronides
Glycosides
Amides
Esters
Sulfamates
Nitrates
Reductive reactions
Nitrocompounds
Azocompounds
Double bonds
Aldehydes
N-oxides
Nitrosation
Amines
Removal of functional group
C-hydroxy
N-hydroxy
Carboxyl
Methyl
Amine
Chlorine
Phenolphthalein-glucuronide
Cellobiose
Methotrexate
Acetyldigoxin
Amygdalin
Pentaerythritol trinitrate
1-nitropyrene
Direct red 2
Polyunsaturated fatty acids
Benzaldhydes
4-Nitroquinoline- 1 -oxide
Dimethylamine
Bile acids
N-hydroxyfluorenyl-acetamide
Amino acids
Biochanin A
Amino acids
DDT
Abbreviation: DDT, dichloro-diphenyl-trichloroethane.
The Metabolism of Nutrients and Drugs by the Intestinal Microbiota 139
that bacteria are excreted daily, and that the normal intestinal transit time varies between
48 and 72 hours. In "Western societies," such as the United Kingdom, the major intestinal
bacterial carbohydrate substrates available are non-starch polysaccharide 12 grams,
oligosaccharides 5 grams, simple sugars less than 5 grams, resistant starch 4 grams, and
fermentable polysaccharides from intestinal mucus unknown (5,9). The amount of
carbohydrate derived from colonic mucus available for bacterial fermentation is limited
based on the fact that elemental diets support a very low bacterial biomass (10,1 1). All of
these sources of carbohydrates are not readily digested and absorbed by humans, and thus
arrive intact in the colon.
Bacteroides, the most abundant bacterial genus in the ileum and colon can degrade,
and ferment a number of different polysaccharides, including xylan, psyllium
hydrocolloid, and numerous other plant polysaccharides (12,13). Bacteroides can also
degrade host derived glycans such as chondroitin sulfate, mucin, heparin, hyaluronate,
and glycosphingolipids.
The fact that non-absorbable polysaccharides would not provide energy for the host
adds a function to intestinal bacterial carbohydrate fermentation, namely salvaging energy.
The major end products of bacterial fermentation in the intestine are the short chain fatty
acids, acetate, propionate, and butyrate (14). For humans approximately 20-70 grams of
carbohydrate would normally be fermented by intestinal flora per day. This would translate
into 30-105 kcal per day or between 1.5 and 5% of typical human caloric intake. This
percentage of caloric requirements varies greatly with the amount of fiber and other non-
absorbable polysaccharides consumed per day. In developing countries, populations may
derive larger benefits from bacterial metabolism in the intestine, as a result of greater
consumption of plant fiber.
Intestinal Bacterial Protein, Amino Acid, and Nitrogen Metabolism
In monogastric animals there are several sources of nitrogen containing compounds that
enter the large intestine, and thus are substrates for metabolic action by the microflora. The
sources include incompletely digested dietary protein, protein from intestinal epithelial
cells, and digestive secretions including digestive enzymes, glycoprotein mucins, free
amino acids, and peptides including those derived from a bacterial origin. In addition,
ammonia, urea, and nitrate are found in the ileal effluent. In terms of amounts and
composition of nitrogen containing compounds entering the large intestine, it has been
estimated in humans that 12-18 grams of protein enter the cecum from the ileum per day,
and 2-3 grams per day of nitrogen (15). The approximate relative amount of nitrogen
containing compounds in the large intestine is 48-51%, 34-42% peptides, and 10-15%
urea/ammonia/nitrate, and free amino acids (15). The nitrogen sources in ileal effluent are
primarily pancreatic enzyme protein and dietary protein residue. In contrast, in the feces the
nitrogen compounds are more than 50% of bacterial origin (16). Therefore, although the
balance of nitrogen is relatively well maintained between the amount entering and leaving
the colon, the bacteria change the nature of the nitrogen containing compounds by utilizing
these nitrogen compounds, and to large extent converting them into bacterial protein, which
is found in the feces as intact bacteria, and as products of the lysed microorganisms.
There are five major bacterial pathways for deaminating amino acids; four are
designated as direct pathways, and one is considered an indirect pathway. The direct
pathways are: reduction resulting in saturated fatty acid production; oxidation resulting in
the formation of keto acids; hydrolysis causing the formation of an alpha-hydroxy fatty acid;
and removal of the elements of ammonia, producing an unsaturated fatty acid (17). A fifth
deamination pathway is known as the Strickland reaction, and is carried out by Clostridia
140 Goldin
that have little or no capacity to degrade single amino acids. As consequence the Clostridia
degrade amino acids in pairs by a coupled oxidation-reduction reaction forming a keto acid
and a saturated fatty acid. Reduction reactions are the major pathway for the degradation of
amino acids in the intestine. The reduction products of the action of intestinal anaerobic
organisms include: acetic, propionic, butyric, and isovaleric, isobutyric, and 2-methylbu-
tyric acids (18). Other reductive products are ammonia, amines, carbon dioxide, and
hydrogen (19). Some of the products that result from reductive degradation of aromatic
amino acids include phenol, p-cresol, phenylactic acid, phenylpropionic acid, indole,
indoleacetic acid, and indolepropionine acid.
Decarboxylation is a second class of reactions that the intestinal microbiota perform
in the course of the intestinal amino acid degradation (20). Bacterial decarboxylases act on
amino acids to form amines and carbon dioxide. Many of these decarboxylases are
specific, acting only on a single amino acid. There are a number of different genera of
intestinal bacteria that have decarboxylase activity including: enterobacteria, enterococci,
lactobacilli, Clostridia, Bacteroides, and bifidobacteria (19). Some of the specific products
formed from bacterial decarboxylation are the formation of cadavarine from lysine,
putrescine from ornithine, histamine from histidine, and tyramine from tyrosine.
Intestinal bacteria can assimilate ammonia from the surrounding environment (20),
and incorporate it into cell structures. Bacteria are also capable of ammonia production
from peptides and amino acids (21).
Bacterial Intestinal Lipid Metabolism
In healthy humans, the vast majority of free fatty acid formed from dietary lipids is
absorbed in the small intestine. The anaerobic bacterial microflora have the capability to
hydrate, and hydrogenate double bonds found in unsaturated fatty acids (22,23). This is
evidenced by the presence of 10-hydroxy stearic acid in human feces. The limited amounts
of fatty acids that are transported to the lower intestinal tract relegate intestinal bacterial
metabolism to minor significance in humans.
Short Chain Fatty Acids
Short chain fatty acids are not an important dietary nutrient, however, they are being
discussed at this point because they are a significant end product of carbohydrate and
amino acid bacterial metabolism. Short chain fatty acids are readily absorbed from the
human colon, and facilitate the absorption of salt and water by the colon. Colonic
epithelium derives 60-70% of its energy from short chain fatty acids with butyrate being
the most important in this regard (24). Short chain fatty acids also stimulate mucosal
growth in the colon. As stated previously, the major short chain fatty acids produced by
intestinal bacterial fermentation are acetate, butyrate, and propionate. Additional end acid
products include: lactate, succinate, and formate (25). The fate of these bacterially
produced acid end products has been studied to varying extents. In humans, acetate is
always found at a concentration of 50 micromolar in fasting venous blood. After a
carbohydrate rich meal, these blood levels rise to 100 to 300 micromolar (5). The half-life
of acetate in the blood is only a few minutes, and is taken up and metabolized in skeletal
and cardiac muscle, brain, and adipocytes for lipogenesis (5). Acetate spares fatty acid
oxidation but has only a small influence on glucose metabolism, and has no effect on
insulin release in humans.
The Metabolism of Nutrients and Drugs by the Intestinal Microbiota 141
Intestinal Bacterial Synthesis and Metabolism of Vitamins
The human intestinal bacteria can synthesize vitamin K, a member of the naphtoquinone
family. The liver cannot synthesize the prothrombin complex, a blood-clotting factor,
unless menaquinone, a substituted naphthoquinone, is present. The peptides that become
the glycopeptides of the prothrombin complex require menaquinone for synthesis from the
appropriate RNA codon.
Bacteria found in the intestine can also synthesize homologues of menaquinone-7
(vitamin K 2 ). The synthesized homologues range from the 6-isoprene unit side chain
containing menaquinone-6 to menaquinone- 1 3 (26,27). The vitamin K bacterial reactions
occur, in part, in the ileum, where the menaquinone is absorbed. The importance of bacterial
synthesis of vitamin K has been demonstrated in human studies (28). Adult subjects
maintained on a low vitamin K diet for several weeks did not develop a deficiency. When
these subjects were treated with antibiotics such as neomycin that reduce the bacterial
population of the intestine, a significant decrease in plasma prothrombin levels was noted
(28,29).
Most of the vitamin B 12 (cyanocobalamin) required by humans comes indirectly
from the meat and milk of ruminants. The synthesis of B 12 in ruminants is exclusively of
bacterial origin. The human intestinal microflora also synthesize vitamin B 12 as evidenced
by the fecal secretion of approximately 5 micrograms per day. However, it appears most of
the bacterially formed B i2 in humans occurs in the large bowel where absorption most
likely does not occur due to lack of B 12 mucosal receptors. However, there is a study of
healthy subjects from Southern India that reported the synthesis of vitamin B 12 in the
jejunum and ileum, an area where absorption of the vitamin can occur (30). It was
demonstrated that pseudomonas and klebsiella were two of the bacteria that synthesized
B 12 in the small intestine.
Biotin is synthesized by the human intestinal microflora. The administration of
antibiotics can lower human urinary biotin levels. The importance of bacterial
involvement in biotin synthesis has been demonstrated in germfree rats. The germfree
animals require biotin in their diet; in contrast conventional rats can thrive without dietary
biotin (22).
Folic acid and thiamine B complex vitamins are also synthesized by bacteria in the
intestinal tract. This synthesis does not solely provide for human requirements, and dietary
sources of these vitamins are required to prevent deficiencies (31).
Intestinal Bacterial Metabolism of Isoflavones and Lignans
Dietary plant sources, such as vegetables, fruit, and cereals contain in addition to nutrients
a large number of physiological active compounds. Many of these orally consumed
compounds are transformed by the intestinal bacteria, which can result in either biological
activation or deactivation of these substances. There are many plant-derived substances. In
this section, two of these compounds of recent interest, the bacterial metabolism of the
phytoestrogen compounds isoflavones and lignans are discussed.
Isoflavones have weak estrogenic and antiestrogenic activities. Soybeans contain the
highest levels of isoflavones in the human food chain. Other plant foods that contain
isoflavones are pinto beans, navy beans, and chick peas, which have approximately two
orders of magnitude lower levels. For populations consuming soy-based foods, the amount
of isoflavones eaten daily is between 30 and 150 mgs. For daidzein, one of three major soy
isoflavones, the intestinal bacteria can convert the parent compound into several end
products. Among the end products are o-desmethylangolensin, equol, cis-4-equol, and
142 Goldin
dihydrodaidzein (32). There is a large individual variation in the ability of intestinal
bacteria to metabolize daidzein. Studies have shown that production of equol does not
occur in 30-40% of people fed soy isoflavones, and the remainder are active equol
producers (33). The conversion of daidzein to equol can be of physiological importance
since equol is a more potent estrogenic substance. The factors that control the extent of
bacterial conversion of isoflavones in the intestine are unknown.
Genistein, the isoflavone with the highest concentration in soy, is converted by
intestinal bacteria to dihydrogenistein, and p-ethyl phenol. These reactions most likely
lower or destroy the estrogenic activity of genistein. Glycetein, the third most prevalent
isoflavone contained in the soybean, is bacterially converted to 5-hydroxy-, and
5-methoxy-o-desmethylangolensin. There are other bacterial metabolites of isoflavones,
and new end products are still being isolated.
Lignans are found in relatively high concentrations in flaxseed, whole-grain
products, vegetables, and sesame seeds (32). Lignans also exhibit weak estrogen and anti-
estrogen activity, although these activities are lower than those found in isoflavones (32).
The plant lignan precursors secoisolariciresinol and matainresinol are converted by the
intestinal microflora to enterodiol and enterolactone, respectively (32). The physiological
importance of these bacterial conversions are not clear.
INTESTINAL BACTERIAL METABOLISM OF HOST ENDOGENOUSLY
SYNTHESIZED COMPOUNDS
Bacterial Cholesterol Metabolism
The intestinal tract has a major impact on cholesterol metabolism (34-36). A major source of
intestinal cholesterol comes from the de novo synthesis of the sterol compound. Cholesterol
also can enter the intestine from dietary sources. It has been estimated that 34-57% of dietary
cholesterol is absorbed from the intestine (37). In humans cholesterol synthesized by the
intestinal cells is introduced into the lumen by exfoliation of these cells. An additional source
of intestinal cholesterol is via biliary excretion.
The fecal excretion of total neutral sterols in humans ranges from 350-900 mg/day,
with a mean of 700 mg/day (38). Cholesterol accounts for about 20% of the total neutral
sterols excreted in the feces, or about 150 mg/day. The normal range of cholesterol
excreted by humans in the feces is between 75-200 mg/day. As discussed above, there are
three sources of intestinal and fecal cholesterol: unabsorbed cholesterol from the diet
which contributes 20%, bile which contributes 67%, and sloughed intestinal epithelial
cells which contribute 13% of the total fecal cholesterol (39).
The cholesterol that enters the intestine can be metabolized by bacterial microflora.
Cholesterol is converted to 4-cholesten-3 one which is an intermediate formed by the
oxidation of the 3 beta-hydroxyl group to a ketone, and isomerization of the 5-6 double
bond to the 4-5 position. Coprostonone is formed by the reduction of the 4-5 double bond.
The final reaction is the formation of coprostonal by reduction of the 3-beta to a hydroxyl
group (34).
The amounts of cholesterol and its metabolites found in feces are approximately
20% cholesterol, 65% coprostonal, and 10% coprostanone (40). An additional 5% of fecal
neutral sterols are made up of cholesterol, cholestanone, and epicoprostanol (40).
Studies in Americans have shown that the majority of this population metabolizes
cholesterol in the intestine (41). The distribution of intestinal bacterial conversion was
bimodal. The majority of subjects converted 70-99% of cholesterol in their feces to
metabolites, and a smaller group of individuals converted 0-19% of cholesterol (42).
The Metabolism of Nutrients and Drugs by the Intestinal Microbiota 143
Intestinal Bacterial Metabolism of Bile Acids and Bile Pigments
Cholesterol is a precursor of bile acids, and both are synthesized in the liver from two carbon
units. Bile acids synthesized in the liver are conjugated through an amide bond to either
glycine or taurine. The conjugated bile acids are deposited in the bile, and excreted into the
upper small intestine. The bacterial conversion of bile acids primarily occurs in the distal
ileum and colon. The bacterial reactions on bile acids include: the hydrolysis of the amide
bond to release free bile acids from their corresponding glycine and taruine conjugates; an
oxidoreduction of the hydroxyl groups at C3, C7, and C12 to form either oxo bile acids or
alpha hydroxyl groups after the reduction of the beta groups (inversion products); and
dehydroxylation at C7, and to a smaller extent at the C3 and C12 positions (43).
The consequence of these reactions is the conversion of primary to secondary bile acids, and
the re-absorption of free bile acids from the ileum, and to a lesser extent, from the colon.
Only approximately 5% of bile acids are lost in the feces in each cycle as a result of bacterial
deconjugation of bile acids (44).
Bacterial Metabolism of Androgens and Estrogens
Estrone, estradiol, and estriol are the three major estrogens that are excreted into the bile.
These estrogens are conjugated to glucuronic acid and/or sulfate. Upon excretion of these
conjugated estrogens from the bile into the small intestine the conjugates are available
substrates for bacterial metabolism. The bacteria of the lower small intestine and colon can
hydrolyze the estrogen conjugate releasing free estrogens (45). The nonconjugated
estrogens are then subject to additional bacterial action. A major reaction involves
oxidoreduction of the C17 position. Bacteria can convert estrone to estradiol, and the fecal
flora can also convert 16 alpha hydroxy estrone to estriol (46).
The intestinal bacteria can also modify androgens. The intestinal bacteria can
reversibly oxidize and reduce the 3 -hydroxy group, and reduce steroid nuclear double bonds
at the one and four positions. The latter reactions can result in several intercon versions of
androgens (47).
Other Steroid Hormone Bacterial Conversions
Studies have shown that fecal organisms can modify corticosteroids. The corticosteroids
undergo reduction in ring A, and undergo side-chain dehydroxylation separately or sequen-
tially with the reduction (48). Cortisol is converted to 2 1-deoxycortisol, tetrahydrocortisol, and
tetrahyro-21-deoxy Cortisol (48). Corticosterone is metabolized to tetrahydrocorticosterone,
21 -deoxycorticosterone, and 3-alpha-hydroxy or 3 -beta-fry droxy epimers of tetrahydro-21-
deoxycorticosterone (48).
The intestinal bacteria can also transform progesterone similar to the reactions
described above. Bacterial reduction of ring A can occur, as well as 16-alpha dehydroxylation,
which can cause epimersation of the side chain (48).
OTHER BACTERIAL REACTIONS
Sulphate Metabolism
The human colon contains Gram-negative anaerobes capable of reducing sulphates. The
process is referred to as dissimilatory sulphate reduction, and results in the conversion of
sulphates and sulphites to sulphides (49,50). The major bacterial genus that performs this
144 Goldin
reaction in the human colon is Desulfovibrio. Hydrogen gas in the colon is used as an
electron donor in the formation of sulphides (50). The source of sulphates for bacterial
reduction can come from food preservatives and drugs, and the levels of sulphides are
highest in the sigmoid colon and rectum (51). Less than half of the human population
appears to actively reduce sulphate in the large bowel (52).
Aromatization
Quinic acid is found in food products such as coffee, tea, fruits, and vegetables. Quinic
acid has an aliphatic cyclic structure. Quinic acid is excreted in the urine as hippuric acid,
an aromatic ring containing compound (53). Evidence that the intestinal bacteria are
involved in the aromatization comes from the observation that hippuric acid is not formed
when Quinic acid is given parenterally, and the formation of hippuric acid is inhibited
when the antibiotic neomycin is given to humans (53). These findings strongly support the
hypotheses that aromatization occurs as a result of intestinal bacterial action.
Bacterial Carbon-Carbon Bond Cleavage
The human intestinal flora has been shown capable of breaking the carbon bond between
two of the rings of the product sennidin (54), which is found in senna and rhubarb. The
product formed from this cleavage is rhein anthrone. The carbon-carbon cleavage is of
physiological importance since this reaction is required for the observed laxative action of
plant sennosides.
BACTERIAL INTESTINAL FORMATION OF MUTAGENS
In Table 2 are shown some of the mutagens formed as a result of intestinal bacterial
reactions. The bacterial enzymes that catalyze the reactions that potentially can produce
mutagens, carcinogens, and tumor promoters are also presented in Table 2. Some of the
reactions discussed in this section also act on various drugs, and will again be discussed in
the section on drug metabolism.
Intestinal bacterial enzymes that have been implicated in the formation of
carcinogens, mutagens, and tumor promoters include: beta-glucuronidase, beta-glucosidase,
beta-galactosidase, nitroreductase, azoreductase, sulfatases, nitrosation, tryptophanase,
1 -alpha-steroid dehydrogenase, and 7 -alpha-hydroxy steroid dehydroxylase (55).
Table 2 Substrates Converted into Mutagens as a Result of Intestinal Bacterial Reactions
Substrate Bacterial enzyme
2-Nitrofluorene Nitroreductase
Metronidazole Nitroreductase
Trypan blue Azoreductase
Ponceau 3R Azoreductase
Cycasin Beta-glucosidase
1 -Nitropyrene B eta-glucuronidase
Cyclamate Sulfatase
Dimethylamine Nitrosation
Tryptophan Tryptophanase
The Metabolism of Nutrients and Drugs by the Intestinal Microbiota 145
Glycosidase
A classic example of the role of the intestinal flora in generating carcinogens is illustrated
by the action of this bacterial enzyme on the plant derived compound cycasin (56).
Cycasin is a naturally occurring beta-glucoside of methylazoxymethanol, extractable from
the seeds and roots of cycad plants. It was observed that when Cycasin was fed to infant
rats a number of different tumors developed. The Cycasin-induced tumors included
hepatomas, renal sarcomas, squamous-cell carcinomas of the ear duct, and most frequently
large bowel and duodenal adenocaricomas (56). The genetic strain of the rat did not appear
to have a major influence on tumor development. It was, however, noted that the intestinal
flora was required for tumorgenesis, since when Cycasin was given orally to germfree rats
no tumors were observed (57). The discovery of the carcinogenicity of Cycasin led to
experiments to test the precursor aglycones of Cycasin azoxymethane, azomethane, and
dimethylhydrazine. These compounds were carcinogenic in conventional and germfree
rats (58). The route of administration was not critical, and tumors developed after oral or
subcutaneous administration (56). These results confirmed that the hydrolysis by the
intestinal flora of the glycosidic bond was required for the activation of Cycasin. It was
also observed that infant but not adult rats developed tumors when given Cycasin by
intraperitoneal injection confirming the observation that tissue b-glucosidase disappeared
in rats after 3 weeks of life (56).
Many other plant natural products occur as glycosides. These glycosides do not
demonstrate mutagenicity when tested in the Salmonella test; however, upon hydrolysis of
the glucosidic linkages they become mutagenic. There have been several studies showing
mixed fecal cultures or fecal isolates of Streptococcus faecium can convert non-mutagenic
rutin (quercetin-3-D-beta-D-glucose-alpha-L-rhamnose) to quercetin (59). Quercetin has
been shown to be mutagenic in the Ames salmonella assay. Red wine and tea contain
glycosides of quercetin.
Beta-Glucuronidase
The formation of glucuronides in the liver is an important mechanism for detoxifying and
enhancing excretion of a large number of orally ingested nutrients and their end products,
other dietary compounds, and drugs, as well as endogenously synthesized compounds,
such as estrogens. In humans many of these glucuronides depending on the structure of the
aglycone, are excreted in the bile, and subsequently enter the duodenum. The glucuronides
are then subject to bacterial deconjugation primarily in the ileum and colon. As a
consequence of this bacterial deconjugation physiologically active, toxic, and
carcinogenic compounds are regenerated. In addition to their formation in the intestine
these compounds can be reabsorbed into the portal blood system. This results in recycling
of these hydrolyzed glucuronides, and this process is referred to as the enterohepatic
circulation.
Several studies have shown that intestinal beta-glucuronidase can alter or amplify
the biological activity of exogenous and endogenous compounds.
The metabolism of the carcinogen N-hydroxyflourenylacetamide administered
parenterally to conventional and germfree rats was studied by Weisburger et al. (60).
Germfree rats excreted larger amounts of the glucuronides of N-hydroxyflourenylace-
tamide in their feces compared to conventional animals. The cecal and fecal contents of
conventional rats contained mostly unconjugated N- hydroxy flourenylacetamide, and its
metabolites; in contrast most of these metabolites were glucuronide or sulfate conjugates
in germfree animals.
146 Goldin
It has been shown that cell-free extracts derived from a number of different bacteria
residing in the intestinal tract, including Bacteroides fragilis, Bacteroides vulgatus,
Bacteroids thetaiotamicron, Eubacterium eligens, Peptostreptoccus, and Escherichia coli,
were capable of increasing the mutagenic activity of bile from rats fed 1-nitropyrene via
stomach tube. These extracts had beta-glucuronidose activity. Cell-free extracts of
bacteria that were not able to enhance the mutangenicity of the bile did not possess beta-
glucuronidose activity (61). These data support the hypothesis that glucuronides of
1-nitropyrene metabolites entering the bile can be hydrolyzed by intestinal bacterial beta-
glucuronidase to produce active deconjugated mutagenic products.
Bacterial Azoreductase
Azoreductase activity, which is of exclusively bacterial origin in the lumen of the
intestine, catalyzes the reduction of the azo bond to cause the formation of aromatic
amines. The highly reactive intermediates and end products have been shown to be
mutagenic and carcinogenic. Azo dyes are used for coloring in the food industry, and as
dyes and stains in textiles and other products. Water-soluble azo dyes are degraded by the
intestinal microflora in the gastrointestinal tract (62). There is a 90% correlation between
carcinogenicity and mutagenicity for aromatic amines and azo dyes tested by the Ames
Salmonella test (63). The need for bacterial azoreductase and nitroreductase to activate
mutagens, such as azocompounds in combination with intestinal mucosal microsomal
enzymes has been demonstrated (64,65).
The reduction of azocompounds by azoreductase is mediated through a free radical
mechanism that produces intermediates that react with nucleic acids and proteins. The
action of azoreductase on food dyes results in the release of phenyl-, and naphthyl-
substituted amines. The amines generated in the lower intestine by bacterial action are
probably oxidized by microsomal enzymes in the intestinal mucosa to carcinogens.
Bacterial generation of mutagens from a number of azodyes has been demonstrated.
Trypan blue, a widely used biologic stain, is converted to the mutagen O-toluidine by cell
free extracts of Fusobacterium, an anaerobic organism found in the large intestine (66).
Ponceau 3R, another biologic stain, is reduced Fusobacterium to 2, 4, 5-trimethylaniline
which is mutagenic (67). Other azo dyes that have been shown to be transformed by
bacterial reduction to mutagenic or carcinogenic products are direct black 38, direct red 2,
and direct blue 15. Congo red lacks mutagenic activity, however, preincubation of dye
with cecal bacteria generates mutagen-positive products (68).
Bacterial Nitroreductase
Nitroreductase similar to azoreductase is exclusively of bacterial origin in the lumen of the
intestine. The enzyme is required for the mutagenic activity of nitrocompounds (64).
Nitroreductase generates reactive nitroso and N-hydroxyintermediates in the course of
converting aromatic amines. 1-nitropyrene is formed by the reaction of nitrogen oxides
with the combustion product pyrene. The presence of 1-nitropyrene in diesel exhaust
makes exposure to this compound a real risk. 1-nitropyrene is mutagenic in bacterial test
systems, and carcinogenic when administered to the rat. When 1-nitropyrene was fed to
conventional rats 5% to 6% of the dose was detected in the feces as 1-aminopyrene (69).
When the same feeding experiment was performed with germfree rats no 1-aminopyrene
was detected in the feces. The reduction of 1-nitropyrene to 1-aminopyrene is a carcinogen
activation process, and the results cited above indicate that the intestinal microflora are
important in the activation of 1-nitropyrene.
The Metabolism of Nutrients and Drugs by the Intestinal Microbiota 147
Mixed bacterial fecal specimens obtained from humans have been shown to reduce
6-nitrochrysene to 6-aminochrysene, a compound that causes cancer in mice (70). The
intermediate nitrosopolychic aromatic hydrocarbons generated in the conversion of the
nitro groups to an amine are highly reactive compounds that can alter DNA.
Bacterial Nitrosation
Since the first report of the induction of liver cancer in rats fed dimethylnitrosamine (71),
more than 80 different nitroso compounds have been identified as cancer-causing agents.
The formation of nitrosamines results from the reaction of secondary amines with nitrite at
acid pH. Nitrite is commonly added to cured meat and fish, and nitroso compounds have
been measured in these foods (72).
Bacteria have been implicated in the formation of N-nitroso compounds. Nitrite can
be produced by the bacterial reduction of nitrate. High levels of nitrate are often present in
leafy vegetables. The oral microbial flora of humans can reduce nitrate with the formation
of nitrite. This reaction can raise nitrite levels in saliva to 6-10 ppm (73).
It has been shown that when dimethylamine and sodium nitrite are incubated at pH
7.0 under anaerobic conditions with rat intestinal microflora, the formation of
dimethylnitrosamine was detected (74). These findings indicate that nitrosamines could
be generated in the intestine, where the pH is nearly neutral, and the reaction would occur
extremely slowly without bacterial enzyme catalysis.
Bacterial Metabolism of Tyrosine and Tryptophan
Tyrosine and tryptophan are amino acids that can be converted by bacterial reactions in
toxins and carcinogens. The tryptophanase containing Bacteroides thetaiotamicron, an
organism found in the intestine, can convert tryptophan to indole a compound with
carcinogenic activity (75).
Tyrosine is converted to phenol by aerobic intestinal bacteria, and to p-cresol by
intestinal anaerobic bacteria. These metabolites of tyrosine are not found in the urine of
germfree mice. Phenol and cresol have been shown to be tumor promoters in mice.
BACTERIAL INTESTINAL DRUG METABOLISM
In Table 3 are shown some representative natural and synthetic compounds that are or
have been used as drugs that have been shown to be metabolized by the intestinal
microflora. A description of the bacterial reactions involved for some of these drugs is
given below.
DOPA
DOPA (3, 4-Dihydroxyphenylalanine) is used for the treatment of Parkinson's disease.
DOPA replaces dopamine lost to Parkinson's disease because dopamine itself cannot cross
the blood-brain barrier. Intestinal microbial metabolism of DOPA influences the dose
required for the pharmacological action of this drug. The bacterial modification involves a
dehydroxylation resulting in the removal of the hydroxyl group at the para position of the
aromatic ring of phenylalanine (76). The product of this reaction, meta-hydroxylphenyl-
acetic acid, is not active in the treatment of Parkinson's disease. In addition DOPA can be
decarboxylated by intestinal bacteria forming inactive amines which can be detected in
148 Goldin
Table 3 Drugs, Supplements, and Additives Metabolized by the Intestinal Microflora
Digoxin
Diethylstilbesterol
Estrogens
Cyclamate
Azulfidine
3, 4-Dihydroxyphelalanine
Amygdalin
Metronidazole
Caffeine
Propachlor
Morphine
Buprenophine
Oxazepum
Phenolphthalein
Warfarin
urine. As a consequence of these bacterial reactions the dose of DOPA required to
influence the symptoms associated with Parkinson's disease is greatly elevated.
Salicylazosulfapyridine (Azulfidine)
Azulfidine has been shown to be beneficial for the treatment and prevention of recurrence
of ulcerative colitis. The drug structurally has sulfapyridine and aminosalicylate moieties
attatched via an azo bond. The drug was originally designed to deliver the anti-
inflammatory action of aminosalicylate, and the antimicrobial activity of sulfapyridine.
The introduction of the azo bond linkage produced an unsymmetrical molecule that was
non-absorbable in the upper intestine.
It has been demonstrated that the azo bond of azulfidine is reductively cleaved by
fecal bacterial cultures and that conventional but not germfree animals can also perform
this cleavage reaction (77). The resultant products of the bacterial cleavage have been
shown to have a different distribution (78). 5-aminosalicylate, because of its dual positive
and negative charge is not absorbed from the colon, and is found almost exclusively in the
feces. Sulfapyridine is readily absorbed from the intestine, and is excreted in the urine.
This observation has been noted in humans and in rats (78). The evidence suggests that
aminosalicylate is the active component for treating ulcerative colitis, and that the azo
bond linkage affords an effective delivery system to the large intestine by being non-
absorbable in the upper gastrointestinal tract, and then being slowly released by the action
of bacteria in the lower ileum and large intestine.
Metronidazole
Metronidazole is an antibiotic which has a specificity against pathogenic anaerobes (79).
Metronidazole structurally is a 5-nitroimidazole. The compound has been shown to be
mutagenic in the Ames assay. This activity is lost when tester strains deficient in
nitroreductase are used in the assay. The nitro group is reduced to amine group prior to ring
cleavage which yields acetamide and N-(2-hydroxyethyl) oxamic acid. Therefore the
amine intermediate generated by bacterial action is not stable, and breaks down to
simpler metabolites.
The Metabolism of Nutrients and Drugs by the Intestinal Microbiota 149
Cyclamate
Cyclamate (cyclohexylamine- N- sulfonate) was used as an artificial sweetening agent
until it was banned. It had been reported that the intestinal flora can hydrolyze
c-sulfonates, o-sulfonates, and N-sulfonates (54). Initially it was reported that Cyclamate
could not be metabolized in the body. It was however, shown that Cyclamate could be
converted to the bladder carcinogen cyclohexylamine as a result of the action of intestinal
bacterial catalyzed N-sulfate ester hydrolysis (80). Cyclohexylamine was absorbed from
the intestine, and excreted in the urine. Prolonged feeding of Cyclamate to rats increased
the hydrolysis to the amine, and withholding cyclamate from the diet caused a decline in
hydrolytic activity within 5 days (81).
Digoxin
The role of intestinal bacterial metabolism is important in the action of the cardiac
glycoside drug digoxin (82). In order to form a pharmacologically active drug, the
bacterial flora has to remove a trisacchride from the parent compound, releasing
digoxigenin. The bacterial intestinal flora can further reduce the double bond in the lactone
ring to form dihydrodigoxigenin (82). This compound is pharmacologically inactive. It
was found that 36% of Americans in New York city given digoxin had the capability to
reduce the double bond forming the inactive metabolite of digoxin (83). A total of 14% of
New Yorkers excreted large amounts of metabolites of digoxin. These findings indicate at
least 14%, and possibly a greater percentage of the population receiving digoxin will not
achieve predicted serum levels resulting from the action of the intestinal microflora.
Studies on a population residing in southern India indicated only 13.7% of those tested
could reduce digoxin, and only 1% excreted large amounts of metabolites (83). These
studies indicate that there are interethnic variations in the metabolic capacity of the
intestinal microflora to reduce the double bond in the lactone ring of digoxin. This finding
is not surprising based on the observation that Eubacterium lentum is exclusively
responsible for the reductive reaction (82).
Diethylstilbesterol
Diethylstilbesterol is a highly active synthetic estrogen. This compound had been used
prior to its being banned as a drug to prevent spontaneous abortions during pregnancy. It
was subsequently discovered that this compound had serious side-effects, including
reproductive problems, and vaginal cancer in the daughters of mothers given
diethylstilbesterol during pregnancy. The metabolic fate of this compound has been
studied (84). When diethylstilbesterol glucuronide was given orally to germfree rats, the
compound was rapidly recovered in the feces. This results from poor absorption of the
glucuronide from the intestine. In conventional rats the fecal recovery of diethylstilbes-
terol is significantly reduced. The explanation for this finding is based on the ability of the
beta-glucuronidase produced by intestinal microflora to generate the free compound from
its glucuronide. Free diethylstilbesterol is more readily absorbed from the intestine. In
conventional animals diethylstilbesterol makes approximately 1.5 passes through the
enterohepatic circulation. The increased exposure resulting form the enterohepatic
circulation can enhance the pharmacologic action, as well as the side-effects
of diethylstilbesterol.
150 Goldin
Estrogens: Hormone Replacement Therapy and Birth Control
Estrogens are used as a drug in a number of different human conditions. The most common
are in hormone replacement therapy for treating menopausal symptoms and other
consequences of aging in postmenopausal women, and for preventing conception in
premenopausal women.
The metabolism of estrogens involves an enterohepatic circulation that is dependent
on intestinal bacterial deconjugation, and intestinal re-absorption similar to those of bile
acids. Approximately 60% of circulating estrogens are conjugated in the form of
glucuronides or sulfates, and are excreted in the bile (85-87). Deconjugation, a required
step to cause intestinal mucosal cell re-absorption, is catalyzed by bacterial beta-
glucuronidase and sulfatase. Approximately 97% of the estrogens excreted in the feces are
in the deconjugated form, although virtually all of the estrogens in bile are conjugated.
Another indicator of the involvement of the intestinal microflora in estrogen
metabolism and pharmacokinetics is the observation that oral antibiotics exert an effect on
the enterohepatic circulation of estrogens. It has been observed that urinary estriol
concentration is decreased following oral administration of penicillin, ampicillin or
neomycin (88). When antibiotics were given, fecal excretion of estrogens increased
60-fold, and unconjugated estrogens increased 3-fold.
These findings have a clinical significance. Failures of oral contraception pills have
been associated with the use of oral antibiotics. Five pregnancies were reported among 88
women receiving rifampin at the same time they were on oral contraceptive pills (89).
Other antibiotics associated with birth-control failures are ampicillin, chloramphenicol,
and sulfamethoxy-pyridazine (90).
CONCLUSION
This chapter has reviewed some of the important intestinal bacterial interactions with
nutrients, endogenously synthesized hormones and other compounds, and orally ingested
drugs. Since there is no available human germfree model to compare the magnitude of the
importance of the intestinal flora in the various reactions cited in this chapter it is difficult
to quantitatively evaluate. Based on animal models, the intestinal microflora are not an
absolute requirement for survival, however, they do influence nutrient requirements, drug
responses, and the effectiveness of various endogenously produced substances. Therefore,
the metabolic potential of the intestinal microflora has to be considered in human
biochemical and physiological activities and responses.
REFERENCES
1. Finegold SM, Atteberg HR, Sutter VL. Effect of diet on human fecal flora: comparison of
Japanese and American diets. Am J Clin Nutr 1974; 27:1456-1469.
2. Moore WEC, Holderman LV. Human fecal flora: the normal flora of 20 Japanese-Hawaiians.
Appl Microbiol 1974; 27:961-979.
3. Finegold SM, Sutter VL, Mathisen GE. In: Hentges DJ, ed. Human Intestinal Microflora in
Health and Disease. New York: Academic Press, 1983:3-31.
4. Goldin BR. Intestinal microflora: metabolism of drugs and carcinogens. Ann Med 1990;
22:43-48.
5. Cummings JT, Macfarlane GT. Role of intestinal bacteria in nutrient metabolism. J Parenter
Enteral Nutr 1997; 21:357-365.
The Metabolism of Nutrients and Drugs by the Intestinal Microbiota 151
6. Hooper LV, Midtvedt T, Gordon JI. How host-microbial interactions shape the nutrient
environment of the mammalian intestine. Ann Rev Nutr 2002; 22:283-307.
7. McNeil NI. The contribution of the large intestine to energy supplies in man. Am J Clin Nutr
1984; 39:338-342.
8. Bergman EN. Energy contributions of volatile fatty acids from the gastrointestinal tract in
various species. Physiol Rev 1990; 70:567-590.
9. Cummings JH, Englyst HN. Fermentation in the large intestine and the available substrates.
Am J Clin Nutr 1987; 45:1243-1255.
10. McCamman S, Beyer PL, Rhodes JB. A comparison of three defined formula diets in normal
volunteers. Am J Clin Nutr 1977; 30:1655-1660.
1 1 . Winitz M, Seedman DA, Groff J. Studies in metabolic nutrition employing chemically defined
diets. Am J Clin Nutr 1970; 23:525-545.
12. Salyers AA, Gheruidini F, O'Brien M. Utilization of xylan by two species of human colonic
bacteroides. Appl Environ Microbiol 1981; 41:1065-1068.
13. Salyers AA, Harris CJ, Wilkins TD. Breakdown of psyllium hydrocolloid by strains of
bacteroides ovatus from human intestinal tract. Can J Microbiol 1978; 24:336-338.
14. Hoverstad T, Fausa O, Bjorneklatt A, Bohmer T. Short-chain fatty acids in the normal human
feces. Scand J Gastroenterol 1984; 19:375-381.
15. Chacko A, Cummings JH. Nitrogen losses from the human small bowel: obligatory losses and
the effect of physical form of food. Gut 1988; 29:809-815.
16. Stephen AM, Cumings JH. The microbial contribution to fecal mass. J Med Microbiol 1980;
13:45-56.
17. Barker HA. Amino acid degradation by anaerobic bacteria. Ann Rev Biochem 1981;
50:23-40.
18. Macfarlane GT, Allison C. Utilization of protein by human gut bacteria. FEMS Microbiol Ecol
1986;38:19-24.
19. Macfarlane S, Macfarlane GT. In: Gibson GR, Macfarlane GT, eds. Human Colonic Bacteria.
Boca Raton: CRC Press, 1995:75-100.
20. Metges CC, Petzke KJ, El-Khoury AE, Henneman L, Grant I. Incorporation of urea and
ammonia nitrogen into ileal and fecal microbial proteins and plasma five amino acid in normal
men and ileostomates. Am J Clin Nutr 1999; 70:1046-1058.
21. Goldin BR, Lichtenstein AH, Gorbach SL. In: Shils ME, Olson JA, Moshe S, eds. Modern
Nutrition in Health and Disease. 85th ed. Philadelphia: Lea and Febiger, 1994:569-582.
22. Coates ME, Fuller R. In: Clarke RTJ, Bauchop T, eds. Microbial Ecology of the Gut Flora. New
York: Academic Press, 1977:311-342.
23. Cummings JH. Short chain fatty acids in the human colon. Gut 1981; 22:763-779.
24. Cummings JH. In: Gibson GR, Macfarlane GT, eds. Human Colonic Bacteria. Boca Raton, FL:
CRC Press, 1995:101-130.
25. Hill MJ. In: Hill MR, ed. Microbial Metabolism in the Digestive Tract. Boca Raton, FL: CRC
Press, 1986:31-41.
26. Fernandez F, Collins MD. Vitamin K composition of anaerobic bacterial. FEMS Microbiol Lett
1987;41:175-180.
27. Ramotor K, Conly JM, Chubb H, Louie TJ. Production of menoquinones by intestinal
anaerobes. J Infect Dis 1984; 150:213-218.
28. Frick PG, Riedler G, Brogli H. Dose response and minimal daily requirement for vitamin K in
man. J Appl Physiol 1967; 23:387-389.
29. Udall JA. Human sources and absorption of Vitamin K in relation to anticoagulation stability.
J Am Med Assoc 1965; 194:127-129.
30. Albert MJ, Mathan VJ, Baber SJ. Vitamin B12 synthesis by human small intestinal bacteria.
Nature 1980; 283:781-782.
31. Wostmann BS. The germfree animal in nutritional studies. Ann Rev Nutr 1981; 1:257-279.
32. Adlercreutz H, Mousovi Y, Loukovaara M, Hanaloimen E. In: Hochberg RB, Naftolin F, eds.
The New Biology of Steroid Hormones, Vol. 72. New York: Raven Press, 1991:145-154.
152 Goldin
33. Rowland IR, Wiseman H, Saners TAB, Adlercreutz H, Bowery EA. Interindividual variation in
metabolism of soy isoflavones and lignans: influence of habitual diet on equol production by
the gut microflora. Nutr Cancer 2000; 36:27-32.
34. Lichtenstein AH. Intestinal cholesterol metabolism. Ann Med 1990; 22:49-52.
35. Eyssen HJ, Parmantier GG. Biotransformation of sterols and fatty acids by the intestinal
microflora. Am J Clin Nutr 1974; 27:1329-1340.
36. McNamara DJ, Prosa A, Miettinen TA. Thin layer and gas-liquid chromatographic
identification of neutral steroids in human and rat feces. J Lipid Res 1981; 22:474-484.
37. Grundy SM, Mok HYL. Determination of cholesterol absorption in man by intestinal perfusion.
J Lipid Res 1977; 18:263-271.
38. Grundy SM, Ahrens EH, Davignon J. The interaction of cholesterol absorption and synthesis in
man. J Lipid Res 1969; 10:103-115.
39. Ferezou J, Coste T, Chevalier F. Origins of neutral sterols in human feces studied by stable
isotope labeling. Digestion 1981; 21:232-243.
40. Reddy BS, Martin CW, Wynder EL. Fecal bile acids and cholesterol metabolites of patients
with ulcerative colitis, a high risk group for development of colon cancer. Cancer Res 1977;
37:1697-1701.
41. Reddy BS, Wynder EL. Large-bowel carcinogenesis: fecal constituents of populations with
diverse incidence rates of colon cancer. J Natl Cancer Inst 1973; 50:1437-1442.
42. Wilkins TD, Hackman AS. Two patterns of neutral sterol conversion in the feces of normal
North Americans. Cancer Res 1974; 34:2250-2254.
43. Owen RW. In: Hill MR, ed. Microbial Metabolism in the Digestive Tract. CRC Press: Boca
Raton, 1986:51-65.
44. Plaa GL. In: Gillette JR, ed. Handbook of Experimental Pharmacology, Vol. 28. New York:
Springer, 1975:139-140.
45. Adlercreutz H, Martin F, Lehtinen T, Tilskanen MJ, Pulkkinen MO. Effect of ampicillin
administration on plasma. Conjugated and unconjugated estrogen and progesterone levels in
pregnancy. Am J Obstet Gynecol 1977; 128:266-271.
46. Adlercreutz H, Martin F, Pulkknen M, et al. Intestinal metabolism of estrogens. J Clin
Endocrinol Metab 1976; 43:497-505.
47. Lombardi P, Goldin B, Boutin E, Gorbach SL. Metabolism of androgens and estrogens by
human fecal microorganisms. J Steroid Biochem 1978; 9:795-801.
48. Bolskenheuser VD, Winter J. In: Hentges DJ, ed. Human Intestinal Microflora in Health and
Disease. New York: Academic Press, 1983:215-239.
49. Gibson GR, Macfarlane S, Macfarlane GT. Metabolic interactions involving sulphate-reducing
methanogenic bacteria in the human large intestine. FEMS Microb Ecol 1993; 12:117-125.
50. Gibson GR, Cummings JH, Macfarlane GT. Use of a three-stage continuous culture system to
study the effect of mucin on dissimilatory sulfate reduction and methanogenesis by mixed
populations of human gut bacteria. Appl Environ Microbiol 1988; 54:2750-2755.
51. McFarlane GT, Gibson GR, Cummings JH. Comparison of fermentation reductions in different
regions of the human colon. J Appl Bacteriol 1992; 72:57-64.
52. Pitcher MCL, Beatty ER, Gibson GR, Cummings JH. Incidence and activities of sulphate-
inducing bacteria in patients with ulcerative colitis. Gut 1995; 36:A63.
53. Asatoor MA. Aromatization of quinic acid and shikimic acid by bacteria and the production of
urinary hippurate. Biochem Biophy Acta 1965; 100:200-202.
54. Scheline RR. Metabolism of foreign compounds by gastrointestinal microorganisms.
Pharmacol Rev 1973; 25:451-523.
55. Goldin BR. In situ bacterial metabolism and colon mutagens. Ann Rev Microbiol 1986;
40:367-393.
56. Laqueur GL, Spatz M. Oncogenicity of cycasin and methylazoxy methanol. Gann Monograph
Cancer Res 1975; 17:189-204.
57. Laqueur GL, McDaniel EG, Matsumoto H. Tumor induction in germ free rats with
methylazoxy methanol (MAM) and synthetic MAM acetate. J Natl Cancer Inst 1967;
39:355-371.
The Metabolism of Nutrients and Drugs by the Intestinal Microbiota 153
58. Druckery H, Pressmann R, Matzkies F, Ivanovic S. Selective erzengung von darmkrebs bei
ratten durch 1,2-dimethylhydrozin. Naturwissenschoften 1967; 54:285-286.
59. Macdonald IA, Brussard RG, Hutchinson DM, Holdeman LV. Rutin induced beta-glucosidase
activity in Streptococcus faecuim VGH-1 and streptococcus sp strain FRP-17 isolated from
human feces: formation of the mutagen quercetin from rutin. Appl Environ Microbiol 1984;
47:350-355.
60. Weisburger JH, Grantham PM, Horton RE, Weisburger EK. Metabolism of the carcinogen
N-hydroxy-N-2-fluorenylacetamide in germfree rats. Biochem Pharmacol 1970; 19:151-162.
61. Morotomi M, Nanno M, Watanbe T, Sakurai T, Mutai M. Mutagenic activitaton of biliary
metabolites of 1-nitropyrene by intestinal microflora. Mutat Res 1985; 149:171-178.
62. Chung KT. The significance of azo-reduction in the mutagenesis and carcinogenesis of azo
dyes. Mutat Res 1983; 114:269-281.
63. Ames BN, McCann J, Yamoski E. Methods for detecting carcinogens and mutagens with
salmonella/mammalian-microsome mutagenicity test. Mutat Res 1975; 31:347-364.
64. McCoy EC, Rosenkranz HS, Mermelstein R. Evidence for the existence of a family of
nitroreductase capable of activating nitrated polycyclics to mutagens. Environ Mutogen 1981;
3:421-427.
65. Karpinsky GE, Rosenkranz HS. The anaerobic-mediated mutagenicity of 2-nitrofluorene and
2-aminofluorene for Salmonella typhimurium. Environ Mutogen 1980; 2:353-358.
66. Hartman CP, Falk CE, Andrews AW. Azo reduction of trypan blue to a known carinogen by a
cell-free extract of a human intestinal anoerobe. Mutat Res 1978; 58:125-132.
67. Hartman CP, Andrews AW, Chung KT. Production of mutagen from ponceau 3R by a human
intestinal anaerobe. Infect & Immunity 1979; 23:686-689.
68. Reid TM, Morton KC, Wang CY, King CM. Conversion of congo red and 2-azoxyfluorence to
mutagens following in vitro reduction by whole-all rat cecal bacteria. Mutat Res 1983;
117:105-112.
69. El-Bayoumy K, Fharma C, Louis Y, Reddy B, Hecht SS. The role of the intestinal microflora in
the metabolic reduction of 1-nitropyrene to 1-aminopyrene in conventional and germfree rats
and in humans. Cancer Lett 1983; 19:311-316.
70. Manning BW, Campbell WL, Franklin W, Delclos KB, Cerniglia CE. Metabolism of
6-nitrochyfesene by intestinal microflora. Appl Environ Microbiol 1988; 54:197-203.
71. Magee PH, Barnes JM. The production of malignant hepatic tumors in the rat by feeding
dimethylnitrosamine. Br J Cancer 1956; 10:1 14—122.
72. Ender F, Ceh L. Occurrence of nitrosamines in foodstuffs for human and animal consumption.
Food Cosmet Toxicol 1968; 6:569-571.
73. Tannenbaum SR, Sinskey AJ, Weisman M, Bishop W. Nitrate in human saliva, its possible
relationship to nitrosamine formation. J Natl Cancer Inst 1974; 53:79-84.
74. Klubes P, Cerna I, Rabinowitz AD, Jondorf WR. Factors effecting dimethrylnitrosamine
formation from simple precursors by rat intestinal bacteria. Food Cosmet Toxicol 1972;
16:307-330.
75. Chung KT, Fulk GE, Slein MW. Tryptophanase of fecal flora as a possible factor in the etiology
of colon cancer. J Natl Cancer Inst 1975; 54:1073-1078.
76. Goldin BR, Peppercorn MA, Goldman P. Contribution of host and intestinal microflora in the
metabolism of L-DOPA by the rat. J Pharmacol Exp Ther 1973; 186:160-166.
77. Peppercorn MA, Goldman P. The role of intestinal bacteria in the metabolism of
salicylazosulfapyridine. J Pharmacol Exp Ther 1972; 181:151-162.
78. Peppercorn MA, Goldman P. Distribution studies of salicylazosulfapyridine and its
metabolities. Gastroenterology 1973; 64:240-245.
79. Goldman P. Drug therapy: Metronidazole. N Engl J Med 1980; 303:1212-1218.
80. Renwick AG, Williams RT. The fate of cyclamate in man and other species. Biochem J 1972;
129:869-879.
81. Wallace WC, Lethco ET, Brower EA. The metabolism of cyclamate in rats. J Pharmacol Exp
Ther 1970; 175:325-330.
154 Goldin
82. Lindenbaum J, Rund DG, Butler VP, Tse-Eng D, Sala JR. Inactivation of digoxin by the gut
flora: revised by antibiotic therapy. N Engl J Med 1981; 305:789-794.
83. Muthan VI, Wiederman J, Dobkin JF, Lindenbaum J. Geographic differences in digoxin
inactivation, a metabolic activity of the human anaerobic gut flora. Gut 1989; 30:971-977.
84. Fisher LJ, Millburn P, Smith RL. The fate of 14 C stilleslerol in the rat. Biochem J 1966; 100:69.
85. Eriksson H, Gustafsson JA. Excretion of steroid hormones in adults: steroids in feces from
adults. Eur J Biochem 1971; 18:146-150.
86. Sandberg AA, Slaunwhite WR, Jr. Studies on phenolic steroids in human subjects. II. The
metabolic fate and hepato-biliary-enteric circulation of 14 C-estrone and 14 C-estradiol in
women. J Clin Invest 1957; 36:1266-1278.
87. Sandberg AA, Slaunwhite WR, Jr. Studies on phenobic steroids in human subjects. VII.
Metabolic fate of estriol and its glucuronide. J Clin Invest 1965; 44:694-702.
88. Adlercreutz H, Martin F, Tikkanen MJ, Pulkkinen MO. Effect of ampicillin administration on
the excretion of twelve oestrogens in pregnancy urine. Acta Endocrinol 1975; 80:551-557.
89. Reimer D. Rifampicin "pill" do not go well together. J Am Med Assoc 1974; 227:608.
90. Dossetar J. Drug interaction with oral contraceptives. BMJ 1975; 4:467-468.
8
The Metabolism of Polyphenols
by the Human Gut Microbiota
Max Bingham
Unilever Research and Development, Vlaardingen, The Netherlands
SUMMARY
Polyphenols are considered to be key active constituents of fruits and vegetables and
responsible for many of the health protective effects of diets rich in these foods. While their
structure varies considerably, following ingestion, most ( ~ 95%) persist to the colon where
they encounter the human gut microbiota. Here they may undergo considerable structural
alteration to compounds that may have enhanced biological properties or possibly degraded
into inert metabolites and excreted. As such, the human gut microbiota may have a
significant influence on the final outcomes of polyphenol ingestion. Moreover, inter-
individual variation in the composition of the microbiota means that certain compounds are
metabolized in different ways, and this is reflected in the considerable variability seen in
excreted polyphenol metabolites. Consequently, polyphenols as active ingredients in
functional foods may turn out to be beneficial for only a certain proportion of the
population. Clearly, this may further have an impact on disease risk and health protection.
This chapter considers the potential role of the human gut microbiota in polyphenol
metabolism and highlights the level of current understanding of this process.
INTRODUCTION
Interest in the role of polyphenols in health has never been greater. Responsible for much
of the flavor, texture, and appearance of fruits, vegetables, pulses, and grains, polyphenols
are also considered to be largely responsible for many of the positive health effects of a
diet rich in these particular food groups. In particular, epidemiologic studies suggest a
protective effect of fruits and vegetables against cancer and coronary heart disease (1-3).
In addition to antioxidant properties, polyphenols show a number of interesting activities
in animal models and within in vitro systems. These effects include scavenging free
radicals, nitric oxide regulation, apoptosis induction, inhibition of cell proliferation and
angiogenesis and phytoestrogenic activity (4-7). As such these effects may contribute to
their potentially protective role in cancer and coronary heart disease. And yet, the question
remains of whether these types of studies are relevant in humans since substantial
proportions of ingested polyphenols persist to the colon and may undergo extensive
metabolism in the gut prior to absorption (8,9). This may further explain the failure of
155
156 Bingham
many studies that sought to detect increases in antioxidant capacity in plasma following
diets rich in polyphenols.
Significantly, our understanding of these processes is limited but a considerable
focus of attention on this issue has recently been established. This is following the
realization that achievable concentrations of polyphenols in circulation may be
significantly affected by the metabolic activities of the human gut microbiota (9,10).
Overall, such processes may represent a significant factor in determining the final health
outcomes of a diet rich in fruits, vegetables, pulses, and grains. We consider how the
human gut microbiota can influence the bioavailability of polyphenols and establish the
extent to which variations in microbiota composition between individuals may affect
such processes.
TYPES OF POLYPHENOLS AND MICROBIAL METABOLISM
Polyphenol compounds are ubiquitous in the plant kingdom. They are secondary plant
metabolites since they are not required in their primary metabolism. Rather, these
compounds are essential for appearance, taste, stability, and often the protection of plant
tissue. They have a wide variety of structures, chemical characteristics and to date several
thousand compounds of this nature have been identified in higher plants (3). A more
limited proportion of these compounds are present in edible food crops. The wide variety
of compound characteristics means they are often separated into different classes
according to their structural properties (Fig. 1).
An important issue in the study of polyphenols in the diet is that the most commonly
consumed ones are not necessarily the most active within the human body. There are several
possible reasons for this: they may have low intrinsic activity, they may be poorly absorbed
from the intestine, extensively metabolized in the intestine or rapidly eliminated. In
addition, the metabolites circulating in blood or reaching target organs, and those that result
from hepatic or digestive processes may differ from their original substances in biological
activity. It is therefore crucial to have an extensive knowledge of the bioavailability of
polyphenols if the true health effects of these compounds are to be understood.
Even though polyphenols exhibit a large structural diversity, the metabolism of
these compounds occurs via a common pathway (1 1). A limited proportion of polyphenols
(mostly as aglycones) is absorbed intact in the small intestine. The balance, mostly present
as glycosides, persists to the colon where they may undergo extensive metabolism and
structural alteration by the colonic microbiota. A diverse range of smaller molecular
weight compounds result and these can be detected in plasma, urine, and feces in various
forms (10,12,13). A consistent observation in studies of polyphenol metabolism is that
considerable inter-individual variation is seen in both the types and amounts of polyphenol
metabolites that result from polyphenol ingestion (14-16). In many cases it is thought that
compositional variations in the colonic microbiota are responsible for this. Many factors
can influence the development and composition of the microbiota, including the overall
diet, drugs, age, xenobiotics, and host factors such as gastric secretions and luminal pH
(17-19). By proxy, the composition of the microbiota may have significant influence on
the metabolism of polyphenols and thus the final health outcomes of diets rich in fruits,
vegetables, cereals, and grains. In the light of this we consider the fate of a number of
representative polyphenols classes (phenolic acids, flavonoids, anthocyanins, and
proanthocyanidins) to illustrate an important aspect of the extent to which the colonic
microbiota activity can impact on health.
The Metabolism of Polyphenols by the Human Gut Microbiota
157
Hydroxycinnamic acids
R,
O
OH
R 1 = OH: Coumaric acid
R 1 = R 2 = OH: Caffeic acid
R 1 = OCH 3 , R 2 = OH: Ferulic acid
Isoflavones
R 1 = H: Daidzein
R 1 = OH: Genistein
Stilbenes
HQ
/ \
\
HO
\\ /
-OH
Hydroxybenzoic acids
\
o
R,
OH
R,
R 1= R 2 =OH, R 3 =H: Protocatechuic acid
R 1= R 2 =R 3 =H: Gallic acid
Flavonoids
OH O
e.g. Quercetin
e.g. resveratrol
e.g. secoisolariciresinol ""y" 'O
OH CK
Figure 1 Example structures of main polyphenol groups.
PHENOLIC ACIDS— HYDROXYCINNAMATES
AND HYDROXYBENZOATES
The phenolic acids are generally the lowest molecular weight polyphenol compounds.
Hydroxycinnamates (Fig. 2) are a core class of polyphenols and are central to the
biosynthetic pathways of polyphenols. Caffeic and quinic acids combine to form
chlorogenic acid, which is found in many types of fruit and in high concentrations in
coffee (20). Ferulic acid is the most abundant phenolic acid found in grains and may
constitute the main dietary source of this compound. Hydroxybenzoic acids (Fig. 2) are
less abundant in plants but are often found in red fruits, black radishes and onions. Tea is
an important source of gallic acid containing 4.5 g/kg fresh weight tea leaves (21), whilst
ellagic acid is a major polyphenol in some berry fruits. Hydroxybenzoic acids are also
important components of complex hydrolysable tannins such as gallotannins in mangoes
and ellagitannins in red fruits, hazelnuts, walnuts, pomegranates, and oak aged wines
(from the barrels) (22-25).
Human bioavailability studies for hydroxycinnamates reveal that between 0.3 and
25% of ingested dose is excreted in urine (12). Chlorogenic acid (ingested as coffee) has
been detected at low concentrations in urine samples (26,27) along with a range of smaller
molecular weight secondary metabolites including ferulic acid, isoferulic acid,
dihydroferulic acid, vannilic acid, 3,4-dihydroxyphenylpropionic acid, 3 -hydroxy hippuric
acid, and hippuric acid (27-29). One third of ingested chlorogenic acid is absorbed in the
158
Bingham
OH
.OH
1 ,2-dihydroxybenzene
catechol
HO.
HO
HO
O
benzoic acid
O
2,5-dihydroxybenzene acid
phenylacetic acid
,OH
O
3-hydroxyphenylacetic acid
4-hydroxyphenylacetic acid
OH
O
.OH
3,4-dihydroxyphenylacetic acid
3,-phenylpropionic acid
hydrocinnammic acid
3-(4-hydroxyphenyl)-propionic acid
3,4-dihydroxycinnamic acid 3,4-dihydroxyphenylpropionic acid
caffeic acid
4-hydroxy-3-methoxycinnamic
acid
ferulic acid
Figure 2 Examples of phenolic acids and flavonoid metabolites (e.g., hydroxycinnamic acids and
hydroxybenzoic acids).
small intestine, leaving the balance to persist to the colon where it is exposed to the gut
microbiota (26,30). Inter-individual variations in excretion profiles in these studies suggest
that hydroxycinnamates are substantially metabolized by the colonic microbiota. In vitro
studies have also revealed that chlorogenic acid is extensively metabolized by the colonic
microbiota (31). Using inocula from different volunteers, it was clearly demonstrated that
degradation rates of chlorogenic acid and the production of the metabolites 3,4-
dihydroxyphenylpropionic acid and 3 -hydroxy phenylpropionic acid varied considerably
between volunteers. Meanwhile in studies with healthy human volunteers, over 50% of the
ingested dose was excreted as hippuric acid (a potential microbial metabolite of
chlorogenic acid), whilst in the same study individuals without a colon excreted a much
smaller amount of aromatic acids. The balance was not metabolized and excreted as
chlorogenic acid in the latter volunteers. The absence of a colon and therefore a substantial
colonic microbiota in the volunteers and the apparent excretion of intact chlorogenic acid
effectively demonstrate the necessity for and the metabolic capacity of the colonic
microbiota (27).
The Metabolism of Polyphenols by the Human Gut Microbiota 159
Successful attempts have been made to identify colonic microbiota species capable
of metabolizing hydroxcinnamates. Inter-individual differences in excretion profiles of
volunteers imply that the composition of the resident microbiota may be important in
determining this final profile. Given that some of these metabolites are considered to be
potentially protective of health, knowledge of the identity of species responsible for such
metabolic activity is valuable. It has been demonstrated that at least three colonic
microbiota species (Bifidobacterium lactis, Lactobacillus gasseri, and Escherichia coli)
can release hydroxy cinnamates from chlorogenic acid in the gut (32) as well as diferulic
acid being released in the colon as a result of metabolism by esterase activity of the colonic
microbiota (33,34). Given that free hydroxycinnmates (including ferulic, caffeic, and
p-coumaric acids) exhibit antioxidant and anticarcinogenic properties in vitro and in
animal models, and that various microbial metabolites can be absorbed readily (35), this
supports the notion that some beneficial effects of hydroxycinnamtes can be ascribed to the
metabolic activities and products of the colonic microbiota.
A more limited set of studies has been carried out for hydroxybenzoates.
Ellagitannins are polyphenols made up of subunits of ellagic acid (a hydroxybenzoate)
and are thought to possess chemopreventative properties that might contribute to health
benefits in humans (36-38). Their fate has been studied in 40 volunteers consuming a
variety of foodstuffs known to contain high levels of ellagitannins (39). In all cases the
ellagitannin microbial metabolite urolithin B (which may be antiangiogenic) could be
identified although inter-individual variation in excretion rates was large. Furthermore
they were able to identify high and low excretors of this compound in much the same way
that consumers of soya can be differentiated by their ability to excrete equol (40,41). Again
this observation indicates that the gut microbiota is likely to be important in the
bioavailability of these potentially health-promoting compounds and that variations in the
composition of the microbiota may dictate the production of a potentially health-promoting
metabolite. At present, we are unaware of any studies designed to identify components of
the colonic microbiota that are potentially responsible for the metabolism of ellagitannins.
FLAVONOIDS
Flavonoids are the most important class of polyphenols in plants. Over 6000 flavonoids
have been identified so far (3) and their structural variety is based on the flavan or
2-phenyl-benzo-dihydropyrane skeleton. Flavonoids are further differentiated into
subclasses (Fig. 3). The metabolism of two of these classes are discussed here — flavonols
and flavan-3-ols.
Flavonols
Flavonols are the most ubiquitous flavonoids in plants, with the main representatives being
quercetin, kaempferol, myricetin, and isohamnetin, which are predominantly present as
glycosides bound to a variety of sugar moieties. The richest sources are onions, curly kale,
leeks, broccoli, and blueberries and are present at levels of approximately 30 mg/kg fresh
weight although in certain circumstances can reach in excess of 1.2 g/kg fresh weight. Red
wine and tea are also rich sources.
In contrast to other classes of polyphenols, flavonols such as quercetin and
kaempferol have received a larger amount of attention in terms of bioavailability over the
past few years. This is largely because of their ubiquitous nature in food crops but also
because a great deal of their apparent in vitro effects on health parameters have failed to be
160
Bingham
Anthocyanidins
Flavanones
R 1= R 2 =H: Perlargonidin
R^OH, R 2 =H: Cyanidin
R 1= R 2 =OH: Delphinidin
R^OCHg, R 2 =OH: Petunidin
R 1= R 2 =OCH 3 : Malvidin
R 1= H: R 2 =OH: Narigenin
R 1= R 2 =OH: Eridocytol
R.,=OH: R 2 =OCH 3 : Hesperetin
Flavanols
Flavonols
R 1= R 2 =OH: R 3 =H: Catechins
R 1= R 2 =R 3 =OH: Gallocatechins
OH O
R 2 =OH: R 1 =R 3 =OH: Kaempferol
R 1= R 2 =OH: R 3 =H: Quercetin
R 1= R 2 =R 3 =OH: Myricetin
Trimeric procyanidin
Flavones
R 1= H: R 2 =OH: Apigenin
R 1= R 2 =OH: Luteolin
Figure 3 Example structures of various flavonoid groups.
repeated in vivo (13). The majority of these compounds exist as glycosides in their original
food matrices and thus reach the colon intact following ingestion. Here they can serve as
substrate for the microbiota. Associations between the urinary excretion of simple phenolics
such as hydroxyhippuric acid, hydroxyphenylacetic acid and 3-(hydroxyphenyl)-propionic
acid, and a high flavonoid intake have been observed in a number of human studies
(28,29,40-48) indicating that a substantial proportion of polyphenols undergo metabolism
in the gut. In addition, the microbiota has also been confirmed as the major site for the
release of free flavonol agly cones from their conjugated forms following cleavage of ester or
The Metabolism of Polyphenols by the Human Gut Microbiota 161
glycosidic forms (49). Quercetin derivatives are deconjugated and converted to
hydroxyphenylacetic acids by the colonic microbiota in vitro (50). Confirming these
observations, recent in vitro studies revealed the production of 3 -hydroxyphenylacetic acid
and 3-(hydroxyphenyl)-propionic acid from rutin (a representative glycoside of quercetin)
in human gut microbiota fermentation studies (31). An important observation in these
studies was that the pattern of degradation varied considerably between donor fecal
microbiota samples and with concentration of the initial substrate. This is significant since
many of the compounds produced in this degradative process may have enhanced biological
properties. 3,4-dihydroxyphenylacetic acid and 4-hydroxyphenylacetic acid have more
effective antiplatelet aggregation activity than their precursors rutin and quercetin (51).
Compositional variations in the microbiota may have a significant impact on the
final metabolic products of flavonol metabolism. Indeed reports of studies designed to
confirm these observations are now appearing. Eubacterium ramulus is capable of
metabolizing quercetin both in vitro and in rats associated with the organism (8). In both
cases, the isolate was capable of releasing quercetin from its glycosidic form and was then
able to cleave the ring system of quercetin and produce mainly 3,4-dihydroxyphenylacetic
acid. Further studies in humans revealed that E. ramulus is a common member of the
human gut microbiota (52); its resident population level is dependant on flavonoid intake
and the production of secondary metabolites of flavonoids (such as 3,4-dihydroxyphe-
nylacetic acid) was greatest when E. ramulus populations where increased (15).
Meanwhile E. ramulus has also been tested for its abilities to degrade other structurally
related flavonoids including other flavonols, flavones, flavan-3-ols, and flavonones, and in
certain cases, significant metabolism can occur (53). Clostridium orbiscindens, which is an
obligate anaerobe commonly found in the intestinal tract, is also capable of cleaving the
C3-C4 bond of quercetin to give 3,4-dihydroxyphenylacetic acid (54). In recent studies, it
was also shown to degrade a range of other flavonols and flavanones in vitro and that it was
present in 8 of 10 volunteers at levels of 1.87 X 10 to 2.5 X 10 cells/ g (55). At present, these
are the most extensively published reports on the influence of microbiota composition in
polyphenol metabolism and set the benchmark for future studies in other polyphenol classes.
Flavan-3-ols
Flavan-3-ols are found in most plants and the stereo isomers ( + )-catechin and ( — )-
epicatechin are the most common monomeric flavan-3-ols in fruits. ( + )-gallocatechin and
( — )-epigallocatechin are their corresponding 0-3 gallates and are rarer but found in
certain seeds of leguminous plants, in grapes and in tea. Catechins are found in many types
of fruit and red wine but by far the most abundant sources are green tea and chocolate (56).
The bioavailability of flavan-3-ols differs markedly among the different catechins
and appears to be related substantially to structure and degree of galloylation (12). Again
due to their structure, a substantial proportion of ingested flavan-3-ols may persist to the
colon where they encounter the colonic microbiota. The colonic degradation of flavan-
3-ols such as catechin, epicatechin, and epicatechin gallate have been investigated
previously (14,44,57-59) revealing that in contrast to other similar structures the
heterocyclic C-ring is not cleaved per se. The hydroxy lation pattern of flavan-3-ols
(5,1,3,3' ,4'-) has instead been suggested to enhance the opening of the heterocyclic ring
after hydrolysis (60,61) and this results in the production of a large number of metabolites
from the colonic microbiota: 3,4-dihydroxyphenylacetic acid, 3 -hydroxyphenylacetic acid,
homo vanillic acid and their conjugates are derived from the B-ring and phenolic acids from
162 Bingham
the C-ring (61). In animal studies, phenylvalerolactones, and phenylpropionic acids have
also been identified as degradation products (61).
Antibiotic treatment in rats significantly alters the metabolism of catechin and
decreases the urinary elimination of many of the compounds of flavan-3-ol metabolism
indicating that an intact microbiota is necessary for the production of many of these
compounds (57). At present there are limited studies (described by 8; see Flavonols) that
have investigated the specific species that may be responsible for the conversion of flavan-
3-ols, and data is limited on any possible inter-individual variation in final metabolic
profiles. However, green tea catechins have been shown to cause a shift in bacterial
populations in humans (62), pigs (63) and chickens (64), and this may have relevance to
the overall polyphenol metabolic capabilities of the resident microbiota. Structurally,
these compounds may exhibit substantial anti-oxidant activities and thus the influence of
the composition of the resident microbiota and associated metabolic variations could
impact on the overall health impact of flavan-3-ol ingestion.
ANTHOCYANIDINS
The red to purple colored anthocyanidins are responsible for a good portion of color in
fruits and flowers. They are only present as glycosides or anthocyanins and their color is
pH dependent. In the human diet, anthocyanidins are present in red wine, certain varieties
of cereals, certain leafy and root vegetables (e.g., aubergines, cabbage, beans, onions, and
radishes) and most abundantly in fruit. The content is generally proportional to the color
intensity and may reach values of 2-4 g/kg fresh weight in blackberries and black currants.
They are found mainly in the skin, except where the flesh is also colored.
Anthocyanidins and anthocyanins have been reported previously as having several
positive effects on health (35,65-72). Much of this evidence has been derived in vitro and
very little is known about their bioavailability in vivo. Previous human and rat studies have
reported very low recoveries of intact anthocyanins in urine (73). Very little is known of
the specific fate of the balance of these compounds. Given their structure, it is likely that
they will undergo substantial metabolism by the human gut microbiota in much the same
way as any other flavonoid structure. And yet, studies performed in the 1970s indicated
that degradation of anthocyanins by the microbiota occurs to a much more limited extent
than with other flavonoid structures (61). However recent studies investigated in vitro
whether the anthocyanin glycosides, cyanidin-3-glucoside, and cyanidin-3-rutinoside
were deglycosylated and whether the resulting aglycones were degraded further to smaller
phenolic compounds by colonic bacteria (74). Cyanidin-3-glucoside and cyanidin
aglycone were identified as intermediary metabolites of cyanidin-3-rutinoside. Proto-
catechuic acid was identified as a major metabolite at early stages of the fermentations
along with a variety of other low molecular weight metabolites suggesting that the
anthocyanins were converted by the gut microbiota. However, protocatechuic acid was
also formed in vitro with the simple incubation of cyanidin with rat plasma in the absence
of colonic microbiota (75). These experiments, although far from conclusive indicate that
bacterial metabolism of anthocyanins can occur and is likely to involve the cleavage of
glycosidic links and the breakdown of the anthocyanidin heterocycle — thus having a
potential impact on the bioavailability of these compounds in vivo. However, significantly
more investigation is needed before the real extent of the involvement of the microbiota is
uncovered in terms of metabolism and the bioavailability of anthocyanins.
The Metabolism of Polyphenols by the Human Gut Microbiota 163
PROANTHOCYANIDINS
Proanthocyanidins are dimers, oligomers, and polymers of flavan-3-ols and are formed by
enzymatic or chemical condensation. These so-called "condensed tannins" contribute to
astringent tastes in fruits (e.g., grapes, peaches, apples, pears, berries etc.), beverages (e.g.,
wine, cider, tea, beer etc.) and chocolate. At a lower degree of polymerization they are
colorless and bitter to taste, but with greater polymerization the taste becomes astringent
and the color yellow to brown. Proanthocyanidins purely consisting of catechin and
epicatechin monomers are called procyanidins, which are the most common type of
proanthocyanidins. Less abundant are the prodelphinidins, which include both epicatechin
and gallocatechin monomers.
Previous studies in rats have indicated that the bioavailability of procyanidins is low
and characterized by a very low urinary recovery (0.5% ingested dose) (76). Procyanidin
consumption in rats and in humans is associated with the production of several aromatic
compounds including derivatives of phenylpropionic, phenylacetic, and benzoic acids
(77,78). More recent studies have also established that consumption of proanthocyanidins
from grape seed extract can result in a consistent increase in urinary excretion of
3 -hydroxy phenylpropionic acid and 4-O-methylgallic acid. Inter-individual variation in
excretion of 3-hydroxyphenylproionic acid was significant (79). The microbial
metabolism of proanthocyanidins has never been studied in humans but the microbial
origin of these compounds was established in vitro following incubation of
proanthocyanidins with rat cecal contents (80) and human fecal microbiota (81). These
studies utilized 14 C labeled proanthocyanidin oligomers and led to the formation of
m-hydroxyphenylpropionic acid, m-hydroxyphenylacetic acid and their /^-hydroxy
isomers, m-hydroxyphenylvaleric acid, phenylpropionic acid, phenyl acetic acid and
benzoic acid. Attempts have been made in the past to identify intestinal bacteria that can
degrade proanthocyanidins (82,83) although these studies actually failed. The impact of
proanthocyanidins on colonic microbiota populations has been investigated in rat studies
and revealed that there was a shift in the predominant bacteria present towards Gram-
negative Enterobacteriaceae and Bacteroides species (84). Furthermore, proanthocyanidin
intestinal absorption and microbial metabolism of some of the above metabolites fell as
the degree of polymerisation increased (77,81). Thus studies on antioxidant and biological
effects of proanthocyanidins are only useful when targeted at compounds with a low
degree of polymerization. Larger compounds do not appear to be able to reach systemic
circulation or be available for microbial metabolism that would result in significant
production of readily absorbable phenolic acid metabolites. However, this does highlight
that at least some of the purported health effects of proanthocy anidin-rich diets may be due
to secondary metabolites rather than the original ingested compounds.
PERSPECTIVES
The role of dietary polyphenols in health and disease continues to be the focus of much
academic and commercial research. Consumption of diets rich in polyphenols is generally
thought to be beneficial to health and this has led to great excitement over the potential of
diets, supplements, and pro-drugs based on polyphenol compositions. As we have
discussed, much of the latest research surrounds the question of bioavailability since they
must reach target tissues in a form that is viable and can have the desired effects. A major
obstacle for these compounds, though, is the microbial mass in the colon since in many
cases they persist intact to the colon, and are structurally ideal for metabolism by the
164 Bingham
human gut microbiota. This review highlights the extent to which certain polyphenol
classes undergo metabolism and structural alteration in the colon, and suggests that much
of the prescribed in vivo health benefits of polyphenols may be due to secondary
metabolites of polyphenols rather than the original compounds.
Well-designed studies have evaluated the need for an intact microbiota in
polyphenol metabolism, although this is not so for all classes. Perhaps one of the most
consistent observations in human bioavailability studies of dietary polyphenol compounds
is how striking the inter-individual variations are in the types and amounts of metabolic
breakdown products seen following polyphenol ingestion. The reasons for this have at
present not been rigorously investigated, but it seems very likely that variations in
composition of the resident microbiota between individuals is key. Numerous factors can
influence the composition of the microbiota (19) and this in turn may affect the overall
metabolic capabilities of this system.
Only a limited amount of research has been targeted at specifically trying to identify
actual species of the human gut microbiota that are responsible or capable of metabolizing
polyphenols. This is perhaps a reflection of the difficulties encountered in undertaking
such an effort. Simply isolating single strains of bacteria anaerobically and carrying out
suitable fermentation assays when presented with such a complex mixed culture of
bacteria is an extreme challenge in terms of the laboratory time required. Furthermore
much of the microbial mass in the colon remains to be described or cultured (85,86). In
terms of the metabolic pathways that polyphenols follow during their degradation in the
gut, they are fairly complex and multistaged, suggesting (although unconfirmed at this
stage) that more than one species/strain may be required for the complete degradation of
the original substrate. The application of culture independent molecular microbiology
techniques (such as fluorescent in situ hybridization) (87) and modern analytical chemistry
techniques (such as metabonomics in combination with pattern recognition techniques)
means that an understanding can be gained of whether variable levels of target populations
present in the gut are related to the production of specific metabolites. This may in turn
have an impact on specific health outcomes (such as cardiovascular markers of health or
the development of cancers). This is particularly so given that a number of the microbial
metabolites are now thought to have specific activities related to health.
REFERENCES
1 . World Cancer Research Fund. Vegetables and fruit. In: Food, Nutrition and the Prevention of
Cancer: A Global Perspective. Washington, D.C.; World Cancer Research Fund/ American
Institute for Cancer Research 1997; 436-446.
2. Law MR, Morris JK. By how much does fruit and vegetable consumption reduce the risk of
ischemic heart disease? Eur J Clin Nutr 1998; 52:549-556.
3. Arts IC, Hollman PC. Polyphenols and disease risk in epidemiologic studies. Am J Clin Nutr
2005; 81:317-325.
4. Higdon JV, Frei B. Tea catechins and polyphenols: health effects, metabolism and antioxidant
functions. Crit Rev Food Sci Nutr 2003; 43:89-143.
5. Yang CS, Landau JM, Huang MT, Newmark HL. Inhibition of carcinogenesis by dietary
polyphenolic compounds. Annu Rev Nutr 2001; 21:381-406.
6. Nijveldt RJ, van Nood E, van Hoorn DEC, Boelens PG, van Norren K, van Leeuwen PAM.
Flavonoids: a review of probable mechanisms of action and potential applications. Am J Clin
Nutr 2001; 74:418-425.
7. Adlercreutz H, Mazur W. Phytoestrogens and western diseases. Ann Med 1997; 29:95-120.
The Metabolism of Polyphenols by the Human Gut Microbiota 165
8. Blaut M, Schoefer L, Braune A. Transformation of flavonoids by intestinal microorganisms. Int
J Vitam Nutr Res 2003; 73:79-87.
9. Clifford MN. Diet-derived phenols in plasma and tissues and their implications for health. Plant
Med 2004; 70:1103-1114.
10. Halliwell B, Rafter J, Jenner A. Health promotion by flavonoids, tocopherols, tocotrienols and
other phenols: direct or indirect effects? antioxidant or not? Am J Clin Nutr 2005; 1:268-276.
11. Spencer JP. Metabolism of tea flavonoids in the gastrointestinal tract. J Nutr 2003;
1:3255-3261.
12. Manach C, Williamson G, Morand C, Scalbert A, Remesy C. Bioavailability and bioefficacy of
polyphenols in humans I. Review of 97 bioavailability studies. Am J Clin Nutr 2005;
1:230-242.
13. Williamson G, Manach C. Bioavailability and bioefficacy of polyphenols in humans II. Review
of 93 intervention studies. Am J Clin Nutr 2005; 1:243-255.
14. Mulder TP, Rietveld AG, van Amelsvoort JM. Consumption of both black tea and green tea
results in an increase in the excretion of hippuric acid into urine. Am J Clin Nutr 2005;
1:256-260.
15. Simmering R, Pforte H, Jacobasch G, Blaut M. The growth of the flavonoids-degrading
intestinal bacterium, Eubacterium ramulus, is stimulated by dietary flavonoids in vivo. FEMS
Microb Ecol 2002; 40:243-248.
16. Jenner AM, Rafter J, Halliwell B. Human fecal water content of phenolics: the extent of colonic
exposure to aromatic compounds. Free Rad Biol Med 2005; 38:763-772.
17. Rowland IR. Factors affecting metabolic activity of the intestinal microbiota. Drug Metab Rev
1988; 19:243-261.
18. Kirjavainen PV, Gibson GR. Healthy gut microbiota and allergy: factors influencing
development of the microbiota. Ann Med 1999; 31:288-292.
19. Mallett AK, Rowland IR. Factors affecting the gut microbiota. In: Rowland I, ed. Role of the
Gut Flora in Toxicity and Cancer. London: Academic Press, 1998:347-382.
20. Clifford MN. Chlorogenic acids and other cinnamates — nature, occurance and dietary burden.
J Sci Food Agric 1999; 79:362-372.
21. Tomas-Barberan FA, Clifford MN. Dietary hydroxybenzoic acid derivatives and their possible
role in health protection. J Sci Food Agric 2000; 80:1024-1032.
22. Clifford MN, Scalbert A. Elagitannins — nature, occurence and dietary burden. J Sci Food Agric
2000;80:118-125.
23. Laszlavik M, Gla L, Misik S, Erdei L. Phenolic compounds in two hungarian red wines
matured in quercus robur and quercus petrea barrels: HPLC analysis and diode array detection.
Am J Enol Vitic 1995; 46:67-74.
24. Haslam E. Plant Polyphenols, Vegetable Tannins Revisitied. Cambridge, U.K.: Cambridge
University Press, 1989.
25. Gil MI, Tomas-Barberan FA, Hess-Pierce B, Holcroft DM, Kader A A. Antioxidant activity of
pomegranate juice and its relationship with phenolic composition and processing. J Agric Food
Chem 2000; 48:4581-4589.
26. Olthof MR, Hollman PC, Katan MB. Chlorogenic acid and caffeic acid are absorbed in humans.
J Nutr 2001; 131:66-71.
27. Olthof MR, Hollman PC, Buijsman MN, van Amelsvoort JM, Katan MB. Chlorogenic acid,
quercetin-3-rutinoside and black tea phenols are extensively metabolized in humans. J Nutr
2003; 133:1806-1814.
28. Rechner AR, Spencer JP, Kuhnle G, Hahu U, Rice-Evans CA. Novel biomarkers of the
metabolism of caffeic acid derivatives in vivo. Free Rad Biol Med 2001; 30:1213-1222.
29. Rechner AR, Pannala AS, Rice-Evans CA. Caffeic acid derivatives in artichoke extract are
metabolized to phenolic acids in vivo. Free Rad Res 2001; 35:192-202.
30. Gonthier MP, Verney MA, Besson C, Remesy C, Scalbert A. Chlorogenic acid bioavailability
largely depends on the its metabolism by the gut microbiota in rats. J Nutr 2003;
133:1853-1859.
166 Bingham
3 1 . Rechner AR, Smith MA, Kuhnle G, et al. Colonic metabolism of dietary polyphenols: influence
of structure on microbial fermentation products. Free Rad Biol Med 2004; 36:212-225.
32. Couteau D, McCartney AL, Gibson GR, Williamson G, Faulds CB. Isolation and
characterisation of human colonic bacteria able to hydrolyse chlorogenic acid. J Appl
Microbiol 2001; 90:873-881.
33. Andreasen MF, Kroon PA, Williamson G, Garcia-Conesa MT. Intestinal release and uptake of
phenolic antioxidant diferulic acids. Free Rad Biol Med 2001; 31:304-314.
34. Konishi Y, Kobayashi S. Microbial metabolites of ingested caffeic acid are absorbed by
monocarboxylic acid transporter (MCT) in intestinal Caco-2 cell monolayers. J Agric Food
Chem 2004; 52:6418-6424.
35. Tsuda T, Watanabe M, Ohshima K, et al. Antioxidative activity of the anthocyanin pigments
cyanidin 3-O-p-D-glucoside and cyanidin. J Agric Food Chem 1994; 42:2407-2410.
36. Gali HU, Perchellet EM, Klish DS, Johnson JM, Perchellet JP. Antitumour-promoting
activities of hydrolyzable tannins in mouse skin. Carcinogenesis 1992; 13:715-718.
37. Castonguay A, Gali HU, Perchellet EM, et al. Antitumourigenic and antipromoting activities of
ellagic acid, ellagitannins and oligomeric anthocyanin and procyanidin. Int J Oncol 1997;
10:367-373.
38. Kresty LA, Morse MA, Morgan C, et al. Chemoprevention of esophageal tumourogenesis by
dietary administration of lyophilised black rasperberries. Cancer Res 2001; 61:6112-6119.
39. Cerda B, Tomas-Barberan FA, Espin JC. Metabolism of antioxidant and chemopreventative
ellagitannins from strawberries, raspberries, walnuts and oak aged wine in humans:
identification of biomarkers and individual variability. J Agric Food Chem 2005; 53:227-235.
40. Rechner AR, Kuhnle G, Bremmer P, Hubbard GP, Moore KP, Rice-Evans CA. The metabolic
fate of dietary polyphenols in humans. Free Rad Biol Med 2002; 33:220-235.
41 . Setchell KDR, Brown NM, Lydeking-Olsen E. The clinical importance of the metabolite equol.
A clue to the effectiveness of soy and its isoflavones. J Nutr 2002; 132:3577-3584.
42. Booth AN, Emerson OH, Jones FT, DeEds F. Urinary metabolites of caffeic and chlorogenic
acids. J Biol Chem 1957; 229:51-59.
43. Booth AN, Murray CW, Jones FT, DeEds F. The metabolic fate of rutin and quercetin in the
animal body. J Biol Chem 1956; 223:251-257.
44. Bravo L, Abia R, Eastwood MA, Saura-Calixto F. Degradation of polyphenols (catechin and
tannic acid) in the rat intestinal tract: effect on colonic fermentation and fecal output. Br J Nutr
1994; 71:933-946.
45. DuPont MS, Bennett RN, Mellon FA, Williamson G. Polyphenols from alcoholic apple cider
are absorbed, metabolized and excreted by humans. J Nutr 2002; 132:172-175.
46. Graefe EU, Veit M. Urinary metabolites of flavonoids and hydroxycinnamic acids in humans
after application of a crude extract from Equisetum arvense. Phytomedicine 1999; 6:239-246.
47. Gross M, Pfeiffer M, Martini M, Cambell D, Slavin J, Potter J. The quantitation of metabolites
of quercetin flavonols in human urine. Cancer Epidemiol Biomarkers Prev 1996; 5:711-720.
48. Pietta PG, Gardana C, Mauri PL. Identification of ginko biloba flavonol metabolites after oral
administration to humans. J Chromatogr B 1997; 693:249-255.
49. Plumb GW, Garcia-Conesa MT, Kroon PA, Rhodes M, Ridley S, Williamson G. Metabolism of
chlorogenic acid by human plasma, liver, intestine and gut microbiota. J Sci Food Agric 1999;
79:390-392.
50. Aura AM, O'Leary KA, Williamson G, et al. Quercetin derivatives are deconjugated and
converted to hydroxyphenylacetic acids but not methylated by human fecal flora in vitro.
J Agric Food Chem 2002; 50:1725-1730.
51. Kim DH, Jung EA, Sohng IS, Han JA, Kim TH, Han MJ. Intestinal bacterial metabolism of
flavonoids and its relation to some biological activities. Arch Pharm Res 1998; 21:17-23.
52. Simmering R, Kleessen B, Blaut M. Quantification of the flavonoid-degrading bacterium
Eubacterium ramulus in human fecal samples with a species specific oligonucleotide
hybridisation probe. Appl Environ Microbiol 1999; 65:3705-3709.
53. Schneider H, Blaut M. Anaerobic degradation of flavonoids by Eubacterium ramulus. Arch
Microbiol 2000; 173:71-75.
The Metabolism of Polyphenols by the Human Gut Microbiota 167
54. Winter J, Popoff MR, Grimont P, Bokkenheuser VD. Clostridium orbiscindens sp. Nov., a
human intestinal bacterium capable of cleaving the flavonoid C-ring. Int J Syst Bacteriol 1991;
41:355-357.
55. Schoefer L, Mohan R, Scwiertz A, Braune A, Blaut M. Anaerobic degradation of flavonoids by
Clostridium orbiscindens. Appl Environ Microbiol 2003; 69:5849-5854.
56. Labenbrink C, Lapczynski S, Maiwald B, Engelhardt UH. Flavonoids and other polyphenols in
consumer brews of tea and other caffeinated beverages. J Agric Food Chem 2000;
48:1752-1757.
57. Gott DM, Griffiths LA. Effects of antibiotic pretreatments on the metabolism and excretion of
[U14C]( + )-catechin [U14C]( + )-cyanidanol-3 and its metabolite, 3 / -0-methyl-( + )-catechin.
Xenobiotica 1987; 17:423-434.
58. Meselhy MR, Nakamura N, Hattori M. Biotransformation of ( — )-epicatechin-3-0-gallate by
human intestinal bacteria. Chem Pharm Bull 1997; 45:888-893.
59. Wang LQ, Meselhy MR, Li Y, et al. The heterocyclic ring fission and dehydroxylation of
catechin and related compounds by Eubacterium sp. Strain SDG-2, a human intestinal
bacterium. Chem Pharm Bull 2001; 49:1640-1643.
60. Spencer JP, Scroeter H, Rechner AR, Rice-Evans CA. Bioavailability of flavan-3-ols and
procyanidins: gastrointestinal tract influences and their relevance to bioactive forms in vivo.
Antioxid Redox Signal 2001; 3:1023-1039.
61. Scheline RR. CRC Handbook of Mammalian Metabolism of Plant Compounds. Boca Raton,
FL: CRC Press, 1991.
62. Okubo T, Ishihara N, Oura A, et al. In vivo effects of tea polyphenol intake on human intestinal
microbiota and metabolism. Biosci Biotechnol Biochem 1992; 56:588-591.
63. Hara H, Orita N, Hatano S, et al. Effect of tea polyphenols on fecal flora and fecal metabolic
products of pigs. J Vet Med Sci 1995; 57:45-49.
64. Hara Y. Influence of tea catechins on the digestive tract. J Cell Biochem 1997; 27:52-58.
65. Morazzoni P, Bombardelli E, Vaccinium myrtillus L. Fitoterapia 1996; 67:3-29.
66. Renaud S, de Longeril M. Wine, alcohol, platelets, and the french paradox for coronary heart
disease. Lancet 1992; 339:1523-1526.
67. Havsteen B. Flavonoids, a class of natural products of high pharmacological potency. Biochem
Pharmacol 1983; 32:1141-1148.
68. Mian E, Curri SB, Lietti A, Bombardelli E. Anthocyanosides and the walls of micro vessels:
further aspects of the mechanism of action of their protective effect in syndromes due to
abnormal capillary fragility. Minerva Med 1977; 68:3565-3581.
69. Kadar A, Robert L, Miskulin M, Tixier JM, Brechemier D, Robert AM. Influence of
anthocyanoside treatment on the cholesterol-induced atherosclerosis in the rabbit. Paroi
Arterielle 1979;5:187-205.
70. Wang H, Nair MG, Strasburg GM, et al. Antioxidant and anti-inflammatory activities of
anthocyanins and their aglycon, cyanidin, from tart cherries. J Nat Prod 1999; 62:294-296.
71. Kamei H, Kojima T, Hasegawa M, et al. Suppression of tumor cell growth by anthocyanins
in vitro. Cancer Invest 1995; 13:590-594.
72. Wang H, Cao G, Prior RL. Oxygen radical absorbing capacity of anthocyanins. J Agric Food
Chem 1997; 45:304-309.
73. Felgines C, Texier O, Besson C, Fraisse D, Lamaison JL, Remesy C. Blackberry anthocyanins
are slightly bioavailable in rats. J Nutr 2002; 132:1249-1253.
74. Aura AM, Martin-Lopez P, O'Leary KA, et al. In vitro metabolism of anthocyanins by human
gut microbiota. Eur J Nutr 2004; 44:133-142.
75. Tsuda T, Horio F, Osawa T. Absorption and metabolism of cyanidin 3-0-(3-D-glucoside in rats.
FEBS Lett 1999; 449:179-182.
76. Baba S, Osakabe N, Natsume M, Terao J. Absorption and urinary excretion of procyanidin B 2
[epicatechin-(43-8)-epicatechin] in rats. Free Rad Biol Med 2002; 33:142-148.
77. Gonthier MO, Donovan JL, Texier O, Felgines C, Remesy C, Scalbert A. Metabolism of
dietary procyanidins in rats. Free Rad Biol Med 2003; 35:837-844.
168 Bingham
78. Rios LY, Gonthier MP, Remesy C, et al. Chocolate intake increases urinary excretion of
polyphenol-derived phenolic acids in healthy human subjects. Am J Clin Nutr 2003;
77:912-918.
79. Ward NC, Croft KD, Puddey IB, Hodgson JM. Supplementation with grape seed polyphenols
results in increased urinary excretion of 3-hydroxyphenylpropionic acid, an important
metabolite of proanthocyanidins in humans. J Agric Food Chem 2004; 52:5545-5549.
80. Groenewoud G, Hundt HK. The microbial metabolism of condensed ( + )-catechins by rat -
cecal microbiota. Xenobiotica 1986; 16:99-107.
81. Deprez S, Brezillon C, Rabot S, et al. Polymeric proanthocyanidins are catabolised by human
colonic microbiota into low molecular weight phenolic acids. J Nutr 2000; 130:2733-2738.
82. Makkar HP, Becker K. Degradation of condensed tannins by rumen microbes exposed to
quebrancho tannins (QT) in rumen simulation technique (RUSITEC) and effects of (QT) on
fermentative processes in the RUSITEC. J Sci Food Agric 1995; 69:495-500.
83. Makkar HP, Blummel M, Becker K. In vitro effects of and interactions between tannins and
saponins and fate of tannins in the rumen. J Sci Food Agric 1995; 69:481-493.
84. Smith AH, Mackie RI. Effect of condensed tannins on bacterial diversity and metabolic activity
in the rat gastrointestinal tract. Appl Environ Microbiol 2004; 70: 1 104—1 115.
85. McCartney AL. Application of molecular biological methods for studying probiotics and the
gut flora. Br J Nutr 2002; 88:29-37.
86. Manguin I, Bonnet R, Seksik P, et al. Molecular inventory of fecal microbiota in patients with
Chrohn's disease. FEMS Microb Ecol 2004; 50:25-36.
87. Namsolleck P, Thiel R, Lawson P, et al. Molecular methods for the analysis of gut microbiota.
Microb Ecol Health Dis 2004; 16:71-85.
9
Molecular Analysis of Host-Microbe
Interactions in the Gastrointestinal Tract
Peter A. Bron
Wageningen Centre for Food Sciences and NIZO Food Research, BA Fde, Wageningen,
The Netherlands
Willem M. de Vos
Wageningen Centre for Food Sciences and Laboratory of Microbiology, Wageningen
University Wageningen, The Netherlands
Michiel Kleerebezem
Wageningen Centre for Food Sciences and NIZO Food Research, BA Fde, Wageningen,
The Netherlands
INTRODUCTION
From birth to death, the human gastrointestinal tract (GI tract) is colonized by a vast and
complex consortium of mainly bacterial cells that outnumbers our somatic and germ cells
(1). The microflora in this niche is estimated to be composed of at least 500 different
species. However, this number is likely to represent a large underestimate, since it has
been based on culturing studies that are known to be selective and notably underestimate
the large number of Gram-positive intestinal bacteria. Molecular approaches, such as
broad-range sequencing of 16S ribosomal RNA genes, have been used to monitor the
composition of the dominant Gl-tract microbiota in different individuals at different points
in their lives (see chapter 1). These approaches revealed a relatively stable composition in
individual adults, but they appeared to be considerably variable when different individuals
were compared (2,3). Moreover, host development (4,5), host genotype (6), and
environmental factors (7) influence the composition of the microbiota, emphasizing
how challenging it is to define and compare bacterial communities within and between
specified intestinal niches of a given individual at a particular time point in his or her life.
The fact that we have not yet been able to culture the majority of the members of this
bacterial community further complicates studies on the activity of individual members of
the Gl-tract consortium. An important development in this respect are the sophisticated
enrichment strategies that have led to the isolation of new bacterial species from fecal
samples [(8) and see chapter 1].
Several biological barriers are met by bacteria during residence in and travel through
the different parts of the host's GI tract, such as the gastric acidity encountered in the
stomach, the presence of bile salts in the duodenum and stress conditions associated with
169
170 Bronetal.
oxygen gradients that are steep at the mucosal surface, while the colon lumen is virtually
anoxic. Moreover, considerable bacterial competition is encountered throughout the
intestinal tract and is most prominent in the colon where bacterial density is highest. There
are many functions that can be ascribed to the bacterial Gl-tract communities, including
the processing of undigested food, the stimulation of the host's immune system, and
providing colonization resistance to pathogens (9). However, it seems that we are only
beginning to understand the dimensions of these interactions. This is evident from the
major impact that bacterial colonization seems to have on the host and the presently known
response of intestinal bacteria that are reviewed below.
BACTERIAL RESPONSES TO THE HOST
In Vitro Approaches
Due to the complex nature of host-specific and chemical stress conditions that are met by
bacteria in the GI tract many studies describe the in vitro response of intestinal bacteria to a
simplified model that mimics (a component of) the stress encountered in the host's GI tract.
Historically, these studies have been performed in pathogens, including studies
describing the response towards acid stress in enteropathogenic bacteria such as Salmonella
and Escherichia coli, which revealed that RpoS, Fur, PhoP, and OmpR are important
pH-response regulators (10). More recent studies describe food-grade bacteria and their
tolerance to acid stress. These studies have focused mainly on physiological aspects such as
determination of levels of acid-tolerance (11,12). Changes in protein synthesis during acid
adaptation have been studied in Propionibacterium freudenreichii using 2D-gel
electrophoresis, indicating an important role in the early acid tolerance response for
a biotin carboxyl carrier protein and enzymes involved in DNA synthesis and repair, as well
as a role in the late response for the universal chaperones GroEL and GroES (13).
Several studies describe the defense mechanisms of Gram-negative enteric bacteria
towards bile acids, which include the synthesis of porins, transport proteins, efflux pumps
and lipopoly saccharides (14). In addition, a few genome- wide approaches aiming at the
identification of proteins important for bile salt resistance in Gram-positive bacteria have
been described. In Propionibacterium freudenreichii, Listeria monocytogenes and
Enterococcus faecalis differential proteome analysis using 2D-gel electrophoresis led to
the identification of several proteins that were expressed at a higher level in the presence of
bile salts relative to control conditions lacking bile salts (15-17). In Propionibacterium
freudenreichii these bile-induced proteins were further analyzed by N-terminal
sequencing and peptide mass fingerprinting, leading to the identification of 1 1 proteins
important in bile stress response. The induced proteins include general stress proteins such
as ClpB and the chaperons DnaK and Hsp20 (16). Analogously, a subset of the proteins
identified in E. faecalis appeared to be inducible by multiple sublethal stresses, including
heat, ethanol, and alkaline pH (18). The fact that these general stress proteins are induced
by bile is in agreement with the cross protection against bile after thermal or detergent
pre-treatment that has been observed in several bacteria, including Enterococcus faecalis,
Listeria monocytogenes and Bifidobacterium adolescentis (15,19,20). Moreover, in
Escherichia coli an rpoS mutant failed to develop starvation-mediated cross protection
after in vitro mimicking of osmotic, oxidative, and heat stresses (21). Two other bile-
induced proteins in Propionibacterium freudenreichii are the superoxide dismutase and
cysteine synthase, which could be involved in the protection against the oxidative stress
imposed on Propionibacterium freudenreichii by bile. In addition, other studies describe
the oxidative stress response of Gl-tract organisms, including Campylobacter coli,
Molecular Analysis of Host-Microbe Interactions in the Gl Tract
171
Escherichia coli and several Shigella species (21-23). A deletion mutant in the gene
encoding superoxide dismutase in Campylobacter coli displayed poor survival and
colonization during infection of an animal model (23). Moreover, proteins involved in
signal sensing and transduction, and an alternative sigma factor appeared to be bile-
inducible (16). Next to these proteomic approaches, random gene disruption strategies
have been applied to Listeria monocytogenes and Enterococcus faecalis, resulting in
strains that are more susceptible to bile salts than the wild-type strains. Subsequent genetic
analysis of the mutants revealed that the disrupted genes encode diverse functions,
including an efflux pump homologue (19) and genes involved in oxidative stress response,
and cell wall and fatty acid biosynthesis (24). In Lactobacillus plantarum a genetic screen
resulted in the identification of 3 1 genes of which the expression appeared to be induced by
bile. In analogy with the random gene disruption strategies applied in other species, this
genetic screen in L. plantarum led to the observation that efflux pumps and changes in the
architecture in the cell envelope are important for bile resistance of these bacteria (25).
Moreover, these findings are in agreement with several physiological studies in Gl-tract
bacteria such as L. plantarum, Propionibacterium freudenreichii and L. reuteri that
demonstrated that bile salts induce severe changes in the morphology of the cell
membrane and/or cell wall of these organisms (Fig. 1) (16,25,26).
Overall, the aforementioned in vitro experiments have provided insight in the
response of specific bacteria towards components of the complex mixture of stress
conditions that is met by these bacteria during residence in or transit through the GI tract of
their hosts. Although these approaches have helped to unravel the response of specific
micro-organisms towards certain Gl-tract conditions, they will not suffice to describe their
behavior in the GI tract. The full response repertoire will only be triggered in vivo, where all
physicochemical conditions are combined with specific host-microbe and microbe-microbe
interactions. Therefore, more sophisticated approaches have aimed at the development of
tools that allow the in vivo identification of genes that are important in the GI tract.
Overview of In Vivo Strategies
Three main strategies have been developed for the identification of genes that are either
highly expressed, differentially expressed or specifically required in vivo (Fig. 2). These
(A)
(B)
Figure 1 Exemplary representation of the morphological changes induced by bile. L. plantarum
cells were grown on laboratory media without (A) or with (B) 0. 1 % of porcine bile and the bacterial
cells were investigated by scanning electron microscopy. Source: From Ref. 25.
172
Bron et al.
(A)
-/
unique tag sequence
transposon
Introduce transposon pool into bacteria
T
Organize
mutants
individual signature tagged mutants
o
♦
o
o
o
o
♦
o
♦
♦
•
o
o
o
•
Pool mutants
Ia
Administer to
animal model
input pool
recovered pool
i
Hybridize to replicate filters
H
o
♦
o
o
o
•
o
•
o
♦
o
o
o
♦
o
/
o
o
o
°/
k
o
•
•
i
o
o
o^
Identify attenuated mutants
(B)
Administer to
animal model
Isolate in vivo and in vitro
bacterial mRNA and
use as template for
cDNA synthesis
Hybridize
to xDNA
i
Identify mRNAs only
present in vivo
(C)
antibiotic
resistance
gene
in vitro
reporter gen
(lacZ)
in vivo reporter gen
(purA, cat, hly, tnpR)
random xDNA fragments
I
Administer plasmid library to animal model
Recover in vivo active sublibrary
J
♦ ♦
♦
♦
Identify in vitro
-^-> inactive clones
as in vivo induced
Figure 2 Schematic representation of the basic principles of STM (A), SCOTS (B) and
(R-)IVET (C). Abbreviations: IVET, in vivo expression technology; SCOTS, selective capture of
transcribed sequences; STM, signature tagged mutagenesis.
strategies have mainly been applied for the identification of genes from pathogens which
are important during infection of their animal host. Signature tagged mutagenesis (STM)
utilizes a negative selection strategy in which an animal host is infected with a pool of
sequence-tagged insertion mutants. Mutated genes represented in the initial inoculum but
not recovered from the host are essential for growth in the host (27,28). A major advantage
of STM is that this type of screen provides direct proof for the importance of the mutated
genes in the relevant niche. Unfortunately, only limited numbers of mutants can be
screened per animal model. Therefore, large scale animal experiments are required for
Molecular Analysis of Host-Microbe Interactions in the Gl Tract 173
genome-wide mutant screens and for this reason STM screens are labor-intensive. In
addition, mutants that are slow-growing, contain mutations in genes encoding redundant
functions, or that can be complemented in a mixed population remain undetected or are at
least underrepresented (29). Moreover, mutants for genes that are essential in the
laboratory can never be obtained and, therefore, their importance for persistence in vivo
cannot be investigated using this technique. Nevertheless, the STM strategy has been
applied successfully to identify genes important in Gl-tract colonization by at least six
enteric pathogens, including Klebsiella pneumoniae, Vibrio cholerae, and Escherichia
coli (27). Lipopoly saccharides have been recognized as an important factor in Gl-tract
persistence and colonization of several Gram-negative bacteria, as they have emerged as a
common theme in the STM-based studies. In addition, the importance of the global
regulator of anaerobic metabolism Fnr was highlighted by several STM screens, which is
not surprising considering the low oxygen tension in the colon. Moreover, the alternate
sigma factor RpoN was found in several of the STM screens and is likely to associate with
RNA polymerase to promote the transcription of genes that are specifically required in the
Gl-tract niche. Finally, STM studies revealed the importance of specific adhesins,
including the type IV pili of Vibrio cholerae and Citrobacter rodentium (27).
A second strategy that has been applied for the identification of in vivo transcribed
genes is selective capture of transcribed sequences (SCOTS). cDNA is prepared from total
RNA isolated from infected cells, or tissue samples. cDNA mixtures obtained are then
enriched for sequences that are transcribed preferentially during growth in the host, using
hybridizations to biotinylated bacterial genomic DNA in the presence of cDNA similarly
prepared from bacteria grown in vitro. This strategy is very effective for the identification
of highly abundant genes in situ which are also expressed to a lower level in the laboratory.
In contrast to the STM strategy, genes that are essential in the laboratory can be
investigated for their importance in Gl-tract colonization. Nevertheless, major
disadvantages of SCOTS are the instability of bacterial mRNA for the construction of
cDNA libraries, the low abundance of mRNA from transiently or lowly expressed genes,
and the technical difficulty in isolation of sufficient high-quality mRNA from small
populations of bacteria in vivo (29). SCOTS has only been applied in a limited number of
studies and the majority of these screens was performed to identify bacterial genes
expressed within macrophages (30-33). More recently, the first SCOTS strategy utilizing
an animal model to identify genes important during infection was performed (34). This
approach resulted in the identification of Escherichia coli genes of which the expression is
either relatively abundant or induced in vivo. Similar to the STM approaches described
above, this SCOTS approach revealed the induction of expression of genes involved in
pilus formation and lipopolysaccharide (LPS) biosynthesis. Other genes identified
included iron-responsive and plasmid- and phage-encoded genes (34).
The third strategy that has been used to identify genes that are specifically induced or
required during infection is in vivo expression technology (IVET). Similar to SCOTS, the
IVET strategy is capable of identifying genes that are non-essential or redundant, while in
an STM approach genes are only identified that are essential in vivo. An important
difference between IVET and SCOTS lies in the fact that SCOTS is capable of identifying
genes that are active in the laboratory, but, nevertheless, are induced in the host, while
IVET only identifies in vivo induced genes that are very lowly or not expressed in the
laboratory. The IVET approach relies on the generation of transcriptional fusions of
genomic sequences to a reporter gene encoding an enzymatic activity. Nowadays, four
variations of IVET utilizing different reporter genes have evolved as discussed in the
section below.
174 Bronetal.
In Vivo Expression Technology Approaches
The original IVET approach involves a tandem set of two promoterless reporter genes,
namely pur A and lacZ, which were used to identify promoters that are specifically switched
on in Salmonella typhimurium during infection (35). Purine auxotroph mutants (A/?wrA) of
Salmonella typhimurium were only able to survive in a mouse model system when
complemented in trans with a plasmid encoded pur A copy. The promoterless pur A gene
was thereby utilized as a reporter for the identification of chromosomal fragments that are
capable to complement the mutants, thereby strongly selecting for chromosomal fragments
which harbor promoter elements that are active in the mouse model system. Subsequently,
the in vivo active promoters are tested for the absence of promoter activity in vitro utilizing
the second reporter gene (lacZ). The second variation of IVET is based on selection of an
antibiotic resistance gene as selectable marker. One obvious disadvantage of this second
variation of IVET is that the antibiotic must be administered to the host animal, which will
certainly disturb the naturally occurring microflora in the GI tract. Therefore, the screening
conditions assessed with this variant of IVET significantly differ from the native, in vivo
situation. On the other hand, the addition of different levels of the selective antibiotic
allows for selection of in vivo induced genes in a wider range of promoter activities. The
third type of IVET selection uses a single gene as a dual reporter. The first example of such
a dual reporter was hly, encoding the pore-forming haemolysin listeriolysin O (LLO) of
Listeria monocytogenes (36). LLO mediates lysis of the phagosomal membrane in
macrophages following infection. This reporter provides an in vivo selection for active
fusions that allow for escape from the phagosomal compartment and subsequent
multiplication. Moreover, a convenient screen on blood agar plates can be performed to
identify inactive fusions in vitro, since clones harboring such fusions do not display
haemolysis on these plates. The major drawback of the three aforementioned IVET
variations is that the experimental set-up is designed in such a way that gene activity is
required throughout the residence of the bacteria in the host. Hence, genes that are weakly
expressed in the laboratory or transiently expressed only in a specific compartment of the
host's GI tract slip through the selection procedure without being noticed. The fourth IVET
variation circumvents this disadvantage by using the irreversible enzymatic activity of
resolvases as reporter gene. Recombination-based IVET (R-IVET) is the only IVET
approach that functions as a genetic screen. An antibiotic resistance marker flanked by two
resolvase-recognition sites is integrated into the chromosome of the bacterium of interest.
Subsequently, a promoterless copy of a resolvase-encoding gene, typically the tnpR gene
from Tny5, is introduced on a plasmid and used to trap transcriptional activation by
monitoring changes in the antibiotic resistance phenotype. Importantly, this approach does
not rely on selective pressure during the animal experiments, as promoter activations are
irreversibly trapped by the excision of the antibiotic resistance marker and can be identified
after recovery of the bacterium under investigation from the host.
In the first decade, (R-)IVET was extensively utilized for the identification of genes
important during infection of at least 15 different pathogens, including Klebsiella
pneumoniae, Salmonella enterica, and Listeria monocytogenes (29,37). Thereby, (R)-IVET
is the most extensively applied screen for the identification of in vivo-induced genes
during infection in animal models. The number of genes that are identified with an individual
(R)-IVET screen varies strongly and ranges from 1 to approximately 100 genes (37).
Several of these screens identified genes that were already known to be involved in
virulence and this observation was considered an intrinsic validation of these (R-)IVET
screens (29). An exemplary finding along these lines is the identification of agrA
using R-IVET in Staphylococcus aureus (38). This gene encodes a quorum-sensing
Molecular Analysis of Host-Microbe Interactions in the Gl Tract 175
transcriptional activator and agrA mutants constructed in this organism prior to the
R-IVET screen had already been shown to display a virulence defective phenotype (39). In
general, regulators are one of the predominant classes of genes identified with (R-)IVET
(29). Another frequently encountered class of in vivo induced genes in pathogenic bacteria
are involved in the uptake of divalent cations, including many examples of Fe
transporters (29). The harsh conditions these pathogens encounter when they transit from
rich laboratory media to the host's GI tract apparently results in the induction of this group
of genes. This suggestion is further supported by the observation that several in vivo
induced genes were demonstrated to be similarly regulated under low Fe concentrations
in vitro (40-42). Other genes that frequently arise from (R-)IVET screens have functions
in a variety of generally recognized functional categories, including cell metabolism,
DNA repair and general stress response.
Recently, the first two reports appeared that describe the utilization of (R-)IVET
strategies in food-grade or commensal micro-organisms in order to determine the specific
induction of gene expression in these bacteria after introduction in the GI tract of animal
models. In L. reuteri an IVET strategy based on in vivo selection of an antibiotic resistant
phenotype (the aforementioned second variation of IVET) led to the identification of three
genes important for this organism during colonization of the GI tract of Lactobacillus-free
mice (43). One of these genes encodes a peptide methionine sulfoxide reductase (msrB)
which has previously been identified using IVET in the non-food-associated Streptococcus
gordonii during endocarditis (44). Although not noticed by the authors at that time, this
was an important clue suggesting an overlap in the genetic response triggered in the
pathogenic and non-pathogenic world following contact with the host. The second report
dealing with in vivo induction of genes in food-associated microbes describes a R-IVET
approach in L. plantarum (45). Previously, the resolvase-encoding tnpR-res system (46)
has been applied to trap promoter activities in R-IVET experiments in several pathogenic
bacteria. Therefore, initial attempts aimed at implementation of this system in
L. plantarum. A res-ery-res cassette was successfully integrated into the chromosome
of this bacterium and a promoterless copy of the tnpR gene was cloned on a low-copy
plasmid. Despite the successful cloning of the endogenous, highly active IdhLl promoter
upstream of tnpR, excision of the ery gene from the chromosome of L. plantarum was
never observed (Bron et al. unpublished data). These experiments strongly suggest that the
tnpR resolvase is not functional in L. plantarum under the conditions applied during
the experiments. Therefore, an alternative strategy was chosen to implement R-IVET in
L. plantarum, which involved the cre-loxP system (47). This system was previously
demonstrated to be functional in another lactic acid bacterium (LAB), Lactococcus lactis
(48). Hence, a loxP-ery-loxP cassette was integrated into the chromosome of L. plantarum
and a promoterless copy of ere was cloned on a low-copy vector. This system appeared
to be functional in L. plantarum, as IdhLl -promoter driven expression of the ere gene
led to the irreversible excision of the loxP-ery-loxP cassette from the chromosome.
Subsequently, a library containing L. plantarum chromosomal fragments upstream of ere
was constructed and administered to mice. The library was recovered from fecal samples
and analyzed for L. plantarum colonies that had lost their erythromycin resistant
phenotype during passage through the animal model. These erythromycin sensitive
colonies potentially harbor chromosomal fragments of which the expression was in
vivo induced. Using this strategy, 72 L. plantarum genes were identified as being in vivo
induced (ivi genes) during host Gl-tract transit (45). The distribution over the generally
recognized classes of main biological functions appeared to be random. A slight
overrepresentation of R-IVET genes is observed around the origin of replication as
compared to the rest of the genome (Fig. 3). However, the significance of the latter
176 Bronetal.
Figure 3 Using R-IVET 72 L. plantarum genes could be identified as in vivo induced (ivi) during
passage of the mouse GI tract. The chromosomal localization of these ivi genes is represented in the
inner circle, while the outer two circles represent the ORFs on the positive (outer circle) and negative
(middle circle) chromosomal DNA strand.
observation is unclear. Nine of the 72 ivi genes appeared to encode sugar-related functions,
including genes involved in ribose, cellobiose, sucrose, and sorbitol transport. Another
nine genes encode functions involved in acquisition and synthesis of amino acids,
nucleotides, cofactors, and vitamins, indicating their limited availability in the GI tract.
Four genes involved in stress-related functions were identified, reflecting the harsh
conditions that L. plantarum encounters in the GI tract. Another four genes encoding
extracellular proteins were identified that could mediate interactions with host Gl-tract
epithelial cells. Remarkably, the protein encoded by one of the hypothetical proteins
identified in this study in L. plantarum is a homologue (32% identity) of the only
conserved hypothetical protein that was identified with I VET in L. reuteri (43). Moreover,
a large number of the functions and pathways identified in L. plantarum have previously
been identified in pathogens as being important in vivo during infection (45). This striking
amount of parallels between the pathogenic and non-pathogenic in vivo response suggests
that survival rather than virulence is the explanation for the importance of these genes
during host residence. Recently, nine of the L. plantarum ivi genes were selected, mainly
focusing on genes that encode proteins with a predicted role in cell envelope functionality,
stress response and regulation, for the construction of isogenic gene replacement mutants.
Quantitative polymerase chain reaction (PCR) experiments were performed to monitor the
relative population abundance of the group of L. plantarum replacement mutants in fecal
samples after competitive passage through the GI tract of mice. These experiments
revealed that after Gl-tract passage the relative abundance of three of the ivi gene
mutants was 100- to 1000-fold reduced as compared to other mutant strains, suggesting
an important role for these three ivi genes, encoding the IIC transport component
of a cellobiose phosphotransferase system (PTS), an extracellular protein that contains an
LPQTNE motif, and a copper transporting ATPase, in the functionality of L. plantarum
during passage of the GI tract (49).
INSIGHTS FROM GENOMICS
Nowadays more and more bacteria are undergoing genome sequencing and as a result over
130 completed bacterial genomes have become available in the public domain. Following
Molecular Analysis of Host-Microbe Interactions in the Gl Tract 177
the first example of Haemophilus influenzae in 1995 (50) the major focus of these efforts
has initially been on pathogenic bacteria and includes the completion of several genome
sequences of food-borne pathogens, including Bacillus cereus (51), Salmonella
typhimurium (52), and Listeria monocytogenes (53). Over the last years sequencing of
the genomes of food-associated, non-pathogenic bacteria has received considerable
attention, including the elucidation of the complete genome sequence of Bacillus subtilis
in 1997 (54). Moreover, the first complete LAB genome sequence published was that of
Lactococcus lactis subspecies lactis strain IL1403 (55). To date, only two other high-
fidelity genome sequences of LAB, L. plantarum strain WCFS1 (56) and L. johnsonii
strain NCC533 (57), have been published. An additional number of LAB genomes is
nearing completion and draft genome information has become available in the public
domain in 2002 with the publication and appearance of genome sequences for LAB
provided by the Joint Genome Institute (http://genome.jgi-psf.org/microbial/) in
collaboration with the lactic acid bacteria genomics consortium (58,59). Next to this
large amount of sequence data from food-associated LAB, successful efforts have been put
in determination of the (complete) genome sequences of members of our normal colonic
microbiota, in particular Bacteroides thetaiotaomicron (60) and Bifidobacterium longum
(Fig. 4) (61).
L. plantarum is a versatile and flexible organism that is able to grow on a wide variety
of sugar sources. This phenotypic trait is reflected in the genome sequence of L. plantarum,
which harbours a remarkably high number of 25 complete PTS enzyme II complexes as well
as several incomplete complexes. This high number of PTS systems is far more than that
found in other complete bacterial genomes, and similar only to Listeria monocytogenes (53)
and Enterococcus faecalis (62). In addition to these PTS systems, the L. plantarum genome
encodes 30 transporters that are predicted to be involved in the transport of carbon sources.
This high sugar uptake flexibility has also been observed in the genomes of other LAB, such
as L. johnsonii (57) and L. acidophilus (http://www.calpoly.edu/~rcano/Lacto_genome.
html). Moreover, a remarkably high percentage of regulatory genes (8.5%) appeared to be
'Escherichia coli (4.6)
Bifidobacterium breve (2.4)
'Bifidobacterium longum (2.3)
■ Pediococcus pentosaceus (2.0)
' Lactobacillus rhamnosus (2.4)
Propionibac terium freudenreichii (2.6)
Brevibacterium linens (3.0)
Bacteroides thetaiotaomicron (6.3)
j — Lactobacillus casei (2.6)
Lactobacillus sakei (1 .9)
-£
-Lactobacillus plantarum (3.3)
— Lactobacillus brevis (2.0)
Lactobacillus alimentarius
rLactobacillus johnsonii (2.0)
Lactobacillus gasseri (1.8)
Lactobacillus delbrueckii (2.3)
| Lactobacillus acidophilus (2.0)
Lactobacillus helveticus (2.4)
-Enterococcus faecalis (3.2)
-Bacillus subtilis (4.2)
J Bacillus cereus (4.2)
Bacillus anthracis (5.2)
Listeria monocytogenes (2.9)
-Lactococcus lactis (2.3)
-Streptococcus thermophilus (1.8)
-Leuconostoc mesenteroi des (2.0)
Oenococcus oeni (1.8)
-Clostridium perfringens (3.0)
0.10
Figure 4 Phylogenetic relationship based upon the neighbor-joining method of partial 16S rDNA
sequences (Escherichia coli positions 107 to 1434). It should be noted that for some species the
genome sequence has (partially) been determined for multiple strains. LAB genomes are
underscored, and published, complete genomes are shown in bold. The estimated genome sizes
are indicated between brackets.
178
Bron et al.
encoded in the L. plantarum genome. Similar percentages were found in Listeria
monocytogenes, in which 7.3% of all the encoded genes were predicted to be involved in
regulatory functions. This could be a reflection of the many different environmental
conditions that these bacteria face. Moreover, these sophisticated regulatory systems enable
these organisms to adapt quickly to changes in the sugar composition of the host's diet
during residence in the proximal parts of the GI tract (Fig. 5).
o
o
o
Ingestion of carbohydrates by the host;
high diet-dependent variation
f"
Uptake of simple carbohydrates
by bacteria and the host
Small intestine
<^>
Bacteria mediated
production and liberation
of host-specific glycans
Bacteria breakdown of
complex polysaccharides
<~D>
OO
O "
Uptake of simple carbohydrates
by bacteria and the host
Large intestine
Figure 5 Molecular model of bacterial sugar utilization in the GI tract. In the small intestine
mono- and disaccharides are rapidly consumed by the host. Typically, bacteria that live in this niche
display highly flexible sugar utilization capacities, allowing them to quickly adapt to changes in the
carbon source availability that is determined by the host's diet. This high sugar flexibility is required
to compete with the host for carbon acquisition. In the large intestine more complex oligo- and
polysaccharides are the only available C-source. Therefore, bacteria in this niche are usually able to
hydrolyse complex dietary polysaccharides and host-derived glycoproteins and glycoconjugates.
Subsequently, the released, simpler sugars are utilized as C-source by the host and the bacteria
residing in the colon. Source: From Ref. 63.
Molecular Analysis of Host-Microbe Interactions in the Gl Tract 179
The genomes of B. thetaiotaomicron and Bifidobacterium longum encode an
elaborate apparatus for acquiring and hydrolysing otherwise indigestible dietary
polysaccharides (60,61). In B. thetaiotaomicron this "colonic substrate dependence" is
associated with an environment-sensing system consisting of a large repertoire of
extracytoplasmic function sigma factors and one- and two-component signal transduction
systems (60). In contrast, genes involved in sugar transport and hydrolysis in
Bifidobacterium longum are organized in operons which are predominantly regulated by
Lacl-type, sugar responsive repressors (61). The tight regulation of sugar utilization
observed in these bacteria allows a stringent response to environmental changes and is in
accordance with the fact that Bifidobacterium longum and B. thetaiotaomicron need to
adapt to wide fluctuations in substrate availability in the colon (60,61). It is speculated that
the mode of regulation via repression of genes could allow a quicker response in
Bifidobacterium longum (61). Similarly, an operon in L. acidophilus involved in utilization
of the prebiotic compound fructooligosaccharide contains a Lad type repressor.
Moreover, the expression of this operon is subject to global catabolite repression in the
presence of readily fermentable sugars (64). Another interesting finding in the genome of
B. thetaiotaomicron is that it appears to encode the capacity to use a variety of host-
derived glycoproteins and glycoconjugates. Sixty-one percent of its glycosylhydrolases
are predicted to be located in the periplasm, outer membrane, or extracellularly. This
suggests that these enzymes are not only important for fulfilling the needs of
B. thetaiotaomicron but may also help shape the metabolic milieu of the intestinal
ecosystem in ways conducive to maintaining a microbiota that supplies the host with 10 to
15% of our daily calories as fermentation products of dietary polysaccharides (Fig. 5) (60).
Similarly, the genome sequence of Bifidobacterium longum revealed insights into the
interaction of bifidobacteria with their host, as genes encoding polypeptides with
homology to glycoprotein-binding fimbriae are present in the genome. Moreover, a
eukaryotic-type serine protease inhibitor is encoded in the genome and could be involved
in the reported immunomodulatory activity of bifidobacteria (61).
Recently, the complete genomes of L. plantarum (3.3 Mbp) and L. johnsonii
(2.0 Mbp) were compared, revealing that these genomes have only 28 regions with
conservation of gene order, encompassing approximately 0.75 Mbp (65). Notably, these
regions are not co-linear, indicating major chromosomal rearrangements. Moreover,
metabolic reconstruction indicated many differences between these two lactobacilli, as
numerous enzymes involved in sugar metabolism and the biosynthesis of amino acids,
nucleotides, fatty acids and cofactors are lacking in L. johnsonii. Interestingly, major
differences were also seen in the number and types of putative extracellular proteins,
which could play a role in host-microbe interactions in the GI tract. The differences
between L. plantarum and L. johnsonii, both in genome organization and gene content, are
exceptionally large for two bacteria of the same genus, emphasizing the complexity and
diversity of the Lactobacillus genus (65).
Overall, the availability and comparison of bacterial genome sequences and their
annotated functions provides valuable clues towards the survival strategy of these bacteria
during their residence in the human GI tract. Additionally, these complete genome
sequences are powerful tools for the convenient and effective interpretation of the data
generated by the in vitro and in vivo screening procedures described above. Moreover,
comparative genomics can provide important insight in diversity, evolutionary
relationship and functional variation between bacteria, which might eventually generate
a comprehensive view of the behavior of microbes during residence in the human
Gl-tract.
180 Bronetal.
IN SITU PROFILING OF TRANSCRIPTION IN THE Gl TRACT
As soon as sequence data is available for a few genes in a bacterium of interest, one could think
of several sophisticated tools that allow investigation of the in situ expression levels of specific
genes. One example of such an approach is the implementation of quantitative reverse
transcriptase polymerase chain reaction (qRT-PCR) in the gram-negative bacterium
Helicobacter pylori (66). This study describes the assessment of gene expression in this
pathogen within the mouse and human gastric mucosae. Three genes, encoding urease,
catalase, and a putative adhesin specific for adherence to human gastric mucosa, were selected
for analysis, as their role during host residence was already established. Using minute
quantities of mRNA isolated from human and mouse infected mucosae, the in situ expression
of these three genes could be established. Moreover, the results of this study indicate that the
relative abundance of transcripts was the same in the human and mouse model system. Hence,
this study demonstrates that qRT-PCR is a powerful tool for the detection and quantification
of bacterial gene expression in the GI tract (66). Similar experiments were performed in
L. plantarum. An in vitro screen and a R-IVET screen were already performed in this LAB to
identify genes of which the expression is induced in vitro by bile or in situ in the GI tract of
a mouse model system, respectively (25,45). Matching of the results obtained in these two
screening procedures revealed two genes, encoding an integral membrane protein and an
argininosuccinate synthase that appeared to be induced by bile in vitro as well as in vivo in the
GI tract of a mouse model system. Therefore, the expression of these two genes was assessed
using qRT-PCR followed by S YBR green fluorescence detection. As the duodenum is the site
of bile release, expression in this specific region of the host' s GI tract was investigated.
The results confirmed that the expression levels of these two genes were significantly higher in
L. plantarum cells isolated from the mouse duodenum relative to cells grown in standard
laboratory media (25). Current studies aim at the confirmation of gene-induction of several
other L. plantarum genes initially identified with the R-IVET screen (Marco et al. unpublished
data). Moreover, transcription profiling under a variety of in vitro conditions could identify
more matches with the R-IVET screen and these genes could subsequently be analyzed with
qRT-PCR. These experiments might reveal the specific environmental cue involved in in situ
induction in the GI tract and could eventually elucidate the regulatory mechanism(s) involved.
These approaches could help to unravel the geographical differentiation of L. plantarum
gene expression along the GI tract, i.e., specific induction in the stomach, small intestine
or colon.
Another promising development is the optimization of bacterial RNA isolation
protocols from fecal samples (67), and Gl-tract samples from conventional mice fed with
L. plantarum (Marco et al. unpublished data) or human cancer patients who volunteered to
consume an oatmeal-based drink containing high numbers of L. plantarum prior to surgery
(de Vries et al. unpublished data). Although it is technically difficult to isolate high quality
bacterial mRNAs from these samples, such RNA samples originating from an in vivo
animal tissue, could prove extremely valuable, as they should allow analysis using
DNA micro-array technology, providing direct information on the in situ expression
levels of thousands of bacterial genes. Moreover, comparison of bacterial responses
in samples from the GI tract from animal models and of human origin could provide an
indication of the overlap in the response of L. plantarum during residence in the GI tract of
different hosts.
Studies in gnotobiotic mice have indicated that there is specific signaling between
the commensal bacterium B. thetaiotaomicron and its host. Synthesis of host epithelial
glycans is elicited by a B. thetaiotaomicron signal of which the expression is regulated by
a fucose-binding bacterial transcription factor. This factor senses environmental levels of
Molecular Analysis of Host-Microbe Interactions in the Gl Tract 181
fucose and coordinates the decision to generate a signal for production of host
fucosylated glycans when environmental fucose is limited or to induce expression of the
bacteria's fucose utilization operon when fucose is abundant (68). Additional studies
have evaluated the global intestinal response to colonization of gnotobiotic mice with
B. thetaiotaomicron. This colonization dramatically affected the host's gene expression,
including several important intestinal functions such as nutrient absorption, mucosal
barrier fortification, and postnatal intestinal maturation (9). From the in situ global
transcription profiles mentioned above and follow-up experiments it could be established
that the production of a previously uncharacterized angiogenin is induced when
gnotobiotic mice are colonized with B. thetaiotaomicron, revealing a mechanism
whereby intestinal commensal bacteria influence Gl-tract bacterial ecology and shape
innate immunity (69). In addition, the cellular origin of the angiogenin response was
investigated when different intestinal cell types were separated by laser-capture
microdissection and analyzed by qRT-PCR, revealing that angiogenin-3 mRNA is
specifically induced only in crypt epithelial cells. Hence, these experiments strongly
suggest an intestinal tissue specific response of the host during colonization (9).
Interestingly, comparison of the changes in global host gene expression in mice after
colonization with B. thetaiotaomicron, Bifidobacterium infantis or E. coli led to the
observation that part of this host response was only induced in mice by colonization with
B. thetaiotaomicron (9). However, analysis of a broader range of members of the
intestinal microbiota will reveal what the level of bacterial response specificity within the
host's tissues actually is. One such study is currently performed for L. plantarum (Peters
et al. unpublished data). Overall, the aforementioned studies on B. thetaiotaomicron
colonization of gnotobiotic mice provided valuable information on the influence of one
particular member of the microbiota on the host. However, the host response during
colonization by more complex mixtures of microbes and/or the host response in other
animal systems remained to be investigated at that time. Recently, it was found that
conventionalization of adult gnotobiotic mice with normal microbiota harvested from the
distal intestine of conventionally raised mice produced a 60% increase in body fat
content and insulin resistance despite reduced food intake. Studies of gnotobiotic and
conventionalized mice revealed that the microbiota promotes absorption of monosac-
charides from the gut lumen, which results in induction of de novo hepatic lipogenesis.
Fastin-induced adipocyte factor (Fiaf), a member of the angiopoietin-like family of
proteins, is selectively suppressed in the intestinal epithelium of normal mice by
conventionalization. Analysis of gnotobiotic and conventionalized, normal and Fiaf
knockout mice established that Fiaf is a circulating lipoprotein lipase inhibitor and that its
suppression is essential for the microbiota-induced deposition of triglycerides in
adipocytes. These results suggest that the gut microbiota have a major impact on food-
derived energy harvest and storage in the host (70). Another recent study investigated the
host response during colonization of a different animal model. DNA micro-array
comparison of gene expression in the digestive tracts of six days post-fertilization
gnotobiotic, conventionalized, and conventionally raised zebrafish (Danio Rerio)
revealed 212 genes regulated by the microbiota. Notably, 59 of these genes were also
found to be regulated in the mouse intestine during colonization, including genes that
encode functions involved in stimulation of epithelial proliferation, promotion of nutrient
metabolism, and innate immune response, indicating a substantial overlap in the genetic
response of mice and zebrafish towards intestinal colonization (71). Despite these recent
developments, an important future challenge lies within the translation of these animal
host response analyses to the human system.
182 Bronetal.
CONCLUDING REMARKS AND FUTURE PERSPECTIVES
Historically, research on the bacterial flora of the GI tract has concentrated on the
inhabitants that have negative effects on their hosts. More recently, research has expanded
from these pathogenic to non-pathogenic bacteria, including symbionts and commensals.
One obvious reason for this is the accumulating evidence that certain bacteria, especially
strains from the genus Lactobacillus and Bifidobacterium, may have probiotic effects in
man and animals (72). At present there is a detailed understanding on the distribution of
specific microbes along the human colon and the variations that can occur between
different individuals (73-75). Moreover, knowledge on the activity and response of
specific species to the conditions encountered when they transit through this complex
niche is starting to accumulate. Several in vitro studies mimicking specific conditions in
the GI tract have been performed, which allowed the identification of the repertoire of
genes and their corresponding proteins that respond to the condition applied. More
recently, in vivo approaches aiming at the identification of bacterial genes that are induced
during passage of the GI tract have been performed in various microbes, including food-
grade species. The current knowledge on promoter elements regulating gene expression of
food-grade bacteria in the GI tract could have application possibilities, as these bacteria
have been shown to possess great potential to serve as delivery vehicles of health-
promoting or therapeutic compounds to the human GI tract (76-84). (R-)IVET approaches
have provided the required promoters that will allow the construction of LAB -based
dedicated Gl-tract delivery vehicles that only express certain desired functions in situ.
Moreover, geographically more detailed insight in the exact site of in situ gene activation
in the GI tract derived from qRT-PCR using specific tissue samples might allow the
construction of highly site-specific delivery vehicles. Combination of these promoters
with certain genes, e.g., bacteriophage-derived or other lytic cassettes, might generate
LAB strains that release their cellular content at a specific location in the GI tract.
At present, a large part of the consortium of bacteria residing in the GI tract has not
been cultured in vitro. Since most genetic approaches require the culturability of the
microbe under investigation, the expansion of our knowledge of this group of bacteria is
highly challenging and very limiting at this stage. Metagenomic approaches might shed
light on the genetic complexity of the collective genomic material of the intestinal
microbiota (85). Moreover, such studies could reveal previously unknown, critical genes
for intestinal microbiota functioning. However, effective exploration of metagenomic
functionality will depend on high throughput screening systems that allow function
identification. Moreover, the development of effective and robust methods to assess
microbiota activity in situ in a culture independent manner will be critical for our
functional understanding of the large number of unculturable bacteria in the GI tract.
A promising prospect from the increasing availability of complete genome
sequences is the construction of DNA micro-arrays in several laboratories working on
food-associated microbes. As a consequence, the first publications presenting data from
these DNA micro-arrays appeared recently (86-88). These genomics-based, global
investigations of gene expression in food-grade microbes under various conditions will
further detail our understanding of their behavior. However, the application of these
transcriptome profiling techniques on microbe-containing GI tract samples will still have
to overcome some technical hurdles (RNA extraction procedures, response validation,
etc.), but will eventually lead to a more complete view of the activity of these bacteria in
this complex niche. Besides the application of DNA micro-array technology to reveal the
bacterial side of host-microbe interactions in the GI tract, this technology has already been
used by Hooper and co-workers in several elegant studies aiming at identification of the
Molecular Analysis of Host-Microbe Interactions in the Gl Tract 183
response of gnotobiotic mice to colonization with the commensal B. thetaiotaomicron
(9,68,69). In addition, more recent gnotobiote studies have shed light on the differences in
mouse gene expression upon colonization by a more complex mixture of bacteria (70), and
have provided the first steps towards the comparative analysis of host responses in
different animal models (71). Nevertheless, an important question that still remains to be
answered is to what extent the data obtained on host and bacterial gene expression using
animal models can be extrapolated to the situation in humans.
In conclusion, the genome-wide transcript profiling approaches that have been
performed to date have provided us with clues of the possible role of individual host and
bacterial genes during host-microbe interactions. Combination of bacterium and host
transcriptomes should allow the construction of molecular models that describe host-
microbe interactions, allowing more pinpointed experiments in the future, designed on the
basis of a molecular interaction hypothesis. As Gl-tract bacteria like L. plantarum and
B. thetaiotaomicron are genetically accessible, gene deletion and overexpression mutants
can be constructed and employed to study the effect of a single bacterial gene and its
corresponding function on host gene expression. After profiling of these host genes, knock-
out mice and/or antisense RNA approaches might allow gene silencing on the host side of
the spectrum, thereby enabling us to study the effect of single host gene mutations on the
colonization of microbes. Ultimately, such studies may provide a molecular knowledge
base to understand Gl-tract colonization of commensals or symbionts, and could lead to the
molecular explanation of probiotic effects associated with LAB and related species.
ACKNOWLEDGMENTS
The authors gratefully acknowledge Jos Boekhorst and Sergey Konstantinov for the
construction of Figures 3 and 4, respectively. We cordially thank our WCFS colleagues for
sharing unpublished data. Part of this work was supported by the EU project LABDEL
(EU-QLRT-2000-00340).
REFERENCES
1 . Savage DC. Microbial ecology of the gastro intestinal tract. Annu Rev Microbiol 1977; 31:133.
2. Zoetendal EG, Akkermans AD, De Vos WM. Temperature gradient gel electrophoresis
analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities
of active bacteria. Appl Environ Microbiol 1998; 64:3854-3859.
3. Zoetendal EG, von Wright A, Vilpponen-Salmela T, Ben- Amor K, Akkermans AD,
de Vos WM. Mucosa-associated bacteria in the human Gl-tract are uniformly distributed
along the colon and differ from the community recovered from feces. Appl Environ Microbiol
2002; 68:3401-3407.
4. Hopkins MJ, Sharp R, Macfarlane GT. Age and disease related changes in intestinal bacterial
populations assessed by cell culture, 16S rRNA abundance, and community cellular fatty acid
profiles. Gut 2001; 48:198-205.
5. Favier CF, Vaughan EE, De Vos WM, Akkermans AD. Molecular monitoring of succession of
bacterial communities in human neonates. Appl Environ Microbiol 2002; 68:219-226.
6. Zoetendal EG, Akkermans AD, Akkermans-van Vliet WM, de Visser JAGM, de Vos WM.
The host genotype affects the bacterial community in the human gastrointestinal tract. Microb
Ecol Health Dis 2001; 13:129-134.
184 Bronetal.
7. Sullivan A, Edlund C, Nord CE. Effect of antimicrobial agents on the ecological balance of
human microflora. Lancet Infect Dis 2001; 1:101—1 14.
8. Zoetendal EG, Plugge CM, Akkermans AD, de Vos WM. Victivallis vadensis gen. nov., sp.
nov., a sugar- fermenting anaerobe from human faeces. Int J Syst Evol Microbiol 2003;
53:211-215.
9. Hooper LV, Wong MH, Thelin A, Hansson L, Falk PG, Gordon JI. Molecular analysis of
commensal host-microbial relationships in the intestine. Science 2001; 291:881-884.
10. Audia JP, Webb CC, Foster JW. Breaking through the acid barrier: an orchestrated response to
proton stress by enteric bacteria. Int J Med Microbiol 2001; 291:97-106.
11. Chou LS, Weimer B. Isolation and characterization of acid- and bile-tolerant isolates from
strains of Lactobacillus acidophilus. J Dairy Sci 1999; 82:23-31.
12. Hyronimus B, Le Marrec C, Sassi AH, Deschamps A. Acid and bile tolerance of spore-forming
lactic acid bacteria. Int J Food Microbiol 2000; 61:193-197.
13. Jan G, Leverrier P, Pichereau V, Boyaval P. Changes in protein synthesis and morphology
during acid adaptation of Propionibacterium freudenreichii. Appl Environ Microbiol 2001;
67:2029-2036.
14. Gunn JS. Mechanisms of bacterial resistance and response to bile. Microbes Infect 2000;
2:907-913.
15. Flahaut S, Frere J, Boutibonnes P, Auffray Y. Comparison of the bile salts and sodium dodecyl
sulfate stress responses in Enterococcus faecalis. Appl Environ Microbiol 1996; 62:2416-2420.
16. Leverrier P, Dimova D, Pichereau V, Auffray Y, Boyaval P, Jan G. Susceptibility and adaptive
response to bile salts in Propionibacterium freudenreichii: physiological and proteomic
analysis. Appl Environ Microbiol 2003; 69:3809-3818.
17. Phan-Thanh L, Gormon T. Stress proteins in Listeria monocytogenes. Electrophoresis 1997;
18:1464-1471.
18. Rince A, Le Breton Y, Verneuil N, Giard JC, Hartke A, Auffray Y. Physiological and
molecular aspects of bile salt response in Enterococcus faecalis. Int J Food Microbiol 2003;
88:207-213.
19. Begley M, Gahan CG, Hill C. Bile stress response in Listeria monocytogenes L028: adaptation,
cross-protection, and identification of genetic loci involved in bile resistance. Appl Environ
Microbiol 2002; 68:6005-6012.
20. Schmidt G, Zink R. Basic features of the stress response in three species of bifidobacteria:
B. longum, B. adolescentis, and B. breve. Int J Food Microbiol 2000; 55:41-45.
21. Krogfelt KA, Hjulgaard M, Sorensen K, Cohen PS, Givskov M. rpoS gene function is
a disadvantage for Escherichia coli BJ4 during competitive colonization of the mouse large
intestine. Infect Immun 2000; 68:2518-2524.
22. Khanduja V, Kang G, Raj an DP, Balasubramanian KA. Oxidative stress response in Shigella &
nonpathogenic gut bacteria. Indian J Med Res 1998; 108:3-7.
23. Purdy D, Cawthraw S, Dickinson JH, Newell DG, Park SF. Generation of a superoxide
dismutase (SOD)-deficient mutant of Campylobacter coli: evidence for the significance of
SOD in Campylobacter survival and colonization. Appl Environ Microbiol 1999;
65:2540-2546.
24. Breton YL, Maze A, Hartke A, Lemarinier S, Auffray Y, Rince A. Isolation and
characterization of bile salts-sensitive mutants of Enterococcus faecalis. Curr Microbiol
2002; 45:434-439.
25. Bron PA, Marco M, Hoffer SM, Van Mullekom E, de Vos WM, Kleerebezem M. Genetic
characterization of the bile salt response in Lactobacillus plantarum and analysis of responsive
promoters in vitro and in situ in the gastrointestinal tract. J Bacteriol 2004; 186:7829-7835.
26. Taranto MP, Fernandez Murga ML, Lorca G, de Valdez GF. Bile salts and cholesterol induce
changes in the lipid cell membrane of Lactobacillus reuteri. J Appl Microbiol 2003; 95:86-91.
27. West NP, Sansonetti PJ, Frankel G, Tang CM. Finding your niche: what has been learnt from
STM studies on GI colonization. Trends Microbiol 2003; 11:338-344.
28. Mecsas J. Use of signature-tagged mutagenesis in pathogenesis studies. Curr Opin Microbiol
2002; 5:33-37.
Molecular Analysis of Host-Microbe Interactions in the Gl Tract 185
29. Mahan MJ, Heithoff DM, Sinsheimer RL, Low DA. Assessment of bacterial pathogenesis by
analysis of gene expression in the host. Annu Rev Genet 2000; 34:139-164.
30. Morrow BJ, Graham JE, Curtiss R, III. Genomic subtractive hybridization and selective capture
of transcribed sequences identify a novel Salmonella typhimurium fimbrial operon and putative
transcriptional regulator that are absent from the Salmonella typhi genome. Infect Immun 1999;
67:5106-5116.
31. Graham JE, Clark-Curtiss JE. Identification of Mycobacterium tuberculosis RNAs synthesized
in response to phagocytosis by human macrophages by selective capture of transcribed
sequences (SCOTS). Proc Natl Acad Sci USA 1999; 96:11554-11559.
32. Daigle F, Graham JE, Curtiss R, III. Identification of Salmonella typhi genes expressed within
macrophages by selective capture of transcribed sequences (SCOTS). Mol Microbiol 2001;
41:1211-1222.
33. Hou JY, Graham JE, Clark-Curtiss JE. Mycobacterium avium genes expressed during growth in
human macrophages detected by selective capture of transcribed sequences (SCOTS). Infect
Immun 2002; 70:3714-3726.
34. Dozois CM, Daigle F, Curtiss R, III. Identification of pathogen-specific and conserved genes
expressed in vivo by an avian pathogenic Escherichia coli strain. Proc Natl Acad Sci USA
2003; 100:247-252.
35. Mahan MJ, Slauch JM, Mekalanos JJ. Selection of bacterial virulence genes that are
specifically induced in host tissues. Science 1993; 259:686-688.
36. Gahan CG, Hill C. The use of listeriolysin to identify in vivo induced genes in the
gram- positive intracellular pathogen Listeria monocytogenes. Mol Microbiol 2000;
36:498-507.
37. Angelichio MJ, Camilli A. In vivo expression technology. Infect Immun 2002; 70:6518-6523.
38. Lowe AM, Beattie DT, Deresiewicz RL. Identification of novel staphylococcal virulence genes
by in vivo expression technology. Mol Microbiol 1998; 27:967-976.
39. Gillaspy AF, Hickmon SG, Skinner RA, Thomas JR, Nelson CL, Smeltzer MS. Role of the
accessory gene regulator (agr) in pathogenesis of staphylococcal osteomyelitis. Infect Immun
1995; 63:3373-3380.
40. Smith HE, Buijs H, de Vries RR, Wisselink HJ, Stockhofe-Zurwieden N, Smits MA.
Environmentally regulated genes of Streptococcus suis: identification by the use of iron-
restricted conditions in vitro and by experimental infection of piglets. Microbiology 2001;
147:271-280.
41. Lai YC, Peng HL, Chang HY. Identification of genes induced in vivo during Klebsiella
pneumoniae CG43 infection. Infect Immun 2001; 69:7140-7145.
42. Janakiraman A, Slauch JM. The putative iron transport system SitABCD encoded on SPI1
is required for full virulence of Salmonella typhimurium. Mol Microbiol 2000;
35:1146-1155.
43. Walter J, Heng NC, Hammes WP, Loach DM, Tannock GW, Hertel C. Identification of
Lactobacillus reuteri genes specifically induced in the mouse gastrointestinal tract. Appl
Environ Microbiol 2003; 69:2044-2051.
44. Kilic AO, Herzberg MC, Meyer MW, Zhao X, Tao L. Streptococcal reporter gene-fusion
vector for identification of in vivo expressed genes. Plasmid 1999; 42:67-72.
45. Bron PA, Grangette C, Mercenier A, de Vos WM, Kleerebezem M. Identification of
Lactobacillus plantarum genes that are induced in the gastrointestinal tract of mice. J Bacteriol
2004; 186:5721-5729.
46. Reed RR, Grindley ND. Transposon-mediated site-specific recombination in vitro: DNA
cleavage and protein-DNA linkage at the recombination site. Cell 1981; 25:721-728.
47. Austin S, Ziese M, Sternberg N. A novel role for site-specific recombination in maintenance
of bacterial replicons. Cell 1981; 25:729-736.
48. Campo N, Daveran-Mingot ML, Leenhouts K, Ritzenthaler P, Le Bourgeois P. Cre-loxP
recombination system for large genome rearrangements in Lactococcus lactis. Appl Environ
Microbiol 2002; 68:2359-2367.
186 Bronetal.
49. Bron PA, Meijer M, Bongers R, de Vos WM, Kleerebezem M. Competitive population
dynamics of /W-gene mutants of Lactobacillus plantarum in the gastrointestinal tract of mice.
In Bron PA, the molecular response of Lactobacillus plantarum to intestinal passage and
conditions. PhD thesis 2004, Wageningen Centre for Food Sciences, Wageningen.
50. Fleischmann RD, Adams MD, White O, et al. Whole-genome random sequencing and
assembly of Haemophilus influenzae Rd. Science 1995; 269:496-512.
5 1 . Ivanova N, Sorokin A, Anderson I, et al. Genome sequence of Bacillus cereus and comparative
analysis with Bacillus anthracis. Nature 2003; 423:87-91.
52. Parkhill J, Dougan G, James KD, et al. Complete genome sequence of a multiple drug resistant
Salmonella enterica serovar Typhi CT18. Nature 2001;848-852.
53. Glaser P, Frangeul L, Buchrieser C, et al. Comparative genomics of Listeria species. Science
2001;294:849-852.
54. Kunst F, Ogasawara N, Moszer I, et al. The complete genome sequence of the gram-positive
bacterium Bacillus subtilis. Nature 1997;249-256.
55. Bolotin A, Wincker P, Mauger S, et al. The complete genome sequence of the lactic acid
bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res 2001; 11:731-753.
56. Kleerebezem M, Boekhorst J, Van Kranenburg R, et al. Complete genome sequence of
Lactobacillus plantarum WCFSL Proc Natl Acad Sci USA 2003; 100:1990-1995.
57. Pridmore RD, Berger B, Desiere F, et al. The genome sequence of the probiotic intestinal
bacterium Lactobacillus johnsonii NCC 533. Proc Natl Acad Sci USA 2004; 101:2512-2517.
58. Klaenhammer T, Altermann E, Arigoni F, et al. Discovering lactic acid bacteria by genomics.
Antonie Van Leeuwenhoek 2002; 82:29-58.
59. de Vos WM. Advances in genomics for microbial food fermentations and safety. Curr Opin
Biotechnol2001; 12:493-498.
60. Xu J, Bjursell MK, Himrod J, et al. A genomic view of the human- Bacteroides
thetaiotaomicron symbiosis. Science 2003;2074-2076.
61. Schell MA, Karmirantzou M, Snel B, et al. The genome sequence of Bifidobacterium longum
reflects its adaptation to the human gastrointestinal tract. Proc Natl Acad Sci USA 2002;
99:14422-14427.
62. Paulsen IT, Banerjei L, Myers GS, et al. Role of mobile DNA in the evolution of vancomycin-
resistant Enterococcus faecalis. Science 2003; 299:2071-2074.
63. Hooper LV, Midtvedt T, Gordon JI. How host- microbial interactions shape the nutrient
environment of the mammalian intestine. Annu Rev Nutr 2002; 22:283-307.
64. Barrangou R, Altermann E, Hutkins R, Cano R, Klaenhammer TR. Functional and comparative
genomic analyses of an operon involved in fructooligosaccharide utilization by Lactobacillus
acidophilus. Proc Natl Acad Sci USA 2003; 100:8957-8962.
65. Boekhorst J, Siezen RJ, Zwahlen MC, et al. The complete genomes of Lactobacillus plantarum
and Lactobacillus johnsonii reveal extensive differences in chromosome organization and gene
content. Microbiology 2004; 150:3601-3611.
66. Rokbi B, Seguin D, Guy B, et al. Assessment of Helicobacter pylori gene expression within
mouse and human gastric mucosae by real-time reverse transcriptase PCR. Infect Immun 2001;
69:4759-4766.
67. Fitzsimons NA, Akkermans AD, de Vos WM, Vaughan EE. Bacterial gene expression detected
in human faeces by reverse transcription-PCR. J Microbiol Methods 2003; 55:133-140.
68. Hooper LV, Xu J, Falk PG, Midtvedt T, Gordon JI. A molecular sensor that allows a gut
commensal to control its nutrient foundation in a competitive ecosystem. Proc Natl Acad Sci
USA 1999; 96:9833-9838.
69. Hooper LV, Stappenbeck TS, Hong CV, Gordon JI. Angiogenins: a new class of microbicidal
proteins involved in innate immunity. Nat Immunol 2003; 4:269-273.
70. Backhed F, Ding H, Wang T, et al. The gut microbiota as an environmental factor that regulates
fat storage. Proc Natl Acad Sci USA 2004; 101:15718-15723.
71. Rawls JF, Samuel BS, Gordon JI. Gnotobiotic zebrafish reveal evolutionarily conserved
responses to the gut microbiota. Proc Natl Acad Sci USA 2004; 101:4596-4601.
Molecular Analysis of Host-Microbe Interactions in the Gl Tract 187
72. Ahrne S, Nobaek S, Jeppsson B, Adlerberth I, Wold AE, Molin G. The normal Lactobacillus
flora of healthy human rectal and oral mucosa. J Appl Microbiol 1998; 85:88-94.
73. Zoetendal EG, Collier CT, Koike S, Mackie RI, Gaskins HR. Molecular ecological analysis of
the gastrointestinal microbiota: a review. J Nutr 2004; 134:465-472.
74. Zoetendal EG, Cheng B, Koike S, Mackie RI. Molecular microbial ecology of the
gastrointestinal tract: from phylogeny to function. Curr Issues Intest Microbiol 2004; 5:31-47.
75. Vaughan EE, de Vries MC, Zoetendal EG, Ben-Amor K, Akkermans AD, de Vos WM. The
intestinal LABs. Antonie Van Leeuwenhoek 2002; 82:341-352.
76. Grangette C, Muller-Alouf H, Hols P, et al. Enhanced mucosal delivery of antigen with cell
wall mutants of lactic acid bacteria. Infect Immun 2004; 72:2731-2737.
77. Hanniffy S, Wiedermann U, Repa A, et al. Potential and opportunities for use of recombinant
lactic acid bacteria in human health. Adv Appl Microbiol 2004; 56:1-64.
78. Reuter MA, Hanniffy S, Wells JM. Expression and delivery of heterologous antigens using
lactic acid bacteria. Methods Mol Med 2003; 87:101-114.
79. Vandenbroucke K, Hans W, Van Huysse J, et al. Active delivery of trefoil factors by
genetically modified Lactococcus lactis prevents and heals acute colitis in mice.
Gastroenterology 2004; 127:502-513.
80. Steidler L, Neirynck S, Huyghebaert N, et al. Biological containment of genetically modified
Lactococcus lactis for intestinal delivery of human interleukin 10. Nat Biotechnol 2003;
21:785-789.
81. Steidler L, Hans W, Schotte L, et al. Treatment of murine colitis by Lactococcus lactis
secreting interleukin- 10. Science 2000; 289:1352-1355.
82. Steidler L. Live genetically modified bacteria as drug delivery tools: at the doorstep of a new
pharmacology? Expert Opin Biol Ther 2004; 4:439-441.
83. Steidler L. Genetically engineered probiotics. Best Pract Res Clin Gastroenterol 2003;
17:861-876.
84. Grangette C, Muller-Alouf H, Geoffroy M, Goudercourt D, Turneer M, Mercenier A.
Protection against tetanus toxin after intragastric administration of two recombinant lactic acid
bacteria: impact of strain viability and in vivo persistence. Vaccine 2002; 20:3304-3309.
85. Schloss PD, Handelsman J. Biotechnological prospects from metagenomics. Curr Opin
Biotechnol 2003; 14:303-310.
86. Bron PA, Molenaar D, de Vos WM, Kleerebezem M. DNA microarray based identification of
bile-responsive genes in Lactobacillus plantarum. J Appl Microbiol 2006; in press.
87. Azcarate-Peril MA, McAuliffe O, Altermann E, Lick S, Russell WM, Klaenhammer TR.
Microarray analysis of a two-component regulatory system involved in acid resistance and
proteolytic activity Lactobacillus acidophilus. Appl Environ Microbial 2005; 71:5794-5804.
88. Pieterse B, Leer RJ, Schuren FH, van der Werf MJ. Unravelling the multiple effects of lactic
acid stress on Lactobacillus plantarum by transcription profiling. Microbiology 2005;
151:3881-3894.
10
The Infant Intestinal Microbiota in Allergy
Pirkka V. Kirjavainen and Gregor Reid
Canadian Research and Development Center for Probiotics, The Lawson Health
Research Institute, London, Ontario, Canada
INTRODUCTION
Allergies represent a condition where impaired immunological tolerance to common
environmental allergens is the fundamental determinant of the disease. The immuno-
pathological mechanism of the disease development is poorly understood. It is thought to
involve complex genetic predisposition, which depending on environmental triggers
and/or protective factors, may lead to allergic sensitization and development of allergic
disease and the consequent symptoms (1-5). One environmental factor that has received
particular interest in recent years is the variation in early microbial exposure, which has
indisputable, although incompletely understood, effects on immunological maturation.
Wider acknowledgment of the possible association between microbes and allergic
diseases followed the introduction of what became known as "hygiene hypothesis" by
Strachan, 1989 (6). Based upon epidemiological findings, he suggested that the rise in
prevalence of allergic diseases in past decades was due to factors associated with changes
in life style such as reduced family size and improved hygiene measures. He assumed that
these epidemiological correlations reflected reduced opportunities for cross-infections in
families with young children.
The basic idea linking microbes and allergies is that adequate microbial exposure
may be able to direct the early immunological development away from allergic type
responsiveness. In contrast, inadequate exposure does not provide this necessary stimulus
and may even promote the development of allergic disease. The original hygiene
hypothesis was based on infections, but what truly constitutes the characteristics and
source of "adequate" microbial stimulus remains unknown. Intestinal microbiota are at
least quantitatively the primary source of host-microbe interactions soon after birth.
Moreover, the early establishment of the microbiota has been shown to be prerequisite for
the formation of tolerance to mucosally encountered antigens (7-12). Arguably the best
clinical evidence linking intestinal microbiota and allergies is provided by preliminary
trials that have had success in preventing or treating allergic conditions by oral
administration of intestinal bacterial isolates (13-18). Also, early use of antibiotics has
been implicated to predispose the infant to allergic sensitization and development of
allergic disease, although this view is controversial (19,20). The aim of this chapter is to
189
190 Kirjavainen and Reid
summarize the current knowledge of the characteristics of gut microbiota in allergic
infants and discuss their implication in allergic disease development.
ALLERGIES— AN OVERVIEW
Allergies are by definition immunological hypersensitivity reactions to substances
(allergens), usually proteins, tolerated in defined dose by normal individuals (21). Allergic
reactions are manifested in allergic diseases such as asthma, eczema, and rhinoconjuncti-
vitis, each defined by a group of symptoms and signs. The life-impairing effect of these
diseases varies from subtle to dominant. In addition to impairing physical health there may
be an impact on social and emotional health, especially in childhood (22). Allergic
symptoms can significantly disturb productivity in school and work where they are among
the major causes of absenteeism. The personal and social economic burden is considerable
(22-24). During the second half of the twentieth century the prevalence of allergic
diseases has increased in epidemic proportions. The highest prevalence is in children and
teenagers. With, on average, every fourth child affected, allergic diseases represent the
most common chronic childhood illnesses in many countries (25,26). The reasons for this
increase are not known (25,27).
There are many exceptions, but in most cases in established allergic disease the
inflammatory cascade leading to the symptoms follows allergen contact at mucosal
membranes in airways or gastrointestinal tract and is initiated through specific recognition
by Immunoglobulin E (IgE) antibodies (27). Overactive T helper 2 (Th2) cells may be
considered as the immunopathological cornerstone of these reactions (28). When, for
example, pollen-derived aeroallergen is inhaled by a non-allergic subject the immune
system reacts mildly by producing allergen-specific IgG 2 and IgG 4 antibodies. This is
probably due to specific recognition and action, e.g., production of interferon (IFN)-y by T
helper 1 cells (Thl) cells (28,29). In contrast, in allergic individuals Th2 cells typically
infiltrate to the affected tissue and produce cytokines such as interleukins (IL)-4, -5, -9,
and, -13. These cytokines promote the production of IgE antibodies, development and
accumulation of mast cells, eosinophils, and basophils (the primary effector cells in allergic
inflammation) as well as overproduction of mucus and airway hyper-responsiveness in
asthma. Recognition of allergens by specific IgE antibodies on the surface of mast cells and
basophils triggers these cells to release pre- and newly formed proinflammatory
and vasoactive molecules (e.g., histamine) that may cause tissue damage and other detrimental
effects. Eosinophilic inflammation contributes to the airway hyper-responsiveness (28).
It is clear that there is a hereditary trait that predisposes to the formation of allergen-
specific IgE antibodies and development of allergic disease (27). This genetic
predisposition, known as atopy, affects arguably as many as 30-50% of the world
population (2,25,27). Although the immunopathological mechanisms in established
allergic diseases are well characterized, it is poorly understood how and why atopy leads
or does not lead to allergic sensitization and why only some sensitized individuals develop
symptomatic allergic disease (30). Intriguingly, the immune responses to common
environmental allergens are initially dominated by Th2 cells in all newborn infants but
these responses are not suppressed in atopic infants during the first year of life (31,32).
This is thought to be due to defects associated with atopy, for example, impaired
production of IFN-y, which compromise the normal maturation of Th2 antagonistic Thl
responses. The major driving force for the Thl maturation is considered to be the nature of
the microbial exposure encountered after birth. Recent studies indicate that another type
of T helper cells, collectively referred to as regulatory T cells (Tregs), may also be
The Infant Intestinal Microbiota in Allergy 191
involved or even be the chief executers in natural suppression of Th2 mediated responses
to environmental allergens. At least two types of Tregs have been shown to have this
ability in humans: (1) CD4 + CD25 + Tregs, which probably mediate their action primarily
via production of immunosuppressive cytokines transforming growth factor (TGF)-(3 (also
in membrane-bound form) and IL-10 and (2) IL-10 producing Tregs (33-35). Notably,
there is indication that the numbers of allergen-specific Tregs may be lower and their
suppressive ability defective in those subjects who become sensitized (36,37). Also, the
mechanism of successful allergen-injection immunotherapy has been linked with
induction of IL-10 Tregs that suppress Th2 responses and induce switching from IgE to
IgG 4 antibody (33).
ALLERGY-ASSOCIATED COMPOSITIONAL CHARACTERISTICS
OF INFANT GUT MICROBIOTA
The predominant site for host-microbe interaction is in the gut. Thus, its compositional
development has been suggested to be the key determinant in whether or not the atopic
genotype will be fully expressed and thereby affect the development of allergic diseases.
The determination of characteristics in compositional development of intestinal
microbiota in association with the expression of allergies may provide a starting point
for elucidating which microbial components, if any, may have particular relevance in
immunopathology of allergic diseases.
Studies by Traditional Plate Culture Methods
The first reports associating allergy with characteristic microbial composition in the gut
appear to be from studies in the former Soviet Union in the early 1980s (38-40). One of these
studies, reported also in English, involved an assessment of 60 under one-year-old infants
with food allergy and atopic eczema. It was claimed that the severity of the disease was in
direct correlation with the stage of aberrancy in the fecal microbiota. This aberrancy was
characterized as low prevalence of bifidobacteria and lactobacilli and high prevalence of
Enterobactericeae, pathogenic species of staplylococci and streptococci as well as Candida
species (39). Indication that such differences may persist beyond infancy was provided a
few years later by Ionescu and co-workers (1986) who studied 10- to 45-year-old subjects.
Subjects with atopic eczema (n = 58) were shown to have lower prevalence of lactobacilli,
bifidobacteria, and enterococci species than the healthy subjects (n = 21) but higher
prevalence of Klebsiellae, Proteus, Staphylococcus aureus, Clostridium innocuum and
Candida species (41,42). Supporting findings were later published by this group from a
comparison of the fecal microbiota of 30 healthy subjects and 110 subjects with atopic
eczema (43).
Although these early studies have not received wider acknowledgment in the
scientific community, they are well in agreement with later studies that began to accumulate
a decade later. In one study Klebsiellae species were again found more frequently in the
feces of 6-month-old infants with atopic eczema (n = 27) and the presence of Streptococcus
species was less frequent than in the healthy controls (n=10) (44). Collectively, the
predominant anaerobic and facultatively anaerobic microbiota of allergic infants has been
characterized by significantly lower prevalence of gram-positive species. In a study by
Bjorksten and co-workers (1999), colonization by lactobacilli was shown to be less common
in both Estonian and Swedish two-year-old children with food allergies (n = 27) than in the
age compatible healthy children (n = 36), whilst the opposite was true for coliforms and
192 Kirjavainen and Reid
S. aureus (45). In addition, their results indicated that Bacteroides comprised a larger
proportion of the whole microbiota in healthy compared to allergic infants. They later
studied the development of microbiota in a prospective follow-up. Surprisingly, lactobacilli
were significantly more frequently present during the neonatal period in the feces of infants
who at 2 years had atopic eczema and/or positive skin prick test (n = 18) than in the feces of
infants who remained symptom free and had negative skin prick test (n = 26) (46). The rest
of the characteristics that were associated with allergy were in concordance with the
previous studies with less frequent presence of bifidobacteria and enterococci during
the neonatal period. Later in the first year of life, a relatively high prevalence of S. aureus
and numbers of Clostridia and relatively low numbers of Bacteroides were associated with
allergic eczema (46). The putative differences in the bifidobacterial microbiota were studied
at species level by Ouwehand and co-workers (2001) and they found that the feces of 2 to
7-month-old infants with atopic eczema (n = 7) contained more frequently B. adolescentis
and less frequently B. bifidum than the feces of healthy infants (n = 6) (47).
Studies by Molecular Methods
Results obtained by molecular-based culture-independent techniques are largely supportive
of the findings presented above. In another prospective follow-up, the fecal microbiota in
Finnish neonates was studied prior to the expression of atopy as detected by a positive skin
prick test at year one (n= 12). The microbiota of these sensitized children tended to contain
lower numbers of bifidobacteria and significantly higher numbers of Clostridium
histolyticum than those in samples from infants with a negative prick test (n= 17) (48).
The Clostridium species detectable with the oligonucleotide-probe used in that study
include common infant gut colonizers such as C paraputrificum, C butyricum and
C perfringens but not C difficile. However, another study indicated that relatively high
fecal levels of rarely detected i-caproic acid indicative of C. difficile activity was associated
with presence of IgE mediated allergic condition in Swedish infants at around one year of
age (49). The association between low numbers of fecal bifidobacteria and subsequent
allergic sensitization was confirmed in a study showing that neonatal bifidobacteria
numbers were significantly lower in children who had food allergen- specific IgE antibodies
in their serum at 2 years (n = 10) than in those who did not have the antibodies (n = 16) (50).
In addition, the numbers of bifidobacteria present during the neonatal period correlated
inversely with total IgE concentration at 2 years (n = 25). In accordance with the association
suggested by the earlier studies between the high prevalence of coliforms and allergy,
another study showed a direct correlation between the fecal numbers of Escherichia coli and
total IgE concentration in infants with early onset atopic eczema at mean age of 5 months
(n=19) (18). Furthermore, at weaning around 1 year of age total bacterial cell counts
correlated inversely with the severity of eczema as indicated by severity Scoring Atopic
Dermatitis (SCORAD) scores (44).
Somewhat contrasting results to those presented by plate culture methods have also
been reported. In a study of 6-month-old exclusively breast-fed infants the mean
bifidobacterial numbers were not found to be lower in the feces of infants with early onset
atopic eczema (n=15) compared to controls (n=10), with the exception of a small
subgroup of allergic infants (n = 5) that additionally had gastrointestinal symptoms.
Moreover, as opposed to studies by Bjorksten and co-workers, Bacteroides numbers were
higher in a subgroup of allergic infants (n = 6) who were later confirmed to have cow milk
allergy by challenge (44). Bacteroides numbers were also associated with cow milk allergy
in a later study where the high counts correlated directly with serum total IgE concentration
in a subgroup of infants intolerant to extensively hydrolyzed whey formula (n = 7) (18).
The Infant Intestinal Microbiota in Allergy
193
During weaning, the numbers of Clostridium histolyticum correlated inversely with the
severity of atopic eczema as indicated by SCORAD scores whereas lactobacilli/
enterococci numbers correlated directly with the serum total IgE levels (44). It is worthy
of note that although high total IgE concentration represents phenotypic characteristics
associated with an atopic background, unlike allergen-specific IgE antibodies, the
immunopathophysiological significance of total IgE is questionable (51).
Common Trends and Contradictions
The microbial characteristics of infants presented above are summarized in Figure 1.
Although some variability exists depending upon the study, there are relatively clear
trends evident. The most consistent trends associated with allergy are low numbers of
bifidobacteria and high numbers of S. aureus and certain species of coliforms and
Clostridia. It should be pointed out that there are several aspects of these studies that
complicate their interpretation. A fundamental downfall is the evaluation of intestinal
microbiota by use of the feces, which may only be indicative of the composition of the
microbial community in the lower bowel (52,53). Notably, it has been shown that
the proportional quantities of specific strains in the colonic mucosa may differ from those
in the feces (54). Moreover, the studies on fecal microbiota reveal little with respect to the
composition of the small intestine, which immunologically may be more relevant than
the large intestine. Another significant deficiency in these studies is the lack of more
detailed characterization, especially at the species and strain level. It is well known that
bacterial properties, including their immunological effects, vary between bacterial species
Aerobes in total
Coliforms
Staph, aureus
Clostridia
Bacteroides
Lactobacilli
Enterococci
Bifidobacteria
Gram + aerobes
Anaerobes in total 4
< X X X >
X X X X
X X X X >
X X X X
X X X X >
a
K"^K"^K*^K*^HT^K*^K*^K"^^n X X X X
^KjIQK^ x x x x
X X X X >
X X X X
X X X X >
X X X X
x y y v •>
a,b 1 ,c\f
X X X X
C X X X X
X X X X
t X X X X
X X X X
x x x x
X X X X >
X X X X
X X X X >
X X X X
a,d
X X X x~
X X X X )
X X X X
x x x x >
X X X X
X X X X 1
"X X X X
X X X X
X X X X
X X X X
X X X X
b 2 ,d,e 2
^tf X X X X
3 x x x x
VI x x x x
31 x x x x
3H X X X x
a,c
X X X X >
X X X X
X X X X >
X X X X
V V V V ^
X X X X
< X X X X
X X X X
< X X X X
V V V V
a,b 3 ,d,f
x x x j^
x x x/
x >-^
X \jr
< X X X X
X X X X
< X X X X
X X X X
< X X X X
b 3 ,d
a,d,e,f,g
b
a,b
AGE 1 st wk 1
12
24 REF.
months
Potentially allergy
preventing bacteria
Potentially allergy
promoting bacteria
Low numbers/frequency associated with allergic disease
Low numbers/frequency associated with allergic disease & allergic sensitisation
High numbers associated with allergic sensitisation/high total IgE cone.
High numbers/frequency associated with allergic disease
High numbers/frequency associated with allergic disease and high total IgE cone.
No characteristics determined/detected
Figure 1 Map of bacterial characteristics in infant microbiota during the first 2 years of life relative
to development and presence of allergic disease and IgE antibodies and total IgE concentrations.
Klebsiellae in ref. "a", E. coli in ref. "c", Clostridium histolyticum, lactobacilli and enterococci
enumerated together, 4 Includes results from total microbial cell counts. Abbreviation: IgE,
Immunoglobulin E. Source: a, From Ref. 45; b, From Ref. 44; c, From Ref. 18; d, From Ref. 46; e,
From Ref. 48; f, From Ref. 39; g, From Ref. 50.
194 Kirjavainen and Reid
and strains of the same species (55,56). Many of the apparent contradictions in the results
may therefore reflect the fact that different species or strains within the same genera may
have dramatically different effects on allergies. Having said that, they could be the result of
different study protocols, methodologies, and particularly differences in the study
populations and their nutritional and therapeutic management. Clearly defined study
populations are particularly important in studies of allergies. This applies even within
allergic diseases such as atopic eczema, which rather than a single disease is an
aggregation of several conditions which have certain clinical characteristics in common
(57). It is difficult to state that specific microbial patterns can be generalized to be common
in all allergic conditions, in part because the microbiota composition remains to be fully
elucidated in all the mucosal compartments, and as human genomic and environmental
exposures differ between individuals. In all the studies reported to date, the composition of
infant intestinal microbiota has been assessed in relation to development of atopic eczema,
food allergy or signs of allergic sensitization. This is an obvious shortcoming, albeit
understandable, as these are nearly exclusive manifestations of allergy in childhood.
INTERPRETING THE GUT MICROBIOTA CHARACTERISTICS
The reason for the compositional differences in the average microbiota of allergic and
healthy infants is not yet known. Undisputable conclusions regarding causal relationship
cannot be drawn based on mere characterization of microbial composition relative to
clinical sings and symptoms. In a few studies, characteristics of the fecal microbiota have
been shown to precede the beginning of the expression of atopy, implying that these
differences are not necessarily secondary to the disease. However, these, and other studies
have not taken into account changes that occur in the development of the gut mucosa as
these likely influence which microbes colonize and how these influence clinical signs
of allergy.
Theoretically, there are a number of plausible causes for microbial compositional
differences seen to date; these are listed in Table 1. Many of these factors are intertwined.
Some plausible ways by which desirable microbes may protect the host from allergic
sensitization and alleviate symptoms are presented in Figure 2.
Reflection of Atopic Genotype
Incomplete knowledge of the genetic characteristics of allergic diseases restricts the full
understanding of their possible influence on the development of gut microbiota (58).
Theoretically, microbial colonization could be directly affected for example if the atopic
genotype was associated with receptor expression on epithelial cells or production of
intestinal mucus. There is some indication that the atopic genotype is associated with
Table 1 Possible Causes for Microbial Compositional Differences in Atopic versus
Healthy Children
Atopic genotype related defects in the host's ability to interact with bacteria
The role of microbial stimulus in the normal maturation of the immune system away from allergic
type responsiveness
The influence of allergic symptoms and consequent inflammation on microbial colonization
The effects microbes have on allergen processing and uptake, for example, by inducing gut
inflammation
Environmental factors that affect the expression of atopy in parallel with the microbiota or via the
microbiota
The Infant Intestinal Microbiota in Allergy
195
Gut barrier
NO
SENSITIZATION/
ALLERGIC
INFLAMMATION
SENSITIZATION/
ALLERGIC
INFLAMMATION
XXXXXXxxXxx
XXXXXXXXXXX)*
XXXXXXXXXXX
Figure 2 Mechanisms by which specific components of intestinal microbiota may protect from
allergic sensitization and/or alleviate symptoms. "Adequate" microbial composition may reduce
allergen uptake by providing maturational stimulus for gut barrier function, enhancing allergen
degradation by production of digestive enzymes (this may also reduce allergen allergenicity), improving
mucosal integrity by direct exclusion of pathogens that may cause epithelial damage or by enhancing
secretory IgA (slgA) production (possibly via inducing TGF-fi secretion) and by inducing secretion of
anti-inflammatory cytokines, which may break a vicious circle where inflammation increases gut
permeability allowing invasion of pathogens and allergens, which then results in further inflammation.
Danger signals caused by epithelial damage and inflammation promote the maturation of dendritic cells,
which influence the differentiation of naive Th cells. Presentation of allergen in absence of danger signals
may promote formation of regulatory T cells (Treg) and thus formation of tolerance to the allergen. The
fate of Th cells in the presence of danger signals depends on additional stimulus: presence of TGF-&
(produced, e.g., by epithelial cells) may promote development of Treg population and again tolerance to
the allergen, presence of IL-12 andlFN-y (produced, e.g., by macrophages or dendritic cells) promotes
development of Thl population and non-allergic type immune responses, whereas presence of IL-10
may promote formation of allergen specific Th2 cells. In the symptomatic phase induction of anti-
inflammatory cytokines may also directly alleviate the allergic inflammation by active suppression.
Abbreviations: slgA, secretory IgA; M, M-cell; iDC, immature dendritic cell; mDC, mature dendritic
cell; IL, interleukin; TGF, transforming growth factor; Th, T-helper; Treg, regulatory T-cell; M<I>,
macrophage.
immunological deviancies that could result in impaired recognition of specific bacterial
groups and thus allow them to flourish. These defects include compromised expression of
Toll-like receptor (TLR) 4 and its soluble co-receptor CD 14 (sCD14), albeit the results
regarding sCD14 are conflicting (59-64). However, also low breast-milk levels of sCD14
have been associated with subsequent development of eczema in children irrespective of
atopy (65). TLR4 and sCD14 are pattern recognition receptors of innate immune systems
that are important in detection of components in both Gram-positive and Gram-negative
bacteria but especially the cell-wall lipopolysaccharides (LPS) in the latter (66,67).
Notably, CD14-independent recognition of LPS would seem to be defective during the
neonatal period (68). Compromised recognition may facilitate colonization by bacteria
196 Kirjavainen and Reid
which would otherwise be cleared or reduced in numbers due to immune responses mounted
against them. This could partly explain why relatively a high prevalence and numbers of
potentially pathogenic Gram-negative bacteria but low numbers of Gram-positive bacteria
appear to accompany atopic eczema and high levels of IgE (18,39,42-45,50).
From another perspective, microbial compositional differences may reflect their
influence on allergic sensitization and disease development. If the recognition of gut
colonizers is compromised, then so may be the interactions that drive the normal
immunological maturation (10,32,60,69,70). Recognition of peptidoglycan, a major
component of Gram-positive cell- wall, is less dependent on CD 14 and TLR4 but rather on
co-operation between TLRs 2 and 6 (71-73). Thereby, an atopic host, with deficient TLR4
and CD 14 recognition, may have better chances to interact with Gram-positive than Gram-
negative bacteria. This interaction may, on one hand, limit the ability of Gram-positive
bacteria to colonize the gut, but on the other, provide maturational stimulus for the
developing immune system (44,69).
Whereas the recognition of one specific bacterial component occurs primarily via one
or two different pattern recognition receptors, the recognition of whole bacterium is likely to
involve a set of different receptors such as TLR9 recognizing unmethylated bacterial CpG
DNA and TLR5 recognizing flagella (74). Accordingly, a quantitatively strong enough
exposure may compensate the poor recognition of Gram-negative bacteria, especially due to
ligation of TLR9. This would be in agreement with the observation that postnatal
administration of exogenous Gram-negative bacteria, namely non-enteropathogenic E. coli
strain, was associated with reduced risk of developing allergic diseases later in life (14,15).
Reflection of Effects on Th1, Th2, and Treg Differentiation
The effects of intestinal bacteria on cytokine production, epithelia-damaging action or
proinflammatory action may have a major influence on naive T-cell differentiation to Thl,
Th2 or Treg cells (Fig. 2). A study in mice with compromised Toll-mediated signaling
capacity indicated that antigen specific Thl responses to food allergens are dependent on
simultaneously induced Toll-mediated activities, whilst similar dependency was not
observed in Th2 responses. Re-exposing the mice to the allergen enhanced the production
of IL-13 by T-cells, a cytokine capable of inducing isotype class-switching of B-cells to
produce IgE (75).
Th differentiation is directed by dendritic cells, which monitor the antigenic
environment and presence of danger signals in the gut. Danger signals may include
epithelial damage and inflammation. In the absence of maturational/inflammatory stimuli,
dendritic cells aim to tolerize the immune system to what they assume to be harmless
antigens. It is noteworthy that the immunological stimulus initiated may vary depending on
which TLR or combination of TLRs are ligated (76). This may provide a mechanistic basis
for consistent data from in vitro studies, which indicate that cytokine responses mounted by
mononuclear cells in response to whole Gram-negative and whole Gram-positive bacteria
are different. The induction of IL-12 is greater for Gram-positive bacteria and IL-10 for
Gram-negative bacteria (77-79). IL-12 is produced by dendritic cells and macrophages and
is a key cytokine promoting the Th cell differentiation into Thl cells. IL-10 may contribute
in maintaining a Th2 bias, but it may also induce tolerance by promoting the formation of
Tregs and anergic T-cells (80-82).
In a study by He and co-workers (2002) bifidobacteria isolated from the feces of
allergic infants tended to induce murine macrophage-like cells to produce more of IL-12,
but less IL-10 than bifidobacteria from the feces of healthy infants (83). In their earlier,
aforementioned, study B. adolescentis was associated with allergic and B. bifidum with
The Infant Intestinal Microbiota in Allergy 197
healthy infants (47). Accordingly, in a recent study, Young and co-workers showed that
B. bifidum enhanced IL-10 production by dendritic cells isolated from cord blood (84).
However, B. adolescentis, or any other bifidobacteria! strain, did not induce IL-12
production. Moderate differences were observed in the effects of bifidobacterial strains on
the expression of dendritic cell activation markers. The basis for speculation on the possible
significance of these findings is weak until more detailed characterization is performed.
Arguably, the findings could collectively indicate that bifidobacteria in allergic infants may
promote formation of tolerogenic responses but this remains to be confirmed (Fig. 2).
Also Lactobacillus strains have been shown to confer differential effects on cytokine
production and expression of surface markers on murine dendritic cells (85). Furthermore,
lactobacilli induced in vitro, in a strain dependent manner, Treg-like low proliferating Th
population producing TGF-P and IL-10 (86). TGF-P is the key cytokine in induction of
T-cell differentiation towards Tregs (Fig. 2) (87). In a clinical study, improvement in
atopic eczema symptoms following oral administration of lactobacilli was accompanied
by increased serum concentrations of TGF-P (17). Interestingly, oral supplementation of
lactobacilli in breast-feeding mothers was followed by increased TGF-P concentrations in
breast-milk (88). This increase may have contributed to subsequently lower prevalence of
atopic eczema in children. It should be noted, however, that allergic sensitization was not
affected and allergic rhinitis and asthma may have increased in frequency (89).
Nevertheless, these studies are not only indicative of the influence of infant microbiota
on allergy development but also of the possible influence of maternal microbiota during
pregnancy and via breast-milk.
Reflection of Effects on Allergen Uptake, Processing, and Presentation
The original hygiene hypothesis implicated pathogens in an allergy-preventing role.
However, their role may be two-sided (90). Whereas the host immune system may become
tolerant towards commensal microbes, this should and will not happen with pathogens
(91,92). Therefore, pathogens may have a greater potential to stimulate the neonatal
immunity away from the allergic type responsiveness than the commensal microbes
towards which tolerance has been formed (90). Conversely, potential pathogens may
induce and sustain inflammation and compromise the gut barrier (18,93). This may allow
greater numbers of allergens to pass the barrier and alter their presentation to lymphocytes
due to the presence of danger signals. Consequently, allergic sensitization may be more
likely to occur, and may be aggravated in already sensitized subjects with allergic disease
(94-96). E. coli and Bacteroides bacterial groups colonizing these subjects may include
strains with such detrimental properties (97-100). Such bacteria were implicated with
higher serum total IgE concentrations and sensitivity to cow's milk proteins in studies
referred to above (18,44). Some non-pathogenic bacteria, such as lactobacilli and
bifidobacteria, may have the opposite effects by reducing gut inflammation either via
excluding colonization by pathogens or inducing secretion of anti-inflammatory
cytokines, reducing gut permeability, allergen antigenicity, and fortifying gut defense
barrier e.g., by stimulating IgA production (101-110). Intestinal microbes are likely to
affect the allergen uptake also by promoting the maturation and integrity of gut barrier but
there is little information on how this ability may vary between different bacteria (111).
Reflection of Allergic Symptoms
The possibility that allergic symptoms either affect, or are affected by, the microbiota is
supported by an observation that alleviation in atopic eczema and allergic inflammation
198 Kirjavainen and Reid
following oral administration of bifidobacteria was accompanied by modified dynamics in
the microbiota (i.e., restriction in the growth of E. coli and Bacteroides) (18). Also, earlier
findings attest to this possibility implicating direct correlation between numbers of
Enterobacteriaceae family bacteria and severity of atopic eczema symptoms (39). The
compositional characteristics associated with the severity of symptoms may be caused by
intestinal inflammation exacerbated in some allergic conditions (95,112-115).
Reflection of Environmental Factors
Amongst the best examples of factors which have been clearly shown to influence the
development of the gut microbiota and have also been implicated in allergic diseases
include the mode of delivery and breast-feeding (1 16-123). Indeed, it is plausible that the
characteristics of fecal microbiota associated with atopic eczema and allergic sensitization
may partly reflect dietary factors. It is well known that changes in diet may dramatically
affect the microbial composition of the gut. Then again, in allergic infants the diet can reflect
the child's health status due to food restrictions. In 39-63% of all infants and young
children, atopic eczema is triggered by one or more challenge-confirmed food allergies
(124-126). Moreover, the development of manifestations of allergic diseases in children
correlates with differences in the composition and immunological characteristics of breast-
milk, which on the other hand are affected by maternal gut microbiota and atopy ( 1 27-1 33).
For example, the polyunsaturated fatty acid composition in breast-milk has been shown to
correlate with the development of allergic disease in children (131,132). In vitro these
compounds have been shown to selectively affect microbial growth and adhesion to
intestinal cells (134). Recently, lactobacilli in breast-milk were shown to have properties
in vitro that could promote the development and maintenance of gut barrier in neonates, thus
warranting further studies on this area (135). Albeit the effect of caesarean delivery in
promoting allergy is disputable, it is notable that colonization by Lactobacillus- and
Bifidobacterium-like bacteria, the high numbers of which have mainly been associated with
non-allergic phenotype, may be delayed for up to 10 days and 1 month, respectively, as
compared to vaginally delivered infants (136).
Regarding our earlier discussion on pathogens and E. coli, it is noteworthy that in
developing countries with low prevalence of allergies, the establishment of intestinal
microbiota is characterized by rapid initial colonization, formation of enterobacterial
microbiota predominated by E. coli, and frequent colonization by pathogens such as
salmonellae. The E. coli population is characterized by a wide spectrum of strains and
instability (137,138). Whether such rapid colonization and strongly variable exposure has
special influence on immunological maturation and gut barrier formation and maintenance
remain to be established.
CONCLUSION
It has been well established that allergic sensitization and the development of allergic
disease are associated, at least in some infants, with characteristic developmental patterns
in fecal microbiota composition that are atypical to healthy infants. With relative
consistency these characteristics include low numbers of bifidobacteria and anaerobes in
total and high numbers of Clostridia, S. aureus and certain coliforms such as Klebsiellae.
Data on lactobacilli, Bacteroides and E. coli are somewhat variable. How this aberrancy in
fecal microbiota depicts the situation in the intestine and how it is clinically significant,
remains to be known. The possibility that the characteristics are secondary to the disease
The Infant Intestinal Microbiota in Allergy 199
cannot be excluded, but it is also feasible that they reflect their significance in the aetiology
of allergy. Extensive experimental data implies that the development of atopic type
immunoreactivity could be promoted by the establishment of an early gut microbiota that
(1) is incapable of directing the immune system towards tolerogenic responses to, what
should be, harmless environmental antigens and/or (2) induces inflammatory responses
against itself, thereby increasing mucosal permeability to potential allergens.
It has been convincingly demonstrated that microbial exposure is likely to be the
primary exogenous stimulus directing the immunological maturation away from allergic
type immunoresponsiveness early in life. However, it is still not clear what are the
qualitative or quantitative characteristics of the indigenous microbiota or other sources of
microbial exposure that could protect from, or conversely promote ("allow"), the
expression of allergies. Future studies should assess whether specific microbial species
have particular importance in this respect or whether the "adequate" stimulus is only a
matter of quantitatively high enough exposure or strongly variable exposure. More efforts
should be directed to characterizing microbial composition of nasal and oral cavities and
different compartments in the intestinal tract of children as well as the gut of pregnant
women and the gut and breast-milk of breast-feeding mothers.
ACKNOWLEDGMENTS
Pirkka Kirjavainen gratefully acknowledges financial support from the Academy
of Finland.
REFERENCES
1. Arruda LK, Sole D, Baena-Cagnani CE, Naspitz CK. Risk factors for asthma and atopy. Curr
Opin Allergy Clin Immunol 2005; 5:153-159.
2. Steinke JW, Borish L, Rosenwasser LJ 5. Genetics of hypersensitivity. J Allergy Clin
Immunol 2003; 111:S495-S501.
3. von Mutius E. Influences in allergy: epidemiology and the environment. J Allergy Clin
Immunol 2004; 113:373-379; quiz 380.
4. von Mutius E. The environmental predictors of allergic disease. J Allergy Clin Immunol 2000;
105:9-19.
5. O'Connell EJ. Pediatric allergy: a brief review of risk factors associated with developing
allergic disease in childhood. Ann Allergy Asthma Immunol 2003; 90:53-58.
6. Strachan DP. Hay fever, hygiene, and household size. BMJ 1989; 299:1259-1260.
7. Noverr MC, Huffnagle GB. Does the microbiota regulate immune responses outside the gut?
Trends Microbiol 2004; 12:562-568.
8. Moreau MC, Corthier G. Effect of the gastrointestinal microflora on induction and
maintenance of oral tolerance to ovalbumin in C3H/HeJ mice. Infect Immun 1988;
56:2766-2768.
9. Moreau MC, Gaboriau-Routhiau V. The absence of gut flora, the doses of antigen ingested
and aging affect the long-term peripheral tolerance induced by ovalbumin feeding in mice.
Res Immunol 1996; 147:49-59.
10. Sudo N, Sawamura S, Tanaka K, Aiba Y, Kubo C, Koga Y. The requirement of intestinal
bacterial flora for the development of an IgE production system fully susceptible to oral
tolerance induction. J Immunol 1997; 159:1739-1745.
11. Gaboriau-Routhiau V, Moreau MC. Gut flora allows recovery of oral tolerance to ovalbumin
in mice after transient breakdown mediated by cholera toxin or Escherichia coli heat-labile
enterotoxin. Pediatr Res 1996; 39:625-629.
200 Kirjavainen and Reid
12. Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science 2001;
292:1115-1118.
13. Kalliomaki M, Salminen S, Arvilommi H, Kero P, Koskinen P, Isolauri E. Probiotics in
primary prevention of atopic disease: a randomised placebo-controlled trial. Lancet 2001;
357:1076-1079.
14. Lodinova- Zadnikova R, Cukrowska B. Influence of oral colonization of the intestine with a
non-enteropathogenic E. coli strain after birth on the frequency of infectious and allergic
diseases after 10 and 20 years. Immunol Lett 1999; 69:64.
15. Lodinova-Zadnikova R, Cukrowska B, Tlaskalova-Hogenova H. Oral administration of
probiotic Escherichia coli after birth reduces frequency of allergies and repeated infections
later in life (after 10 and 20 years). Int Arch Allergy Immunol 2003; 131:209-211.
16. Majamaa H, Isolauri E. Probiotics: a novel approach in the management of food allergy.
J Allergy Clin Immunol 1997; 99:179-185.
17. Isolauri E, Arvola T, Sutas Y, Moilanen E, Salminen S. Probiotics in the management of
atopic eczema. Clin Exp Allergy 2000; 30:1604-1610.
18. Kirjavainen PV, Arvola T, Salminen SJ, Isolauri E. Aberrant composition of gut microbiota of
allergic infants: a target of bifidobacteria! therapy at weaning? Gut 2002; 51:51-55.
19. Celedon JC, Weiss ST. Use of antibacterials in infancy: clinical implications for childhood
asthma and allergies. Treat Respir Med 2004; 3:291-294.
20. Voor T, Julge K, Bottcher MF, Jenmalm MC, Duchen K, Bjorksten B. Atopic sensitization
and atopic dermatitis in estonian and Swedish infants. Clin Exp Allergy 2005; 35:153-159.
21 . Johansson SG, Bieber T, Dahl R, et al. Revised nomenclature for allergy for global use: report
of the nomenclature review committee of the world allergy organization, October 2003.
J Allergy Clin Immunol 2004; 113:832-836.
22. O'Connell EJ. The burden of atopy and asthma in children. Allergy 2004; 78:7-11.
23. Blaiss MS. Important aspects in management of allergic rhinitis: compliance, cost, and quality
of life. Allergy Asthma Proc 2003; 24:231-238.
24. Cisternas M, Blanc P, Yen I, et al. A comprehensive study of the direct and indirect costs of
adult asthma. J Allergy Clin Immunol 2003; 111:1212-1218.
25. Jarvis D, Burney P. ABC of allergies. The epidemiology of allergic disease. BMJ 1998;
316:607-610.
26. Wickman M, Lilja G. Today, one child in four has an ongoing allergic disease in Europe.
What will the situation be tomorrow? Allergy 2003; 58:570-571.
27. Johansson SG, Hourihane JO, Bousquet J, et al. A revised nomenclature for allergy. An
EAACI position statement from the EAACI nomenclature task force. Allergy 2001;
56:813-824.
28. Kay AB. Allergy and allergic diseases. First of two parts. N Engl J Med 2001; 344:30-37.
29. Ebner C, Schenk S, Najafian N, et al. Nonallergic individuals recognize the same T cell
epitopes of Bet v 1, the major birch pollen allergen, as atopic patients. J Immunol 1995;
154:1932-1940.
30. Prescott SL. Allergy: when does it begin and where will it end?. Allergy 2003; 58:864-867.
3 1 . Prescott SL, Macaubas C, Holt BJ, et al. Transplacental priming of the human immune system
to environmental allergens: universal skewing of initial T cell responses toward the Th2
cytokine profile. J Immunol 1998; 160:4730-4737.
32. Prescott SL, Macaubas C, Smallacombe T, Holt BJ, Sly PD, Holt PG. Development of
allergen-specific T-cell memory in atopic and normal children. Lancet 1999; 353:196-200.
33. Robinson DS, Larche M, Durham SR. Tregs and allergic disease. J Clin Invest 2004;
114:1389-1397.
34. Nakamura K, Kitani A, Fuss I, et al. TGF-beta 1 plays an important role in the mechanism of
CD4 + CD25+ regulatory T cell activity in both humans and mice. J Immunol 2004;
172:834-842.
35. Nakamura K, Kitani A, Strober W. Cell contact-dependent immunosuppression by
CD4( + )CD25( + ) regulatory T cells is mediated by cell surface-bound transforming
growth factor beta. J Exp Med 2001; 194:629-644.
The Infant Intestinal Microbiota in Allergy 201
36. Ling EM, Smith T, Nguyen XD, et al. Relation of CD4 + CD25 + regulatory T-cell
suppression of allergen-driven T-cell activation to atopic status and expression of allergic
disease. Lancet 2004; 363:608-615.
37. Akdis M, Verhagen J, Taylor A, et al. Immune responses in healthy and allergic individuals
are characterized by a fine balance between allergen-specific T regulatory 1 and T helper 2
cells. J Exp Med 2004; 199:1567-1575.
38. Kuvaeva IB, Zakharova NV, Orlova NG, Veselova OL. Functional state of the immunological
system and of the gastrointestinal tract in children with a food allergy. Vopr Pitan
1980;33-40.
39. Kuvaeva IB, Orlova NG, Veselova OL, Kuznezova GG, Borovik TE. Microecology of the
gastrointestinal tract and the immunological status under food allergy. Nahrung 1984;
28:689-693.
40. Shaternikov VA, Kuvaeva ID, Ladodo KS, Orlova NG, Veselova OL. General and local
humoral immunity and intestinal microflora in children with skin manifestations of food
allergy. Vopr Pitan 1982;51-56.
41. Ionescu G, Radovicic D, Schuler R, et al. Changes in fecal microflora and malabsorption
phenomena suggesting a contaminated small bowel syndrome in atopic eczema patients.
Microecol Ther 1986; 16:273.
42. Ionescu G, Kiehl R, Ona L, Schuler R. Abnormal fecal microflora and malabsorption
phenomena in atopic eczema paitents. J Adv Med 1990; 3:71-91.
43. Ionescu G, Kiehl R, Wichmann-Kunz F, Leimbeck R. Immunobiological significance of
fungal and bacterial infections in atopic eczema. J Adv Med 1990; 3:47-58.
44. Kirjavainen PV, Apostolou E, Arvola T, Salminen SJ, Gibson GR, Isolauri E. Characterizing
the composition of intestinal microflora as a prospective treatment target in infant allergic
disease. FEMS Immunol Med Microbiol 2001; 32:1-7.
45. Bjorksten B, Naaber P, Sepp E, Mikelsaar M. The intestinal microflora in allergic estonian
and Swedish 2-year-old children. Clin Exp Allergy 1999; 29:342-346.
46. Bjorksten B, Sepp E, Julge K, Voor T, Mikelsaar M. Allergy development and the intestinal
microflora during the first year of life. J Allergy Clin Immunol 2001; 108:516-520.
47. Ouwehand AC, Isolauri E, He F, Hashimoto H, Benno Y, Salminen S. Differences in
Bifidobacterium flora composition in allergic and healthy infants. J Allergy Clin Immunol
2001; 108:144-145.
48. Kalliomaki M, Kirjavainen P, Eerola E, Kero P, Salminen S, Isolauri E. Distinct patterns of
neonatal gut microflora in infants in whom atopy was and was not developing. J Allergy Clin
Immunol 2001; 107:129-134.
49. Bottcher MF, Nordin EK, Sandin A, Midtvedt T, Bjorksten B. Microflora-associated
characteristics in faeces from allergic and nonallergic infants. Clin Exp Allergy 2000;
30:1590-1596.
50. Kirjavainen P. The Intestinal Microbiota — A Target for Treatment in Infant Atopic
Eczema, in Department of Biochemistry and Food Chemistry. Turku: University of
Turku, 2003: 79.
51. Howard TD, Meyers DA, Bleecker ER. Mapping susceptibility genes for allergic diseases.
Chest 2003; 123:363S-368S.
52. Mikelsaar M, Mandar R, Sepp E. Lactic acid microflora in the human microbial ecosystem
and its development. In: Salminen S, Von Wright A, eds. Lactic Acid Bacteria: Microecology
and Functional Aspects. New York: Marcel Dekker Inc., 1998:278-342.
53. Marteau P, Pochart P, Dore J, Bera-Maillet C, Bernalier A, Corthier G. Comparative study of
bacterial groups within the human cecal and fecal microbiota. Appl Environ Microbiol 2001;
67:4939-4942.
54. Zoetendal EG, von Wright A, Vilpponen-Salmela T, Ben-Amor K, Akkermans AD, de
Vos WM. Mucosa-associated bacteria in the human gastrointestinal tract are uniformly
distributed along the colon and differ from the community recovered from feces. Appl
Environ Microbiol 2002; 68:3401-3407.
202 Kirjavainen and Reid
55. Kirjavainen PV, EINezami HS, Salminen SJ, Ahokas JT, Wright PF. Effects of orally
administered viable Lactobacillus rhamnosus GG and Propionibacterium freudenreichii
subsp. shermanii JS on mouse lymphocyte proliferation. Clin Diagn Lab Immunol 1999;
6:799-802.
56. Kirjavainen PV, El-Nezami HS, Salminen SJ, Ahokas JT, Wright PF. The effect of orally
administered viable probiotic and dairy lactobacilli on mouse lymphocyte proliferation.
FEMS Immunol Med Microbiol 1999; 26:131-135.
57. Wollenberg A, Bieber T. Atopic dermatitis: from the genes to skin lesions. Allergy 2000;
55:205-213.
58. Feijen M, Gerritsen J, Postma DS. Genetics of allergic disease. Br Med Bull 2000;
56:894-907.
59. Koppelman GH, Reijmerink NE, Colin Stine O, et al. Association of a promoter
polymorphism of the CD14 gene and atopy. Am J Respir Crit Care Med 2001; 163:965-969.
60. Baldini M, Lohman IC, Halonen M, Erickson RP, Holt PG, Martinez FD. A Polymorphism*
in the 5 ; flanking region of the CD14 gene is associated with circulating soluble CD14 levels
and with total serum immunoglobulin E. Am J Respir Cell Mol Biol 1999; 20:976-983.
61. Zdolsek HA, Jenmalm MC. Reduced levels of soluble CD 14 in atopic children. Clin Exp
Allergy 2004; 34:532-539.
62. Kabesch M, Hasemann K, Schickinger V, et al. A promoter polymorphism in the CD 14 gene
is associated with elevated levels of soluble CD 14 but not with IgE or atopic diseases. Allergy
2004; 59:520-525.
63. Kedda MA, Lose F, Duffy D, Bell E, Thompson PJ, Upham J. The CD14 C-159T
polymorphism is not associated with asthma or asthma severity in an Australian adult
population. Thorax 2005; 60:211-214.
64. Fageras Bottcher M, Hmani-Aifa M, Lindstrom A, et al. A TLR4 polymorphism is associated
with asthma and reduced lipopolysaccharide-induced interleukin-12(p70) responses in
Swedish children. J Allergy Clin Immunol 2004; 114:561-567.
65. Jones CA, Holloway J A, Popplewell EJ, et al. Reduced soluble CD 14 levels in amniotic fluid
and breast milk are associated with the subsequent development of atopy, eczema, or both.
J Allergy Clin Immunol 2002; 109:858-866.
66. Haziot A, Ferrero E, Kontgen F, et al. Resistance to endotoxin shock and reduced
dissemination of gram-negative bacteria in CD14-deficient mice. Immunity 1996; 4:407-414.
67. Miller SI, Ernst RK, Bader MW. LPS, TLR4 and infectious disease diversity. Nat Rev
Microbiol 2005; 3:36^16.
68. Cohen L, Haziot A, Shen DR, et al. CD14-independent responses to LPS require a serum
factor that is absent from neonates. J Immunol 1995; 155:5337-5342.
69. Kirjavainen PV. Exposure to gram-positive bacteria: the key in natural defence against atopic
sensitisation?. Microecol Ther 2002;109-114.
70. Sudo N, Yu XN, Aiba Y, et al. An oral introduction of intestinal bacteria prevents the
development of a long-term Th2-skewed immunological memory induced by neonatal
antibiotic treatment in mice. Clin Exp Allergy 2002; 32:1112-1116.
71. Ozinsky A, Underhill DM, Fontenot JD, et al. The repertoire for pattern recognition of
pathogens by the innate immune system is defined by cooperation between toll-like receptors.
Proc Natl Acad Sci USA 2000; 97:13766-13771.
72. Ozinsky A, Smith KD, Hume D, Underhill DM. Co-operative induction of pro-inflammatory
signaling by Toll-like receptors. J Endotoxin Res 2000; 6:393-396.
73. Dziarski R, Ulmer AJ, Gupta D. Interactions of CD 14 with components of gram-positive
bacteria. Chem Immunol 2000; 74:83-107.
74. Takeda K, Akira S. Toll-like receptors in innate immunity. Int Immunol 2005; 17:1-14.
75. Schnare M, Barton GM, Holt AC, Takeda K, Akira S, Medzhitov R. Toll-like receptors
control activation of adaptive immune responses. Nat Immunol 2001; 2:947-950.
76. Aderem A, Ulevitch RJ. Toll-like receptors in the induction of the innate immune response.
Nature 2000; 406:782-787.
The Infant Intestinal Microbiota in Allergy 203
77. Cross ML, Ganner A, Teilab D, Fray LM. Patterns of cytokine induction by gram-
positive and gram-negative probiotic bacteria. FEMS Immunol Med Microbiol 2004;
42:173-180.
78. Karlsson H, Hessle C, Rudin A. Innate immune responses of human neonatal cells to bacteria
from the normal gastrointestinal flora. Infect Immun 2002; 70:6688-6696.
79. Hessle C, Andersson B, Wold AE. Gram-positive bacteria are potent inducers of monocytic
interleukin-12 (IL-12) while gram-negative bacteria preferentially stimulate IL-10
production. Infect Immun 2000; 68:3581-3586.
80. Raghupathy R. Pregnancy: success and failure within the Thl/Th2/Th3 paradigm. Semin
Immunol 2001; 13:219-227.
81. Akdis CA, Blaser K. Mechanisms of interleukin-10-mediated immune suppression.
Immunology 2001; 103:131-136.
82. Levings MK, Gregori S, Tresoldi E, Cazzaniga S, Bonini C, Roncarolo MG. Differentiation of
Trl cells by immature dendritic cells requires IL-10 but not CD25 + CD4+ Tr cells. Blood
2005; 105:1162-1169.
83. He F, Morita H, Hashimoto H, et al. Intestinal Bifidobacterium species induce varying
cytokine production. J Allergy Clin Immunol 2002; 109:1035-1036.
84. Young SL, Simon MA, Baird MA, et al. Bifidobacteria! species differentially affect
expression of cell surface markers and cytokines of dendritic cells harvested from cord blood.
Clin Diagn Lab Immunol 2004; 11:686-690.
85. Christensen HR, Frokiaer H, Pestka JJ. Lactobacilli differentially modulate expression of
cytokines and maturation surface markers in murine dendritic cells. J Immunol 2002;
168:171-178.
86. von der Weid T, Bulliard C, Schiffrin EJ. Induction by a lactic acid bacterium of a population
of CD4( + ) T cells with low proliferative capacity that produce transforming growth factor
beta and interleukin-10. Clin Diagn Lab Immunol 2001; 8:695-701.
87. Huber S, Schramm C, Lehr HA, et al. Cutting edge: TGF-beta signaling is required for the
in vivo expansion and immunosuppressive capacity of regulatory CD4 + CD25 + T cells.
J Immunol 2004; 173:6526-6531.
88. Rautava S, Kalliomaki M, Isolauri E. Probiotics during pregnancy and breast-feeding might
confer immunomodulatory protection against atopic disease in the infant. J Allergy Clin
Immunol 2002; 109:119-121.
89. Kalliomaki M, Salminen S, Poussa T, Arvilommi H, Isolauri E. Probiotics and prevention of
atopic disease: 4-year follow-up of a randomised placebo-controlled trial. Lancet 2003;
361:1869-1871.
90. Kirjavainen PV. In: Mattila-Sandholm T, Saarela M, eds. Probiotics and the management of
food allergy, in functional dairy products. Cambridge, U.K.: Woodhead Publishing,
2003:108-131.
91. Neish AS, Gewirtz AT, Zeng H, et al. Prokaryotic regulation of epithelial responses by
inhibition of IkappaB -alpha ubiquitination. Science 2000; 289:1560-1563.
92. Nagler- Anderson C. Man the barrier! Strategic defences in the intestinal mucosa. Nat Rev
Immunol 2001; 1:59-67.
93. Kirjavainen PV, Apostolou E, Salminen SJ, Isolauri E. New aspects of probiotics-a novel
approach in the management of food allergy. Allergy 1999; 54:909-915.
94. Batt RM, Rutgers HC, Sancak AA. Enteric bacteria: friend or foe?. J Small Anim Pract 1996;
37:261-267.
95. Berin MC, Yang PC, Ciok L, Waserman S, Perdue MH. Role for IL-4 in macromolecular
transport across human intestinal epithelium. Am J Physiol 1999; 276:C1046-C1052.
96. Gee JM, Wal JM, Miller K, et al. Effect of saponin on the transmucosal passage of beta-
lactoglobulin across the proximal small intestine of normal and beta-lactoglobulin-sensitised
rats. Toxicology 1997; 117:219-228.
97. Dahlgren UI, Wold AE, Hanson LA, Midtvedt T. Expression of a dietary protein in E. coli
renders it strongly antigenic to gut lymphoid tissue. Immunology 1991; 73:394-397.
204 Kirjavainen and Reid
98. Deitch EA, Specian RD, Berg RD. Endotoxin-induced bacterial translocation and mucosal
permeability: role of xanthine oxidase, complement activation, and macrophage products. Crit
Care Med 1991; 19:785-791.
99. Obiso RJ, Jr., Lyerly DM, Van Tassell RL, Wilkins TD. Proteolytic activity of the Bacteroides
fragilis enterotoxin causes fluid secretion and intestinal damage in vivo. Infect Immun 1995;
63:3820-3826.
100. Duchmann R, Kaiser I, Hermann E, Mayet W, Ewe K, Meyer zum KH. Buschenfelde,
Tolerance exists towards resident intestinal flora but is broken in active inflammatory bowel
disease (IBD). Clin Exp Immunol 1995; 102:448-455.
101 . Moreau MC, Ducluzeau R, Guy-Grand D, Muller MC. Increase in the population of duodenal
immunoglobulin A plasmocytes in axenic mice associated with different living or dead
bacterial strains of intestinal origin. Infect Immun 1978; 21:532-539.
102. De Simone C, Ciardi A, Grassi A, et al. Effect of Bifidobacterium bifidum and Lactobacillus
acidophilus on gut mucosa and peripheral blood B lymphocytes. Immunopharmacol
Immunotoxicol 1992; 14:331-340.
103. Kaila M, Isolauri E, Soppi E, Virtanen E, Laine S, Arvilommi H. Enhancement of the
circulating antibody secreting cell response in human diarrhea by a human Lactobacillus
strain. Pediatr Res 1992; 32:141-144.
104. Yasui H, Nagaoka N, Mike K, Hayakawa K, Ohwaki M. Detection of Bifidobacterium strains
that induce large quantities of IgA. Microb Ecol Health Dis 1992; 5:155-162.
105. Majamaa H, Isolauri E, Saxelin M, Vesikari T. Lactic acid bacteria in the treatment of acute
rotavirus gastroenteritis. J Pediatr Gastroenterol Nutr 1995; 20:333-338.
106. Isolauri E, Majamaa H, Arvola T, Rantala I, Virtanen E, Arvilommi H. Lactobacillus casei
strain GG reverses increased intestinal permeability induced by cow milk in suckling rats.
Gastroenterology 1993; 105:1643-1650.
107. Matsuzaki T, Yamazaki R, Hashimoto S, Yokokura T. The effect of oral feeding of
Lactobacillus casei strain Shirota on immunoglobulin E production in mice. J Dairy Sci 1998;
81:48-53.
108. Siitas Y, Soppi E, Korhonen H, et al. Suppression of lymphocyte proliferation in vitro by
bovine caseins hydrolyzed with Lactobacillus casei GG-derived enzymes. J Allergy Clin
Immunol 1996; 98:216-224.
109. Siitas Y, Hurme M, Isolauri E. Down-regulation of anti-CD3 antibody-induced IL-4
production by bovine caseins hydrolysed with Lactobacillus GG-derived enzymes. Scand
J Immunol 1996; 43:687-689.
110. Pessi T, Isolauri E, Siitas Y, Kankaanranta H, Moilanen E, Hurme M. Suppression of T-cell
activation by Lactobacillus rhamnosus GG-degraded bovine casein. Int Immunopharmacol
2001; 1:211-218.
111. Hooper LV, Falk PG, Gordon JI. Analyzing the molecular foundations of commensalism in
the mouse intestine. Curr Opin Microbiol 2000; 3:79-85.
112. Ogawa H, Yoshiike T. A speculative view of atopic dermatitis: barrier dysfunction in
pathogenesis. J Dermatol Sci 1993; 5:197-204.
113. Majamaa H, Laine S, Miettinen A. Eosinophil protein X and eosinophil cationic protein as
indicators of intestinal inflammation in infants with atopic eczema and food allergy. Clin Exp
Allergy 1999; 29:1502-1506.
114. Majamaa H, Miettinen A, Laine S, Isolauri E. Intestinal inflammation in children with atopic
eczema: faecal eosinophil cationic protein and tumour necrosis factor-alpha as non-invasive
indicators of food allergy. Clin Exp Allergy 1996; 26:181-187.
115. Majamaa H, Aittoniemi J, Miettinen A. Increased concentration of fecal alpha 1 -antitrypsin is
associated with cow's milk allergy in infants with atopic eczema. Clin Exp Allergy 2001;
31:590-592.
116. Xu B, Pekkanen J, Hartikainen AL, Jarvelin MR. Caesarean section and risk of asthma and
allergy in adulthood. J Allergy Clin Immunol 2001; 107:732-733.
117. Kero J, Gissler M, Gronlund MM, et al. Mode of delivery and asthma — is there a connection?.
Pediatr Res 2002; 52:6-11.
The Infant Intestinal Microbiota in Allergy 205
118. Saarinen UM, Kajosaari M, Backman A, Siimes MA. Prolonged breast-feeding as prophylaxis
for atopic disease. Lancet 1979; 2:163-166.
119. Gdalevich M, Mimouni D, Mimouni M. Breast-feeding and the risk of bronchial asthma in
childhood: a systematic review with meta-analysis of prospective studies. J Pediatr 2001;
139:261-266.
120. Gdalevich M, Mimouni D, David M, Mimouni M. Breast-feeding and the onset of atopic
dermatitis in childhood: a systematic review and meta-analysis of prospective studies. J Am
Acad Dermatol 2001; 45:520-527.
121. Schoetzau A, Filipiak-Pittroff B, Franke K, et al. Effect of exclusive breast-feeding and early
solid food avoidance on the incidence of atopic dermatitis in high-risk infants at 1 year of age.
Pediatr Allergy Immunol 2002; 13:234-242.
122. Kull I, Wickman M, Lilja G, Nordvall SL, Pershagen G. Breast feeding and allergic diseases
in infants-a prospective birth cohort study. Arch Dis Child 2002; 87:478^-81.
123. Kirjavainen PV, Gibson GR. Healthy gut microflora and allergy: factors influencing
development of the microbiota. Ann Med 1999; 31:288-292.
124. Sampson HA. The immunopathogenic role of food hypersensitivity in atopic dermatitis. Acta
Derm Venereol Suppl (Stockh) 1992; 176:34-37.
125. Isolauri E, Turjanmaa K. Combined skin prick and patch testing enhances identification of
food allergy in infants with atopic dermatitis. J Allergy Clin Immunol 1996; 97:9-15.
126. Burks AW, James JM, Hiegel A, et al. Atopic dermatitis and food hypersensitivity reactions.
J Pediatr 1998; 132:132-136.
127. Kalliomaki M, Ouwehand A, Arvilommi H, Kero P, Isolauri E. Transforming growth factor-
beta in breast milk: a potential regulator of atopic disease at an early age. J Allergy Clin
Immunol 1999; 104:1251-1257.
128. Jarvinen KM, Laine S, Suomalainen H. Defective tumour necrosis factor- alpha production in
mother's milk is related to cow's milk allergy in suckling infants. Clin Exp Allergy 2000;
30:637-643.
129. Jarvinen KM, Laine ST, Jarvenpaa AL, Suomalainen HK. Does low IgA in human milk
predispose the infant to development of cow's milk allergy? Pediatr Res 2000; 48:457-462.
130. Jarvinen KM, Suomalainen H. Leucocytes in human milk and lymphocyte subsets in cow's
milk-allergic infants. Pediatr Allergy Immunol 2002; 13:243-254.
131. Duchen K, Casas R, Fageras-Bottcher M, Yu G, Bjorksten B. Human milk polyunsaturated
long-chain fatty acids and secretory immunoglobulin A antibodies and early childhood
allergy. Pediatr Allergy Immunol 2000; 11:29-39.
132. Duchen K, Bjorksten B. Polyunsaturated n-3 fatty acids and the development of atopic
disease. Lipids 2001; 36:1033-1042.
133. Thijs C, Houwelingen A, Poorterman I, Mordant A, van den Brandt P. Essential fatty acids in
breast milk of atopic mothers: comparison with non-atopic mothers, and effect of borage oil
supplementation. Eur J Clin Nutr 2000; 54:234-238.
134. Kankaanpaa P, Nurmela K, Erkkila A, et al. Polyunsaturated fatty acids in maternal diet,
breast milk, and serum lipid fatty acids of infants in relation to atopy. Allergy 2001;
56:633-638.
135. Martin R, Olivares M, Marin ML, Fernandez L, Xaus J, Rodriguez JM. Probiotic potential of 3
Lactobacilli strains isolated from breast milk. J Hum Lact 2005; 21:8-17 quiz 18-21, 41.
136. Gronlund MM, Lehtonen OP, Eerola E, Kero P. Fecal microflora in healthy infants born by
different methods of delivery: permanent changes in intestinal flora after cesarean delivery.
J Pediatr Gastroenterol Nutr 1999; 28:19-25.
o
137. Adlerberth I. In: Hanson LA, Yolken RH, eds. Establishment of Normal Intestinal Microflora
in the Newborn Infant., in Probiotics, Other Nutritional Factors, and the Intestinal Flora.
Philadelphia: Vevey/Lippicott-Raven Publishers, 1999.
138. Mata LJ, Urrutia JJ. Intestinal colonization of breastfed children in a rural area of low socio-
economic level. Ann NY Acad Sci 1971; 176:93-109.
11
Probiotics: A Role in Therapy for
Inflammatory Bowel Disease
Barbara Sheil, Jane McCarthy, Liam O'Mahony, and Malik M. Anwar
Alimentary Pharmabiotic Centre, Departments of Medicine and Surgery, Microbiology
National Food Biotechnology Centre, National University of Ireland, Cork, Ireland
Fergus Shanahan
Alimentary Pharmabiotic Centre, Departments of Medicine and Surgery, National
University of Ireland, Cork, Ireland
INTRODUCTION
Hippocrates is credited with saying: "Let food be thy medicine and medicine be thy food"
(1). The term "functional food" includes "any food or food ingredient that may provide a
health benefit beyond the traditional nutrients it contains" (2). Probiotic bacteria are forms
of functional food that are of particular relevance to gastroenterologists, with evidence for
their role in the treatment of infectious and antibiotic-associated diarrhea. Their putative
therapeutic role in inflammatory bowel disease (IBD) is receiving growing interest;
however, it remains unproven. The Noble laureate, Elie Metchnikoff, suggested that
bacteria could be of some benefit to the health of man (3). He suggested that the
consumption of copious amounts of fermented dairy products, which served to introduce
"beneficial" bacteria to the gastrointestinal tract, was responsible for the longevity of
Bulgarian peasants. This marked the birth of probiotics, which are live microorganisms
that, when consumed in an adequate amount, confer a health effect on the host (4).
The last decade has seen a resurgence of interest in probiotic research. This renewal
of interest in enteric (intestinal) microbiota and gut host-microbe interactions has been
generated for a number of reasons. Firstly, the gut contains a complex microbial
community, the composition of which has remained elusive due to limited bacteriological
culturing techniques. Molecular techniques have now been applied to accurately profile
intestinal bacterial groups. Secondly, cross-talk between the gut epithelium and bacteria
has been demonstrated. The mechanisms underlying this interaction, and the role of the
microbiota in the development and function of the gastrointestinal tract needs further
investigation. A breakdown in immune tolerance to enteric microbiota has also been
implicated in the pathogenesis of inflammatory disorders, such as inflammatory bowel
disease. While evidence suggests that inflammatory bowel disease is characterized by an
aggressive immune response to luminal antigens, including members of the commensal
207
208 Sheil et al.
microbiota, the precise role of the luminal microbiota in the pathogenesis of disease has
yet to be elucidated. Finally, there is evidence suggesting a role for probiotic bacteria in
ameliorating inflammatory disease. This has led to the suggestion that probiotics may be
an option in the therapy of inflammatory bowel disease, the rationale being that these
bacteria without proinflammatory potential might alter the intestinal microbiota balance
and modulate the immune response (5-8).
Inflammatory bowel disease encompasses two major diseases, ulcerative colitis
(UC) and Crohn's disease (CD). These two syndromes, while sharing similar features of
gut mucosal inflammation, are distinct entities. Their pathogenesis remains incompletely
understood. Both diseases are commonest in the Western, developed world, with highest
incidence in northern climates (9,10).
Genetic factors are known to play a role in the pathogenesis of inflammatory bowel
disease. This is demonstrated by concordance in monozygous twin studies. Also, 10-25%
of affected patients have a first-degree relative with the disease. However, the incomplete
concordance seen in twin studies (concordance rates are 40-50% for CD and < 10% for
ulcerative colitis) suggests that environmental factors also contribute to the pathogenesis
of the disease. In addition, there has been a marked rise in the frequency of CD in the
developed world in the past fifty years, with a prevalence of approximately 100 per
100,000 population in North America and northern Europe. This rise in incidence in CD
underscores the importance of environmental factors in its etiology. The increase in the
incidence of CD has occurred as countries become more developed and industrialized.
With changes in lifestyle and environment, improving levels of sanitation have altered the
microbial environment. This means altered patterns of exposure to microbes and
infections during childhood (11). Inflammatory bowel disease may be a disorder of
mucosal immune responsiveness due to lack of stimulation and education of the immune
responses (12). It is interesting that parallel to an increase in CD, other chronic
inflammatory disorders, including allergies, asthma, multiple sclerosis and insulin-
dependent diabetes mellitus have also increased in incidence. Environmental changes
associated with industrialization may alter immune system development and pose a risk
factor for inflammatory bowel disease in the genetically susceptible individual (12).
THE ROLE OF THE ENTERIC MICROBIOTA IN THE NORMAL GUT
Underpinning the probiotic concept is the importance of the normal intestinal microbiota
in health and disease (12). Establishment of gut microbiota begins within minutes of
delivery of the newborn (13,14). During delivery the infant is exposed to bacteria in the
birth canal, the environment, maternal fecal microbiota, and other sources (15). The gut is
initially colonized by facultative anaerobes such as Escherichia coli and Enterococcus
species, possibly due to the absence of anaerobic conditions in the intestine (16).
Colonization with bifidobacteria follows, particularly in breast-fed infants, and as the
environment becomes more anaerobic, Bacteroides and Clostridia.
The importance of the intestinal microbiota is suggested by the fact that the healthy
adult gastrointestinal tract is home to a gut microbiota comprising over 400 different
species with more bacterial cells in the gut than eucaryotic cells in the human body and with
the average mass of bacteria being 1-2 kg. Commensal bacteria are present at a number of
10" per gram of intestinal content in the small bowel, up to 1 per gram of ileal content in
the distal ileum and up to 10 cells per gram of colonic content (17).
Probiotics: A Role in Therapy for Inflammatory Bowel Disease 209
The collective metabolic activity of the normal microbiota, of which little is known,
is estimated to rival that of the liver (18-21). Up to 99% of the microbiota is comprised of
30 to 40 strains, with the most abundant populations being strict anaerobes (22,23).
Bacterial members of the genus Bacteroides are amongst the most prominent species
found in human feces. Other species include bifidobacteria, Clostridia, streptococci,
enterococci, lactobacilli, ruminococci, and eubacteria (4,22). Information regarding the
microbiota has been restricted by the limitations of bacteriological culture methodology
with only 40% of bacterial communities being cultivated on non-selective media in the
laboratory (24).
Effects of Enteric Microbiota in the Healthy Intestine
Experiments with germ-free and re-colonized animals demonstrate beneficial effects of the
resident microbiota (20). The commensal bacteria act as a defense against infection using
several mechanisms, including competition for nutrients, the production of antimicrobial
factors against pathogens, such as lactic acid and bacteriocins, and blockage or antagonism
of adhesion sites.
In addition, the integrity of the mucosa requires cell signaling between the
microbiota, epithelium, and mucosal immune system (7). Without the microbiota, mucosal
associated lymphoid tissue is underdeveloped and cell mediated immunity is defective.
The enteric microbiota plays an important role in immune system education by fine-tuning
T-cell repertoires and Thl/Th2 cytokine profiles (11). Compared with conventional
animals, germ-free animals have reduced mucosal cell turnover, cytokine production,
mucosal associated lymphoid tissue and lamina propria cellularity leading to an ineffective
cell mediated immunity, decreased vascularity and less muscle wall thickness (25-27).
There are also differences in intraepithelial lymphocytes (28,29). The intestinal microbiota
primes the mucosal immune response and keeps it in a state of "controlled physiological
inflammation" (26). Induction and/or maintenance of oral tolerance to ingested antigens
also require microbial colonization of the gastrointestinal tract in early life.
Understanding the influence of the gastrointestinal microbiota has prompted interest
in the therapeutic modification of the enteric microbiota with probiotics or prebiotics.
THE IMPORTANCE OF THE ENTERIC MICROBIOTA
IN INFLAMMATORY BOWEL DISEASE
Considerable evidence implicates the enteric microbiota in the pathogenesis of
inflammatory bowel disease (Table 1) (7,8,30,31). Firstly, mucosal inflammation occurs
in areas of the gut with highest bacterial numbers. Secondly, surgical diversion of the fecal
stream has been associated with clinical improvement in the distal bowel, but relapse is
predictable following surgical restoration. Thirdly, putative therapeutic efficacy is seen
with the use of antibiotics in colonic disease. Fourthly, immune reactivity to intestinal
bacteria is detectable in patients with inflammatory bowel disease suggesting a loss of
immune tolerance to components of the microbiota (32,33). Fifthly, there are reports of
increased numbers of bacteria within the mucosa of patients with inflammatory bowel
disease compared with controls (34,35). The highest bacterial numbers have been seen in
CD patients and numbers increase with severity of disease. Finally, the description of the
first susceptibility gene for CD, CARD15/NOD2, has provided a basis for explaining the
interaction between bacteria and the immune response. CARD15/NOD2 encodes a protein
210 Sheiletal.
Table 1 Evidence Implicating the Enteric Microbiota in the Pathogenesis of IBD
The distribution of the lesions is greatest in areas of highest numbers of luminal bacteria
Interruption of the fecal stream has been associated with clinical improvement but relapse is
predictable following surgical restoration
Evidence for loss of immunological tolerance to components of the commensal microbiota
Serology and cellular immune reactivity to enteric microbiota that has formed the basis of putative
diagnostic tests
Efficacy of antibiotics in patients
Description of first susceptibility gene for Crohn's disease (CARD15/NOD2)
Colonization with normal enteric microbiota is required for expression of disease in animal models
of colitis irrespective of the underlying defect
Attenuation of inflammation in animal models of enterocolitis
Efficacy of probiotics in animal models of colitis
Effect of probiotics in human studies of IBD
Abbreviation: IBD, inflammatory bowel disease.
that is involved in the recognition of bacterial products and initiates the inflammatory
cascade via activation of the transcription factor Nuclear Factor kappaB (NFkB) (36,37).
Compelling evidence for the interactive role of genes, bacteria, and immunity has
been derived from experimental animal models of both Crohn' s-like and colitis-like
disease (38,39). There are now about 30 different spontaneously occurring or genetically
engineered (knockout or transgenic) animal models for inflammatory bowel disease
(40-42). Colonization with normal enteric microbiota is required for full expression of
disease. Thus, the normal microbiota is a common factor driving the inflammatory process
irrespective of the genetic underlying predisposition and immunological effector
mechanism (43,44). Several different microorganisms have been demonstrated to induce
colitis in animal models. These include Enterococcus faecalis, causing colitis in the anti-
inflammatory interleukin-10 (IL-10) knockout mice, and Bacteroides vulgatus, which
induced inflammation in the HLA-B27 rat model (45,46). This evidence has prompted the
therapeutic modification of the enteric microbiota in inflammatory bowel disease.
In patients with ulcerative colitis, the construction of an ileal pouch following
a colectomy represents a human "model" showing the contribution of genes, bacteria,
and immune mechanisms to its pathogenesis. A genetic contribution is consistent with
the relative frequency of pouchitis in patients undergoing surgery for colitis compared
with those having a pouch created surgically for familial polyposis coli. The contribution
of bacteria to the pathogenesis of pouchitis is shown by the efficacy of both antibiotic
and probiotic therapy in treating the disease (47). The immune system mediates the
tissue damage and pouchitis appears to be a colitis-like process occurring in the
colonized ileum.
Specific Microorganisms in Inflammatory Bowel Disease
Despite the importance of bacteria in the pathogenesis of colitis and CD, no specific micro-
organism has been implicated in causing the intestinal inflammation. The roles of
Mycobacterium paratuberculosis, measles virus, Listeria monocytogenes and adherent
E. coli in the pathogenesis have been examined. Strains of adherent-invasive E. coli have
been isolated in the mucosa of patients with CD (48). M. paratuberculosis has been
cultured from the intestine of patients with CD and detected by molecular methods in the
granulomas of resected tissue from patients (49). Possible disease modifying mechanisms
Probiotics: A Role in Therapy for Inflammatory Bowel Disease 211
of transient pathogens include the disruption of the mucosal barrier (allowing increased
uptake of luminal antigens), mimicry of self-antigens and activation of the mucosal
immune system via modulation of transcription factors such as NFkB. However, a direct
cause and effect relationship has not been established for any of these organisms. Indeed,
conditions favoring transmission of infection (low socio-economic status, overcrowding,
poor sanitation) appear to protect against inflammatory bowel disease, arguing against an
infectious aetiology (50).
Since there is evidence for the role of luminal microbiota in the pathogenesis of
inflammatory bowel disease, the alteration of the microbiota by the introduction of
probiotic bacteria may result in clinical improvement of the condition. Conventional drug
therapy for inflammatory bowel disease involves suppression of the immune system or
modulation of the inflammatory response. Probiotics offer an alternative without the risk of
side effects associated with conventional therapy.
PROBIOTICS
Probiotic Definition
Probiotics may be defined as "Live microorganisms which when administered in adequate
amounts confer a health benefit on the host" (4,51). Probiotics are non-pathogenic
microbial organisms which survive passage through the gastrointestinal tract and are
believed to have potential beneficial health effects. The desirable properties of probiotic
bacteria include having generally regarded as safe status, acid, and bile stability,
adherence to intestinal cells, persistence for some time in the gut, antagonism against
pathogenic bacteria and modulation of the immune response (52). Bacteria of human
origin were originally required for safety reasons and because probiotic efficacy appeared
to be host-specific. This stipulation may now be unnecessary as potential probiotics are
fully identified and characterized by phenotypic and genotypic methods and tested for
safety before use. Probiotic activity has been associated most commonly with lactobacilli
and bifidobacteria, but other non-pathogenic bacteria including species of streptococci and
enterococci, non-pathogenic E. coli Nissle 1917, and the yeast Saccharomyces boulardii
have been used (53).
However, the current definition of a probiotic may now be too limited. Whilst the
definition is one of live microorganisms, studies have demonstrated that bacterial DNA or
bacterial components could themselves be responsible for any observed probiotic effects
(54). Genetically modified bacteria have also been tested and a genetically engineered
lactobacillus secreting the anti-inflammatory cytokine IL-10 has attenuated colitis in
animals (55). Therefore, future use of the functional microbes may be outside the definition
of probiotics. The definition of probiotics is likely to undergo continuing modification,
and the term "pharmabiotics" may be more appropriate [(56), www.apc.ucc.ie]. This
umbrella term includes live and dead organisms and constituents thereof, and
encompasses genetically engineered microbes.
How Probiotics May Exert an Effect in Inflammatory Bowel Disease
The mechanisms of action of probiotic bacteria in the setting of inflammation are not
completely elucidated and are likely to involve a number of factors and be strain specific.
Proposed mechanisms focus on how probiotics influence the immune response. Commensal
microbiota are known to contribute to immune homeostasis (7,26). There are several
212 Sheiletal.
molecular pathways which are suggested as candidates for the site of probiotic immune
effects. In the context of IBD, anti-inflammatory activity may involve signaling with the
gastrointestinal epithelium and perhaps mucosal regulatory T-cells (7).
Gut Epithelium and Dendritic Cells
Within the gut, intestinal epithelial cells are the first point of contact for bacteria and play
an important role in bacteria-host communication (57). The epithelial cells act as sensors
of commensal and pathogenic bacteria, with discriminatory capacity to activate signaling
pathways (8,58,59). Interactions with Toll-like receptors and dendritic cells in the gut are
believed to be involved in this communication between host and bacteria (8,60). Dendritic
cells in the gut mucosa are responsible for the stimulation of T cells and seem to have an
important role in the balance between inducing TH1, TH2, and TH3 cytokine profiles (61).
Gut dendritic cells are mostly immature and potentially prone to modulation by the
environment, containing microorganisms. TH1/TH2/TH3 cytokine profiles induced by gut
dendritic cells have been modulated by the administration of lactobacilli (62). In a further
study, the probiotic bacteria Bifidobacterium infantis and Lactobacillus salivarius have
induced dendritic cells to produce the anti-inflammatory cytokine IL-10 rather than pro-
inflammatory IL-12 (63). In addition, intestinal dendritic cells have been shown to retain
small numbers of commensal bacteria. This allows induction of protective IgA by the
dendritic cells, preventing mucosal penetration by bacteria (64).
Modulation of the Cytokine Response
The ability of probiotic bacteria to induce an anti-inflammatory or regulatory cytokine
profile by in vitro immunocompetent cells has been confirmed (65). In vitro studies
examined the effect of probiotics on cytokine production by human intestinal mucosa.
Both Lactobacillus casei and Lactobacillus bulgaricus down-regulated the production of
TNF-a from normal and inflamed mucosa (66,67). The effects of various lactic acid
bacteria on the cytokine profile produced by peripheral blood mononuclear cells in vitro
have been studied (57,68-71). Alterations in cytokine production have been observed in
the IL-10 knockout mouse model which develops colitis similar to human inflammatory
bowel disease. The anti-inflammatory effects of Lactobacillus salivarius UCC118, and
Bifidobacterium infantis 35624, when administered both orally and subcutaneously to
IL-10 knockout mice, were accompanied by a reduction in pro-inflammatory cytokines
IFN-y, TNF-a and IL-12 from splenocytes, while levels of the regulatory cytokine TGF-P
were maintained (72,73).
It is suggested that live bacteria may not be necessary for the immune responses seen
with probiotics. Indeed bacterial DNA has been shown to have potent immunostimulatory
effects and has reduced colitis in a number of murine models (54). The DNA sequences
used are termed immunostimulatory sequences or CpG motifs. CpG DNA can activate
dendritic cells and its effects are mediated via Toll-like receptors (74,75).
Nuclear Factor kappaB Pathway
The NFkB pathway, a nuclear factor involved in the transcriptional regulation of
inflammatory genes, mediates responses to invasive pathogenic bacteria. Certain non-
pathogenic organisms have been shown to counterbalance epithelial responses to invasive
bacteria via an effect on the inhibitor kappaB / NFkB pathway (76). A recent study has
demonstrated that a commensal bacterium, Bacteroides thetaiotaomicron, also acted on
NFkB to attenuate pro-inflammatory cytokine expression, but via a unique mechanism.
The mechanism involved limiting the duration of action of NFkB by promoting its nuclear
Probiotics: A Role in Therapy for Inflammatory Bowel Disease 213
export through a peroxisome proliferator activated receptor-y-dependent (PPAR-y)
pathway (77).
Intestinal Permeability
Apart from immune mechanisms, it is also suggested that probiotic bacteria may have
a beneficial effect on permeability of the gut barrier. There is evidence to suggest that the
epithelial barrier function is reduced in inflammatory bowel disease (78).
Probiotic strains have demonstrated an ability to enhance the epithelial barrier
function, based on measurements of intestinal permeability in excised mucosal tissue from
animal models and humans (79,80). Probiotics given to IL-10 knockout mice normalized
colonic physiological function and barrier integrity, along with a reduction in severity
of colitis.
EFFICACY OF PROBIOTICS IN INFLAMMATORY BOWEL DISEASE
Probiotics in Animal Models of IBD
The efficacy of probiotics in attenuating colitis has been demonstrated in experimental
animal models (Table 2). These models include the interleukin-10 knockout murine model
(81-84), methotrexate induced colitis (85), HLA-B27 transgenic rats (86), and the
CD45Rbhi transfer model (87).
The model of IL-10 knockout mice develop colitis when colonized with normal
enteric microbiota but remain disease-free if kept in germ-free conditions. In a study of
IL-10 - ' mice colonization with Lactobacillus plantarum 299 v was performed 2 weeks
before transferring from a germ-free environment to a specific pathogen-free
environment (84). This treatment led to a reduction in disease activity and a significant
decrease in mesenteric lymph node IL-12 and IFN-y production. A role for Lactobacillus
reuteri in prevention of colitis in IL-10 - mice was also demonstrated (81). In this
study, the oral administration of the prebiotic lactulose (shown to increase the levels of
Lactobacillus species) and rectal swabbing with L. reuteri restored Lactobacillus levels
to normal in neonatal mice, originally found to have low levels of lactobacilli species.
This effect was associated with the attenuation of colitis. In a placebo controlled trial,
orally administered Lactobacillus salivarius UCC118 reduced the incidence of colon
cancer and the severity of mucosal inflammation in IL-10 _/ " mice (82). L. salivarius
was also shown to modify the gut microbiota in these animals as Clostridium
perfringens, enterococci and coliform levels were significantly reduced in the probiotic
group. A further trial confirmed the efficacy of L. salivarius UCC118 and demonstrated
efficacy for Bifidobacterium infantis 35624 in attenuation of colitis in the IL-10 _/ "
mouse model (83). The amelioration of disease activity in this study was associated with
modulation of the gut microbiota as investigated by culture-independent 16S ribosomal
RNA targeted PCR-direct gradient gel electrophoresis. In addition, mucosal pro-
inflammatory cytokine production was significantly reduced. Indeed, the oral route of
administration may not be essential for certain probiotic effects. Reduced inflammatory
scores and reduced production of pro-inflammatory cytokines have been observed in
IL-10 - mice which had been injected subcutaneously with L. salivarius UCC1 18 (73).
Modified Probiotics in Animal Models
Combinations of probiotic treatment with prebiotic s or antibiotics have been used to
increase the beneficial effect. The combination of the prebiotic inulin, and the probiotic
214
Sheil et al.
Table 2 Summary of Probiotic Efficacy in Animal Models of Enterocolitis
Probiotic microorganism
Type of study
Trial outcome
Reference
Lactobacillus reuteri
IL-10" /_ mice. N = 4-8
per group. Placebo
controlled trial
Lactobacillus salivarius
UCC118
IL-10~ /_ mice. N= 10
per group. Placebo
controlled
Lactobacillus salivarius
UCC118 and Bifido-
bacterium infantis
35624
IL-10"'" mice. N= 10
per group. Placebo
controlled
Lactobacillus salivarius
UCC118
L-10~ /_ mice. CIA
model N= 10 per
group. Placebo
controlled
.-/-
Lactobacillus plantar um IL-10 mice. Placebo
299v controlled
Lactobacillus rhamnosus HLA-B27 transgenic
GG rats
Combination of Lacto- HLA-B27 transgenic
bacillus acidophilus rats
La-5, L. delbruckii
subsp. bulgaricus,
Bifidobacterium
Bb-12, and Strepto-
coccus thermophilus
Prebiotic lactulose and
probiotic L. reuteri
attenuated colitis
and improved
mucosal barrier
function.
Reduced incidence of
colon cancer and
mucosal inflam-
mation. Modulation
of fecal microbiota.
Attenuation of disease.
Modulation of gut
microbiota.
Reduction in in vitro
production of IFN-
y,TNF-aandIL-12.
TGF-(3 levels main-
tained.
Attenuation of colitis
and arthritis
following subcu-
taneous adminis-
tration of probiotic.
Reduction in proin-
flammatory cyto-
kine production.
Attenuation of colitis.
Reduction in IL-12
and IFN-y produced
by stimulated
mesenteric lymph
node cells.
Prevented recurrence
of colitis.
Attenuated colitis
following treatment
with the prebiotic
inulin and a combi-
nation of probiotic
organisms.
Madsen et al.
1999 (81)
O'Mahonyetal.
2001(82)
McCarthy et al.
2003 (83)
Sheil et al. (73)
Schultz et al.
2002 (84)
Dieleman et al.
2001 (86)
Schultz et al.
unpublished
data
Abbreviations: HLA, human leukocyte antigen; IFN, interferon; IL, interleukin; N, number of animals; TGF,
transforming growth factor; TNF, tumor necrosis factor.
organisms Lactobacillus acidophilus La-5, Lactobacillus delbrueckii subsp. bulgaricus,
Bifidobacterium lactis Bb-12, and Streptococcus thermophilus significantly decreased
inflammation in HLA-B27 rats (Schultz, unpublished data). Furthermore, genetically
modified probiotics have been developed. Lactococcus lactis was engineered to secrete
Probiotics: A Role in Therapy for Inflammatory Bowel Disease 215
biologically active IL-10 and a significant reduction in inflammation was observed in both
IL- 10 ~ ' ' and dextran sodium sulfate-induced murine colitis models (55). The investigators
concluded that genetically engineered bacteria for local administration of a therapeutic
agent, such as IL-10, may be a useful strategy in the treatment and prevention of IBD.
Live versus Dead Bacteria
It may not be necessary to administer live bacteria to achieve benefit. Bacterial DNA has
been shown to have potent immuno-stimulatory effects. In a trial by Rachmilewitz et al. (54)
bacterial DNA was used to attenuate colitis in a number of murine models suggesting an
anti-inflammatory effect for bacterial DNA that warrants further study. A more recent study
investigated the role of Toll-like receptors in mediating these effects of bacterial DNA (88).
Human Trials of Probiotics in Patients with Inflammatory Bowel Disease
Evidence that the enteric microbiota play a role in the pathogenesis of IBD and results
from models of IBD which have demonstrated beneficial effects for probiotics has
prompted clinical studies examining the effect of these organisms in patients with
inflammatory bowel disease.
Trials in Ulcerative Colitis
A number of studies have examined the use of a non-pathogenic E. coli strain Nissle
1917, in the setting of ulcerative colitis. Kruis et al. (89) first performed in 1997 a
randomized, double-blind clinical trial where 120 patients with inactive ulcerative colitis
were randomized to receive oral E. coli strain Nissle 1917 or mesalazine. They reported
that there was no difference in relapse rates in the probiotic treated group compared to
patients on mesalazine. Relapse rates were 11.3% for the mesalazine treated group and
16.0% for the E. coli group. Life table analysis showed a relapse free time of 103 +
4 days for mesalazine and 106 + 5 days for E. coli. From the results of this preliminary
study, probiotic treatment appeared to offer another option for maintenance therapy of
ulcerative colitis (89). Further beneficial results were described by Rembacken et al. (90)
in a study where a total of 116 patients with active ulcerative colitis were recruited.
Seventy-five percent and 68% of the mesalamine and E. coli groups achieved remission,
respectively. In the second maintenance part of this study, the relapse rate in both groups
was markedly higher than the investigators anticipated, 73% for the mesalamine group
and 67% for the E. coli group. The time to relapse was not significantly different
between the groups (90). These results suggested that the non-pathogenic E. coli was
equivalent to mesalazine in maintaining remission, however these relapse rates are
similar to those of placebo-treated patients. In a larger, 1-year multi-center, randomized,
double-blind, remission maintenance study of 327 patients, E. coli was shown to be as
effective as mesalazine in maintaining remission with relapse rates of 45% for the E. coli
group and 36% in the mesalazine group, therefore offering an alternative to mesalazine
in maintenance of remission in ulcerative colitis patients (Table 3) (92).
The probiotic cocktail VSL#3, a mixture of four lactobacilli (Lactobacillus
plantarum, Lactobacillus casei, Lactobacillus acidophilus, Lactobacillus delbrueckii ssp.
Bulgaricus), three bifidobacteria strains (Bifidobacterium infantis, Bifidobacterium breve,
Bifidobacterium longum), and one strain of Streptococcus salivarius ssp. thermophilus,
has been studied in ulcerative colitis. There is a high concentration of bacteria in this
mixture with potential synergistic relationships to enhance suppression of potential
pathogens. The effect of VSL#3 on maintenance of remission in UC patients was
216
Sheil et al.
Table 3 Summary of Human Trials of Probiotic Therapy in Ulcerative Colitis
Study type
Organism used
Trial outcome
Reference
Randomized
E. coli strain Nissle
Patients with active colitis
Kruis et al.
controlled
1917. N= 120
demonstrated similar relapse rates
1997 (89)
trial
compared to patients on mesalazine
Randomized,
E. coli strain Nissle
Confirmed result from Kruis
Rembacken et al.
controlled
1917. N=116
et al. 1997
1999 (90)
trial
Open labeled
VSL#3. N = 20
Maintenance of remission in patients
Venturi et al.
trial
1999 (91)
Randomized
E. coli strain Nissle
Remission maintained in patients
Kruis et al.
controlled
1917. N = 327
receiving probiotic
2001 (92)
trial
Open labeled
Sac char omyces
Treatment given in combination with
Guslandi et al.
trial
boulardii.
mesalamine for relapse of ulcerative
2003 (93)
N = 25
colitis. Remission achieved in 17
patients
Abbreviation'. N, number of subjects in trial.
evaluated using an open label design (91). In this pilot study, 20 patients in remission
were treated for 12 months. At the end of the trial 15 out of 20 patients (75%) remained
in remission.
A recent study has investigated the use of Saccharomyces boulardii in the setting of
ulcerative colitis. In an open, non-placebo controlled study, 25 patients with a relapse of
ulcerative colitis were treated with mesalazine in combination with S. boulardii.
Seventeen patients achieved remission (93).
Trials in Pouchitis
Convincing evidence for beneficial probiotic effects in inflammatory bowel disease is
seen in the treatment of pouchitis. In an open labeled study, patients with pouchitis were
treated with Lactobacillus GG and fructooligosaccharide (94). The patients reported
a beneficial effect when the probiotic-prebiotic mix was administered as an adjuvant to
antibiotic therapy. Remission was documented by suppression of symptom scores and
reversal of endoscopic findings (94). Gionchetti et al. (95) have studied VSL#3 in the
setting of pouchitis and have demonstrated the efficacy of this probiotic mix in
maintenance of remission in patients with chronic pouchitis. In a randomized, double-
blind, placebo-controlled trial, 40 patients with pouchitis received one month of
antibiotic treatment and were in clinical and endoscopic remission. Patients were then
randomized to receive VSL#3 or placebo for 9 months. At the end of the study three
patients (15%) had relapsed in the VSL#3 group compared to 20 (100%) in the placebo
group. In a follow-up study, this group has also used VSL#3 as prophylaxis in patients
after ileo-anal pouch formation surgery to prevent pouchitis. Forty patients were
randomized to receive VSL#3 or placebo. At 1-year follow-up, 10% of probiotic treated
patients had developed pouchitis, compared with 40% of the placebo treated group (96).
A recent study has again examined the role of VSL#3 in maintaining remission
following treatment of refractory or recurrent pouchitis. Thirty-six patients with
recurrent pouchitis (at least twice in the past year) or requiring continuous antibiotics, in
whom remission was induced by 4 weeks of antibiotics, were randomized to receive
Probiotics: A Role in Therapy for Inflammatory Bowel Disease
217
Table 4 Summary of Human Trials of Probiotic Therapy in Pouchitis
Study type
Organism used
Trial outcome
Reference
Open labeled
Prebiotic fructooli-
Effective in inducing remission in
Friedman et al.
trial
gosaccharide and
probiotic.
N = 10
combination with antibiotic
2000 (94)
Randomized
VSL#3. N = 40
Maintenance of remission in chronic
Gionchetti et al.
controlled
pouchitis after antibiotic induced
2000 (95)
trial
remission. 15% relapse rate
compared with 100% in control
group
Randomized
VSL#3. N = 40
Prevention of acute pouchitis in
Gionchetti et al.
controlled
patients after ileo-anal pouch sur-
2003 (96)
trial
gery. 10% pouchitis rate in probiotic
group compared with 40% in control
group
Randomized
VSL#3 (6 g).
Maintenance of remission in recurrent
Mimura et al.
controlled
N = 36
or refractory pouchitis after anti-
2004 (97)
trial
biotic induced remission. 85%
remained in remission at one year,
compared with 6% in placebo group
Abbreviation: N, number of subjects in trial.
6 gram of VSL#3 or placebo daily for one year or until relapse. Eighty-five percent
of the VSL#3 treated group remained in remission at one year compared with 6%
(one patient) in the placebo group (Table 4) (97).
Trials in Crohn 's Disease
In CD, an early study involved the use of Sac c char omyces boulardii (98). In a double-
blind study, 20 patients with moderately active CD were randomized to treatment with this
organism or placebo for 7 weeks. The probiotic treated patients had a significant decrease
in CD activity index (CDAI) compared with the control group. More recently, a double-
blind trial randomized 32 CD patients in clinical remission to receive either mesalamine
alone or mesalamine plus S. boulardii. Clinical relapse was observed in only 6.25% of
patients receiving mesalamine plus S. boulardii, while 37.5% relapse rate was observed in
the group receiving mesalamine alone (Table 5) (103).
The efficacy of Lactobacillus rhamnosus GG in the treatment of CD has been
studied (99). Malin et al. (99) reported that in pediatric CD, consumption of Lactobacillus
GG was associated with increased gut IgA levels which could promote the gut
immunological barrier. Gupta et al. (101) also reported improved clinical scores and
improved intestinal permeability in an open labeled pilot study in a small study involving
four pediatric CD patients.
A double-blind study investigated the use of the E. coli Nissle 1917 strain in CD (100).
Malchow et al. randomized 28 patients in remission to receive either E. coli or placebo. At
1-year follow-up, the relapse rates were significantly reduced in the group that received
E. coli (30%) compared with 70% in the placebo group. In a large double-blind, randomized
study the efficacy of VSL#3 combined with antibiotic treatment on the post-operative
recurrence of CD was compared to treatment with mesalamine alone (102). Forty patients
218
Sheil et al.
Table 5 Summary of Human Trials of Probiotic Therapy in Crohn's Disease
Study type Organism used
Trial outcome
Reference
Randomized
Saccharomy-
controlled
ces boular-
trial
dii. N = 20
Open labeled
Lactobacillus
trial
rhamnosus
GG. N=14
Randomized
E. coli strain
controlled
Nissle 1917
trial
N = 28
Open labeled
Lactobacillus
trial
rhamnosus
GG in chil-
dren. N = 4
Randomized
VSL#3 with
controlled
antibiotic.
trial
N = 40
Randomized
Saccharomy-
controlled
ces boular-
trial
dii. N = 32
Open labeled
Lactobacillus
trial
salivarius
118. N = 25
Randomized
Lactobacillus
controlled
rhamnosus
trial
GG
Decrease in CDAI in probiotic group
Increase in gut IgA response
Remission achieved in patients on probiotics
and steroids greater than with steroids alone
Improved intestinal permeability and CDAI
Patients with CD had 20% remission when
given antibiotic and VSL#3 compared to
40% in mesalamine treated group
Maintenance of remission in treatment group
superior as relapse observed in 6.25% of
patients receiving probiotic plus mesalasine
compared to 37.5% on mesalamine alone
Reduction of mean CDAI and induction of
IgA in patients with relapse
No difference seen in rate of recurrence 1 year
after surgery between group given probiotic
or control
Plein et al.
1993 (98)
Malin et al.
1996 (99)
Malchow et al.
1997 (100)
Gupta et al.
2000 (101)
Campieri et al.
2000 (102)
Guslandi et al.
2000 (103)
McCarthy et al.
2001 (104)
Prantrera et al.
2002 (105)
Abbreviations: N, number of subjects in trial; CD, Crohn's disease; CDAI, Crohn's disease activity index.
were randomized to receive rifaximin for 3 months followed by VSL#3 for 9 months or
mesalamine for 12 months. At the end of the trial 20% of the patients had recurrent CD in the
probiotic/antibiotic group while 40% of patients in the mesalamine group relapsed (102). In
an open study of patients with mildly active CD despite 5-ASA therapy, patients were
offered either steroids or a trial of Lactobacillus salivarius subsp. salivarius UCC118 for
6 weeks (104). Of the 25 patients enrolled, 19 successfully completed the study and avoided
steroids for a 3-month follow-up period. The mean CDAI at enrolment was 217, falling to
150 at the end of the study period (104). Finally, in a recent study of 45 CD patients who
underwent curative surgery, the recurrence rate 1 year after surgery in patients treated with
Lactobacillus rhamnosus GG or placebo was compared. No difference was seen between
the patients receiving probiotic (16% recurrence rate) and the placebo group (10%) (105).
In conclusion, while the trials for probiotics in treatment of IBD to date are
promising, results have been mixed; consequently, better-designed trials are needed.
DISCUSSION
Although preliminary studies are promising, large placebo-controlled, randomized,
double-blinded clinical trials are needed to clarify the role of probiotic bacteria in the
treatment of inflammatory bowel disease. Studies of probiotics in inflammatory bowel
Probiotics: A Role in Therapy for Inflammatory Bowel Disease 219
disease in the future will also need to increase our knowledge of how probiotics exert their
effect. Optimal dosing schedules need to be determined. Detailed comparisons of probiotic
performance amongst different bacterial strains have not yet been performed, in vivo or
under clinical trial conditions, and the level of scientific characterization of individual
organisms has been variable. The route of administration also requires more study, in
particular to determine whether the oral route is always essential. The issue of live versus
dead bacteria remains unclear. The beneficial effect of bacterial DNA and other
metabolites or constituents versus whole organisms needs comprehensive study.
Irrespective of the mechanism of action, however, there are reasons which might
favor therapeutic usage of live over dead bacteria. Live bacteria may be more reliable for
enteric transit and occupation of microbial niche. Secondly, live bacteria offer the
advantage of elaborating biological molecules other than immunomodulatory DNA.
Detailed strain characterization is also required for all potential probiotic strains
before the use of combinations can be recommended. The potential exists for synergistic
or antagonistic effects amongst bacterial strains and this requires further study. Finally,
disease-specific probiotic organisms designed to target particular patients, (the "designer
probiotic"), may become a possibility as we increase our understanding of molecular
mechanisms behind the anti-inflammatory effects of individual probiotics. What is already
clear, is that there will be an increasing role for bacteria or bacterial products in a
therapeutic setting along with conventional treatments for inflammatory bowel disease.
The concept of a food influencing the health of the gastrointestinal tract is appealing to
many people. Therapeutic modification of the microbiota with functional foods such as
probiotics empowers patients with an enhanced sense of control in the management of
their illness. Microbial therapeutics is an expanding field inviting further investigation,
and we should not allow ourselves to become captive of the definition of probiotics.
REFERENCES
1. Milner JA. Functional foods and health promotion. J Nutr 1999; 129:1395S-1397S.
2. McCarthy J, Shanahan F. Functional food and probiotics: time for gastroenterologists to
embrace the concept. Curr Gastroenterol Rep 2000; 2:345-346.
3. Metchnikoff E. Prolongation of life. London: William Heinmann, 1907.
4. Fooks LJ, Fuller R, Gibson GR. Prebiotics, probiotics and human gut microbiology. Int Dairy
J 1999; 9:53-61.
5. Dunne C. Adaption of bacteria to the intestinal niche: probiotics and gut disorders. Inflamm
Bowel Dis 2001; 7:136-145.
6. Schultz M, Sartor RB. Probiotics and inflammatory bowel disease. Am J Gastroenterol 2000;
95:519-521.
7. Shanahan F. Probiotics and inflammatory bowel disease: is there a scientific rationale.
Inflamm Bowel Dis 2000; 6:107-115.
8. Shanahan F. Therapeutic manipulation of the gut flora. Science 2000; 289:1311-1312.
9. Shanahan F. Crohn's disease. Lancet 2002; 359:62-69.
10. Ekbom A. The changing faces of Crohn's disease and ulcerative colitis. In: Targan S,
Shanahan F, Karp L, eds. Inflammatory Bowel Disease. From Bench to Bedside. 2nd ed.
Dordrecht: Kluwer Academic Publishers, 2003:5-20.
11. Rook GAW, Stanford JL. Give us this day our daily germs. Immunol Today 1998;
19:113-116.
12. Shanahan F. The host- microbe interface within the gut. Best Pract Res Clin Gastroenterol
2002; 19:915-931.
13. Fuller R. Probiotics in man and animals. J Appl Bacteriol 1989; 66:365-378.
220 Sheil et al.
14. Collins JK, Thornton G, Sullivan G. Selection of probiotic strains for human applications.
Int Dairy J 1998; 8:487-490.
15. Mackie R, Gaskins HR. Gastrointestinal microbial ecology. Sci. Med. 1999; 6:18-27.
16. Vanderhoof JA, Young RJ. Use of probiotics in childhood gastrointestinal disorders.
J Paediatr Gastroenterol Nutr 1998; 27:323-332.
17. Berg RD. The indigenous gastrointestinal microbiota. Trends Microbiol 1996; 434:430-435.
18. Bengmark S. Ecological control of the gastrointestinal tract. The role of the probiotic flora.
Gut 1998; 42:2-7.
19. Mackowiak PA. The normal microbial flora. N Engl J Med 1982; 307:83-93.
20. Midtvedt T. Microbial functional activities. In: Hanson LA, Yolken RH, eds. Intestinal
Microflora Nestle Nutrition Workshop Series, Vol. 42. Philadelphia: Lippincott-Raven,
1999:79-96.
21. Bocci V. The neglected organ: bacterial flora has a crucial immunostimulatory role. Perspect
Biol Med 1992; 35:251-260.
22. Alderberth I, Breslin L, Bjoerkstein B, et al. Digestive flora. In: Gorthier G, Arnaud C, eds.
Mechanisms of Protection of the Digestive Tract. Paris: John Libby Eurotext, 1998:17-20.
23. Tannock GW. Probiotic properties of lactic acid bacteria: plenty of scope for fundamental
R&D. Trends Biotechnol 1997; 15:270-274.
24. Tannock GW, Munro K, Harmsen HJM, et al. Analysis of the fecal flora of human subjects
consuming a probiotic containing Lactobacillus rhamnosus DR20. Appl Environ Microbiol
2000; 66:2578-2588.
25. Hooper LV, Gordon JI. Commensal host-bacterial relationships in the gut. Science 2001;
292:1115-1118.
26. MacDonald TT, Carter PB. Requirement for a bacterial flora before mice generate cells
capable of mediating the delayed hypersensitivity reaction in sheep red blood cells. J Immunol
1979; 122:2426-2429.
27. Gordon HA, Pesti L. The gnotobiotic animal as a tool in the study of host-microbial
relationships. Bacterial Rev 1971; 35:390-429.
28. Kawaguchi M, Nanno M, Umesaki Y, et al. Cytolytic activity of intestinal intraepithelial
lymphocytes in germ-free mice is strain dependent and determined by T-cells expressing
T-cell receptors. Proc Natl Acad Sci 1993; 90:8591-8594.
29. Umesaki Y, Setomaya S, Matsumoto S, et al. Expansion of the alpha beta T-cell receptor-
baring intestinal intraepithelial lymphocytes after microbial colonisation in germ-free mice,
and its independence from the thymus. Immunology 1993; 79:32-37.
30. Guarner F, Casellas F, Borruel N, et al. Role of microecology in chronic inflammatory bowel
diseases. Eur J Clin Nutr 2002; 56:S34-S38.
31. Campierei M, Gionchetti P. Probiotics in inflammatory bowel disease: new insight to
pathogenesis or possible therapeutic alternative. Gastroenterology 1998; 116:1246-1260.
32. Macpherson A, Khoo UY, Forgacs I, et al. Mucosal antibodies in inflammatory bowel disease
are directed against intestinal bacteria. Gut 1996; 38:365-375.
33. Duchmann R, Kaiser I, Hermann E, et al. Tolerance exists towards resident intestinal flora but
is broken in active inflammatory bowel disease (IBD). Clin Exp Immunol 1995; 102:448-455.
34. Schultsz C, Van Den Berg F, Ten Kate FW, et al. The intestinal mucus layer from patients
with inflammatory bowel disease harbors high numbers of bacteria compared with controls.
Gastroenterology 1999; 117:1089-1097.
35. Swindinski A, Ladhoff A, Pernthaler A, et al. Mucosal flora in inflammatory bowel disease.
Gastroenterology 2002; 122:44-54.
36. Hugot JP, Chamaillard M, Zouali H, et al. Association of NOD2 leucine rich repeat variants
with susceptibility to Crohn's disease. Nature 2001; 411:599-603.
37. Hugot JP, Zouali H, Leasage S. Lessons to be learned from the NOD2 gene in Crohn's
disease. Eur J Gastroenterol Hepatol 2003; 15:593-597.
38. Elson CO, Sartor RB, Tennyson GS, et al. Experimental models of inflammatory bowel
disease. Gastroenterology 1995; 109:1344-1367.
Probiotics: A Role in Therapy for Inflammatory Bowel Disease 221
39. Strober W, Fuss IJ, Ehrhardt RO, et al. Mucosal immunoregulation and inflammatory bowel
disease: new insights from murine models of inflammation. Scand J Immunol 1998;
48:453-458.
40. Blumberg RS, Saubermann LJ, Strober W, et al. Animal models of mucosal inflammation and
their relation to human inflammatory bowel disease. Curr Opin Immunol 1999; 11:648-656.
41. Wirtz S, Neyrath MF. Animal models of intestinal inflammation: new insights into the
molecular pathogenesis and immunotherapy of inflammatory bowel disease. Int J Colorectal
Dis2000; 15:144-160.
42. Kosiewicz MM, Nast CC, Krishnan A, et al. Thl-type responses mediate spontaneous ileitis in
a novel murine model of Crohn's disease. J Clin Invest 2001; 107:695-702.
43. Kuhn R, Lohler J, Rennick D, et al. Interleukin-10-deficient mice develop chronic
enterocolitis. Cell 1993; 75:263-274.
44. Shanahan F. Gene-targeted immunologic knockouts: new models of inflammatory bowel
disease. Gastroenterology 1994; 17:312-314.
45. Balish E, Warner T. Enterococcus faecalis induces inflammatory bowel disease in
interleukin-10 knockout mice. Am J Pathol 2002; 160:2253-2257.
46. Rath HC, Wilson KH, Sartor RB. Differential induction of colitis and gastritis in HLA-B27
transgenic rats selectively colonized with Bacteroides vulgatus or Escherichia coli. Infect
Immunol 1999; 67:2969-2974.
47. Sartor RB. Probiotics in chronic pouchitis: restoring the luminal balance. Gastroenterology
2000; 119:305-309.
48. Darfeuille-Michaud A, Neut C, Barnich N, et al. Presence of adherent Escherichia coli strains
in ileal mucosa of patients with Crohn's disease. Gastroenterology 1998; 115:1405-1413.
49. Ryan P, Bennett MW, Aarons S, et al. PCR detection of Mycobacterium paratuberculosis in
Crohn's disease granulomas isolated by laser capture microdissection. Gut 2002; 51:665-670.
50. Gent AE, Hellier MD, Grace RH, et al. Inflammatory bowel disease and domestic hygiene in
infancy. Lancet 1994; 343:766-767.
51. Guarner F, Schaafsma GJ. Probiotics. Int J Food Microbiol 1998; 39:237-238.
52. Dunne C, O'Mahony L, Murphy L. In vitro selection criteria for probiotic bacteria of human
origin: correlation with in vivo findings. Am J Clin Nutr 2001; 73:386S-392S.
53. Shanahan F. Inflammatory bowel disease: immunodiagnostics, immunotherapeutics, and
ecotherapies. Gastroenterology 2001; 120:622-635.
54. Rachmilewitz D, Karmeli F, Takabayashi K, et al. Immunostimulatory DNA ameliorates
experimental and spontaneous murine colitis. Gastroenterology 2002; 122:1428-1441.
55. Steidler L, Hans W, Schotte L, et al. Treatment of murine colitis by Lactococcus lactis
secreting interleukin-10. Science 2000; 289:1352-1355.
56. Shanahan F. Host-flora interactions in inflammatory bowel disease. Inflamm Bowel Dis 2004;
10:S16-S24.
57. Haller D, Bode C, Hammes WP, et al. Non-pathogenic bacteria elicit a differential cytokine
response by intestinal epithelial cell / leukocyte co-cultures. Gut 2000; 47:79-87.
58. Gordon JI, Hooper LV, McNevin MS, Wong M, Bry L. Epithelial cell growth and
differentiation, III. Promoting diversity in the intestine: conversations between the microbiota,
epithelium and diffuse GALT. Am J Physiol 1997; 273:G565-G570.
59. Hooper LV, Wong MH, Thelin A, et al. Molecular analysis of commensal host/microbial
relationships in the intestine. Science 2001; 291:881-884.
60. Marteau P, Seksik P, Jian R. Probiotics and health: new facts and ideas. Curr Opin Biotechnol
2002; 13:486-489.
61. Kronin V, Hochrein H, Shortman K, et al. Regulation of T cell cytokine production by
dendritic cells. Immun Cell Biol 2000; 78:214-223.
62. Christensen HR, Frokiaer H, Pestka JJ. Lactobacilli differentially modulate expression of
cytokines and maturation surface markers in murine dendritic cells. J Immunol. 2002;
168:171-178.
63. O'Mahony L, Zong Y, Sharma S, et al. Probiotic bacteria and pathogenic bacteria elicit diff-
erential cytokine responses from dendritic cells (abstract). Gastroenterology 2001; 120:1625.
222 Sheil et al.
64. Macpherson AJ, Uhr T. Induction of protective IgA by intestinal dendritic cells carrying
commensal bacteria. Science 2004; 303:1624-1625.
65. O'Mahony L, Feeney M, MacSharry J, et al. Probiotics, mononuclear cells and epithelial
cells: an anti-inflammatory network (abstract). Gastroenterology 2000; 118:680.
66. Borruel N, Carol M, Casellas F, et al. Increased mucosal TNF-a production in Crohn's disease
can be downregulated ex vivo by probiotic bacteria. Gut 2002; 51:659-664.
67. Borruel N, Casellas F, Antolin M, et al. Effects of non-pathogenic bacteria on cytokine
secretion by human intestinal mucosa. Am J Gastroenterol 2003; 98:865-870.
68. Miettinen M, Matikainen S, Vuopio-Varkila J, et al. Lactobacilli and streptococci induce
interleukin-12 (IL-12), IL-18, and gamma inteferon production in human peripheral blood
mononuclear cells. Infect Immun 1998; 66:6058-6062.
69. Miettinen M, Lehtonen A, Julkunen I, et al. Lactobacilli and streptococci activate NF-kappaB
and STAT signalling pathways in human macrophages. J Immunol 2000; 164:3733-3740.
70. Haller D, Serrant P, Granato D, et al. Activation of human NK cells by staphylococci
and lactobacilli requires cell contact-dependent costimulation by autologous monocytes.
Clin Diagn Lab Immunol 2002; 9:649-657.
71. Haller D, Blum S, Bode C, et al. Activation of human peripheral blood mononuclear cells by
non-pathogenic bacteria in vitro: evidence of NK cells as primary targets. Infect Immun 2000;
68:752-759.
72. McCarthy J, O'Mahony L, O'Callaghan L, et al. Double-blind, placebo-controlled trial of two
probiotic strains in interleukin 10 knockout mice and mechanistic link with cytokine balance.
Gut 2003; 52:975-980.
73. Sheil B, McCarthy J, O'Mahony L, et al. Is the mucosal route of administration essential for
probiotic function? Subcutaneous administration is associated with attenuation of murine
colitis and arthritis Gut 2004; 53:694-700.
74. Hemmi H, Takeuchi O, Kavai T, et al. A Toll-like receptor recognizes bacterial DNA. Nature
2000; 408:740-745.
75. Wagner H. Toll meets bacterial CpG-DNA. Immunity 2001; 14:499-502.
76. Neish AS, Gerwirtz AT, Zeng H, et al. Prokaryotic regulation of epithelial responses by
inhibition of IkappaB -alpha ubiquitination. Science 2000; 289:1560-1563.
77. Kelly D, Campbell JI, King TP, et al. Commensal anaerobic gut bacteria attenuate
inflammation by regulating nuclear-cytoplasmic shuttling of PPAR-y and RelA. Nature
Immunol 2004; 5:104-112.
78. Schmitz H, Barmeyer C, Fromm M, et al. Altered tight junction structure contributes to the
impaired epithelial barrier function in ulcerative colitis. Gastroenterology 1999;
116:301-309.
79. Isolauri E, Majamaa H, Arvola T, et al. Lactobacillus casei strain GG reverses increased
intestinal permeability induced by cow milk in suckling rats. Gastroenterology 1993;
105:1643-1650.
80. Madsen K, Cornish A, Soper P, et al. Probiotic bacteria enhance murine and human intestinal
epithelial barrier function. Gastroenterology 2001; 121:580-591.
81. Madsen KL, Doyle JS, Jewell LD, et al. Lactobacillus sp prevents development of
enterocolitis in interleukin- 10 deficient mice. Gastroenterology 1999; 116:1107-1114.
82. O'Mahony L, Feeney M, O'Halloran S, et al. Probiotic impact on microbial flora,
inflammation, and tumour development in IL-10 knockout mice. Aliment Pharmacol Ther
2001; 15:1219-1225.
83. McCarthy J, O'Mahony L, O'Callaghan L, et al. Double-blind, placebo-controlled trial of two
probiotic strains in interleukin 10 knockout mice and mechanistic link with cytokine balance.
Gut 2003; 52:975-980.
84. Shultz M, Veltkamp C, Dieleman LA, et al. Lactobacillus plantarum 299 v in the treatment
and prevention of spontaneous colitis in Interleukin- 10-deficient mice. Inflamm Bowel Dis
2002; 8:71-80.
85. Mao Y, Nobaek S, Kasravi B, et al. The effects of Lactobacillus strains and oat fibre on
methotrexate induced enterocolitis in rats. Gastroenterology 1996; 111:334-344.
Probiotics: A Role in Therapy for Inflammatory Bowel Disease 223
86. Dieleman LA, Goerres MS, Arends A, et al. Lactobacillus GG prevents recurrence of colitis in
HLA-B27 transgenic rats after antibiotic treatment. Gastroenterology 2001; 118:A4312.
87. Murphy L, Byrne F, Collins JK, Shanahan F, O' Sullivan GC, Aranda R. Evaluation and
characterisation of probiotic therapy in the CD45Rbhi transfer model. Gastroenterology 1999;
116:A3882 (abstract).
88. Rachmilewitz D, Katakura K, Karmeli F, et al. Toll like receptor 9 signaling mediates the anti-
inflammatory effects of probiotics in murine experimental colitis. Gastroenterology 2004;
126:520-528.
89. Kruis W, Schutz E, Fric P, Fixa B, Judmaier G, Stolte M. Double blind comparison of an oral
Escherichia coli preparation and mesalazine in maintaining remission of ulcerative colitis.
Aliment Pharmacol Ther 1997; 11:853-858.
90. Rembacken BJ, Snelling AM, Hawkey PM, Axon ATR. Non-pathogenic Escherichia coli
versus mesalazine for the treatment of ulcerative colitis: a randomised trial. Lancet 1999;
354:635-639.
91. Venturi A, Gionchetti P, Rizzello F, et al. Impact on the composition of the faecal flora by
a new probiotic preparation: preliminary data on maintenance treatment of patients with
ulcerative colitis. Aliment Pharmacol Ther 1999; 13:1103-1108.
92. Kruis W, Fric P, Stolte M. The Mutflor Study Group. Maintenance of remission in ulcerative
colitis is equally effective with Escherichia coli Nissle 1917 and with standard mesalazine.
Gastroenterology 2001; 120:A680 (abstract).
93. Guslandi M, Giollo P, Testoni PA. A pilot trial of Saccharomyces boulardii in ulcerative
colitis. Eur J Gastroenterol Hepatol 2003; 15:697-698.
94. Friedman G, George J. Treatment of refractory 'pouchitis' with probiotic and prebiotic
therapy. Gastroenterology 2000; 118:A4167.
95. Gionchetti P, Rizzello F, Venturi A, et al. Oral bacteriotherapy as maintenance treatment in
patients with chronic pouchitis: a double-blind, placebo-controlled trial. Gastroenterology
2000; 119:305-309.
96. Gionchetti P, Rizzello F, Helwig U, et al. Prophylaxis of pouchitis onset with probiotic
therapy: A double-blind, placebo- controlled trial. Gastroenterology 2003; 124:1202-1209.
97. Mimura T, Rizzello F, Helwig U, et al. Once daily high dose probiotic therapy (VSL#3) for
maintaining remission in recurrent or refractory pouchitis. Gut 2004; 53:108-114.
98. Plein K, Holz J. Therapeutic effects of Saccharomyces boulardii on mild residual symptoms
in a stable phase of Crohn's disease with special respect to chronic diarrhoea-a pilot study.
Z Gastroenterol 1993; 31:129-134.
99. Malin M, Suomalainen H, Saxelin M, et al. Promotion of IgA immune response in patients
with Crohn's disease by oral bacteriotherapy with Lactobacillus GG. Ann Nutr Metab 1996;
40:137-145.
100. Malchow HA. Crohn's disease and Escherichia coli. A new approach in therapy to maintain
remission of colonic Crohn's disease? J Clin Gastroenterol 1997; 25:653-658.
101 . Gupta P, Andrew H, Kirschner BS, et al. Is Lactobacillus GG helpful in children with Crohn's
disease? Results of a preliminary open-label study J Pediatr Gastroenterol Nutr 2000;
31:453-457.
102. Campieri M, Rizzello F, Venturi A, et al. Combination of antibiotic probiotic treatment is
efficacious in prophylaxis of post-operative recurrence of Crohn's disease: a randomised
controlled study vs mesalamine. Gastroenterology 2000; 118:A4179 (abstract).
103. Guslandi M, Mezzi G, Sorghi M, Testoni PA. Saccharomyces boulardii in the maintenance of
Crohn's disease. Dig Dis Sci 2000; 45:1462-1464.
104. McCarthy J, O'Mahony L, Dunne C, et al. An open trial of a novel probiotic as an alternative
to steroids in mild/moderately active Crohn's disease (abstract). Gut 2001; 49:2447.
105. Prantrera C, Scribano ML, Falasco G, Andreoli A, Luzi C. Ineffectiveness of probiotics in
preventing recurrence after curative resection for Crohn's disease: a randomised controlled
trial with Lactobacillus GG. Gut 2002; 51:405-409.
12
The Gastrointestinal Microbiota in Cancer
Patricia M. Heavey
School of Life Sciences, Kingston University, Kingston-upon-Thames, U.K.
Ian R. Rowland
Northern Ireland Center for Food and Health, University of Ulster, Coleraine,
Northern Ireland, U.K.
Joseph J. Rafter
Department of Medical Nutrition, Novum, Huddinge University Hospital,
Karolinska Institutet, Stockholm, Sweden
INTRODUCTION
The microbiota of the human gastrointestinal tract and in particular the large intestine,
1 "y
comprises a large and diverse range of microorganisms, with over 10 bacteria per gram
of contents (1). It is therefore not surprising that the activities of this microbial population
have a significant impact on the health of the host. The microbiota interacts with its host at
both the local (intestinal mucosa) level, and systemically, resulting in a broad range of
immunological, physiological, and metabolic effects. From the standpoint of the host,
these effects have both beneficial and detrimental outcomes for nutrition, infections,
xenobiotic metabolism, toxicity of ingested chemicals, and cancer.
The participation of intestinal bacteria in carcinogenesis continues to be
controversial partly due to the lack of agreement on the molecular mechanisms involved
in the development of this disease. In normal adult tissues, proliferation, apoptosis, and
DNA repair are in equilibrium and this ensures a steady state of healthy cells. In the
progression of changes leading from a normal mucosa to carcinoma, at least five to seven
major molecular alterations need to occur. Extensive studies on colorectal cancer (CRC)
have identified specific genetic changes in various proto-oncogenes, tumor suppressor
genes, and DNA mismatch repair genes, as well as alterations in DNA methlyation status
and inherited genetic defects. Subsequently, several molecular pathways have been
identified which can contribute to the development of CRC. In 1990, Fearon and
Vogelstein (2) proposed a genetic pathway of colorectal tumorigenesis, which is now
generally accepted as the classical model for the development of CRC. The model
postulates that at least five to seven major molecular alterations need to occur for a normal
epithelial cell to proceed to carcinoma. This process is now accepted as central to the
majority of cancers and has been studied extensively in CRC.
Bacteria have been linked to cancer by two mechanisms: induction of chronic
inflammation following bacterial infection and production of toxic bacterial metabolites.
225
226 Heavey et al.
The latter mechanism has a strong link with diet. Carcinogenic agents may be present
in the diet or formed in vivo during digestion. Many of these mechanisms involve the
metabolic activities of the microbiota normally resident in the human colon. This paper
discusses both the detrimental and beneficial consequences of bacterial activity of the
gastrointestinal tract focusing on the stomach and large intestine.
THE STOMACH
The pH of the gastric contents of the fasting normal human is usually less than three, which
is sufficient to kill most commensal bacteria (3). However, during a meal the gastric acid is
buffered, allowing bacteria ingested with food to survive at least until the pH falls, and
thus permitting a transient gastric microbiota. However, where gastric acid secretion is
impaired, bacteria can survive longer and even proliferate in the elevated pH conditions.
Reduced gastric acid secretion (hypochlorhydria) occurs naturally with ageing (4) and is
common after gastric surgery. Certain diseases such as pernicious anemia and
hypogammaglobulinaemia are associated with achlorhydria, which results in the gastric
pH rising to seven and above (4). This allows a diverse microbiota with up to 10 9
organisms per gram to establish, consisting usually of species of salivary bacteria of the
genera Streptococcus, Neisseria, Staphylococcus, and Veillonella, although Bacteroides,
Lactobacillus and Escherichia species are also found (4). Hypochlorhydria is also
common in patients with atrophic gastritis associated with chronic Helicobacter pylori
H. pylori infection.
The presence of a gastric microbiota in hypochlorhydric and achlorhydric
individuals has potential toxicological sequelae since it increases the probability of
xenobiotic metabolism by the bacteria, particularly since the gastric emptying time of such
patients may be up to 5 hours (4). It has been suggested that the increased gastric cancer
risk of achlorhydric patients is linked to increased formation of N-nitroso compounds
(NOC) by their gastric microbiota (5).
Helicobacter pylori
H. pylori is a Gram-negative bacterium found in the human stomach and plays an
important role in the pathogenesis of chronic gastritis and peptic ulcers (6). Additionally,
both epidemiological and clinical evidence has indicated that H. pylori is associated with
an increased risk of gastric carcinoma (7,8) and as such it is the first bacterium to be termed
a definitive cause of cancer by the International Agency for Research into Cancer (I ARC).
The cag pathogenicity island appears to play an important role in the aetiology of the
disease since, in developed countries, strains of H. pylori that carry it are associated with
an increased risk of peptic ulcer and adenocarcinoma than strains that are negative for the
cag island (9).
The precise mechanisms involved in its pathogenesis have yet to be fully elucidated
although numerous clues can be derived from in vitro models and animal studies.
The inflammatory effects of H. pylori infection have been related to cancer due to
increased cell proliferation and production of mutagenic free radicals and NOC (10). In the
Mongolian gerbil model ofH. pylori infection, it has been shown that H. pylori inoculation
can induce abnormality in gastric mucosal cell proliferation (11).
Infection with H. pylori is associated with significant epithelial cell damage as well
as an increased level of apoptosis. However, the mechanism for H. pylori induced
apoptosis in gastric epithelial cells remains uncertain. Apoptosis is a genetically
programmed mode of cell death that is regulated by many genes, including oncogenes
The Gastrointestinal Microbiota in Cancer 227
and oncosuppressor genes, which may be mutated, delayed or abnormally expressed in
neoplasia, thus altering tumor cell susceptibility to apoptosis (12). The role of the p53
tumor supressor gene in apoptosis is currently of particular interest. Genetic abnormalities
in this gene have been observed in a wide range of human cancers, and are also closely
associated with the transition from adenoma to carcinoma (13). The mutational
inactivation of p53 function allows cells to continue with their cell cycle, meaning
damaged or mutated DNA is propagated in the next generation of cells.
Zhang and coworkers (14) examined the effect of H. pylori on gastric epithelial
cells and the role of p53 and showed that the organism induced a time and dose dependent
inhibition of cell growth and apoptosis over 72 hours. In agreement with other findings
(15), at low inoculations of H. pylori, cell DNA synthesis was stimulated compared to the
controls. They also demonstrated no difference in the induction of gastric cell epithelial
cell apoptosis and cell proliferation between cells exposed to cagA positive and cagA
negative strains. In addition, H. pylori infection was associated with changes in oncogene
and tumor suppressor gene expression as shown by increased ras p21 expression and p53
mutation in H. pylori positive cases of gastric cancer (16). Cell cycle regulatory proteins
have also been identified as critical targets during carcinogenesis. It has been shown that
chronic H. pylori infection is associated with decreased expression of the cyclin
dependent kinase inhibitor (CDI) p27kipl. Another CDI, pl6Ink4a (pi 6) is over-
expressed in gastric epithelial cells of H. pylori patients and this is associated with an
increase in apoptosis (17).
High dose vitamin C has been shown to inhibit H. pylori growth and colonization
(18) and at physiological concentrations it induced H. pylori associated apoptosis and
cell cycle arrest in vitro (19). Such effects may account for the observed negative
association between dietary vitamin C intake and gastric cancer risk (20) although other
mechanisms include the ability of vitamin C to scavenge reactive oxygen species and
inhibit NOC formation. Other studies have implicated cigarette smoking and low levels
of dietary vitamin C as a contributing factor in those high risk individuals with H. pylori
infection (21,22).
Overexpression of cyclooxygenase 2 (COX-2) has also been observed in tissues of
human gastric cancer. There are two isoforms of COX; COX-1 and COX-2. These are key
enzymes that convert arachidonic acid to prostaglandins. COX-1 is expressed in most
human tissues, whereas COX-2 is usually undetectable. Overexpression of COX-2 has
been implicated in a number of cancers including gastric and colon cancer. It has been
shown that COX-2 was overexpressed in 84% of gastric cancer specimens and those
specimens with cagA positive strain expression had a significantly higher expression of
COX-2 than the specimens with cagA negative strain expression (23). It has therefore been
suggested that the application of COX-2 selective inhibitors may be an effective
preventive strategy for gastric cancer and in particular those that would not cause
gastrointestinal complications. Both nonsteroidal anti-inflammatory drug (NSAID) use
and H. pylori infection independently and significantly increase the risk of peptic ulcer and
ulcer bleeding. In a meta-analysis of the data it was interpreted that there was synergism
for the development of peptic ulcer and ulcer bleeding between H. pylori infection and
NSAID use (24).
The prevalence of H. pylori infection is falling in developing countries and this has
been linked to changes in the epidemiology of gastrointestinal diseases, in particular
reduced incidence of gastric cancers in western countries (25,26). Improved nutrition,
water supplies and reduced family sizes have been associated with reduced H. pylori
colonization (25). Novel treatment of this infection using probiotics is in the initial stages
and results indicate only a slight improvement (27).
228 Heavey et al.
THE LARGE INTESTINE
It is becoming increasingly evident that the large and complex bacterial population of the
large intestine and their metabolism has an important role in toxicity of ingested chemicals
and in cancer (28-31). A number of potential mechanisms have been proposed whereby
gut bacteria may impact carcinogenesis. They may have a direct effect through the binding
of potential mutagens and thus reduce exposure to the host (32). The normal microbiota
present in the gut is known to produce and release toxins, which can bind specific cell
surface receptors and affect intracellular signal transduction (33). Bacterial involvement in
CRC has been widely studied with most information being derived from animal work and
some human studies. Evidence from a wide range of sources supports the view that the
colonic microbiota is involved in the etiology of cancer (Table 1).
Gut Bacterial Involvement in Colorectal Cancer
Comparisons of the fecal microbiota of healthy subjects and colon cancer patients have
not revealed any consistent patterns, possibly due to the difficulties in culturing and
identifying gut organisms. Elevated numbers of Bacteroides have been associated with
increased colon cancer risk in humans (34,35). Similarly, lecithinase-negative Clostridium
and Lactobacillus were more abundant in colon cancer patients (36) although in another
study, some Lactobacillus species and Eubacterium aerofaciens have been associated with
reduced risk (35).
In animals, the presence of the intestinal microbiota has a major impact on colonic
tumor formation (37,38). In a study conducted by Reddy and coworkers (38) the rate
of tumor formation was much more rapid in conventional than in germ-free rats treated
with the tumor initiator 1,2-dimethylhydrazine (DMH). After 20 weeks, 17% of
conventional rats had colon carcinomas, whereas there were no tumors (adenomas or
carcinomas) in the germ-free animals. At 40 weeks, two out of 18 germ-free rats had
developed benign adenomas (although still none had carcinomas), compared to six out of
24 conventional rats with tumors (4 cancers, 2 adenomas); thus the gut microbiota had a
tumor-promoting effect when DHM was the tumor initiator.
A high incidence of spontaneous CRC has been demonstrated in the T-cell receptor
(TCR) P chain and p53 double-knockout mice. In one study, 70% of the animals with a
conventional microbiota developed adenocarcinomas, whereas adenocarcinoma of the
colon did not occur in germ-free TCR $~'~ p53~'~ mice, thus indicating a major role for
the intestinal microbiota (39).
Table 1 Evidence That the Colonic Microbiota Is Involved in the Etiology of Colon Cancer
Human feces have been shown to be mutagenic, and genotoxic substances of bacterial origin have
been isolated
Intestinal bacteria can produce, from dietary components, substances with genotoxic, carcinogenic,
and tumor-promoting activity
Gut bacteria can activate procarcinogens to DNA reactive agents
Germ-free rats fed human diets exhibit lower levels of DNA adducts in tissues than conventional rats
Germ-free rats treated with the carcinogen 1 ,2-dimethylhydrazine have a lower incidence of colon
tumors than similarly treated rats having a normal microbiota
Germ-free T-cell receptor chain and p53 double-knockout (TCR3~ p53~ ") mice did not develop
adenocarcinoma of the colon at 4 months of age. Adenocarcinomas of the ileocecum and cecum
were detected in 70% of the conventional TCR(3 -/ ~ p53 _/ ~ mice
The Gastrointestinal Microbiota in Cancer 229
Streptococcus bovis has been implicated in colonic neoplasia and supplements of
this strain of bacteria and antigens extracted from the bacterial cell wall were shown to
induce formation of hyperproliferative aberrant colonic crypts and increase the expression
of proliferation markers in carcinogen treated rats (40). The effect of individual bacteria on
cancer risk varies. Mice mono-associated with Mitsuokella multiacida, Clostridium
butyricium or Bifidobacterium longum had a higher incidence of colonic adenoma (68% in
each case) as compared to those associated with Lactobacillus acidophilus (30%) (41).
Gut Bacterial Metabolism and CRC Risk
The enormous numbers and diversity of the human gut microbiota is reflected in a large
and varied metabolic capacity, particularly in relation to xenobiotic biotransformation,
carcinogen synthesis and activation. The metabolic activities of the gut microbiota can
have wide-ranging implications for the health of the host (42). To date the vast majority of
mechanisms whereby bacteria are involved in carcinogenesis involve toxic or protective
products of bacterial metabolism. Such metabolic activities include numerous enzymatic
reactions and degradation of undigested dietary residues. Diet can substantially modulate
these activities by providing a vast array of substrates. A wide range of enzyme activities
capable of generating potentially carcinogenic metabolites in the colon are associated with
the gut microbiota, including (3-glucuronidase, (3-glucosidase, nitrate reductase and nitro-
reductase. These are usually assayed in fecal suspensions and appear to be present in many
bacterial types (43-52).
A major role for the intestinal microbiota has been identified in the metabolism of
the bile acids. The primary bile acids, chenodeoxycholic acid and cholic acid, are subject
to extensive metabolism by the intestinal microbiota (53), predominantly 7-a-
dehydroxylation, which converts cholic to deoxycholic acid (DCA) and chenodeoxycholic
acid to lithocholic acid (LCA). These secondary bile acids exert a range of biological and
metabolic effects in vitro and in vivo including cell necrosis, hyperplasia, and tumor-
promoting activity in the colon, induction of DNA damage and apoptosis (54). It has also
been suggested that secondary bile acids influence CRC by selecting for apoptosis-
resistant cells or by interacting with various secondary messenger signaling systems.
A number of human observational studies in patients with adenomas or CRC have
reported a correlation between fecal bile acid (FBA) concentrations and CRC risk (55,56).
Some studies have also suggested that high fecal DCA concentrations and DCA to LCA
ratio are associated with increased CRC risk (57). However, not all studies have confirmed
this relationship between bile acids and CRC risk (58).
Formation of Protective Agents During Fermentation
Both dietary and endogenous carbohydrate substrates (e.g., starch and non-starch
polysaccharides and intestinal mucins) are hydrolyzed by gut bacterial enzymes to
produce the short chain fatty acids (SCFAs), acetate, propionate, and butyrate (59). These
SCFAs provide an energy source for the intestinal cells and are also thought to confer
beneficial effects on the host. SCFAs decrease colonic and fecal pH and this acidic
environment is thought to be beneficial to the host (60). Specific oligosaccharides and
resistant starch that result in SCFAs, and in particular butyrate (61) may have the potential
to decrease CRC risk. This SCFA is of specific interest since it has been shown to induce
apoptosis in colon adenoma and colon cell lines. In vitro studies have shown that
increased butyrate supply to colon cells induces growth of the gut epithelium whereas
reduced butyrate supply causes gut atrophy and functional impairments (62). Sodium
230 Heavey et al.
butyrate has been observed to induce apoptosis and to alter the resistance of colonic tumor
cells to apoptosis (62). However, the majority of these results have come from
experiments conducted in vitro and again there have been conflicting views (63).
It follows from the above that modification of the gut microbiota may exert a
beneficial effect on the process of carcinogenesis and this opens up the possibility for
dietary modification of colon cancer risk. Probiotics and prebiotics, which modify the
microbiota by increasing the numbers of lactobacilli and/or bifidobacteria in the colon,
have been a particular focus of attention in this regard. In general species of
Bifidobacterium and Lactobacillus have low activities of those enzymes involved in
carcinogen formation and metabolism by comparison to other major anaerobes in the gut
such as Bacteroides, Eubacteria and Clostridia (44). This suggests that increasing the
proportion of lactic acid bacteria (LAB) in the gut could modify, beneficially, the levels of
xenobiotic metabolizing enzymes. This manipulation of the gut is discussed in greater
detail in other chapters within this book. Overall, experimental and animal research show
encouraging effects of several probiotic strains to decrease colon cancer, leading the way
to the development of well-designed human intervention trials.
Effects of Gut Microbiota on Gene Expression
To date, there are only a few molecular descriptions of how bacteria in the normal
microbiota regulate gene products with presumed positive functions in the intestine or
systemically. Dramatic changes in gene expression were noted when germ-free mice
were mono-colonized with Bacteroides thetaiotaomicron, a component of the normal
microbiota of adult mice and humans (64). A number of genes involved in general
mechanisms like nutrient uptake, fortification of the intestinal epithelial barrier,
postnatal development, and angiogenesis are regulated in response to this commensal
microbe. In addition, it is becoming clear that metabolic products, produced by the gut
microbiota, can alter gene expression in the colonocyte [e.g., butyrate, produced by
bacterial fermentation of dietary fiber, induces p21/Cipl/WAFl mRNA (important in cell
cycle control)] and secondary bile acids, produced from primary bile acids by the gut
microbiota, alter AP-1 -dependent and COX-2 gene transcription) (65,66).
SURROGATE MARKERS FOR DIET-RELATED
COLON CANCER STUDIES
As discussed above, the gut microbiota has been implicated in the etiology of CRC by a
number of studies and these observations form the theoretical basis for the use of several
gut microbiota biomarkers (fecal biomarkers) in studies on diet and colon cancer. They are
composed of two main categories; those examining the activity of bacterial enzymes or
bacterial metabolites and those based on bioassays on fecal water. For a more thorough
review of this subject, the reader is referred to Rafter and coworkers (67).
Bacterial Enzymes
A wide range of enzyme activities capable of generating potentially carcinogenic
metabolites in the colon are associated with the gut microbiota, including P-glucuronidase
P-glucosidase, nitrate- and nitro-reductase. These are usually assayed in fecal suspensions
and appear to be present in many bacterial types. Of these enzymes, P-glucuronidase has
been the most extensively investigated as a biomarker of CRC risk. It should be noted that
The Gastrointestinal Microbiota in Cancer 231
these factors are associated with the generation of carcinogens and promoters and do not
have a direct link with tumors.
(5 -Glucuronidase
Many carcinogenic compounds are metabolized in the liver and then conjugated to
glucuronic acid before being excreted via the bile into the small intestine. In the colon
bacterial P-glucuronidase can hydrolyze the conjugates, releasing the parent compound or
its activated, hepatic metabolite.
The activity of P-glucuronidase in the colon can alter the likelihood of tumor
induction in animal models of CRC. The use of a P-glucuronidase inhibitor administered
in conjunction with the carcinogen azoxy methane (which undergoes activation and
conjugation in the liver) significantly reduces the number of tumors formed in the rat
colon, indicating that microbiota P-glucuronidase has a role in tumor induction. Metabolic
epidemiological studies have shown that populations at high risk of CRC have high levels
of fecal P-glucuronidase activity. Furthermore, fecal P-glucuronidase activity in colon
cancer patients is significantly higher than in healthy controls.
The activity of P-glucuronidase is influenced by diet. High risk diets for CRC have
consistently been shown to increase P-glucuronidase activity relative to low risk diets.
Furthermore, various types of fiber decrease the activity of P-glucuronidase in rats.
Although it represents a simple reproducible marker, evidence for a role for
P-glucuronidase in human CRC is indirect and is remote from the final endpoint (tumors).
Metabolites
A wide range of metabolites with potential genotoxic, tumor-promoting and anti-
carcinogenic activities have been identified in feces.
N-Nitroso Compounds
Nitrate, ingested via diet and drinking water, is reduced by gut bacterial nitrate reductase
to its more reactive and toxic reduction product, nitrite. Nitrite reacts with nitrogenous
compounds in the body to produce NOC. The reaction can occur chemically in the acidic
conditions prevalent in the human stomach and can also be catalyzed at neutral pH by gut
bacteria in the colon.
The term NOC covers a wide range of compounds including N-nitrosamines,
N-nitrosamides, N-nitrosoguanidines, and N-nitrosoureas, the majority of which are
highly carcinogenic, DNA alkylating agents. However, the genotoxic or carcinogenic
activity of the NOC produced by the bacterial N-nitrosation process in the large intestine
has not yet been established.
Fecal apparent total NOC (ATNC) excretion is increased by red meat consumption.
In conjunction with high meat intakes, wheat bran, resistant starch and vegetable
consumption had no effect on fecal ATNC excretion or concentration.
Secondary Bile Acids
The primary bile acids, chenodeoxycholic acid and cholic acid, are subject to extensive
metabolism, predominantly 7-a-dehydroxylation, by the intestinal microbiota, which
converts cholic to DCA and chenodeoxycholic to LCA. These are termed secondary
bile acids.
232 Heavey et al.
Epidemiological studies indicate that concentrations of secondary bile acids are
higher in populations at high risk of CRC and in case control studies 7-a-dehydroxylase
activity is higher in cases than controls. In human studies, high fat intake, which correlates
with CRC risk, increases FBA concentrations, whereas increased consumption of wheat
bran (negatively correlated with CRC risk) reduces FBA concentration.
Short Chain Fatty Acids
The SCFAs acetate, propionate, and butyrate are the principal end-products of
carbohydrate fermentation. These are absorbed from the colonic lumen and metabolized
by various body tissues. Butyrate is preferentially metabolized by colonocytes.
There is evidence from in vitro studies and animal models (where cecal SCFA
concentrations can be measured) that the type of carbohydrate has an important influence
on the amount and proportions of SCFA produced, with starch and wheat bran being
particularly associated with elevated butyrate production. In human studies, inulin has
been shown to enhance excretion of total SCFA in human feces, whereas wheat bran
increased absolute or relative proportions of butyrate in feces. Where the butyrate is
produced relative to proximal and distal regions of the colon is important and should be a
methodological consideration.
Gut bacterial enzymes and fecal metabolites are relatively simple to measure
routinely and in general may be of use in assessing effects of diet on modulating exposure
of the colon to potential carcinogens, rather than reflecting cancer risk.
Fecal Water Activities
Fecal Water Cytotoxicity
There is considerable evidence that colon tumors are a result of gut luminal factors
damaging the mucosa. Furthermore, free reactive and soluble factors are more likely to
affect the epithelium than substances bound to the insoluble matrix such as fiber.
Therefore, an alternative approach to assaying enzymes or metabolites in feces is to
assess toxicological activity of fractions using short-term tests for toxicity, genotoxicity,
and mutagenicity. Usually the aqueous phase of the human feces (fecal water) is used,
since this will contain most of the free reactive species. For assessment of fecal water
cytotoxicity, the effect on proliferation of human colon carcinoma cells in culture
is used.
Proliferative zone expansion in the colonic crypts and an increased rate of epithelial
proliferation are considered to be an early step in carcinogenesis. Stimulation of
proliferative activity in colonic epithelium may in part be mediated via cytotoxic
mechanisms, resulting in increased cell loss at the epithelial surface and a compensatory
rise in mitotic activity of the crypts. Such considerations led to the development of assays
to assess cytotoxic activity in fecal water towards colon cells in vitro. It is thought that bile
acids, especially secondary bile acids, make a major contribution to fecal water
cytotoxicity. In a comparison of fecal water cytotoxicity in patients at low (no colon
adenomas) medium (small colorectal adenomas) and high (large tubular adenomas) risk of
CRC, no significant differences between the groups were observed.
Interventions using dietary regimes associated with increased or decreased CRC risk
have been shown to modulate appropriately fecal water cytotoxicity. For example, dietary
calcium has frequently been shown to reduce the cytotoxicity of fecal water presumably by
precipitating soluble bile acids. Fecal water cytotoxicity was higher in subjects on a high
fat, low calcium, low fiber diet compared with those on a low fat, high calcium, high fiber
The Gastrointestinal Microbiota in Cancer 233
regime. In rats, a high red meat consumption increases the cytotoxicity of fecal water. This
effect was independent of the fat and bile acid content of the fecal water and may be related
to dietary haem.
Fecal Water Genotoxicity
The presence of DNA damaging activity towards human cultured colon cells has been
demonstrated in samples of fecal water from healthy human subjects. A wide variation was
found ranging from negligible to high activity. The presence of genotoxic activity in fecal
water can be considered to reflect exposure of the colonic mucosa to carcinogens.
There is now convincing evidence that CRC is induced by a series of mutational
events in a number of critical genes. Sporadic colorectal tumors have been shown to
contain mutations and deletions in oncogenes, and tumor suppressor genes such as Ape,
K-ras, and p53. DNA damage has been detected in biopsies of colon tissue derived
from laboratory animals and human subjects. Thus, the presence in the colonic lumen
of DNA damaging agents could represent an important risk factor for CRC. There are
as yet no reports of validation studies for the endpoint in patients at different risk
of CRC.
In healthy subjects, a diet high in fat and meat, but low in dietary fiber (hence
considered to be of high CRC risk) was associated with a significantly increased fecal
water genotoxicity by comparison to a diet low in fat and meat.
Cytotoxicity and particularly genotoxicity of fecal water have a good mechanistic
link with colon carcinogenesis and hence provide potentially valuable, non-invasive
methods for assessing CRC risk in human subjects. However, there is a need for more
extensive validation of these endpoints.
CONCLUSION
It is becoming increasingly evident that the microbiota of the gastrointestinal tract and in
particular that of the large intestine interacts with its host and may exert either harmful or
protective effects, thus participating in the etiology of cancer. Gastric adenocarcinoma is
the second leading cause of cancer-related deaths in the world and has been associated
with the presence of H. pylori in the stomach. Several mechanisms of how this bacterium
may affect tumorigenesis have been identified as well as dietary and environmental
agents, which may confer either protective or detrimental effects. Colon cancer is the
fourth most common cancer worldwide and again environmental factors and in particular
diet play an important role in this disease. It has been shown that the microbiota of the gut
interacts with its host both locally and systemically resulting in a broad range of effects,
which may have both beneficial and detrimental outcomes, for nutrition, infections,
xenobiotic metabolism, toxicity of ingested chemicals, and cancer. It is important to gain
more insight into the pathogenesis of these cancers in order to develop more effective
preventive and treatment strategies. The use of pro- and prebiotics may serve to induce
beneficial effects on the host. Further research from well-planned intervention trials is
required to further our understanding of the role of these agents in human carcinogenesis.
Finally, as our understanding of the role of the gut microbiota in health and disease
improves, we will be able to develop even better surrogate markers for use in human
dietary intervention studies.
234 Heavey et al.
REFERENCES
1 . Cummings JH, MacFarlane GT. The control and consequences of bacterial fermentation in the
human colon. J Appl Bacteriol 1991; 70:443^159.
2. Fearon ER, Vogelstein B. A genetic model for colorectal tumorgenesis. Cell 1990; 61 :759-767.
3. Draser BS. The bacterial flora of the intestine. In: Rowland IR, ed. The role of the Gut Flora in
Toxicity and Cancer. London: Academic Press, 1988:23-38.
4. Hill MJ. In: Hill MJ, ed. The role of Gut Bacteria in Human Toxicology and Pharmacology.
London: Taylor and Francis, 1995.
5. Hill MJ. Gut flora and cancer in humans and laboratory animals. In: Rowland IR, ed. The role
of the Gut Flora in Toxicity and Cancer. London: Academic Press, 1988:461-502.
6. Graham DY, Lew GM, Klein PD, et al. Effect of treatment of Helicobacter pylori infection on
the long-term recurrence of gastric or duodenal ulcer: a randomised, controlled study. Ann Int
Med 1992; 116:705-708.
7. Asaka M, Kimura T, Kato M, et al. Possible role of Helicobacter pylori infection in early
gastric cancer development. Cancer 1994; 73:2691-2694.
8. Kikuchi S, Wada O, Nakajaima T, et al. Serum anti-He licobacter pylori antibody and gastric
carcinoma among young adults. Research group on prevention of gastric carcinoma among
young adults. Cancer 1995; 75:2789-2793.
9. Atherton JC. H. pylori virulence factors. Br Med Bull 1998; 54:105-120.
10. Moss SF. The carcinogenic effect ofH. pylori on the gastric epithelial cell. J Physiol Pharmacol
1999; 50:847-856.
11. Yao YL, Xu B, Song YG, et al. Effect of Helicobacter pylori infection on gastric mucosal cell
proliferation in mongolian gerbils. Di Yi Junyi Daxue Xuebao 2002; 22:348-350.
12. Arends MJ. How do cancer cells die? Apoptosis and its role in neoplastic progression. In:
Leake R, Gore M, Ward RH, eds. The Biology of Gynaecological Cancer. Royal College of
Obstetricians and Gynaecological Press, London, 1995:73-91.
13. Cho KR, Vogelstein B. Suppressor gene alterations in the colorectal adenoma-carcinoma
sequence. J Cell Biochem 1992; 16G:137-141.
14. Zhang ZW, Patchett SE, Farthing MJ. Role of Helicobacter pylori and p53 in regulation of
gastric epithelial cell cycle phase progression. Dig Dis Sci 2002; 47:987-995.
15. Wagner S, Beil W, Westermann J, et al. Regulation of gastric epithelial cell growth by
Helicobacter pylori: offdence for a major role of apoptosis. Gastroenterology 1997;
113:1836-1847.
16. Wang J, Chi DS, Kalin GB, et al. Helicobacter pylori infection and oncogene expressions in
gastric carcinoma and its precursor lesions. Dig Dis Sci 2002; 47:107-113.
17. Shirin H, Hibshoosh H, Kawabata Y, et al. P16Ink4a is overexpressed in H. /?y /on-associated
gastritis and is correlated with increased epithelial apoptosis. Helicobacter 2003; 8:66-71.
18. Correa P, Malcolm G, Schmidt B, et al. Antioxidant micronutrients and gastric cancer. Aliment
Pharmacol Ther 1998; 12:73-82.
19. Zhang HM, Wakisaka N, Maeda O, Yamamoto T. Vitamin C inhibits the growth of a bacterial
risk factor for gastric carcinoma: Helicobacter pylori. Cancer 1997; 80:1897-1903.
20. Zhang ZW, Abdullahi M, Farthing MJ. Effect of physiological concentrations of vitamin C on
gastric cancer cells and Helicobacter pylori. Gut 2002; 50:165-169.
21. Kaaks R, Tuyns AJ, Haelterman M, Riboli E. Nutrient intake patterns and gastric cancer risk: a
case control study in Belgium. Int J Cancer 1998; 78:415-420.
22. You WC, Zhang L, Gail MH, et al. Gastric dysplasia and gastric cancer: Helicobacter pylori,
serum vitamin C and other risk factors. J Natl Cancer Inst 2000; 92:1607-1612.
23. Guo X, Wang L, Yuan Y. Association between Helicobacter pylori cagA strain infection and
expression of cyclooxygenase 2 in gastric carcinoma. Chin Med J 2002; 82:868-871.
Breuer NF, Dommes P, Jaekel S, Goebell H. Fecal bile acid excretion pattern in colonic cancer
patients. Dig Dis Sci 1985; 30:852-859.
24. Huang JQ, Sridhar S, Hunt RH. Role of Helicobacter pylori infection, and non-steroidal anti-
inflammatory drugs in peptic-ulcer disease: a meta-analysis. Lancet 2002; 359:14-22.
The Gastrointestinal Microbiota in Cancer 235
25. Blaser MJ. Helicobacters are indigenous to the human stomach: duodenal ulceration is due to
changes in microecology in the modern era. Gut 1998; 43:721-727.
26. Logan RP, Walker MM. ABC of the upper gastrointestinal tract: epidemiology and diagnosis of
Helicobacter pylori infection. BMJ 2001; 323:920-922.
27. Michetti P, Dorta G, Wiesel PH, et al. Effect of whey-based culture supernatant of
Lactobacillus acidophilus (johnsonii) Lai on Helicobacter pylori infection in humans.
Digestion 1999; 60:203-209.
28. Mitsuoka T. Recent trends in research on intestinal flora. Bifidobacteria Microflora 1982;
3:3-24.
29. Draser BS. The bacterial flora of the intestine. In: Rowland IR, ed. The Role of the Gut Flora in
Toxicity and Cancer. London: Academic Press, 1998:23-38.
30. Rowland IR, ed. Role of the Gut Flora in Toxicity and Cancer. London: Academic Press, 1988.
31. Rowland IR. Toxicology of the colon: role of the intestinal flora. In: Gibson GR,
MacFarlane GT, eds. Human Colonic Bacteria: Role in Nutrition, Physiology and Pathology.
Boca Raton: CRC Press, 1995:155-174.
32. Orrhage K, Sillerstrom E, Gustafsson JA, et al. Binding of the mutagenic heterocyclic amines
by intestinal and lactic acid bacteria. Mutat Res 1994; 311:239-248.
33. Fassano A. Cellular microbiology: can we learn cell physiology from microorganisms? Am
J Physiol 1999; 276:C765-C776.
34. Hill MJ, Draser BS, Hawksworth G, et al. Bacteria and aetiology of cancer of the large bowel.
Lancet 1971; i:95-100.
35. Moore WE, Moore LH. Intestinal floras of populations that have a high risk of colon cancer.
Appl Environ Microbiol 1995; 61:3202-3207.
36. Kanazawa K, Konishi F, Mitsuoka T, et al. Factors influencing the development of sigmoid
colon cancer. Bacteriologic and biochemical studies. Cancer 1996; 77:1701-1706.
37. Reddy BS, Narisawa T, Maronpot R, et al. Animal models for the study of dietary factors and
cancer of the large bowel. Cancer Res 1975; 35:3421-3426.
38. Reddy BS, Weisburger JH, Narisawa T, Wynder EL. Colon carcinogenesis in germ-free rats
with dimethylhydrazine, and N-nitrosamines in health and gastroduodenal disease. Lancet
1974; ii:550-552.
39. Kado S, Uchida K, Funabashi H, et al. Intestinal microflora are necessary for development of
spontaneous adenocarcinoma of the large intestine in T-cell receptor 3 chain and p53 double-
knockout mice. Cancer Res 2001; 61:2395-2398.
40. Ellmerich S, Djouder N, Scholler M, Klein JP. Production of cytokines by monocytes,
epithelial and endothelial cells activated by Streptococcus bovis. Cytokine 2000; 12:26-31.
41. Horie H, Kanawawa K, Okada M, et al. Effects of intestinal bacteria on the development of
colonic neoplasm: an experimental study. Eur J Cancer Prev 1999; 8:237-245.
42. Rowland IR, Gangolli SD. Role of gastro-intestinal microflora in the metabolic and
toxicological activities of xenobiotics. In: Ballentyne B, Marrs, TC, Syveron T eds. General
and Applied Toxicology 1999; P562-576.
43. Cole CB, Fuller R, Mallett AK, Rowland IR. The influence of the host on expression of
intestinal microbial enzyme activities involved in metabolism of foreign compounds. J Appl
Bacteriol 1985; 58:549-553.
44. Saito Y, Takano T, Rowland IR. Effects of soybean oligosaccharides on the human gut
microflora in in vitro culture. Microb Ecol Health Dis 1992; 5:105-110.
45. Tadaka H, Hirooka T, Hiramatsu Y, Yamamoto M. Effects of beta-glucuronidase inhibitor on
azoxymethane-induced colonic carcinogenesis in rats. Cancer Res 1982; 42:331-334.
46. Grasten SM, Juntunen KS, Poutanen KS, et al. Rye bread improves bowel function and
decreases the concentrations of some compounds that are putative colon cancer risk markers in
middle-aged women and men. J Nutr 2000; 130:2215-2221.
47. Kim DH, Jin YH. Intestinal bacterial beta-glucuronidase activity of patients with colon cancer.
Arch Pharmacol Res 2001; 24:564-567.
48. Eriyamremu GE, Osagie VE, Alufa OI, et al. Early biochemical events in mice exposed to
cycas and fed a nigerian-like diet. Ann Nutr Metab 1995; 39:42-51.
236 Heavey et al.
49. Rowland IR, Tanaka R. The effects of transgalactosylated oligosaccharides on gut flora
metabolism in rats associated with a human fecal microflora. J Appl Bacteriol 1993;
74:667-674.
50. Mallet AK, Rowland IR. Factors affecting the gut microflora. In: Rowland IR, ed. Role of the
Gut Flora in Toxicity and Cancer. London: Academic Press, 1988:347-382.
51. Hughes R, Cross AJ, Pollock JR, Bingham S. Dose-dependent effect of dietary meat on
endogenous colonic N-nitrosation. Carcinogenesis 2001; 22:199-202.
52. Silvester KR, Bingham SA, Pollock JR, et al. Effect of meat and resistant starch on fecal
excretion of apparent N-nitroso compounds and ammonia from the human large bowel. Nutr
Cancer 1997;29:13-23.
53. MacDonald IA, Sutherland JD, Cohen BI, Mosbach EH. Effect of bile acid oxazoline
derivatives on microorganisms participating in 7 alpha-hydroxyl epimenzation of primary bile
acids. J Lipid Res 1983; 24:1150-1559.
54. Gill CI, Rowland IR. Diet and cancer: assessing the risk. Br J Nutr 2002; 88:S73-S87.
55. Imray CHE, Radley S, Davis A, et al. Fecal unconjugated bile acids in patients with colorectal
cancer or polyps. Gut 1992; 33:1239-1245.
56. Stadler J, Yeung KS, Furrer R, et al. Proliferative activity of rectal mucosa and soluble fecal
bile acids in patients with normal colons and in patients with colonic polyps or cancer. Cancer
Lett 1988; 38:315-320.
57. Owen RW. Feacal steroids and colorectal carcinogenesis. Scand J Gastroenterol 1997;
222:76-82.
58. de Kok TM, van Maanen JM. Evaluation of fecal mutagenicity and colorectal cancer risk.
Mutat Res 2000; 463:53-101.
59. Silvi S, Rumney CJ, Cresci A, Rowland IR. Resistant starch modifies gut microflora and
microbial metabolism in human flora-associated rats inoculated with feces from Italian and
U.K. donors. J Appl Microbiol 1999; 86:521-530.
60. Scheppach W. Effects of short chain fatty acids on gut morphology and function. Gut 1994;
LS35-S38.
61. Bird AR, Brown IL, Topping DL. Starches, resistant starches, the gut microflora and human
health. Curr Issues Intest Microbiol 2000; 1:25-37.
62. Archer S, Meng S, Shei A, Hodin RA. P21WAFI is required for butyrate-mediated growth
inhibition of human colon cancer cells. Proc Natl Acad Sci USA 1998; 95:6791-6796.
63. Ishizuka S, Sonoyama K, Kassai T. Changes in the number and apoptosis of epithelial cells in
the colorectum of wheat bran-fed rats soon after administering 1,2-dimethylhydrazine. Biosci
Biotechnol Biochem 1997; 61:1337-1341.
64. Xu J, Bjursell MK, Himrod J, et al. A genomic view of the human- Bacteroides
thetaiotaomicron symbiosis. Science 2003; 299:2074-2076.
65. Smith JG, Yokoyama WH, German BG. Butyric acid from the diet: actions at the level of gene
expression. Clin Rev Food Sci 1998; 38:259-297.
66. Hodin RA, Meng S, Archer S. Cellular growth state differentially regulates enterocyte gene
expression in butyrate-treated HT-29 cells. Cell Growth Differ 1996; 7:647-653.
67. Rafter J, Govers M, Martel P, et al. PASSCLAIM — Diet-related cancer. European Journal of
Nutrition,. 2004; 43:1147-1184.
13
In Vitro Methods to Model
the Gastrointestinal Tract
Harri Makivuokko and Paivi Nurminen
Danisco Innovation, Kantvik, Finland
INTRODUCTION
The human intestinal microbiota has never been so intensively studied as in this current
period. Over the last decade, the use of molecular methods, especially those based on 16S
ribosomal RNA, have generated much knowledge on the composition of the intestinal
microbiota of especially humans but also animals. The relatively easy accessible fecal
sample is the main source of intestinal microbiota used for various analyses. It is uncertain
how well fecal samples reflect the composition of the microbiota in the proximal parts of
the colon (1,2) but it is certainly very different from the small intestine. In order to study
the microbial composition and activity in these sites, one would need in vivo samples from
a large number of healthy individuals. Invasive sampling from healthy people is ethically
not acceptable. Animal models can be used for invasive sampling (see chapter by
Henriksson); however, due to physiological and anatomical differences, animals will have
a different microbiota. Therefore, in vitro techniques complement animal studies and offer
means to test specific hypotheses in a controlled, replicable manner without using animal
models or clinical samplings. With in vitro models, it is possible to simulate the conditions
in the human oral cavity, stomach, duodenum, jejunum, ileum, and in the ascending,
transverse, and descending sections of the colon.
TYPES OF INTESTINAL SIMULATOR MODELS
In vitro models can be divided into batch cultures, chemostat-type simulators, including
semi-continuous and continuous cultures, and non-chemostat-type simulators. All models
of the gastrointestinal tract (GIT) have strictly anaerobic conditions in order to simulate
the environment that supports the growth of microbiota obtained from the GIT of humans
or other mammals. In vitro models can be used sequentially, so that in the simulators of
stomach and small intestine the food matrix can be digested using conditions and enzymes
representing the physiological conditions in the upper GIT, while the colon simulators
continue by simulating the microbial metabolism of the nondigestible residue. The
237
238
Makivuokko and Nurminen
different chemostat- and non-chemostat-type models have major structural differences,
but the batch fermentors are generally similarly structured, small-scale bottle fermentors.
The chemostat models can be run using inocula in either an in vitro steady-state (the
exponential growth of the bacterial has stabilized) achieved with several days of pre-
fermentation of the fecal inoculum or after a short (16-24 hours) pre-fermentation.
Batch-Type Simulators
The simplest and most commonly used in vitro method in microbiological studies is the use
of batch fermentation with intestinal fluid or fecal slurry to study the effects of different
added ingredients. These chemostat are typically anaerobically sealed bottles with fecal,
caecal or rumen material and these models simulate only a certain part of the animal's GIT,
e.g., mouse cecum or cow's rumen. The transit times of the intestinal fluids through those
areas are relatively short and therefore the run-times in batch fermenting simulations range
from 2-24 hours (3-7). The accumulation of fermentation products (e.g., SCFAs) can
change the conditions in the batch fermentation from the microbially balanced starting
point to a more competitive environment for the fermentative microbiota, thus affecting the
in vivo relevance in longer simulations. More complex fermentation models with several
vessels and fluid transitions between vessels either continuously or semi-continuously
avoid this accumulation of metabolites and depletion of nutrients.
Chemostat-Type Simulators
The in vitro colon simulators were introduced for the first time in 1981 (8), and all models
functioning today have a lot in common with this model. Rumney and Rowland reviewed
the first decade of in vitro simulators in their excellent article (3). Of the models reviewed
by Rumney and Rowland, the Reading model introduced by Gibson and co-workers in
1988 (9), revised 1998 by Macfarlane and co-workers (10), is still actively being used and
two new interesting models have been described in the literature. Of these, the SHIME
(Simulator for Human Intestinal Microbiological Ecosystem) model introduced by Molly
et al. in 1993 (11) and the EnteroMix® colon simulator introduced by Makivuokko et al.
N
Media
*=<p> = 3r
Figure 1 The Reading model. This model represents the human colon in three vessels:
VI proximal, V2 transverse, and V3 distal colon. Media is pumped to system continuously, and at the
same time there is a continuous overflow from vessel to vessel. Source: From Ref. 9.
In Vitro Methods to Model the Gastrointestinal Tract
239
Table 1 Colon Simulator Models
Reading
SHIME
EnteroMix®
TIM 1
TIM 2
Simulation
Colon
Stomach
Colon
Stomach
Colon
area
to colon
to ileum
Vessel
220-320 ml
300-1600 ml
6-15 ml
200 ml
200 ml
volumes
pH levels
5.8-6.8
5.0-7.0
5.5-7.0
1.8-6.5
5.8
Running times
14 days to
steady state
30 days
per cycle
2 days
~ 1 day
~3 days
Abbreviations: SHIME, Simulator for Human Intestinal Microbiological Ecosystem; TIM, TNO Intestinal Model.
in 2005 (12), together with the Reading model, are structurally chemostat models having
3-6 sequentially attached fermenting vessels with computer controlled fluid transition
systems (Fig. 1) and (Table 1). The Reading model and the EnteroMix model both
simulate only the human colon, and a similar artificial simulator media described by
Macfarlane et al. (10) is used in them to simulate the fluid entering the colon from the
small intestine. The SHIME model simulates the whole human GIT from stomach to colon
using artificial SHIME media, which has much in common with the medium described by
Macfarlane and co-workers (10). These three models have three different designs in fluid
transition. Fluids are either pumped semi-continuously to the subsequent vessels in three-
hour intervals (EnteroMix® model), there is a continuous overflow of fluids between
vessels (the Reading model), or the model can be a combination of these two types
(SHIME).
Reading Simulator
The Reading simulator (Fig. 1) simulates the gut using a 3 stage continuous culture with
three glass vessels (220 ml, 320 ml and 320 ml) and different pH in each vessel (5.8, 6.2,
and 6.8); mimicking the human proximal, transverse, and distal colon, respectively.
In the beginning of the simulation, each vessel is inoculated with 100 ml of 20%
(wt/vol) of human feces. The system is incubated in a batch overnight, after which a
continuous pumping of fresh simulator fluid to the first vessel is started. At the same time a
continuous overflow from vessel to vessel begins and the system is run for at least 14 days
in order achieve a steady- state condition in the vessels. The excess fluid from the third
vessel is collected to a waste container. The total retention time of the system can vary,
e.g., between 27 and 67 hours (10). The viability of the microbiota is determined by taking
samples at regular intervals from the vessels. After the incubation period, the test
substance is added to the system mixed in the fresh simulation fluid and the system is then
run to new steady state [e.g., for 22 days (9)]. The last phase is the washout period [e.g., for
50 days (9)] with the original simulation fluid to determine how long the changes induced
by the test substance can still be measured in the absence of the substrate itself.
SHIME Model
The current SHIME model is a single six-stage system, where the first three glass vessels
simulate stomach and small intestine and the subsequent three glass vessels the large
intestine (11a). The original SHIME model (Fig. 2) (11) was a single five-stage system
without the stomach compartment. Working volumes in these vessels are 300 ml for
stomach and small intestine, 1000 ml for ceacum and ascending colon, 1600 ml for
240
Makivuokko and Nurminen
acid
Pancreatic juice
Vessel 1
Vessel 2
Vessel 3
Vessel 4
Vessel 5
Figure 2 The original SHIME model. Vessels 1-5 in the figure mimic the different compartments
of the human GIT: duodenum + jejunum, ileum, caecum + ascending colon, transverse colon and
distal colon, respectively. In the revised version of this system, a vessel representing the stomach has
been added before vessel 1. First five pumps work semi-continuously, and pumps between vessels,
3-5 and effluent work continuously. Source: From Ref. 11.
transverse colon, and 1200 ml for descending colon. pH is controlled in vessels 2, 3, 4, 5,
and 6 in the ranges 5.0-6.5, 6.5-7.0, 5.5-6.0, 6.0-6.5 and 6.5-7.0, respectively.
The system is inoculated by introducing 10 ml supernatant of a human western diet
suspension per day to the three first vessels for eight successive days. The remaining three
vessels 4-6 representing the different compartments of the colon are inoculated with 50 ml
of fecal suspension for 10 successive days. The contents of these three vessels are pumped
continuously from vessel to vessel and finally to a discard bottle. The transit time of the
whole system is 84 hours.
In the beginning of the simulation, 200 ml of fresh SHIME media (11) is added to
vessel 1 (stomach) three times per day. Every 2-3 hours, the acidic (pH 2.0) contents of the
first vessel is pumped to vessel 2 (duodenum + jejunum) along with 100 ml of pancreatic
juice, supplemented with bile, to neutralize the acidity of the gastric effluent. After four
hours the contents of vessel 2 is pumped to vessel 3 (ileum).
After eight days of using SHIME media only, the actual test substrate mixed with the
SHIME media is introduced to the system. Feeding of the substrate is continued for 12 days,
followed by another SHIME media-only period for 8-10 days. This cycle of three periods is
repeated for all the studied substrates and samples are taken after each period.
The EnteroMix R Colon Simulator
The EnteroMix® model (Fig. 3) has four parallel units each comprising four glass vessels,
allowing four simulations to be run simultaneously using the same fecal inoculum (12).
EnteroMix model vessels 1, 2, 3, and 4 have the smallest working volumes (6, 8, 10, and
12 ml, respectively) of the three models presented here (Table 1). The pH levels in the
vessels (5.5, 6.0, 6.5, and 7.0, respectively) are similar to the other models. Because of the
small volumes of vessels, a 40 ml inoculum of 25% wt/vol human feces and only 4 g of
test substrate is needed for four parallel 48-hour simulations.
The simulation begins by filling the vessels of each of the four units with 0.9 mM
anaerobic NaCl (3, 5, 7, and 9 ml to vessels 1, 2, 3, and 4, respectively) and inoculating the
In Vitro Methods to Model the Gastrointestinal Tract
241
N 2 +NH 3
+37°C
fe^ fe^
+4°C
Fresh
medium
nT~1
V1
V2
V3
V4
6
+4°C
Effluent
3 ml
5.5
5 ml
6.0
7 ml
6.5
9 ml < Volume
7.0 <— PH
Figure 3 The EnteroMix® model. The figure represents the initial volumes of the system before
fresh medium is added to begin the simulation. The vessels VI to V4 are mimicking different
sections of the human colon: caecum + ascending, transverse, descending, and distal colon,
respectively. pH controlling and semi-continuous fluid transitions are operated via opening and
closing of computer controlled valves (S).
first vessel with 10 ml of fecal inoculum. The inoculum is mixed in the vessel with NaCl
and 10 ml of the mixed culture is pumped to the next vessel. This procedure continues
through the vessels and finally the excess inoculum is pumped to waste container from the
fourth vessel. After three hours of the incubation, 3 ml of fresh simulator media with (three
test channels) or without (one control channel) test substance is pumped to the first vessel.
The media is fermented in the first vessel for three hours, after which 3 ml of the fermented
media is transferred to the second vessel, and 3 ml of fresh media is pumped to the first
vessel. This procedure of transferring liquid to the next vessel continues through all the
vessels, so that finally after 15 hours, when 3 ml of fermented fluid has been transferred
from vessel four to the waste container for the first time, vessels 1, 2, 3, and 4 have
respective volumes of 6, 8, 10, and 12 ml of fermenting fluid. The fermentation and three-
hourly fluid transfers continue for 48 hours, after which the system is stopped and samples
are collected from each vessel.
Other Simulators
In addition to simulate different parts of the GIT, chemostat-type simulators have also
been used to simulate the oral cavity, in particular to investigate plaque formation (13);
and to simulate the urinary bladder to investigate antibiotic sensitivity of urinary tract
infection-causing pathogens (14). These simulators usually consist of a single
chemostat.
Non-Chemostat Models
The third type of model is actually comprised of two complementary parts, the TIM (TNO
Intestinal Model) systems 1 and 2 introduced by Minekus et al. in 1995 (15) and 1999 (16).
The TIM 1 system (Fig. 4) comprises eight sequentially attached glass modules and
mimics the stomach and small intestine, while the TIM 2-system consists of four glass
modules in a loop mimicking the proximal colon of monogastric animals (Fig. 5). These
242
Makivuokko and Nurminen
Figure 4 TIM 1 model. The model is mimicking the different sections of the human small
intestine: the gastric compartment (1), duodenum (2), jejunum (3) and ileum (4). Gastric (5) and
intestinal secretions (6), peristaltic valve pumps (7) and dialysis devices (8) are also included in this
simulator. Source: From Ref. 17.
dynamic models differ from the three previously presented models in two main aspects:
fluid transportation from vessel to vessel is executed via peristaltic valve-pumps and there
is a constant absorption of water and fermentation products through dialysis membranes.
In both systems the peristaltic movement of the intestinal fluid flowing in a flexible tube in
the middle of the modules is achieved by changing the pressure of the 37°C heated water
circulating between the module walls and the flexible tube. The peristaltic pressure around
the flexible tube is controlled via computer-controlled valves to mimic the gastric
emptying times. For the simulation of intestinal absorption TIM 1 has two integrated 5
kDa dialysis membranes, after jejunal and ileal modules, and TIM 2 has one, a hollow-
fiber membrane (molecular mass cut-off value 50 kDa) in the lumen of the system. The
TIM 1 dialysis membranes allow real-time collection of absorbable metabolites and water
that would be absorbable in the human jejunum and ileum. In the tube membrane of TIM 2
circulates dialysis fluid allowing absorption of e.g., water, and short-chain fatty acids. The
pH-values are monitored in each compartment.
In a TIM 1 simulation, a homogenized human meal is introduced into the gastric
compartment in pre- set times. From the stomach, the fluid is pumped through the
following six compartments. During the simulation, the secretion of enzymes, bile, and
pancreatic juice and the pH-controlling of the stomach (a pH gradient from 5.0 to 1.8 in
80 minutes from the beginning) and duodenum (constant pH 6.5) is regulated
via computer.
In a TIM 2 simulation the model is first inoculated with 200 ml of fecal inoculum.
Microbiota is allowed to adapt to the conditions for 16 hours, after which the actual
simulation is started by adding ileal medium semi-continuously with or without the tested
substrate to the system. The pH is constantly maintained constant at 5.8 representing the
pH-level in the proximal colon. Samples can be taken both from the lumen of the simulator
and from the dialysis liquid during the simulation.
In Vitro Methods to Model the Gastrointestinal Tract
243
Figure 5 TIM 2 model: The model represents the human proximal colon in one loop-shaped
system: peristaltic mixing with flexible walls inside (a), pH electrode (b), alkaline pump (c), dialysis
system (d), fluid level sensor (e), nitrogen inlet (f), peristaltic valves (g), sample port (h), gas
sampling (i) and ileal medium reservoir. Source: From Ref. 18.
Comparison of the Models
The four colon simulation models presented here have structural and functional
differences (Table 1), but the solutions used to reproduce the critical conditions that
influence the microbiology of the colon are similar in all four models. Firstly the colonic
microbiota is simulated in each model using fecal samples from a single donor or several
donors in a pooled sample, because more realistic samples of gastrointestinal tract bacteria
from the ileum or cecum of humans are very difficult to obtain both ethically and
technically. Secondly all the colon simulators use similar growth media that originate from
media originally published by Gibson et al. in 1988 (9) mimicking the ileal fluids obtained
from sudden-death victims. Thirdly all the colon models have strictly anaerobic
conditions, similar pH set-points representing the in vivo situation in the colon of healthy
humans (19) and all the functions of these systems are computer-controlled.
The Reading model and the SHIME system are both run until a steady state
in microbial growth is reached, while TIM 2 and the EnteroMix® model are run for
a pre-determined time (2 or 5 days). The SHIME system is the only one of the above-
mentioned four systems having a continuous line from stomach to distal colon, thus
enabling the simulation of the whole Gl-tract in one run. The simulated ileal fluid
coming from TIM 1 can also be used indirectly as growth medium in TIM 2. The
EnteroMix® model has the smallest working volumes (Table 1) in the vessels, enabling
the simulation of small concentrations of the tested substrate. On the other hand the
244 Makivuokko and Nurminen
small volumes do not allow any samplings during the simulation run, which is possible
in all the other models, because the volume of microbiota would be too heavily
affected in the vessels. The EnteroMix model is also the only model having parallel
channels in the same simulator allowing four parallel simulations to be run at the same
time with the same fecal inoculum.
SIMULATING THE RUMEN
Although the simulators described above are mainly aimed at simulating the human GIT, the
models can also be used to simulate the GIT of other monogastric animals. However for the
simulation of the ruminant GIT different factors have to be taken into consideration; in
particular the different functioning of the rumen, retaining and fermenting solid material
while liquid phase is allowed to pass on into the GIT.
The anaerobic environment of the rumen is heterogeneous in nature: a large volume
of free liquid, a complex solid mass of digesta, and a gas phase. Within this mixture, the
diverse microbial population of bacteria, protozoa, and anaerobic fungi can be described
as occurring in four different compartments (1) the microbes living free in suspension, (2)
the microbes loosely associated with the solid material, (3) the microbes that are trapped in
the solid material, and (4) the microbes close to or attached to the rumen wall (20). The
complexity is still increased due to the different removal rates of the solid and liquid
portions of rumen contents, revealing the dynamic nature of the rumen.
Rumen Simulators
The artificial rumen techniques developed over the past five decades for investigation of
rumen physiology as well as evaluation of feed rations, have ranged from batch
fermentations to more complicated continuous incubations. In addition, the absorption
function of the rumen wall has been included in some designs, in which a semi-permeable
membrane is applied for removal of the fermentation end products.
Batch Culture
The most simplistic, in vitro fermentations representing the rumen were performed in
different kinds of tubes (21-23). Another way to conduct a static, batch simulation is to use
closed glass serum bottles. As an example, in the study of Lopez et al. (24) 0.2 g of diet
(ground to pass through 1 mm screen) was weighed into the 120 ml serum bottles and the
fermentation process started by dispensing 50 ml of strained, 1 :4 (v/v) buffered rumen
fluid under C0 2 flushing. The bottles were sealed with butyl rubber stoppers and
aluminium caps and incubated in a shaking water bath at +39°C. After 24-hour
incubation, total gas production and pH were measured and samples for methane,
hydrogen, and short chain fatty acid analysis taken.
The durations of the reported batch fermentations employing rumen microbes have
varied from six (25) to 96 hours (26) or even up to 168 hours (27). The buffer systems
applied in batch simulations are quite often adopted from by Menke et al. (28), McDougall
(29), or Goering and van Soest (30).
Due to the fact that gas production has been used as an indirect measure of
digestibility and fermentation kinetics of ruminant feeds, a scaled glass syringe (volume
of 100-150 ml) has also been used as a fermentation vessel (28,37). The piston is allowed
to move upward without restrain and thus indicates the amount of gas released due to
In Vitro Methods to Model the Gastrointestinal Tract
245
microbial activity. The more sophisticated ways to measure gas production kinetics have
been reported, for example the syringe/electronic pressure transducer-equipment (32),
which measured and released the accumulated gas. However more automated systems
were, both an apparatus which combined electronic pressure transducers and electric
micro- valves (33) and the automated pressure evaluation system (APES) (34) where the
overpressure was released by use of pressure sensitive switches and solenoid valves.
Semi-Continuous Culture (Rusitec)
The structure of semi-continuous rumen simulation technique Rusitec (Fig. 6), which was
described by Czerkawski and Breckenridge (35), provides three of the four microbial
compartments mentioned earlier. A Rusitec reaction vessel with capacity of one liter consisted
of a Perspex cylinder (254 X 76) with an inlet at the bottom. The cylinder was sealed by flat
Perspex cover provided with a screw flange for easy access. The cover is provided with two
outlets, one for sampling and the other for effluent overflow and gas collection. The solids
(feed or digesta) were placed in nylon bags (pore size 50-100 urn) inside a perforated
container. This "cage" then slid up and down inside the reaction vessel, allowing the effluent to
flush the solids. At the bottom of the vessel, the artificial saliva (29) was continuously infused
and the excess liquid and the gases are forced out through an overflow by a slight positive
Figure 6 A schematic diagram of semi-continuous Rusitec unit: driving shaft (S), sampling valve
(V), gas-tight gland (G), flange (F), main reaction vessel (R), rumen fluid (L), perforated food
container (C), nylon gauze bag (N), rigid tube (T), inlet of artificial saliva (I), outlet through overflow
(O), line to gas-collection bag (M), vessel for collection of effluent (E). Source: From Ref. 35.
246
Makivuokko and Nurminen
pressure in the gas space. The proper fermentation temperature was maintained by incubating
the reaction vessel in water bath at 39°C during the experiment.
The fermentation in Rusitec was started by placing solid rumen digesta in one nylon
bag and an equal amount of feed to be used in a second nylon bag. The reaction vessel was
filled up to overflow with strained diluted rumen contents. After 24 hours the inoculum
bag was removed and replaced with a new bag of food. Removal of the oldest bag
(48 hours) and adding a new bag was repeated each day. At the beginning of the experiment
and during feeding, the gas space was flushed with the mixture of C0 2 and N 2 (5:95 v/v).
The removed bag is drained, placed in a plastic bag and the solids washed twice with the
artificial saliva. This rumination mimicking process includes gentle pressing of the solids
and squeezing out excess liquid, which is combined and returned to the reaction vessel.
The Rusitec technique has been quite widely applied as such. It has been used by a
number of authors to study, for example, decreased methanogenesis (36,37) and efficiency
of recovery of particle-associated microbes from ruminal digesta (38). In reported Rusitec
studies at least up to 16 reaction vessels have been applied simultaneously (39). The
running times of sample collection periods have exceeded from five (40) to 36 days (36)
after stabilizing the microbial population for 12 hours (39) to 17 days (40).
Continuous Culture
One of the earliest reports of continuous culture apparatus (Fig. 7) is the work of Stewart
et al. (41). With the device designed by Quinn (42) the incubation time could exceed
more beyond 24 hours because of the pH control system. In these simulation systems the
timed periodic impulse ^,
solenoid inflow valve
stirring motor /^wvent
float with
electrical contacts
»
»
^X
\ sampling
-V - " device
relay
solenoid outflow value H
IT
V,
thermometer
water
bath
constant
U/ C °2
pressure
ice bath
magnet
magnetic
stirring
motor
water bath heater
»
/
i
i
i
outflow receptacle
Figure 7 One of the earliest continuous culture systems for studying rumen fermentation. Source:
FromRef. 41.
In Vitro Methods to Model the Gastrointestinal Tract
247
zzzzzszzzzzzzzzzzzzszzzzzzzzzzzzzzz
Figure 8 A continuous culture apparatus providing absorption of fermentation products:
centrifugal water pump (A), gas-sampling port (B), fermentor (C), feeding port (D), water-drainage
pipe (E), Plexiglas reservoir (F), drainage tube (G), magnetic stirrer (H), water bath (I), dialysis sac
with cation-exchange resin (J), saliva-inflow ground-glass joint (K), fermentor stirring device (L),
gas-outlet tube (M), fermentor port (N), sampling glass tube and resin holder (O), liquid-effluent
collection funnel (P), peristaltic pump (Q), effluent outlet (R), effluent rubber tubing (S), saliva-water
reservoir (T), gas-collection bladder (U), feed-input apparatus (V). Ports D and N are shown 90° out
of phase from their actual position to simplify the drawing. Source: From Ref. 44.
water insoluble substrates were continuously delivered to the vessel in the form of a
slurry. One of the few devices taking the absorption of fermentation end products into
account was developed by Rufener et al. (43) and improved by Slyter et al. (44). The
apparatus (Fig. 8) consisted of six independent fermentation chambers (500 ml) with
accessories providing anaerobiosis, constant volume, agitation of the fermentation
mixture and collection of effluents and gases. For controlling the pH, this system
included a dialysis bag containing a mixture of ion-exchange resins, which absorbed the
short chain fatty acids. The fermentors were reported to reach the steady state in three to
248
Makivuokko and Nurminen
four days of operation. One criterion for this conclusion was the stabilization of
protozoal numbers even though their density in the vessels was merely 2% of that found
in the inoculum.
The dual flow continuous culture system described by Hoover et al. (45) and modified
later by Crawford et al. (46) and Hannah et al. (47) simulates the differential flows of liquids
and solids that occur in the rumen. In the design described by Hannah et al. (Fig. 9) (47), the
mineral buffer solution (48) supplemented with urea is infused to maintain fixed liquid
dilution rate, and solids retention is regulated by adjusting the ratio of the filtered to overflow
effluent volumes using a filtering device. Temperature of the vessel is kept constant at
+ 39°C and pH is adjusted by infusion of 5N HC1 or 5N NaOH. The vessel is constantly
purged with N 2 to preserve anaerobic conditions and mixing of the fermentation broth is
performed with magnetic impeller system. The ground and pelleted diet is semi-
continuously fed to the vessel in eight equal portions over the 24-hour period by use of
an automated feeder.
In typical experiments, durations of stabilization periods have varied from five to
seven days followed by three-day effluent sampling period. Fermentation gases are neither
collected nor analyzed from this simulation system. Depending on the experiment,
systems consisting of four (49) to eight (50) glass vessels with a volume of 1.0 (49) to
1.26 liters (51) have been reported.
(A)
(B)
Figure 9 (A) General schematic of dual flow continuous culture system. (B) Schematic of
fermenter flask components. A, Automatic feeding device and feed input port; B, magnetic impeller
assembly; C, sodium hydroxide infusion port; D, hydrochloric acid infusion port; E, filters; F, buffer
infusion port; G, nitrogen sparger; H, thermocouple assembly; I, coaxial heat exchanger apparatus;
J, pH electrode; K, overflow port. Source: From Ref. 47.
In Vitro Methods to Model the Gastrointestinal Tract 249
Possibilities and Limitations of Rumen Simulation Methods
The in vitro environmental conditions (temperature, pH, buffering capacity, osmotic
pressure, dry matter content and oxidation-reduction potential) should represent as closely
as possible those of the rumen. Irrespective of the technique applied, the quality of the
inoculum is one of the most important aspects in rumen simulations. In most studies the
rumen fluid is strained through two, sometimes even four layers of cheesecloth. As a
result, the inoculum is likely to represent only the microbes occurring in free liquid and a
major part of the cellulolytic micro-organisms is lost.
Efforts that can more effectively reproduce the real conditions within the rumen
will be very useful. Nevertheless the designs may be too complicated for routine and
easy use: particle block up in the outlet filter or daily opening of the fermentor for
feeding the microbes prevents the usability. A continuous culture system of two (52) to
21 (53) reaction vessels with running times of three to four weeks is not a very rapid
method for analyzing the effects of feed substances on fermentation patterns of rumen
microbes. The advantage of a batch simulation over continuous one is not only the
possibility to have more replicates but also the flexibility to test a greater number of
different treatments simultaneously.
The duration of the fermentation in closed batch culture should be adjusted
carefully according to the substrates and cell density to prevent the deprivation and
inhibitory effects of accumulating metabolites. As a consequence in either case, the
most fastidious bacteria and protozoa are at risk of being lost. A shorter incubation
time should be used with substrates that are rapidly fermented. By using actual feed
components and compositions, the risk of substrate deprivation during simulations is
reduced. For example, Leedle and Hespell (54) have reported the selective effects of
single or purified carbohydrates and nitrogen substrates on microbial population. The
amount of feed should be not only adequate in relation to the microbial density in
vitro, but also in relation to the calculated total digestive nutrient requirement of the
host (44).
The lack of substrates or excess of accumulated end products are, more rarely, the
reasons for microbial changes in continuous culture systems. Those fermentors, which
have a uniform and fast turnover rate for the total contents, quickly lose part or all of the
protozoa. Stabilization of the system for several days will lead to selection and survival of
those microbes best adapted to that environment. Irrespective of the artificial rumen
technique, the longer the simulation is run, the greater the difference that will develop in
the microbial populations compared to the original inoculum. However, a stable
fermentation that can be maintained long enough to allow microbial adaptation, is
considered desirable by continuous culture users (36,55). The use of actual feed
components and compositions presumably assists the maintenance of a representative
population also in continuous culture systems.
Although some of the artificial rumen techniques are more superior in taking into
account the microbial compartments or the different transfer rates of liquids and solids,
none of them include the activity of bacteria associated with the rumen wall or the
interaction with the host immune system. It is both challenging and difficult to mimic
ruminal fermentation and measure the parameters as they actually happen in the rumen.
The real long-term effects of a test substance on rumen microbes and animal physiology
can be evaluated neither with a short batch simulation nor with continuous culture
simulation run for several weeks. Nevertheless, simulation of the rumen in vitro is a
valuable technique for evaluating particular feed components and testing new diets before
undertaking animal experiments.
250 Makivuokko and Nurminen
CONCLUSION
Despite the advanced techniques used in the simulators described here, they will remain
only limited models of the authentic gastrointestinal tract. In particular, the interaction
between the microbes and the host is absent including contact with the mucosa and the
intestinal immune system. Some of these issues may be addressed by the use of intestinal
cell lines, either in the simulator, as a separate loop in the simulator or by using simulator
effluent. While the latter would remain approximations of the real situation, they would
nevertheless be very valuable for providing further insight into the dynamics and activity
of the gastrointestinal microbiota.
REFERENCES
1. Zoetendal EG, von Wright A, Vilpponen-salmela T, Ben- Amor K, Akkermans ADL,
de Vos WM. Mucosa-associated bacteria in the human gastrointestinal tract are uniformly
distributed along the colon and differ from the community recovered from feces. Appl
Environ Microbiol 2002; 68:3401-3407.
2. Ouwehand AC, Salminen S, Arvola T, Ruuska T, Isolauri E. Microbiota composition of the
intestinal mucosa: association with fecal microbiota? Microbiol Immunol 2004; 48:497-500.
3. Rumney CJ, Rowland IR. In vivo and in vitro models of the human colonic flora. Crit Rev
Food Sci Nutr 1992; 31:299-331.
4. Edwards CA, Eastwood MA. Comparison of the effects of ispaghula and wheat bran on rat
caecal and colonic fermentation. Gut 1992; 33:1229-1233.
5. Barry J-L, Hoebler C, Macfarlane GT, et al. Estimation of fermentability of dietary fibre
in vitro: a European interlaboratory study. Br J Nutr 1995; 74:303-322.
6. Deprez S, Brezillon C, Rabot S, et al. Polymeric proanthocyanidins are catabolized by human
colonic microflora into low-molecular-weight phenolic acids. J Nutr 2000; 130:2733-2738.
7. Oufir LE, Barry JL, Flourie B, et al. Relationships between transit time in man and in vitro
fermentation of dietary fiber by fecal bacteria. Eur J Clin Nutr 2000; 54:603-609.
8. Miller TL, Wolin MJ. Fermentation by the human large intestine microbial community in an
in vitro semicontinuous culture system. Appl Environ Microbiol 1981; 42:400-407.
9. Gibson GR, Cummings JH, Macfarlane GT. Use of a three-stage continuous culture system to
study the effect of mucin on dissimilatory sulfate reduction and methanogenesis by mixed
populations of human gut bacteria. Appl Environ Microbiol 1988; 54:2750-2755.
10. Macfarlane GT, Macfarlane S, Gibson GR. Validation of a three-stage compound continuous
culture system for investigating the effect of retention time on the ecology and metabolism of
bacteria in the human colon. Microb Ecol 1998; 35:180-187.
11. Molly K, Vande WM, Verstraete W. Development of a 5-step multi-chamber reactor as
a simulation of the human intestinal microbial ecosystem. Appl Microbiol Biotechnol 1993;
39:254-258.
11a. Alander M, De Smet I, Verstraete W, von Wright A, Mattila-Sandholm T. The effect of
probiotic strains on the microbiota of the Simulator of the Human Intestinal Microbial
Ecosystem (SHIME). Int J Food Microbiol 1999; 46:71-79.
12. Makivuokko H, Nurmi J, Nurminen P, Stowell J, Rautonen N. In vitro effects on polydextrose
by colonic bacteria and Caco-2 cell cyclooxygenase gene expression. Nutr Cancer 2005;
52:93-103.
13. Herles S, Olsen S, Afflitto J, Gaffar A. Chemostat flow cell system: an in vitro model for the
evaluation of antiplaque agents. J Dent Res 1994; 73:1748-1755.
14. Takahashi S, Sano M, Nishimura M, et al. Bactericidal effect of levofloxacin on strains with
equal susceptibility in an in vitro urinary bladder model. Chemotherapy 1998; 44:337-342.
In Vitro Methods to Model the Gastrointestinal Tract 251
15. Minekus M, Marteau P, Havenaar R, Huis in't Veld HJ. A multicompartmental dynamic
computer-controlled model simulating the stomach and small intestine. ATLA 1995;
23:197-209.
16. Minekus M, Smeets-Peeters M, Bernalier A, et al. A computer-controlled system to simulate
conditions of the large intestine with peristaltic mixing, water absorption and absorption of
fermentation products. Appl Microbiol Biotechnol 1999; 53:108-114.
17. Marteau P, Minekus M, Havenaar R, Huis In't Veld JHJ. Survival of lactic acid bacteria in a
dynamic model of the stomach and small intestine: validation and the effects of bile. J Dairy Sci
1997; 80:1033.
18. Krul C, Humblot C, Philippe C, et al. Metabolism of sinigrin (2-propenyl glucosinolate) by the
human colonic microflora in a dynamic in vitro large-intestinal model. Carcinogenesis 2002;
23:1011.
19. Macfarlane GT, Gibson GR, Cummings JH. Comparison of fermentation reactions in different
regions of the human colon. J Appl Bacteriol 1992; 72:57-64.
20. Czerkawski JW. Compartmentation in the rumen, p. 65-82. An Introduction to Rumen Studies.
Oxford OX3 OB W: Pergamon Press Ltd, 1986.
21. Morgavi DP, Newbold CJ, Beever DE, Wallace RJ. Stability and stabilization of potential feed
additive enzymes in rumen fluid. Enzyme Microb Technol 2000; 26:171-177.
22. Hatfield RD, Weimer PJ. Degradation characteristics of isolated and in situ cell wall
Lucerne pectic polysaccharides by mixed ruminal microbes. J Sci Food Agric 1995;
69:185-196.
23. Susmel P, Spanghero M, Marchetti S, Moscardini S. Trypsin inhibitory activity of raw soya
bean after incubation with rumen fluid. J Sci Food Agric 1995; 67:441-445.
24. Lopez S, Valdes C, Newbold CJ, Wallace RJ. Influence of sodium fumarate addition on rumen
fermentation in vitro. Br J Nutr 1999; 81:59-64.
25. Gomez JA, Tejido ML, Carro MD. Influence of disodium malate on microbial growth and
fermentation in rumen-simulation technique fermenters receiving medium- and high-
concentrate diets. Br J Nutr 2005; 93:479-484.
26. Blummel M, Karsli A, Russell JR. Influence of diet on growth yields of rumen micro-organisms
in vitro and in vivo: influence on growth yield of variable carbon fluxes to fermentation
products. Br J Nutr 2003; 90:625-634.
27. Ranilla MJ, Carro MD, Lopez S, Newbold CJ, Wallace RJ. Influence of nitrogen source on the
fermentation of fibre from barley straw and sugarbeet pulp by ruminal micro-organisms
in vitro. Br J Nutr 2001; 86:717-724.
28. Menke KH, Raab L, Salewski A, Steingass H, Fritz D, Schneider W. The estimation of the
digestibility and metabolizable energy content of ruminant feedingstuffs from the gas production
when they are incubated with rumen liquor in vitro. J Agric Sci Camb 1979; 93:217-222.
29. McDougall EO. Studies on ruminant saliva I. The composition and output of sheep's saliva.
Biochem J 1948; 43:99.
30. Goering KH, Van Soest PJ. Forage fiber analysis (apparatus, reagents, procedures, and some
repplication). Agricultural Handbook. Washington D.C.: Agricultural Research Counsil,
U.S. Department of Agriculture, 1970.
31. Wallace RJ, Wallace SJ, McKain N, Nsereko VL, Hartnell GF. Influence of supplementary
fibrolytic enzymes on the fermentation of corn and grass silages by mixed ruminal
microorganisms in vitro. J Anim Sci 2001; 79:1905-1916.
32. Theodorou MK, Williams BA, Dhanoa MS, McAllan AB, France J. A simple gas production
method using a pressure transducer to determine the fermentation kinetics of ruminant feeds.
Animal 1994;48:185-197.
33. Cone JW, van Gelder AH, Visscher GJW, Oudshoorn L. Influence of rumen fluid and substrate
concentration on fermentation kinetics measured with a fully automated time related gas
production apparatus. Animal 1996; 61:113-128.
34. Davies ZS, Mason D, Brooks AE, Griffith GW, Merry RJ, Theodorou MK. An automated
system for measuring gas production from forages inoculated with rumen fluid and its use in
determining the effect of enzymes on grass silage. Animal 2000; 83:205-221.
252 Makivuokko and Nurminen
35. Czerkawski JW, Breckenridge G. Design and development of a long-term rumen simulation
technique (Rusitec). Br J Nutr 1977; 38:371-384.
36. Wallace RJ, Czerkawski JW, Breckenridge G. Effect of monensin on the fermentation of basal
rations in the Rumen Simulation Technique (Rusitec). Br J Nutr 1981; 46:131-148.
37. Dong Y, Bae HD, McAllister TA, Mathison GW, Cheng K-J. Lipid-induced depression of
methane production and digestibility in the artificial rumen system (RUSITEC). Canadian
J Anim Sci 1997; 77:269-278.
38. Ranilla MJ, Carro MD. Diet and procedures used to detach particle-associated microbes from
ruminal digesta influence chemical composition of microbes and estimation of microbial
growth in Rusitec fermenters. J Anim Sci 2003; 81:537-544.
39. Wang Y, McAllister TA, Rode LM, et al. Effects of an exogenous enzyme preparation on
microbial protein synthesis, enzyme activity and attachment to feed in the Rumen Simulation
Technique (Rusitec). Br J Nutr 2001; 85:325-332.
40. Russi JP, Wallace RJ, Newbold CJ. Influence of the pattern of peptide supply on microbial
activity in the rumen simulating fermenter (RUSITEC). Br J Nutr 2002; 88:73-80.
41. Stewart DG, Warner RG, Seeley HW. Continuous culture as a method for studying rumen
fermentation. Appl Microbiol 1961; 9:150-156.
42. Quinn LY. Continuous culture of ruminal microorganisms in chemically defined medium I.
Design of continuous-culture apparatus. Appl Microbiol 1962; 10:580-582.
43. Rufener WH, Nelson WO, Jr., Wolin MJ. Maintenance of the rumen microbial population in
continuous culture. Appl Microbiol 1963; 11:196-201.
44. Slyter LL, Nelson WO, Wolin MJ. Modifications of a device for maintenance of the rumen
microbial population in continuous culture. Appl Microbiol 1964; 12:374-377.
45. Hoover WH, Crooker BA, Sniffen CJ. Effects of differential solid-liquid removal rates on
protozoa numbers in continuous cultures of rumen contents. J Anim Sci 1976; 43:528-534.
46. Crawford RJ, Jr., Shriver BJ, Varga GA, Hoover WH. Buffer requirements for maintenance of pH
during fermentation of individual feeds in continuous culture. J Dairy Sci 1983; 66:1881-1890.
47. Hannah SM, Stern MD, Ehle FR. Evaluation of a dual flow continuous culture system for
estimating bacterial fermentation in vivo of mixed diets containing various soya bean products.
Animal 1986; 16:51-62.
48. Weller RA, Pilgrim AF. Passage of protozoa and volatile fatty acids from the rumen of the
sheep and from a continuous in vitro fermentation system. Br J Nutr 1974; 32:341-351.
49. Karunanandaa K, Varga GA. Colonization of rice straw by white-rot fungi (Cyathus
stercoreus): effect on ruminal fermentation pattern, nitrogen metabolism, and fiber utilization
during continuous culture. Animal 1996; 61:1-16.
50. Mansfield HR, Stern MD, Otterby DE. Effects of beet pulp and animal by-products on milk
yield and in vitro fermentation by rumen microorganisms. J Dairy Sci 1994; 77:205-216.
5 1 . Hoover WH, Kincaid CR, Varga GA, Thayne W V, Junkins LL, Jr. Effects of solids and liquid flows
on fermentation in continuous cultures IV. pH and dilution rate. J Anim Science 1984; 58:692-699.
52. Fellner V, Sauer FD, Kramer JK. Steady-state rates of linoleic acid biohydrogenation by
ruminal bacteria in continuous culture. J Dairy Sci 1995; 78:1815-1823.
53. Newbold CJ, Wallace RJ, Chen XB, Mcintosh FM. Different strains of Saccharomyces
cerevisiae differ in their effects on ruminal bacterial numbers in vitro and in sheep. J Anim Sci
1995;73:1811-1818.
54. Leedle JAZ, Hespell RB. Brief incubations of mixed ruminal bacteria: effects of anaerobiosis
and sources of nitrogen and carbon. J Dairy Sci 1983; 66:1003-1014.
55. Jayasuriya MCN, Hamilton R, Rogovic B. The use of an artificial rumen to assess low quality
fibrous feeds. Biol Wastes 1987; 20:241-250.
14
Animal Models for the Human
Gastrointestinal Tract
Anders Henriksson
DSM Food Specialties, Sydney, Australia
INTRODUCTION
Scientific research is continuously generating new ingredients for food and pharmaceu-
tical products. In pace with consumer awareness of healthy products, considerable efforts
are made to find new ingredients with beneficial effects on human health. The health
benefits of such ingredients need to be assessed in human trials prior to being developed as
a product for wider human consumption. Animal trials, conducted prior to human trials,
offer a sound filtering system that provide the opportunity to identify those ingredients that
are worthy of the relatively costly human studies that may follow. Animal models are
important tools used in the study of human gastrointestinal (GI) microbiology.
Specifically, animal models are used when considering the effect of food and
pharmaceutical ingredients on GI health and disease. These effects include the metabolic
and immunological activities of microorganisms that colonize the human gastrointestinal
tract (GIT).
This chapter deals with issues related to the use of animal models in studies of human
GI microbiota or specific microorganisms of human origin. It discusses similarities and
differences between human and animal physiology and microbiota with specific focus
on categories of animal models. The following discussion focuses predominantly on
rodents and highlights some limitations and opportunities that relate to categories of
rodent models such as "germ- free," "human flora associated" and "surgically or chemically
modified."
Physiology and Microbiology of the GI Tract
Physiology
The human GIT is the most appropriate environment to conduct studies on the human GI
microbiota but for practical reasons animal models are used extensively for these types of
studies. The wide range of similarities between the animal and human GIT makes it
possible to draw reasonable parallels between these two hosts, however, results from
studies on the human microbiota in animals may not entirely reflect processes occurring in
253
254
Henriksson
the human GIT. The reason for this is that there are also many differences between human
and animal gut physiology, diets, and behavior. Rodents are the most extensively used
animals in the research of human GI microbiota. The differences between the human and
rodent GIT may be important in interpreting any research findings.
When considering the differences between the human and rat GITs, the issue of size
is certainly obvious. This difference has impact on transit time of GI contents. Also, the
rate of passage can vary between the type of diet, the particle size of digesta and
morphological characteristics of the GITs. In rats the transit time is 12-35 hours
depending on the type of diet and transit markers used (1,2). In humans, native Africans,
consuming a traditional diet, have an average GI transit time of 33 hours, which is
approximately half of the transit time that has been observed in Europeans or Africans on a
Western diet.
Many more subtle and potentially important morphological and physiological
differences exist between the human and rat GITs. An example of this exists in the fact that
the adult human appendix, known to be the undeveloped caecum, does not correspond in
function to the developed, functioning rodent ceacum. The adult human GIT is roughly
divided into three major regions, namely, the stomach, small intestine and the large
intestine (colon). In the human fetus the caecum commences deveploment as a conical
diversion. As the rest of the intestine grows, caecal growth is arrested and a vermiform
appendix remains. In adult humans, the colon, which is haustred throughout its entire
length, takes the shape and function of the caecum which is found in many other animals
(Fig. IB) (3).
The mouse and rat GIT is divided into four major regions, namely the stomach,
small intestine, caecum, and colon (Fig. 1A). In contrast to the human stomach, the
NON-SECRETING REGION
STOMACH
SMALL INTESTINE
-CAECUM
COLON
APPENDIX
(A)
(B)
Figure 1 The mouse (A) and human (B) gastrointestinal tracts.
Animal Models for the Human Gastrointestinal Tract
255
stomach of rats and mice have a large area of nonsecreting epithelium that expands
considerably as the animals are eating. In rodents, microbial fermentation is mainly
occurring in the caecum. The colon of these animals is not haustred and is less important
for microbial fermentation, compared to the caecum. The large intestine of these animals
is important for re-absorption of water and formation of fecal pellets.
Microbiota
The physiological properties of the human GIT, with its many unique features provide a
vast number of microbial niches. Host factors such as enzymes, mucins, proteases, bile
acids dietary factors and regimes contribute to this diversity. The result is a complex
microbial community composed of several hundred microbial species (4) that collectively
form the GI microbiota. The mammalian GI microbiota forms dense microbial
populations, particularly in the posterior part of the intestine (5). The composition of
both human and rodent microbiota has been extensively investigated and discussed
in several comprehensive studies and reviews (6-8). The microbial profiles of rodents
such as rats and mice are in many ways similar to that of other mammals, including
humans (5,9). In such rodents, lactobacilli are present in levels of 10 9 colony forming units
(CFU) per gram of feces, (5) whereas in humans, the average levels of fecal lactobacilli are
usually 10 4 -10 6 CFU per gram of feces (10). As described by Finegold et al. (10), diet has
impact on population levels of lactobacillus and other microbial groups in humans.
Bifidobacteria may be detected in both human (10) and rodent feces (11), however
commercial rodent feed may not support GIT colonization by bifidobacteria as much as
some other diets (Fig. 2). This suggests that the type of diet should be considered carefully
to ensure that the diet used supports the colonization of important microbial groups. The
effect of feed composition is further discussed in the section "Conventional Animals."
There are also behavioral differences between various animal species that may
contribute to the resulting GI microbiology of these animals. Rodents are known as
coprophages, and unless coprophagy is prevented, it is possible that the GIT of these
rodents are continuously re-inoculated with their own fecal microorganisms. This
behavior, which could possibly affect the microbial profile, may be inhibited by fitting a
tail cup which makes the fecal pellets unavailable to the animals (13). Other techniques
have been attempted, such as keeping animals on a grid to allow fecal pellets to fall
through and become inaccessible, however coprophagic animals, including rats, usually
HAS
Type of feed
Normal
Figure 2 Fecal bifidobacteria of mice (Balb/C) fed high amylomaize starch (HAS) diet,
containing 40% starch [AIN 76 (12)] and a commercial rodent feed (Normal). Results presented are
the average + SDV of six animals per group.
256 Henriksson
collect fecal pellets as they are extruded from anus (14), making such a grid less efficient in
preventing coprophagy.
The relative importance of coprophagy, and specifically the rate of microbal
re-inoculation, has been investigated in a number of studies. The rat may consume 35-50
percent of the total output of feces, or an even larger proportion if the rat is on a vitamin
depleted diet (14). It has been reported that prevention of coprophagy has reduced
weight gains in rats and also caused major changes in caecal and fecal lactobacilli,
enterococci, and coliforms (15). In another report, prevention of coprophagy made no
change in GI microbial profiles, apart from a minor decrease in lactobacilli of the stomach
and the lactobacilli of the small intestine (16). A study conducted by Smith (5) indicated
that coprophagy has no, or minor effects on gastric microbial populations. These studies,
whilst showing dramatically varying conclusions, possibly resulting from varying feed
and housing conditions, indicate that coprophagic behavior should remain an
important consideration.
The Role of Microbiota on GI Health
The mammalian microbiota has several important functions. It aids in nutrition by
degrading complex nutrients and by synthesizing vitamins. It protects against infectious
disease, by either preventing invading pathogenic bacteria from establishing in the GIT, or
by conditioning of the mucosal immune system. The microbiota may also influence the
development of cancer, by modulation of carcinogens, pre-carcinogens or by activation of
immunological responses.
Many factors influence the progression and severity of GI infectious disease. Some
examples of this are seen in the interaction between various microorganisms and also in
their interaction with dietary factors and the host. A pathogen entering the GIT will meet
resistance by the microbiota. An invading pathogen is also faced with the host' s immune
system as well as host factors such as stomach acids, bile acid and enzymes.
The GI microbiota plays an important role in activation of the innate immune system
(17-19). Mucosal immune responses are activated as a result of microorganisms
interacting with the gut associated lymph tissue (GALT). Interaction of microbes and
antigens with GALT leads to a cascade of responses as outlined in the chapter by Moreau.
The host mucosal immune system is important in preventing a pathogen from invading the
GIT and the translocation of a pathogen to both the mesenteric lymph nodes (MLN) and
the internal organs (20-22). The intestinal microbiota and orally administrated probiotics,
prebiotics, and other nutrients may also affect the balance of Thl/Th2 cell response, and
the production of pro and anti-inflammatory cytokines (23,24). The oral administration of
probiotics to rodents may activate macrophages (25) and natural killer (NK) cells (26), in a
similar fashion to when they are administered to humans (27). There are a number of
described animal models that make research on human GI microbiota possible and bring to
light the effects of the human microbiota on nutrition, immunology, and resistance against
infections and other diseases (Table 1).
ANIMAL MODELS USED FOR STUDIES
ON THE HUMAN GI MICROBIOTA
Administration Feed and Test Material to the Animal GIT
The effect of specific agents, such as pro and prebiotics or specific chemicals, on the GI
microbiota and gut health is monitored after administration of these agents to experimental
Animal Models for the Human Gastrointestinal Tract
257
d
•1-H
•c
O
d
cd
a
d-
O
co
£
CO
'S
cd
OX)
»H
c
c
'—
o
o
Cd
o
cj
a.
oo
i-
c
cd
43
O
'—
o
d
cd
s
CD
43
cj
C
d
CD
o
d
_o
"43
o
CD
13
<
.Q
(0
H
o
o
d
CJ
»H
CD
CO
O
Oh
H
S3
O
CD
d
cj
CO
-*— »
bu
0)
>^
cd
-a
X)
fTl
p
•4— »
-d
O
• «— «
CO
CD
O
s
d
0)
•l-H
T3
43
T3
d
O
0)
CO
13
. ■ — i
CD
CO
d
• i-H
CO
CD
I— -H
CO
u
u
O
Ph 1)
d ^
cd £»
.9 §
cd CD
00
d
CD
T3
O
00 0\ O h (S
(N cn <n en cn
en rj- *o \o t>
en m m m m
ooaNOeN^om'sj-invo ^j- r-
cnen^Tj-eN^Tj-TtTt cn ^f
co
•l-H
•4-H
•c
43
03
T3
co CD
a °
O T3
3 .g
2 d
Oh <L>
>. S>
43 =3
O
CO
CO
• i-H
CO
o
-d
.9 -S
« o
a a
Oh <h-h
o °
> O
> ,P.
d
O
• i-H
■4-J
cd
O
o
> 03
8 5
.a *£
P CD
OX) -"
03 <4-h
43 O
Oh
d
O
•i-H
co .O
•"H _d
- d
d
o
ft
CO
■*—•
CO
d
2 -9 •§
o
Sh
Oh
<H-H
O
S-H
a
co
cj
CJ
.1)
43
O
*H
P3 Oh
03
bp
03
O „
O g
•tf O
<•> d
- J
O ^3
»-i
Oh
< < < < <
^ z z ^ z
X ^
rn P3
U Q
u u u
j-o ^ i
o3 o3 o3
PQ CQ CQ
<D 1) 1) <D (D
o o CJ o o
IT:
I
CO
o
■d
o
•l-H
2
o-
o
•l-H
o
o-
co
>>
d
o
•l-H
-4— <
o
<H-H
d
•l-H
13
d
o
d
. -H
03
^H
-*— '
O
O
T3
<
z
co Q
° ^
•z3 d
c3
c3
Oh -tn
5T.a
O-fi
03
oo
■>—•
CO
d
•l-H
03
bp
03
d
•2 o
O •--•
(D O
O ?h
Ph pj
o
d
13
43
H
43
H
d
c
co
"-4— >
c
o
•—
Oh
O
o -t 1 bp
CX2 >> o3
o o 5
^ °-
^ B
d
c
03
d 43 O
o o "S
•a s -g
c ^J d
•a cu d
>^>
cu
Q
F Oh
» d
o
d
a o
d -ih
c3
4^
c3
d
•l-H
■*-<
CO
cu
d
c3
S 3 o
03 j3
c O- 43
O 'H l *H
•13 O O
O ■(-» -w
CD O O
"^ CD CD
2 te ^
Ph PJ PJ
< < < <
z z z z
^ Si -J %
£ £ £ U
13 Id 13 vo
PP Ph PQ Ph
P^
CD CD CD CD CD
O O CJ O O
53
o
CJ
T3
co Q
O
tj
T3
CD
■*— »
03
d
CJ
d
T3
CJ
Oh
^O
13
>
CD
T3
tq -h
d
O
• i-H
-4— '
c3
^H
.o
co
d
•l-H
03
W)
03
d
O
•l-H
■*— »
CJ
CJ
■*— »
O
•—
O-
a
co
♦«»
Q
co
C3
co
CJ
43
O
s-
CJ
CJ
o Q
cd PQ
C-H M
W <4H<4H
«H-. o O
d
. -H
03
^H
-4— '
CJ
43
O
«H
Oh
O
• i-H
•F Oh
> CO
CJ
c3
43
d
O
5
— —
"ft
CJ
c3
CJ
=3 g 43 -a
CQ
CJ
" CJ
CD
ft
43
• S 33 fe3
d
CJ
CJ
d
o
0)
"3
l-H
d
CJ
B
d
CJ
CJ
03
03
n
43
CJ
CJ
d
-*— >
l-H
s-
■*— '
■*— '
CD
M-H
o
l-H
fH
i-
,o
,o
,o
*—•
<-i-H
«+H
'-I-.
£ i
CD 43
O c3
S C/3
03
■4-J
co
d
03
43
-4—'
d
•l-H
03
H
CO
CJ
.cd
d
CJ
43
CJ
CO
d -^
CO Q
co .y
CD o
CO 'q
^ 2
< Ph
CO
CJ
43
O
•—
Ph
03
03
co d
.-- o
S '^
O o
•53 CD
4J ■(->
O O
S^H 1-4
Ph Ph
O S °
-o 2 ^
2 2 °
d
o
d
I- 2
03 X)
Cj 03
O
o
CJ
O
l-H
V
X
m
U
d
03
ex:
CJ
CJ
d
4h
13
43
co
• i-H
o
43
03
CN ^3
d
o
cj
c^
03
d
43
H
d
CO co
° 2
•-H S-H
s
CO
or
CJ
N
d
CJ
•4-J
CO
o
43
co
O
• -H
l-H
03
>
d
o
CJ
43
« ^32
O
43
O
l-H
Oh
_o3
O
d
l-H
03
r : "H fl)
^ CO .s
O 73
CJ
CJ
d
CJ
d
to *5
PJ P3
CJ
.CJ
CJ
'bb
CJ
PJ
CJ
d
CJ
l-H
43
u
-4—*
d
03
<
'o
<
43
co
CJ
CJ
t
• i-H
-4—>
o
z
4-H
-4— »
CD
• i-H
43
a
HH
<
< < °°
\ < oo
S
<
<
<
oo
oo
^<
<
z
Z Z Q
i
m
Z
z
z
Q
< z
z
CN
i
o o o
Z Z
5 5 § y 7
53 S3 ffi < £ d
S S S S CN CN K 43 c3 ^
^o
m
-J
CP
>n ._
U £
53
43
co
m
53
43
co
• i-H
Ph
CJCDCDCDCDCDCDCDCD
OCJCJOOCJOCJCJ
SSSSS SSSSS SSSSSSSSS
CJ
CJ w
■4— >
^ cd
cd
^ P<
Ph
^3
S
a
258
Henriksson
"^3
+—
S
c
• y—t
W)
• y—t
S-H
o
d
g
CO
CO
. -H
d
o
o
O
o
4d
• i-H
o
cj
ft
O0
S-i
O
cd
O
S-H
u
d
g
<D
s:
c
o
CO
<D
• i-H
-a
d
4— i
oo
c
• i-H
o
CO
CO
13
O
C
<D
O
4-H
o
c
o
•1-H
4— I
cj
13
OO
-Q
re
o
CJ
c
o
HH
o
CO
ft
>^
H
<D d
-d <U
X)
O
• i-H
£
C O
a
T3
CJ
o
=3
CD
CO
cd
CD
CO
O
s-
o
c3 &
S §
cd CD
H &Q
OO
c
O
on o i— i (N en ^t
^t m io wo m in
o
,o
4h
*— i
a
>^
S-i
CJ
4-H
c
d
c
c3
o
O
b
•I-H
• i-H
4— >
4-H
CJ
cd
C3
X
o
CJ
cd
O
O
4-h
CO
CO
O
d
S-H
CJ
>>
C
c
cd
K3
o
• ^H
cd
• rH
S-H
» «
S-H
o
s-
■*— <
•l-H
4-1
• i-H
4-H
i
s
42
C
d
X
CJ
Oh
13
• -H
S-H
CJ
4-H
CJ
C3
X)
c3
O
o
CJ
d
CJ
E
s-
CJ
4-H
13
•c
CJ
4-J
CJ
cd
o
xl
4-H
• i-H
3
4-H
— (
4-h
O
>.
bfi
O
CD
c
d
-a
c
,
o
13
CJ
o
d
cd
• i-H
4— <
o
>
• i-H
J — 1
c3
d
CJ
o
W)
cd
S— <
CO
S-H
CJ
>
CJ
s-
•I-H
• i-H
■§
• i-H
• i-H
B
CJ
-d
CJ
c
s-
e
•1-H
• i-H
X)
• i-H
q
• i-H
s-
i-H
i-H
u
S-H
s
O
,o
o
o
,o
4-H
4-H
4-H
4-H
4-H
O
CO
CO
co
■CO
co
4-h
O
CJ
O
CJ
CJ
O
• I-H
• i-H
• i-H
• I-H
• i-H
4-»
4-H
4—1
4-»
4-H
4- '
o
o
o
o
o
CJ
CJ
• l-H
• i-H
• i-H
• i-H
• i-H
_C
X
X
pO
X
ft- 1
o
o
o
o
o
4—1
S-
(h
S-H
s-
S-H
w
&h
ft
Oh
Qh
Oh
CJ
d
si
4-H
CJ
E
o
N
<
CJ
4—1
cd
60
X
O Z Q
oo
z
Z
>^ >. >>
0) CD CD
en
S-H
o
si
CO
cd
Q
i
CJ
3
cd
Q
i
CJ
3
Q
i
CJ
d s-H
SD t)i) bD c3
c3 cd cd ti
J-* S-h Vh .22
Dh Ch ft
S-H
cd
4-H
co
Ph oo oo oo
^^
cd cS cd cd cd A
P< rt 0^ P< C^ P<
13
S-i
o
o
13
o
S-i
3
13
d
■a
o
SOh
§■
4J
o
d
Animal Models for the Human Gastrointestinal Tract 259
animals. In this type of studies, the following should be considered: (1) Type of animal
feed, (2) Administration of microorganisms (e.g., pathogenic bacteria or probiotics),
carcinogens or inflammatory agents, (3) Assessment of animal health and properties of the
GI microbiota.
Feed
The effect of specific dietary components are most conveniently assessed after feeding
animals a feed containing these compounds. There are several basic feed formulations that
may be used for this purpose. The feed which was described by Rickard et al. (12) and
modifications thereof (55) are suitable for administration of probiotics. The composition
of animal diets may have a significant impact on the composition and activity of the GI
microbiota. These effects are further discussed in the section on Human Flora Associated
Animals.
Microorganisms
Administration of microorganisms to the GIT of animals can be performed in several
ways. Gavage is a method in which microorganisms may be inoculated directly into the
stomach of an animal using a gastric probe (33,56). This method allows a known volume
containing pathogen, probiotic cultures or complex microbial mixtures to be injected into
the stomach. Animals can also be inoculated by administering feed or water containing
microorganisms. However, administration through water or feed may not allow for a
known inoculum size to be administered at a specific time. In order to avoid this issue,
animals can be left for a short time without water or feed to ensure that the contaminated
substrate is consumed without delays (43). Alternatively, the microorganisms can be given
to animals in a sucrose solution, to improve the rate of consumption (57).
Carcinogens and Inflammatory Agents
Cancer and inflammation may be induced by exposure of animals to specific agents.
Administration of carcinogens, pre-carcinogens or pro-inflammatory agents may be
introduced orally, by gavage or by feeding animals feeds containing the specific agents. A
desired effect may also be induced by intrarectal or systemic inoculation of specific agents.
Conventional Animals
Conventional (CV) animals, being those which have a natural occurring microbiota, may
be used to stimulate the human GIT. However, due to differences between the human and
animal microbiota, the results from studies in CV animals may be quite different from
corresponding studies conducted in humans. CV animal models are useful in studies on
orally administrated human microorganisms in vivo, where the activities of the indigenous
microbiota are acceptable. CV rodent models have been used for studies of probiotic
cultures and particularly their effect on infectious disease. CV animals may also be used to
assess the survival of probiotic cultures in vivo. Although the GI conditions of CV animal
models are quite different from those of the human, the conditions of the animal GIT are most
likely closer to human than what can be simulated in vitro.
There are several examples of studies where CV animals have been used to assess the
protective effects of probiotics. These include studies in which Salmonella (32,56,58-60),
E. coli (61,62) and Listeria (63,64) have been used as model pathogens. Specific Pathogen
Free (SPF) mice have been useful in similar studies where animals were given single or
260 Henriksson
mixed cultures that were considered to be probiotic, before being challenged with
Salmonella. The progress of infection is determined by monitoring (1) translocation of
pathogen to internal organs (31,43), (2) change in animal body weight, and (3) mortality
(65) following the challenge. Out of these three general methods, monitoring changes in
animal body weight is convenient and relevant in most cases. The virulence of a model
pathogen is relevant in this regard, since the virulence will affect the progress of infection. A
too virulent strain may induce an unnecessarily severe infection (66). In other cases, human
pathogens may not colonize, infect or give a demonstrable effect in an animal model (64,67).
If this is the case, then a human pathogen may be replaced with a strain known to be virulent
in animals. Examples given so far relate to models used for the monitoring of GI infection
and translocation to areas such as MLN and intestinal organs. The protective effect of
probiotic cultures can also be monitored by assessing the clearance rate of a specific
pathogen from the feces of animals challenged with that pathogen (65). The clearance rate of
Listeria was measured in the feces of animals that were fed probiotic cultures and meat
starter cultures in order to identify specific probiotic cultures that eliminated this particular
pathogen (64).
CV animals may also be used as a model system to assess the survival and
colonization of probiotic cultures and other microorganisms of human origin. The
survival, during passage through the GIT, can be monitored as long as appropriate
methods of detection are available. Traditional culturing methods have been important
tools used in monitoring the survival of probiotic cultures during GI transit (68-70).
Recent years have seen other more efficient detection methods such as molecular probes,
which have been developed for the accurate assessments of population sizes of particular
probiotic cultures in feces (71). Probes of this type may be used to confirm the identity of
particular probiotic strains (72-74) and detect specific strains even at very sparse
population levels (75).
GI microbiota is obviously important for the biochemical profile of the GIT. However,
simply identifying the survival of microorganisms in feces gives little information about the
details of their activity in the GIT. In vivo investigations into the activity of particular
microorganisms require methods other than those used for that of detection. Mice or rats
may be used to characterize the activity of cultures at specific sites throughout the GIT,
something that is very difficult to assess in humans. Traditionally this type of study has
been conducted on animals containing microorganisms of interest by describing the
biochemical profile of the animal's GI contents. This methodology is adequate in instances
where the sum of all microbial and host activities are investigated at the time of sampling.
However, it is less appropriate if the activities of specific microorganisms are assessed,
where these microorganisms are a part of a complex microbial system. In vivo studies on
the activities of specific cultures in a complex ecosystem require different animal models.
The development of a lactobacillus free mouse model has provided the opportunity to
study the effects of lactobacillus colonization on host physiology, including the effects on
fecal bile acids and enzyme activities (76-78). This type of model may be used in studies
on the effect of human lactobacillus strains if animals are colonized by strains of
human origin.
Germ-Free Animals
Under normal conditions animals are exposed to microorganisms during birth and
continue to be exposed to a wide range of microorganisms throughout their lives. These
microorganisms form the microbiota, characteristic to CV animals. Hysterectomy at birth,
allows the unborn fetus to be transferred from the womb to a sterile chamber. If this
Animal Models for the Human Gastrointestinal Tract 261
process is carried out under sterile conditions, the animal would not be contaminated with
microorganisms from the environment. High hygiene standards are required to ensure that
animals are maintained and bred under germ-free conditions.
Considerable achievements have been made since the 1970s in investigating the role
of the gut microbiota using germ-free animals. Germ-free animals have enabled investi-
gation of animal gut physiology in the absence of the gut microbiota. Studies using germ-
free animals have revealed that the gut microbiota is indeed of tremendous importance for
the biochemical properties of the GIT, by metabolizing compounds in ingested feed and
host factors of mucosal and pancreatic origin. Data from these studies revealed that many
physiological and biochemical features of the GIT are indeed the result of microbial gut
activity (79,80). The gut of germ-free animals have different physiological and
biochemical properties to that of CV animals. The biochemical properties of germ-free
and CV animals are often regarded as either germ-free associated characteristics (GAC) or
microbiota associated characteristics (MAC). The characteristics of MAC and GAC are
described in the chapter by Norin and Midtvedt.
Germ-free animals provide the opportunity to investigate the role of specific
microorganisms in the GIT. These microorganisms and their impact on host physiology,
can be monitored in an environment that is unaffected by a preexisting microbiota.
Ex-germ-free animals have also been used to study the interaction between a controlled
composition of microbial species in the GIT (81-84). Germ-free animals have also been
useful in research that focuses on the role of the GI microbiota in metabolism of host
factors such as mucin and bile acids (85,86). More recently, germ-free technology has
been extensively used in research on the effect of specific strains on host immunology
(87,88). mucosal physiology and morphology (89-91). Although the absence of a diverse
microbiota enables characterization of specific microbes, it cannot be used to characterize
their activity in a complex microbial environment. Therefore, animals associated with one
or a limited number of strains, may not truly reflect the microbial activity of those that
harbor a CV gut ecosystem.
Human Flora-Associated Animals
The establishment of human fecal microbes within animals, provides the opportunity for
the study of a microbiota of human origin within these animals. Human flora associated
animals (HFA) have proven to be particularly valuable in studies of the metabolic and
immunological activities of the human microbiota. Athough HFA animals are valuable for
investigations related to the human microbiota, several differences between animal and
human physiology may influence colonization by the human microbiota in animal hosts.
Such differences may promote host-specific colonization by microorganisms in different
animals (92,93). As a result, microbes of human origin may be disadvantaged in the animal
GIT, compared to isolates originating from this particular animal species.
HFA animals are created by inoculating germ-free animals with a human fecal
homogenate (94). The resulting microbial profile of HFA animals is partly dependent on
the differing ability of the various microorganisms in the human fecal sample to colonize
the animal GIT. Previous studies have shown that certain microorganisms of human fecal
origin were unable to colonize the rodent GIT (95). There may be several reasons for this,
such as diets or host factors like transit times and physiological conditions. It has been
demonstrated that mice, fed with a commercially available animal feed, may have a
reduced, or even undetectable level of bifidobacteria in feces. However, after feeding these
mice an alternative diet for several weeks, bifidobacteria could be detected in the mice that
were fed sucrose or amylose, with particularly dense populations of bififodobacteria
262 Henriksson
observed in mice that were fed with an amy lose rich diet (Fig. 2). This suggests that diet,
and specifically dietary ingredients such as certain carbohydrates, are important for the
composition of the GI microbota and that previously nondetectable microbial groups may
be stimulated to detectable levels. Consideration may be given to the possibility that the
growth of microbal populations due to dietary intervention, may be at the expense of less
competitive microbial groups.
The colonization of human originated bifidobacteria within germ-free animals is not
always successful (95). Hiramaya and co-workers (96) demonstrated that in rodents, the
source of fecal material containing bifodobacteria influences the ability of bifodobacteria
to colonize the GIT (95). This may be due to the fact that bifodobacteria from different
sources possess different natural characteristics. The activity of the human source
microbiota that is contained within HFA animals may also be dependent on the cultural
origin and dietary habits of the human source (97,98). For instance, fecal material obtained
from different human donors has been shown to provide a different degree of effectiveness
in protection against Salmonella (32). Although this type of model provides a good tool for
studying the effects of the human microbiota, it cannot be assumed that the microbial
profile of HFA animals is identical to that of the human donor.
HFA rodents are useful in studies of the metabolic activity of the human microbiota.
The effects of microbiota on the metabolism of lignans and isoflavones have been
investigated in studies using germ-free and HFA rats (98). In similar studies, HFA rats
have been used to assess the metabolism of dietary fats (99,100). The usefulness of HFA
animals has also been illustrated in studies such as those conducted on the effect of
complex carbohydrates on the human microbiota, including the effect of resistant starch
(97). Other studies include those relating to the production of short chain fatty acids
(85,101) and microbial enzyme activities (102). HFA animals are also valuable for
toxicological studies. There are several examples of studies in which HFA animals have
been used to assess the effect of the human microbiota on potentially carcinogenic
compounds (47,103). Interestingly, both studies indicated that the source of fecal material
used to create HFA rats influenced the transformation of pre-carcinogens to
carcinogenic componds.
Oozeer and colleagues (28) used a genetically modified L. casei strain to assess
whether the strain was active throughout the passage of the intestinal tract of HFA mice.
This strain was modified by the introduction of genes coding for erythromycin resistance
and luciferase. Results from this study indicate that this strain is both metabolically active
and able to initiate new protein synthesis during its transit through the GIT. Techniques in
transcriptomics and metabolomics are paving the ways for new studies on microbial
activity of the gut contents and detailed studies of biochemical properties of host cells
lining the GI epithelium.
Surgically Modified Animals
Surgical modification of the GIT gives new opportunities for the study of the GI
microbiota. Using surgical procedures, specific parts of the GIT can be removed in order to
make modifications to basic physiology. Surgery can also provide the opportunity, by
means of cannulation of the GIT, to give repeated post-surgical access to specific sites of
the tract. The human GIT lacks some of the areas that may be found in the rodent and
porcine GIT, such as the areas of non-secreting epithelium that are found in the stomachs
of rodents and pigs. It has been suggested that these areas are the primary sites for
Lactobacillus colonization within such animals, and that bacterial populations contained
at these sites are in fact seeding the intestinal tract with lactobacillus (104,105). If this was
Animal Models for the Human Gastrointestinal Tract 263
to be correct, removal of the non-secreting stomach region could result in a gastric
microbial profile that is more in line with that of the human. However, surgical removal of
the non-secreting stomach region has no effect on the luminal levels of lactobacillus in
either the stomach or in the colon of mice (A. Henriksson, unpublished observations).
Therefore, it can be assumed that in mice and possibly other animals, this region is not
responsible for the relatively dense lactobacillus populations found in either the intestinal
contents or the stomach itself.
The caecum is an important part of the rodent intestine for microbial fermentation.
This stands in contrast to the human GIT where the colon is the major site for such
fermentation. It has been suggested that this difference is another factor that contributes to
various differences between the microbial profiles of rodents and humans (106). However,
studies indicate that the microbial biochemical profile of caecectomized mice remains
significantly different from that of normal humans or mice (106,107). Most studies on
rodents with surgically modified GIT have failed to give microbial profiles that closely
resemble that of the human GIT.
Cannulation is performed to provide access to specific sites of the GIT in order to
facilitate collection of microbiological samples. Cannulated animals are equipped with a
port from which samples can be taken at one or several sites along the GIT. Cannulation
has been performed on dogs, pigs, and other larger animals (108-110). This technology
has been valuable in assessing the microbial and enzymatic properties of specific areas
within the GIT.
Gene Deficient Animals
In recent years, specific mouse strains have been frequently used in studies of colitis. Colitis
in mice closely resembles human inflammatory bowel disease (IBD). There are several
specific inbred mouse strains that are most useful in this area as they are more likely to
develop spontaneous colitis. Strains displaying a disrupted expression of Interleukin (IL)-2,
IL-10, and TGF-P have proven to be particularly useful in these studies and have
contributed to a broader understanding of the role of the human GI microbiota in IBD.
There are a number of different characteristics associated with animals that express
irregular cytokine profiles. In mice that are deficient in IL-2, usually when 6-15 weeks
old, inflammation occurs in the colon only (111). However, in IL-10 deficient mice,
inflammation may also occur in the small intestine as well as the colon (112). TCRa
deficient animals have developed inflammation in the caecum, colon, and rectum
(113-115), whereas HLA-B27 rats develop inflammation in the colon, duodenum, and
caecum (1 16). These "knock out" models may be used to investigate the effect of the human
microbiota, both in terms of the aggravating, as well as alleviating effects on IBD (117).
Immune deficient animals have also been useful in studies relating to the effects
of probiotic cultures on colitis. Probiotic cultures investigated in IL-10 deficient mice
include L. salivarius, Bifidobacterium lactis (1 17). IL-10 knock out mice with colitis have
also been used to investigate the effect of a genetically modified (GM) Lactococcus lactis
that synthesizes IL-10 (42,118).
Chemically Induced Responses
Animals that have been intentionally exposed to specific pro-inflammatory or
carcinogenic chemicals have been used in studies on the role of microbiota in the
development of both cancer and IBD (Table 1). Cancer, or other malignant abnormalities
in the gut mucosa, may be induced by the oral administration of carcinogens. Examples of
264 Henriksson
such carcinogens are 1, 2 dimethylhydrazine (DMH), and N-methyl-N'-nitro-Nitrosogua-
din (MNNG). These types of models, which are based on either CV or HFA animals, have
also been used to assess the effect of both probiotics and prebiotics on the progression of
cancer in its various stages from DNA damage through to differentiation of tissue and
formation of tumors.
A study by Mclntoch and co-workers (52) investigated the effect of L. acidophilus
on the incidence of tumor formation as well as the mass of tumors found in animals that
had been challenged with DMH. It was demonstrated that the animals that had been given
L. acidophilus were associated with less tumors than those animals that were given other
probiotic cultures. As a result the most effective culture, in terms of protecting animals
against cancer, could be isolated out of a range of LAB cultures.
Another way of investigating the effect of microbiota on the formation of cancer is to
assess the occurrence of aberrant crypt foci in the intestinal epithelium. In this type of
model, increased occurrence of aberrant crypts indicate increased formation of tumors.
This model has been used to assess the effect of GI microbiota and specific dietary factors
on the development of intestinal cancer (48,119). In similar studies, animals given
azoxymethane were used to assess the effect of L. casei, of human origin, on the formation
of aberrant cells (120). Other studies using 3-methylcholanthrene to induce tumor
formation, demonstrated that the same strain delayed the onset of tumor formation. It was
suggested that this delay was due to an enhancement of cytotoxicity of NK cells (26).
Finally, mucosal carcinogenesis may be assessed by determination of the DNA adduct
formation (121). This type of methodology allows assessment of carcinogenesis without
visual scoring of aberrant crypts. This method has been successfully used to investigate the
effects of human intestinal flora on the mutagenicity of dietary factors by assessing DNA
adduct formation (36). Assessment of DNA adduct formation has been used as a tool in
investigating the protective effect of potentially probiotic cultures against the formation of
cancer (122,123). This type of model provides a cost-effective tool used in studies on the
GI microbiota and its role in formation of intestinal cancers.
Although both animal models have been used to demonstrate protection against
cancer by probiotic cultures, the difference between how cancer that has developed in the
chemically modified animal and how it has developed in the diseased human subject raises
questions as to what extent such observations are relevant for the human host. The
opportunity to test probiotic cultures in humans that have been intentionally exposed to
carcinogens does not exist. However, it is known that some of the probiotic cultures that
reduce the incidence of tumor formation in animals have a similar effect on cancer in
humans (124,125).
Apoptosis is a mechanism inherent to healthy mucosal cells, which ultimately leads
to the death of cancerous cells. The effect of various dietary factors on apoptosis can be
assessed in animal models. Several studies have investigated the effect of probiotics and
prebiotics on apoptosis. Some of these studies have revealed that prebiotics such as Fructo-
Oligosaccharides (FOS) and inulin increase incidence of apoptosis and thereby provide
increased protection against the formation of intestinal cancers (126).
A wide range of animal models have been applied to studies on IBD. Naturally
occurring animal models have been important tools in studies related to human ulcerative
colitis and Crohn's disease. IBD-like symptoms have also been induced chemically. The
application of such chemicals may induce ulceration of the intestinal mucosa as well as
several immunological responses that are typical to IBD in humans. Simple methods for
T-cell induced onset of IBD may be initiated by di-nitro chlorobenzene (DNCP) as
described by Glick and Falchuk (127). This method involves both systemic and local
application of DNCP. Other chemically induced forms of IBD may be induced by intra
Animal Models for the Human Gastrointestinal Tract 265
rectal inoculation of trinitrobenzene sulphonic acid (TNBS) which is dissolved in alcohol.
The latter treatment results in inflammation that lasts for several weeks after exposure to
these agents (128). Animals not treated with this agent are normally tolerant to sonicates
derived from the heterologus intestine of syngenic littermates (BsH). However, in animals
with IBD induced by TNBS, both local and systemic tolerance to BsH is broken (129).
Interestingly, this study also demonstrated that tolerance to BsH was abrogated by
treatment with IL-10 or antibodies to IL-12.
A study using oral therapy with a probiotic culture had no effect on either the
severity of colitis or gut permeability in this TNBS model (53). Similarly, oral therapy
with L. rhamnosus and a mixture of probiotic cultures has been shown to reduce the extent
of colonic damage in TNBS induced colitis (130). However, both L. rhamnosus and the
culture mixture significantly ameliorated colitis induced by idoacetamide (130). These
studies indicate that inflammation induced by a sulfhydryl blocker (e.g., idoacetamide), as
described by Rachmilewitz and co-workers (128), may be a better model for assessing the
effect of gut microorganisms on colitis.
CONCLUSION
Animal models provide opportunities to investigate the effect of food and pharmaceutical
ingredients on GI health and the human microbiota in vivo. A wide range of methods that
use animal models have been described, including those based on CV, germ-free, and HFA
animals. CV animal models are particularly suitable for studies on the effect of orally
dosed probiotic strains, or other microorganisms of human origin, on resistance against
infection and aberrant formations in the GI mucosa. Germ-free animals provide
opportunities to create HFA animals that are suitable for studies on the effect of the
total human microbiota in vivo. HFA animals have been used extensively in studies on
the role of the human microbiota in nutrition and metabolism of nutrients. The effect of the
microbiota on the immune system can be investigated in chemically modified animals, or
specific immune deficient "knock out" models. These models have been used in studies on
the effect of the human microbiota and probiotic cultures on the progress of IBD and other
diseases that may be caused by a dysfunctional immune system. In addition, chemically
modified animals have been used in studies on the effect of probiotic cultures on the
development of tumors and other aberrant formations. The usefulness of animals in studies
on human microbiota and its effect on GI health has a long standing and clear value. In an
age where virtual in vivo simulations are becoming increasingly important, it remains
clear that animal models will continue to be highly valuable in research on the functions of
the human microbiota and activity of specific microbial strains of human origin.
REFERENCES
1 . Luick BR, Penner MH. Nominal response of passage rates to fiber particle size in rats. J Nutr
1991; 121:1940-1947.
2. Sakaguchi E, Itoh H, Uchida S, Horigome T. Comparison of fibre digestion and digesta
retention time between rabbits, guinea-pigs, rats and hamsters. Br J Nutr 1987; 58:149-158.
3. Stevens CE. Comparative Physiology of the Vertebrate Digestive System. New York:
Cambridge University Press, 1988.
4. Savage DS. Microbial ecology of the gastrointestinal tract. Annu Rev Microbiol 1977;
31:107-133.
266 Henriksson
5. Smith WH. Observations on the flora of the alimentary tract of animals and factors affecting
its composition. J Pathol Bacteriol 1965; 89:95-122.
6. Tannock GW. Normal microbiota of the gastrointestinal tract of rodents. In: Mackie RI,
White BA, Isaacson RE, eds. Gastrointestinal Microbiology. New York: Chapman & Hall,
1997 pp. 187-215.
7. Holdeman LV, Good IJ, Moore WEC. Human fecal flora: variation in bacterial composition
within individuals and a possible effect on emotional stress. Appl Environ Microbiol 1976;
31:359-375.
8. Moore WEC, Holdeman LV. Human fecal flora: the normal flora of 20 Japanese-Hawaiians.
Appl Microbiol 1974; 27:961-979.
9. Drasar BS, Barrow PA. Intestinal Microbiology. Washington: Van Nostrand Reinhold, 1985.
10. Finegold SM, Attebery HR, Sutter VL. Effect of diet on human fecal flora: comparison of
Japanese and American diets. Am J Clin Nutr 1974; 27:1456-1469.
1 1 . Mitsuoka T. Taxonomy and ecology of the indigenous intestinal bacteria. Recent Advances in
Microbial Ecology. Tokyo: Japan Scientific Societies Press, 1989 pp. 493-498.
12. Rickard KL, Folino M, Mclntyre A, Albert V, Muir J, Young GP. Colonic epithelial biology;
comparison of resistant starch to soluble and insoluble dietary fibres. Processing Nutr Soc
1994; 18:57.
13. Barnes RH, Fiala G, McGehee B, Brown A. Prevention of coprophagy in the rat. J Nutr 1957;
63:489-528.
14. Barnes RH. Nutritional implications of coprophagy. Nutr Rev 1962; 20:289-291.
15. Fitzgerald RJ, Gustafsson BE, McDaniel EG. Effects of coprophagy prevention on intestinal
microflora in rats. J Nutr 1964; 84:155-160.
16. Smith HW, Jones JET. Observations on the alimentary tract and its bacterial flora in healthy
and diseased pigs. J Pathol Bacteriol 1963; 86:387-412.
17. Cross ML. Microbes versus microbes: immune signals generated by probiotic lactobacilli and
their role in protection against microbial pathogens. FEMS Immunol Med Microbiol 2002;
34:245-253.
18. Schiffrin EJ, Blum S. Interactions between the microbiota and the intestinal mucosa. Eur
J Clin Nutr 2002; 56:S60-S64.
19. Borchers AT, Keen CL, Gershwin ME. The influence of yogurt/ Lactobacillus on the innate
and acquired immune response. Clin Rev Allergy Immunol 2002; 22:207-230.
20. Berg RD, Owens WE. Inhibition of translocation of viable Escherichia coli from the
gastrointestinal tract to the mesenteric lymph nodes and other organs in a gnotobiotic mouse
model. Infect Immun 1979; 25:820-827.
21. Berg RD. Inhibition of Escherichia coli translocation from the gastrointestinal tract by normal
cecal flora in gnotobiotic or antibiotic-decontaminated mice. Infect Immun 1980; 29: 1073-108 1 .
22. Berg RD. Promotion of the translocation of enteric bacteria from the gastrointestinal tracts of
mice by oral treatment with penicillin, clindamycin, or metronidazole. Infect Immun 1981;
33:854-861.
23. Perdigon G, Maldonado Galdeano C, Valdez JC, Medici M. Interaction of lactic acid bacteria
with the gut immune system. Eur J Clin Nutr 2002; 56:S21-S26.
24. Sudo N, Yu XN, Aiba Y, et al. An oral introduction of intestinal bacteria prevents the
development of a long-term Th2-skewed immunological memory induced by neonatal
antibiotic treatment in mice. Clin Exp Allergy 2002; 32:1112-1116.
25. Perdigon G, Nader ME, Alvarez MS, Oliver G, Holgado AAPD. Effect of perorally
administered lactobacilli on macrophage activation in mice. Infect Immun 1986; 53:404-410.
26. Takagi A, Matsuzaki T, Sato M, Nomoto K, Morotomi M, Yokokura T. Enhancement of
natural killer cytotoxicity delayed murine carcinogenesis by a probiotic microorganism.
Carcinogenesis 2001; 22:599-605.
27. Gill HS, Rutherfurd KJ, Cross ML. Dietary probiotic supplementation enhances natural killer
cell activity in the elderly: an investigation of age-related immunological changes. J Clin
Immunol 2001; 21:264-271.
Animal Models for the Human Gastrointestinal Tract 267
28. Oozeer R, Goupil-Feuillerat N, Alpert CA, et al. Lactobacillus casei is able to survive and
initiate protein synthesis during its transit in the digestive tract of human flora-associated
mice. Appl Environ Microbiol 2002; 68:3570-3574.
29. Kato I, Endo-Tanaka K, Yokokura T. Suppressive effects of the oral administration of
Lactobacillus casei on the type II collagen-induced arthritis in DBA/1 mice. Life Sci 1998;
63:635-644.
30. Gill HS, Rutherfurd KJ. Viability and dose-response studies on the effects of the
immunoenhancing lactic acid bacterium Lactobacillus rhamnosus in mice. Br J Nutr 2001;
86:285-289.
31. Gill HS, Shu Q, Lin H, Rutherfurd KJ, Cross ML. Protection against translocating Salmonella
typhimurium infection in mice by feeding the immuno-enhancing probiotic Lactobacillus
rhamnosus strain HN001. Med Microbiol Immunol 2001; 190:97-104.
32. Henriksson A, Conway PL. Colonization resistance induced in mice orogastrically dosed with
human fecal homogenates from different donors. Microbiol Ecol Health Dis 2001; 13:96-99.
33. Henriksson A, Conway PL. Isolation of the human fecal bifidobacteria which reduce signs of
Salmonella infection when orogastrically dosed to mice. J Appl Microbiol 2001; 90:223-228.
34. Cross ML, Mortensen RR, Kudsk J, Gill HS. Dietary intake of Lactobacillus rhamnosus
HNOOl enhances production of both Thl and Th2 cytokines in antigen-primed mice. Med
Microbiol Immunol 2002; 191:49-53.
35. Mahoney M, Henriksson A. The effect of processed meat and meat starter cultures on
gastrointestinal colonization and virulence of Listeria monocytogenes in mice. Int J Food
Microbiol 2003; 84:255-261.
36. Pestka JJ, Ha C-L, Warner RW, Lee JH, Ustunol Z. Effects of ingestion of yoghurts containing
Bifidobacterium and Lactobacillus on spleen and peyer' s patch lymphocyte populations in the
mouse. J Food Prot 2001; 64:392-395.
37. Hirayama K, Baranczewski P, Akerlund JE, Midtvedt T, Moller L, Rafter J. Effects of human
intestinal flora on mutagenicity of and DNA adduct formation from food and environmental
mutagens. Carcinogenesis 2000; 21:2105-2111.
38. Waidmann M, Bechtold O, Frick JS, et al. Bacteroides vulgatus protects against Escherichia
co//-induced colitis in gnotobiotic interleukin-2-deficient mice. Gastroenterology 2003;
125:162-177.
39. Balish E, Warner T. Enterococcus fecalis induces inflammatory bowel disease in interleukin-
10 knockout mice. Am J Pathol 2002; 160:2253-2257.
40. Schultz M, Veltkamp C, Dieleman LA, et al. Lactobacillus plantarum 299V in the treatment
and prevention of spontaneous colitis in interleukin-10-deficient mice. Inflamm Bowel Dis
2002; 8:71-80.
41. McCarthy J, O'Mahony L, O'Callaghan L, et al. Double blind, placebo controlled trial of two
probiotic strains in interleukin 10 knockout mice and mechanistic link with cytokine balance.
Gut 2003; 52:975-980.
42. Steidler L, Hans W, Schotte L, et al. Treatment of murine colitis by Lactococcus lactis
secreting interleukin- 10, [comment]. Science 2000; 289:1352-1355.
43. Hudault S, Lievin V, Bernet-Camard MF, Servin AL. Antagonistic activity exerted in vitro
and in vivo by Lactobacillus casei (strain GG) against Salmonella typhimurium C5 infection.
Appl Environ Microbiol 1997; 63:513-518.
44. Silva SH, Vieira EC, Dias RS, Nicoli JR. Antagonism against Vibrio cholera by diffusible
substances produced by bacterial components of the human fecal microbiota. J Med Microbiol
2001;50:161-164.
45. Li Z, Yang S, Lin H, et al. Probiotics and antibodies to TNF inhibit inflammatory activity and
improve nonalcoholic fatty liver disease, [comment]. Hepatology 2003; 37:343-350.
46. Konrad A, Mahler M, Flogerzi B, et al. Amelioration of murine colitis by feeding a solution of
lysed Escherichia coli. Scand J Gastroenterol 2003; 38:172-179.
47. Rouzaud G, Rabot S, Ratcliffe B, Duncan AJ. Influence of plant and bacterial myrosinase
activity on the metabolic fate of glucosinolates in gnotobiotic rats. Br J Nutr 2003;
90:395-404.
268 Henriksson
48. Roland N, Nugon-Bandon L, Flinois P, Beaune P. Hepatic and intestinal cytochrome P-450,
glutathione-transferase and UDP-glucuronosyl transferase are affected by six types of dietary
fiber in rats inoculated with human whole fecal flora. J Nutr 1994; 124:1581-1587.
49. Tache S, Peiffer G, Millet AS, Corpet DE. Carrageenan gel and aberrant crypt foci in the colon
of conventional and human flora-associated rats. Nutr Cancer 2000; 37:193-198.
50. Sidhu H, Allison MJ, Chow JM, Clark A, Peck AB. Rapid reversal of hyperoxaluria in a rat
model after probiotic administration of Oxalobacter formigenes. J Urol 2001 ; 166: 1487-1491 .
51. Adawi D, Ahrne S, Molin G. Effects of different probiotic strains of Lactobacillus and
Bifidobacterium on bacterial translocation and liver injury in an acute liver injury model. Int
J Food Microbiol 2001; 70:213-220.
52. Mcintosh GH, Royle PJ, Playne MJ. A probiotic strain of L. acidophilus reduces DMH-
induced large intestinal tumors in male Sprague-Dawley rats. Nutr Cancer 1999; 35:153-159.
53. Kennedy RJ, Hoper M, Deodhar K, Kirk SJ, Gardiner KR. Probiotic therapy fails to improve
gut permeability in a hapten model of colitis. Scand J Gastroenterol 2000; 35:1266-1271.
54. Eizaguirre I, Urkia NG, Asensio AB, et al. Probiotic supplementation reduces the risk of bacterial
translocation in experimental short bowel syndrome. J Pediatr Surg 2002; 37:699-702.
55. Wang X, Brown IL, Evans AJ, Conway PL. The protective effects of high amylose maize
(amylomaize) starch granules on the survival of Bifidobacterium spp. in the mouse
gastrointestinal tract. J Appl Microbiol 1999; 87:631-639.
56. Hudault S, Lievin V, Bernet-Camard MF, Servin AL. Antagonistic activity exerted in vivo
and in vitro by Lactobacillus casei (strain GG) against Salmonella typhimurium C5 infection.
Appl Environ Microbiol 1997; 63:513-518.
57. Cohen PS, Rossoll R, Cabelli VJ, Yang S-L, Laux DC. Relationship between the mouse
colonizing ability of a human fecal Esherichia coli strain and its ability to bind a specific
mouse colonic mucous gel protein. Infect Immun 1983; 40:62-69.
58. Paubert-Braquet M, Xiao-Hu G, Gaudichon C, et al. Enhancement of host resistance against
Salmonella typhimurium in mice fed a diet supplemented with yogurt or milks fermented with
warious Lactobacillus casei strains. Int J Immunother 1995; XI: 153-161.
59. Shu Q, Lin H, Rutherfurd KJ, et al. Dietary Bifidobacterium lactis (HN019) ennhances
resistance to oral Salmonella typhimurium infection in mice. Microbiol Immunol 2000;
44:213-222.
60. Bovee-Oudenhoven IM. Increasing the intestinal resistance of rats to the invasive pathogen
Salmonella enteritidis: additive effects of dietary lactulose and calcium. Gut 1997; 40:497-504.
61. Shu Q, Gill HS. Immune protection mediated by the probiotic Lactobacillus rhamnosus
HN001 (DR20) against Escherichia coli 0157:H7 infection in mice. FEMS Immunol Med
Microbiol 2002; 34:59-64.
62. Shu Q, Gill HS. A dietary probiotic (Bifidobacterium lactis HN019) reduces the severity of
Escherichia coli 0157:H7 infection in mice. Med Microbiol Immunol 2001; 189:147-152.
63. DeWaard R, Garssen J, Bokken GCAM, Vos JG. Antagonistic activity of Lactobacillus casei
strain Shirota against gastrointestinal Listaria monocytogenes infection in rats. Int J Food
Microbiol 2002; 73:93-100.
64. Mahoney M, Henriksson A. The effect of processed meat and meat starter cultures on
gastrointestinal colonization and virulence of Listeria monocytogenes in mice. Int J Food
Microbiol 2001; 84:255-261.
65. Bernet-Camard MF, Lievin V, Bassart D, Neeser JR, Servin AL, Hudault S. The human
Lactobacillus acidophilus strain LAI secrets a nonbacteriocin antibacterial substance(s)
active in vitro and in vivo. Appl Environ Microbiol 1997; 63:2747-2753.
66. Voravuthikunchai SP. Investigation of Caecectomy as a Perturbation of the Mouse Intestinal
Ecosystem. Sydney: The University of New South Wales, 1988.
67. Babour AH, Rampling A, Hormaeche CE. Variation in the infectivity of Listeria
monocytogenes isolates following intregastric inoculation of mice. Infect Immun 2001.
68. Yuki N, Watanabe K, Mike A, et al. Survival of a probiotic, Lactobacillus casei strain Shirota,
in the gastrointestinal tract: selective isolation from feces and identification using monoclonal
antibodies. Int J Food Microbiol 1999; 48:51-57.
Animal Models for the Human Gastrointestinal Tract 269
69. Saxelin M, Elo S, Salminen S, Vapaatalo H. Dose response colonization of feces after oral
administration of Lactobacillus easel strain GG. Microb Ecol Health Dis 1991; 4:209-214.
70. Goldin BR, Gorbach SL, Saxelin M, Barakat S, Gualtieri L, Salminen S. Survival of
Lactobacillus species (strain GG) in human gastrointestinal tract. Dig Dis Sci 1992;
37:121-128.
71. Charteris WP, Kelly PM, Morelli L, Collins JK. Selective detection, enumeration and
identification of potentialy probiotic Lactobacillus and Bifidobacterium species in mixed
bacterial populations. Int J Food Microbiol 1997; 35:1-27.
72. Lynch PA, Gilpin BJ, Sinton LW, Savill MG. The detection of Bifidobacterium adolescentis
by colony hybridization as an indicator of human fecal pollution. J Appl Microbiol 2002;
92:526-533.
73. Lucchini F, Kmet V, Cesena C, Coppi L, Bottazzi V, Morelli L. Specific detection of a
probiotic Lactobacillus strain in fecal samples by using multiplex PCR. FEMS Microbiol Lett
1998; 158:273-278.
74. Kaneko T, Kurihara H. Digoxigenin-labeled deoxyribonucleic acid probes for the
enumeration of bifidobacteria in fecal samples. J Dairy Sci 1997; 80:1254-1259.
75. Su P, Tandianus JE, Park JH, Henriksson A, Dunn NW. A colony hybridization method for
Bifidobacterium lactis LAFTI B94. Aust Dairy Technol 2003; 58:213.
76. Tannock GW, Crichton C, Welling GW, Koopman JP, Midtvedt T. Reconstitution of the
gastrointestinal microflora of lactobacillus-free mice. Appl Environ Microbiol 1988;
54:2971-2975.
77. Tannock GW, Dashkevicz MP, Feighner SD. Lactobacilli and bile salt hydrolase in the
murine intestinal tract. Appl Environ Microbiol 1989; 55:1848-1851.
78. McConell MA, Tannock GW. Lactobacilli do not influence enzyme activities of duodenal
enterocytes of mice. Microb Ecol Health Dis 1993; 6:315-318.
79. Midtvedt T, Gustafsson BE. Microbial convesion of bilirubin to urobilin in vitro and in vivo.
Acta Pathol Microbiol Scand Sect B 1981; 89:57-60.
80. Norin KE, Midtvedt T, Gustafsson BE. Influence of intestinal microflora on the tryptic activity
during lactation in rats. Lab Anim Sci 1986; 20:234-237.
81. Corthier C, Dubos F, Ducluzeau R. Prevention of Clostridium difficile induced mortality in
gnotobiotic mice by Saccharomyces boulardii. Can J Microbiol 1986; 32:894-896.
82. Rodrigues ACP, Nardi RM, Bambirra EA, Vieira EC, Nicoli JR. Effects of Saccharomyces
boulardii against oral infection with Salmonella typhimurium and Shigella flexneri in
conventional and gnotobiotic mice. J Appl Bacteriol 1996; 81:251-256.
83. Wilson KH, Sheagren JN, Freter R, Weatherbee L, Lyerly D. Gnotobiotic models for study of
the microbial ecology of Clostridium difficile and Escherchia coli. J Infect Dis 1986;
153:547-551.
84. Kabir AM, Aiba Y, Takagi A, Kamiya S, Miwa T, Koga Y. Prevention of helicobacter pylori
infection by lactobacilli in a gnotobiotic murine model. Gut 1997; 41:49-55.
85. Kleessen B, Hartmann L, Blaut M. Oligofructose and long-chain inulin: influence on the gut
microbial ecology of rats associated with a human fecal flora. Br J Nutr 2001; 86:291-300.
86. Chikai T, Nakao H, Uchida K. Deconjugation of bile acids by human intestinal bacteria
implanted in germ-free rats. Lipids 1987; 22:669-671.
o
87. Herias MV, Hessle C, Telemo E, Midtvedt T, Hanson LA, Wold AE. Immunomodulatory
effects of Lactobacillus plantarum colonizing the intestine of gnotobiotic rats. Clin Exp
Immunol 1999; 116:283-290.
88. Scharek L, Hartmann L, Heinevetter L, Blaut M. Bifidobacterium adolescentis modulates the
specific immune response to another human gut bacterium, Bacteroides thetaiotaomicron, in
gnotobiotic rats. Immunobiology 2000; 202:429-441.
89. Hooper LV, Midtvedt T, Gordon JI. How host-microbial interactions shape the nutrient
environment of the mammalian intestine. Annu Rev Nutr 2002; 22:283-307.
90. Husebye E, Hellstrom PM, Sundler F, Chen J, Midtvedt T. Influence of microbial species on
small intestinal myoelectric activity and transit in germ-free rats. Am J Physiol Gastrointest
Liver Physiol 2001; 280:G368-G380.
270 Henriksson
91 . Kleessen B, Hartmann L, Blaut M. Fructans in the diet cause alterations of intestinal mucosal
architecture, released mucins and mucosa-associated bifidobacteria in gnotobiotic rats. Br
J Nutr 2003; 89:597-606.
92. Lin JH-C, Savage DC. Host specificity of the colonization of murine gastric epithelium by
lactobacilli. FEMS Microbiol Lett 1984; 24:67-71.
93. Conway PL, Henriksson A. Strategies for the isolation and characterization of functional
probiotics. Human Health: The Contribution of Microorganisms. London: Springer- Verlag,
1993 pp. 75-94.
94. Mallett AK, Bearne CA, Rowland IR, Farthing MJ, Cole CB, Fuller R. The use of rats
associated with a human fecal flora as a model for studying the effects of diet on the human gut
microflora. J Appl Bacteriol 1987; 63:39-45.
95. Hirayama K. Ex-germfree mice harboring intestinal microbiota derived from other animal
species as an experimental model for ecology and metabolism of intestinal bacteria. Exp
Anim 1999; 48:219-227.
96. Hirayama K, Miyaji K, Kawamura S, Itoh K, Takahashi E, Mitsuoka T. Development of
intestinal flora of human-flora-associated (HFA) mice in the intestine of their offspring. Exp
Anim 1995; 44:219-222.
97. Silvi S, Rumney CJ, Cresci A, Rowland IR. Resistant starch modifies gut microflora and
microbial metabolism in human flora-associated rats inoculated with feces from Italian and
U.K. donors. J Appl Microbiol 1999; 86:521-530.
98. Bowey E, Adlercreutz H, Rowland I. Metabolism of isoflavones and lignans by the gut microflora:
a study in germ-free and human flora associated rats. Food Chem Toxicol 2003; 41:631-636.
99. Ward FW, Coates ME, Cole CB, Fuller R. Effect of dietary fats on endogenous formation of
N-nitrosamines from nitrate in germ-free and conventional rats and rats harbouring a human
flora. Food Addit Contam 1990; 7:597-604.
100. Kamlage B, Hartmann L, Gruhl B, Blaut M. Linoleic acid conjugation by human intestinal
microorganisms is inhibited by glucose and other substrates in vitro and in gnotobiotic rats.
J Nutr 2000; 130:2036-2039.
101. Roland N, Nugon-Baudon L, Andrieux C, Szylit O. Comparative study of the fermentative
characteristics of inulin and different types of fibre in rats inoculated with a human whole fecal
flora. Br J Nutr 1995; 74:239-249.
102. Djouzi Z, Andrieux C. Compared effects of three oligosaccharides on metabolism of intestinal
microflora in rats inoculated with a human fecal flora. Br J Nutr 1997; 78:313-324.
103. Lhoste EF, Ouriet V, Bruel S, et al. The human colonic microflora influences the alterations of
xenobiotic-metabolizing enzymes by catechins in male F344 rats. Food Chem Toxicol 2003;
41:695-702.
104. Barrow PA, Brooker BE, Fuller BE, Newport MJ. The attachment of bacteria to the gastric
epithelium of the pig and its importance in the microbiology of the intestine. J Appl Bacteriol
1980;48:147-154.
105. Jonsson E, Conway PL. Probiotics for pigs. In: Fuller R, ed. Probiotics, the Scientific Basis.
London: Chapman & Hall, 1992:87-110.
106. Voravuthikunchai SP, Lee A. Cecectomy causes long-term reduction of colonization
resistance in the mouse gastrointestinal tract. Infect Immun 1987; 55:995-999.
107. Henriksson A, Khaled AKD, Conway PL. The effect of caecectomy on the fecal
concentrations of urobilinogen and active trypsin in mice. Microb Ecol Health Dis 1996;
9:61-65.
108. Simmons HA, Ford EJ. Multiple cannulation of the large intestine of the horse. Br Vet J 1988;
144:449-454.
109. Walker J A, Harmon DL, Gross KL, Collings GF. Evaluation of nutrient utilization in the
canine using the ileal cannulation technique. J Nutr 1994;2672S-2676S.
110. Hagberg L, Bruce AW, Reid G, Eden CS, Lincoln K, Lidin-Janson G. Colonization of the
urinary tract with bacteria from the normal fecal and urethral flora in patients with recurrent
urinary tract infections. In: Kass HE, Eden CS, eds. Host-Parasite Interactions in Urinary
Tract Infections. Chicago: University of Chicago Press, 1989:194-197.
Animal Models for the Human Gastrointestinal Tract 271
111. Sadlack B, Merz H, Schorle H, Schimpl A, Feller AC, Horak I. Ulcerative colitis-like disease
in mice with a disrupted interleukin-2 gene, [comment]. Cell 1993; 75:253-261.
1 12. Kuhn RJ, Lohler J, Rennick D, Rajewsky K, Muller W. Interleukin 10-deficient micedevelop
chronic enterocolitis. Cell 1993; 75:263-274.
113. Gaskins HR, Vondrak-Juergens GL, McCracken BA, Woolsey JH. Specific-pathogen-free
conditions enhance inflammatory bowel disease in T-cell receptor knockout, but not
C3H/HeJBir mice, [comment]. Lab Anim Sci 1997; 47:650-655.
1 14. Dianda L, Hanby AM, Wright NA, Sebesteny A, Hayday AC, Owen MJ. T cell receptor-alpha
beta-deficient mice fail to develop colitis in the absence of a microbial environment. Am
J Pathol 1997; 150:91-97.
115. Mombaerts P, Mizoguchi E, Grusby MJ, Glimcher LH, Bhan AK, Tonegawa S. Spontaneous
development of inflammatory bowel disease in T cell receptor mutant mice, [comment]. Cell
1993; 75:274-282.
116. Taurog JD, Richardson JA, Croft JT, et al. The germfree state prevents development of gut
and joint inflammatory disease in HLA-B27 transgenic rats. J Exp Med 1994; 180:2359-2364.
117. Desreumaux P, Colombel JF. Intestinal flora and Crohn's disease. Ann Pharm Fr 2003;
61:276-281. McCarthy J, O'Mahony L, O'Callaghan L, et al. Double blind, placebo
controlled trial of two probiotic strains in interleukin 10 knockout mice and mechanistic link
with cytokine balance. Gut 2003; 52:957-980.
118. Steidler L. In situ delivery of cytokines by genetically engineered Lactococcus lactis. Antonie
van Leeuwenhoek 2002; 82:323-331.
119. Hambly RJ, Rumney CJ, Fletcher JM, Rijken PJ, Rowland IR. Effects of high- and low-risk
diets on gut microflora-associated biomarkers of colon cancer in human flora-associated rats.
Nutr Cancer 1997; 27:250-255.
120. Yamazaki K, Tsunoda A, Sibusawa M, et al. The effect of an oral administration of
Lactobacillus casei strain shirota on azoxymethane-induced colonic aberrant crypt foci and
colon cancer in the rat. Oncol Rep 2000; 7:977-982.
121. Rumney CJ, Rowland IR, Coutts TM, et al. Effects of risk-associated human dietary
macrocomponents on processes related to carcinogenesis in human-flora-associated (HFA)
rats. Carcinogenesis 1993; 14:79-84.
122. Knasmuller S, Steinkellner H, Hirschl AM, Rabot S, Nobis EC, Kassie F. Impact of bacteria in
dairy products and of the intestinal microflora on the genotoxic and carcinogenic effects of
heterocyclic aromatic amines. Mutat Res 2001; 480-481:129-138.
123. Horie H, Zeisig M, Hirayama K, Midtvedt T, Moller L, Rafter J. Probiotic mixture decreases
DNA adduct formation in colonic epithelium induced by the food mutagen 2-amino-9H-
pyrido[2,3-b]indole in a human-flora associated mouse model. Eur J Cancer Prev 2003;
12:101-107.
124. Aso Y, Akaza H, Kotake T, Tsukamoto T, Imai K, Naito S. Preventive effect of a
Lactobacillus casei preparation on the recurrence of superficial bladder cancer in a double-
blind trial. The BLP Study Group. Eur Urol 1995; 27:104-109.
125. Aso Y, Akazan H. Prophylactic effect of a Lactobacillus casei preparation on the recurrence
of superficial bladder cancer. BLP Study Group. Urol Int 1992; 49:125-129.
126. Hughes R, Rowland IR. Stimulation of apoptosis by two prebiotic chicory fructans in the rat
colon. Carcinogenesis 2001; 22:43-47.
127. Glick ME, Falchuk ZM. Dinitrochlorobenzene-induced colitis in the guinea-pig: studies of
colonic lamina propria lymphocytes. Gut 1981; 22:120-125.
128. Rachmilewitz D, Simon PL, Schwartz LW, Griswold DE, Fondacaro JD, Wasserman MA.
Inflammatory mediators of experimental colitis in rats. Gastroenterology 1989; 97:326-337.
129. Duchmann R, Kaiser I, Hermann E, Mayet W, Ewe K, Meyer zum Buschenfelde KH.
Tolerance exists towards resident intestinal flora but is broken in active inflammatory bowel
disease (IBD) [comment]. Clin Exp Immunol 1995; 102:448-455.
130. Shibolet O, Karmeli F, Eliakim R, et al. Variable response to probiotics in two models of
experimental colitis in rats. Inflamm Bowel Dis 2002; 8:399-406.
15
Born Germ-Free — Microbial Dependent
Elisabeth Norin and Tore Midtvedt
Microbiology and Tumor Biology Center, Karolinska Instituted Stockholm, Sweden
INTRODUCTION
The essence of research on germ-free life is isolation. Any isolation must be attained
mechanically, proven scientifically, and understood philosophically. As early as 1885,
Louis Pasteur declared that the concept of a multicellular life free of all demonstrable
living microbes could be looked upon as "mission impossible." Germ-free animal research
began when Nuttal and Thierfelder in 1895/96 (1) succeeded in keeping a small number of
Caesarean-derived guinea pigs alive and germ-free for more than a week. From their work,
one can see that the major elements of germ-free research are similar today. They
described how to determine the time for partition; developed anesthetic procedures that
would not too adversely affect the offspring; and worked out procedures of aseptic
Cesarean section and transfer of the offspring from the uterus into a sterile environment
and sterilization procedures for food, water, and air, as well as proper methods for testing
the sterility of the isolator.
In the decades to follow, several scientists did some work on germ-free multi-
cellular organisms, but they all had to work with the first generation. A real breakthrough
in germ-free animal research came in 1945, when the second generation of germ-free rats
were born at the Lobund Laboratory, Notre Dame, USA. In the following decades, units
for germ-free animal research were established in several countries all around the world.
Bengt E. Gustafssson's lightweight stainless steel isolators (2) represented a major
technical improvement, and so did Trexler's plastic isolators. In the 1980s and 1990s,
there has been a temporary decline in germ-free animal research since much resources
from bioscience research were allocated to HIV and AIDS. However, in the last
5-7 years, there has been an increased interest in germ-free animals as well as in animals
with a specific, known microbiota, i.e., gnotobiotic animals. This increased interest is
partly based on progress in molecular methods for studying prokaryot-eukaryote cross-
talk in health and disease, partly on the mere fact that investigators, when working with
transgenic or knock-out laboratory animals have realized the tremendous influence of the
microbiota on the physiological and pathophysiological consequences of the new genetic
construct. Therefore, it is easy to forecast that germ-free animals and gnotobiotic
technology will be of increasing interest in the years to come. In the following, we will
focus on the role of the microbiota on some anatomical structures, physiological, and
273
274 Norin and Midtvedt
biochemical functions in the host. Additionally, the immunological impact of the
microbiota will briefly be commented on.
TERMINOLOGY
With a slight travesty of the well-known terminology introduced by Claude Bernhard, the
mammalian organism itself — a mouse, a rat or a human — can be characterized as a Milieu
interieur (MI), a normal microbiota as a Milieu exterieur (ME) and the macroorganism and
its microbiota as a Milieu total (MT) (3). In studies on the interplay between MI and ME,
two terms, i.e., Microflora Associated Characteristic (MAC) and Germ-free Animal
Characteristic (GAC) — have been found to be of considerable value (4). A MAC is defined
as the recording of any anatomical structure, physiological, biochemical or immunological
function in a macroorganism, which has been influenced by the microbiota. When
microorganism(s) influencing the parameter(s) under study are absent — as in germ-free
animals, newborns, or in relation to ingestion of antibiotics — the recording of a MAC can
be defined as a GAC. Consequently, a germ-free organism is a sum of all GACs, and a
normal macroorganism is a sum of MACs. Studies in germ-free animals and healthy
newborns have given us the values of GACs, i.e., the MI. When we are investigating
conventional organisms — MT — the question "what have the microbes done, " can be
answered by the equation MT minus MI = ME. A gnotobiotic animal harboring a known
microbiota, may present a set-up of some MACs and some GACs, depending on the
specific activity of its microbiota.
Over the years, the MAC/GAC concept has been applied in several studies (5). So
far, most studies have been related to a phenotypic expression of what the microbes have
done. However, the concept is applicable also when studying host-microbe cross-talk on a
molecular, genotypic level (6-8). In the following, some major discrepancies between
germ-free and conventional animals will be highlighted (Table 1).
GERM-FREE ANIMALS AND DIETARY REQUIREMENTS
Contrary to what is generally believed, germ-free animals require a higher dietary caloric
intake than their conventional counterparts. The main reason is very simple. A normal
microbiota will break down indigestible dietary substances to compounds that can be
absorbed by the host. That is most prominent in ruminants, i.e., the microbiota digest
cellulose into short chain fatty acids (SCFAs).
Also contrary to what is generally believed, germ-free animals require a higher
intake of nitrogen than their conventional counterparts. The main reason for this is most
probably the great loss of non-degraded material from expelled enterocytes that are found
in germ-free animals. In conventional animals, the microbiota converts the expelled
material into absorbable compounds.
In many germ-free macroorganisms, there might be a demand for an increased
dietary intake of some vitamins. Broadly speaking, the gastrointestinal microbiota, placed
between the ingesta and the host, may utilize dietary vitamins or produce vitamins
themselves.
Among the earliest evidence that the vitamin synthesis is connected to functions by
the intestinal microbes was the demonstration that germ-free rats reared without a dietary
source of vitamin K developed hemorrhages and hypoprotothrombinemia soon, whereas
their conventional controls had normal prothrombin levels and no bleeding tendencies (9).
Born Germ-Free — Microbial Dependent
275
Table 1 Influences of the Microbiota on Some Intestinal Anatomic, Physiological, and Biochemical
Parameters
Parameter
MAC
GAC
Microbes
Anatomical/physiological
Intestinal wall
Thicker
Thinner
Unknown
Cell kinetics
Fast
Slower
Unknown
Migration motor complexes
Normal
Fewer
Unknown
Production of peptides
Normal
Altered
Unknown
Sensitivity to peptides
Normal
Reduced
Unknown
Caecum size (rodents)
Normal
Enlarged
Partly known
Osmolality
Normal
Reduced
Unknown
Colloid osmotic pressure
Normal
Increased
Unknown
Oxygen tension
Low
High (as in tissue)
Several species
Electropotential Eh, mv
Low (under 100)
High (above 100)
Unknown
Biochemical
(3-aspartylglycine
Absent
Present
Unknown
Bile acid metabolism
Deconjugation
No deconjugation
Many species
Dehydrogenation
No dehydrogenation
Many species
Dehydroxylation
No dehydroxylation
Few species
Bilirubin metabolism
Much deconjugation
Little deconjugation
Many species
Urobilin
No urobilin
One species
Cholesterol
Coprostanol
No coprostanol
Few species
Intestinal gases
Carbon dioxide
Some carbon
dioxide
Many species
Methane
No methane
Few species
Hydrogene
No hydrogene
Few species
Mucin
Degraded
No degradation
Some species
SCFAs
Large amounts
Far less
Many species
Tryptic activity
Little or absent
High activity
Few species
Abbreviations: MAC, microflora associated characteristic; GAC, germ-free animal characteristic; SCFAs, short
chain fatty acids.
Source: From Ref. 8.
Administration of vitamin Ki restored prothrombin levels to normal values within a few
hours, but e.g., vitamin K 3 was less effective. If the germ-free animals were inoculated
with an intestinal microbiota from conventional animals, the prothrombin levels were
normalized quickly. The vitamin K dependent plasmaprotein factors II, VII, IX, and X are
taking part in the blood coagulation cascade. It has been shown that some bacterial strains
were effective in reversing vitamin K deficiency (10). It has also been shown, by hindrance
of coprophagy in rodents, that the intestinal microbiota supplies the host with parts of the
vitamin B complex.
INTESTINAL MICROBIOTA, GROSS ANATOMY, HISTOLOGY,
AND MOTILITY
An enlargement of the cecum in the Caesarean-derived guinea pigs was the first
anatomical difference observed when the epoch of germ-free research started (1), and
similar differences have been observed in all rodents so far investigated. This enlargement
might partly be explained by an absence of mucin breakdown in the germ-free animals,
partly by a reduced degradation of dietary compounds, such as fiber, and partly by
276 Norin and Midtvedt
a reduced sensitivity to biogenic amines in germ-free animals (11). Interestingly, it has
been shown that a mono-association of germ-free animals with Clostridium difficile
markedly reduced the cecum size (12).
For years, it was generally accepted that the villi were more slender and uniform in
shape and that the crypts were shallower, containing less cells in germ-free animals as
compared to their conventional counterparts. Moreover, the lamina propria was supposed
to be thinner, and the turn-over rate of epithelial loss was slower. However, most recently
it was shown — in germ-free, and conventional rats and mice — that age, gender, and the
intestinal compartment actually under study have to be taken into proper consideration
before stating significant differences (13-15).
Another striking difference than an enlarged cecum, is a reduction in spontaneous
muscular activity in germ-free animals. This may in part be due to a reduced sensitivity to
biogenic amines (11), partly also to a reduction in motor migrating complexes (16).
Interestingly, it was found that mono-association of germ-free animals with some bacterial
species, including a probiotic strain, switches the function from a GAC to an MAC pattern
within a few days. Furthermore, the area of endocrine cells in the GI tract is enlarged in
germ-free animals (17).
Most recently it has been found that experimental post-surgical intestinal adhesion
formation is markedly reduced in germ- free rats ( 1 8). After mono-associated with lactobacilli,
i.e., a probiotic strain, the animals reacted similar to the germ-free control, whereas they
switched to a conventional pattern after being mono-associated with Escherichia coli.
Obviously, germ-free animals should be used for solving this important question in surgery.
Additionally, germ-free animals may express a compartmentalized reduced
osmolarlity in intestinal content, an increased colloid osmotic pressure, a higher oxygen
tension, and a higher redox potential than their conventional counterparts. As a
consequence of this, strictly anaerobes are often difficult to establish as a monoculture
in germ-free animals (this is often a dose-dependency).
BIOCHEMICAL FUNCTIONS AND THE
GASTROINTESTINAL MICROBIOTA
Microbial Conversion of Bilirubin to Urobilinogen
Bile pigments, consisting almost exclusively of bilirubin, are the end products of the
catabolism of hemoglobin and some other heme-containing enzymes. Bilirubin, taken up
by the liver, is conjugated to glucuronate in the liver and excreted with the bile to the
intestine, where the bilirubin conjugates are de-conjugated, and transformed to a series of
urobilinogens, usually collectively termed urobilins. Some intestinal (3-glucuronidases are
derived from endogenous sources (19), but most of them are of microbial origin (20). The
capacity to alter deconjugated bilirubin to urobilins seems to be a rare property among
intestinal microorganisms. So far, only one bacterium, a strain of Clostridium ramosum,
has been found capable of performing this transformation (21,22).
Studies in children as well as adults, in rats and mice, and in pigs and horses show
that this is a function normally present in any organism with a normal acting micro-
biota (8). In infants, this function is established within the first month of life (23). In adults,
fecal levels of urobilins are significantly higher in men than in women (p<0.05).
Furthermore, in 36 to 50-year-old men the mean level of urobilins is significantly lower
than for younger men ( < 36 years). In the case of women, the highest fecal values are
found in women younger than 35 years of age (24).
Born Germ-Free — Microbial Dependent 277
Other studies have shown that intake of different antimicrobial drugs used in clinical
practice significantly suppressed this MAC (25).
Microbial Bile Acid Metabolism
In all mammals, bile acids are derived from cholesterol in the liver. Cholic acid and
chenodeoxycholic acid are common, but many other primary bile acids may be found. The
primary bile acids are conjugated, usually with taurine or glycine, sometimes also with
sulphate or glucuronate, and excreted into the bile. In the intestinal tract, the conjugated
primary bile acids are attacked by microbial enzymes and converted into a variety of
metabolites. The so-called secondary bile acids thus formed may then either be excreted
with the feces, or reabsorbed, and sometimes further metabolized by hepatic enzymes to
so-called tertiary bile acids before re-excretion in the bile. When present in the intestine,
the bile acids (primary, secondary or tertiary) are subject to a number of microbial
transformations such as deconjugation, desulfatation, deglucuronidation, dehydroxylation,
and other oxidation-reduction reactions at the hydroxy 1 groups (8). In general, the
metabolites formed are less water-soluble, less active in forming micelles, and sometimes
more toxic to the host.
Over the years, many hypotheses have been brought forward regarding the
influence(s) of various bile acids on several host-related signs and symptoms (intestinal
motility, cell-turnover, bacterial over-growth, effects similar as pheromones, development
of cancer etc). Obviously, further works on these areas are needed.
Microbial Conversion of Cholesterol to Coprostanol
Cholesterol is a component in all mammalian cellular membranes and a precursor of
steroid hormones, vitamin D, and bile acids. Pathophysiological^, it is thought to be an
important factor in the pathogenesis of atheromatous arterial disease, hypertension, cancer
of the large bowel, and other disorders (8). The intestinal cholesterol is derived mainly
from two sources — partly from synthesis occurring in the liver and the small intestine and
partly from foods of animal origin. The main elimination routes for the plasma cholesterol
are biliary excretion of cholesterol into the intestine as well as hepatic conversion of
cholesterol to bile acids. The intestinal cholesterol can be absorbed to the entero-hepatic
circulation or undergo microbial conversion. The major microbial metabolite is
(unabsorbable) coprostanol which is excreted with the feces. The organisms responsible
for the conversion are all strictly anaerobic, Gram-positive, nonspore-forming coccoid
rods, probably belonging to the genus Eubacterium.
By definition, any germ-free organism lacks the intestinal microbial excretion route
for cholesterol. From a functional point of view, conversion of cholesterol to coprostanol
can be looked upon as a sharp "microbial intestinal knife," influencing the normal entero-
hepatic circulation of cholesterol (26). As early as 1959, higher serum cholesterol
concentrations were found in germ-free than in conventional rats fed the same diet (27).
Studies in many mammalian species show that this function is present in all
animals soon after birth (5). However, data from infants indicate that this function is
established — when established — in the second part of their first year. Comparative data
from several countries show that one of five healthy adults might be a "non-excretor" or
"low-excretor" of coprostanol. We have hypothesized that a genetically determined
receptor determines whether an environmental receptor modulation determines if a
cholesterol converting microbiota will be established. So far, however, the nature of
the(se) receptor(s) is still unknown (8).
278 Norin and Midtvedt
It has been claimed by some probiotic-producing companies that their microbial
products decrease the level of plasma cholesterol, by mechanisms(s) still under discussion.
Gnotobiotic animal studies seem very applicable for further mechanistic investigations.
Microbial Degradation of Mucin
Mucin in the GI tract is produced by goblet cells in the mucosa and glandular mucous cells
in the submucosa. Mucin consists of a peptide core with oligosaccharide side chains
O-glycosidically bound, and it has several important physiological and patho-
physiological roles. It acts as lubricant, as a barrier and stabilizer for the intestinal
microclimate as well as a source of energy for the microbiota. There is growing evidence
that the mucin pattern may be a relevant issue to take into account in the pathophysiology
of some intestinal diseases, such as ulcerative colitis, Crohn's disease, gastric and
duodenal ulceration, and colon adenocarcinoma.
In contrast to conventional rats and healthy adult humans, organisms without any
intestinal microbiota excrete large amounts of mucin with their feces (28). The complete
degradation of mucin requires various glycosidases and peptidases, and the degradation is a
sequential action of several bacterial strains (28,29). However, one Peptostreptococcus
strain can degrade mucin in vitro and in vivo (30). Additionally, some strains belonging to
other species can act upon mucin (31) e.g., Bifidobacterium and Ruminococcus genera (31)
have been isolated and are related to degrading of mucin.
In all mammalian species so far studied, the intestinal microbiota is capable of
breaking down mucin (8). In healthy children the function is successively established
within the first year of life. It has also been shown that the microbiota might act upon the
glycosylation pattern of mucin (32). In fact, alteration in glycosylation was the first
observation of a molecular, quorum sensing dependent cross-talk between a host and a
single microbial strain present in the GI tract (33). Also regarding this intestinal function,
it has been demonstrated that different antibiotics cause disturbance of this microbial
function in animals and man (34,35).
Microbial Degradation of Intestinal Enzymes
In the following section, trypsin is used as a model substance for endogenously derived
enzymes. It is excreted as a precursor, trypsinogen, from the pancreas, and activated in the
small intestine, mainly by brush border enzymes (36). Fecal tryptic activity represents the
net sum of processes involving the secretion of trypsinogen, its activation to trypsin,
trypsin inactivators, and the presence in the intestine of microbial- and diet-derived
compounds and enzymes that inactivate or degrade trypsin and trypsin inactivators. Feces
of germ-free rats contain large amounts of tryptic activity, whereas far less is found in their
conventional counterparts (37,38). Obviously, intestinal microorganisms are responsible
for the inactivation of trypsin, and at least one strain of Bacteroides distasonis capable of
performing this inactivation, has been described (39).
In most mammals, except man, the intestinal microbiota is breaking down trypsin,
yielding fecal tryptic activity to be absent or very low. In man, most adults express tryptic
activity in their feces, although the levels are influenced upon by age and gender (24).
Microbial Degradation of p-Aspartylglycine
The biochemical background for the presence of (3-aspartylglycine in feces is probably as
follows: host-derived intestinal proteolytic enzymes break down some dietary proteins to
Born Germ-Free — Microbial Dependent 279
the P-carboxyl dipeptide P-aspartylglycine. The P-carboxyl dipeptide bonds are then
cleaved by proteases derived from microbes (40). This is substantiated by findings in germ-
free animals: lambs, piglets, rats, and mice. In feces from germ-free lambs and piglets
(Welling, personal communication), and adult germ-free rats and mice (41) P-aspartyl-
glycine is always found in germ-free rats and mice, whereas never in samples from their
conventional counterparts. Thus, the presence or absence of p-aspartylglycine represents a
functional parameter, depending on the presence of dietary precursors, the presence of host-
derived proteolytic enzymes, and the presence/absence of microbial derived proteolytic
enzymes. Previously it has been shown that the amount of P-aspartylglycine gradually
diminishes in feces from ex-germ-free mice, as the number of microbes in their GI
microbiota gradually increases (8). This dipeptide has been suggested as an indicator for
colonization resistance i.e., a barrier against opportunistic pathogens and other
microbes (42). Thus, presence of the dipeptide P-aspartylglycine in feces indicates that
the normal intestinal microbial ecosystem is seriously altered.
Microbial Production of Short-Chain Fatty Acids
All Short-Chain Fatty Acids (SCFAs) but acetic acid are microbial anabolic and catabolic
products following microbial degradation of many exogenously and endogenously derived
compounds in the GI tract of all mammalian species. Endogenous production of acetate
may occur in the liver or in the peripheral tissue. However, in intestinal contents nearly all
acetate present derives from microbial metabolism. The microbial origin of GI SCFAs has
been substantiated by comparative studies in germ-free and conventional animals (43). In
conventional animals, the total GI production will partly be influenced by anatomical
factors (far more in ruminants than in monogastric animals), partly by dietary habits (more
in herbivores than in carnivores). Fecal SCFAs represent the net sum of production,
absorption, and possible secretion of SCFAs throughout the GI tract. In short, each
mammalian species can be expected to have its own "excretion profile" (8).
The mere fact that so many physiological and clinical roles, ranging from sodium
absorption (5,23) to cancer pathogenesis are attributed to SCFAs, make them an extremely
interesting parameter. Significant alteration in fecal SCFAs profiles have been found in
atopic children (44). Intake of antibiotics (45,46) and dietary changes (47,48) may also
cause alterations in fecal SCFAs. Therefore, when studying this parameter in gnotobiotic
animals — or in patients — a consequence analysis, as outlined in Table 2, might give an
extra incitement for a proper evaluation.
IMMUNOLOGY AND GERM-FREE LIFE
In general, the major difference between germ-free and conventional animals is on a
quantitative rather than a qualitative level. This seems to hold true for innate as well as for
acquired immunity.
Serum from germ-free animals contains complement in similar amounts as in
conventional animals, whereas the levels of specific antibodies are reduced. On a cellular
level, polymorphonuclear neutrophiles (PMNs) from germ-free animals are equal to their
conventional counterparts with regard to phagocytic capacity (49) and chemotaxis
(50), and an apparent reduction in phagocytosis is due to humoral factors, i.e., reduced
antibodies (52).
The most striking difference between germ-free and conventional animals is found
with regard to the lymphoid immune system. In most — if not all — conventional
280 Norin and Midtvedt
Table 2 A Consequence Analysis of One Microbiota Associated Characteristic
Statement: SCFAs are normally produced in high amounts by the intestinal microbiota; they are
partly absorbed, and partly excreted in feces
Mechanism behind possible consequences
Biochemical: SCFAs are involved in several metabolic pathways
Immunological: Uncertain consequences
Place
Locally
In the intestinal lumen
At the mucosa surface
Within the mucosa cells
Distant
In the liver, pancreas, brain etc.
Form
Direct
Locally
Main anions in intestinal content
Growth promotion of some microbes
Growth suppression of others
Growth regulation of mucosa cells
Distant
Energy supply to the general metabolism
Indirect
Locally
"Promoted" microbes produce suppressive bacteriocins
Direct suppression provides niches for other microbes to grow
Distant
Metabolic alternations act on production of insulin, etc.
Consequence
Physiological
Locally the SCFAs are parts of direct/indirect regulatory
Mechanisms for water and electrolyte absorption; the net effect is antidiarrheic, involved in
regulation of carbohydrate metabolism, etc.
Pathophysiological
Involved in hepatic coma.
Probably involved in colonic cancer, ulcerative, and pseudomembraneous colitis, etc.
Abbreviation: SCFA, short chain fatty acid.
mammalian species, there are more lymphoid cells associated with the GI tract than with
the spleen, peripheral lymph nodes, and blood taken together, and gut-associated B cells
account for more than 80% of all B cells in the human body (52). The total daily output of
dimeric IgA is 0.8 g per m of intestine, an amount equivalent to the output of a lactating
mammary gland (52).
The gut-associated lymphoid tissue (GALT) has to be considered both from the
perspective of its composition and spatial complexity, and an extensive evaluation is
beyond the scope of this review. Interested readers may search in Medline for names such
as Bengt Bjorksten, Per Brandtzaeg, John Cebra, and Agnes Wold, among others. In the
future, it is reasonable to assume that germ-free animals will be used in several settings, as
(1) germ-free inbred animals, with and without genetic manipulation of defined
components of their immune systems or their epithelium, (2) isogenic strains of a given
bacterial species expressing defined endogenous or foreign epitopes, and (3) prior or
Born Germ-Free — Microbial Dependent 281
simultaneous administration of other competing organisms. In all these future
experiments, it might be wise to keep in mind that it is a constant "trialogue" of
interactions between intestinal microbes, epithelium, and GALT. As pointed out
elsewhere (6) these interactions are probably dynamic, reciprocal, and combinatorial,
making it difficult to separate out a single tune in this cacophony of noise. Utilization of
gnotobiotic animals might represent a suitable reductionistic "noise filter, " allowing us to
study host-microbe cross-talks in greater details. For more information on the role of the
intestinal microbiota on the immune system, see the chapter by Moreau elsewhere in
this book.
CONCLUSION
For more than a century, germ-free and gnotobiotic animals have been used to investigate
the influence of the intestinal microbiota and specific members of the intestinal microbiota
on the functioning and health of the host. This has provided much insight into the intricate
relation between the host and its microbes. However, as outlined above, much still remains
to be studied, and germ-free animals will remain an important tool in the study of the
interactions between the intestinal microbiota and the host.
REFERENCES
1. Nuttal GHF, Thierfelder H. Tierisches leben ohne Bakterien im Verdauungskanal. Hoppe
Seyler's Zeitsch Physiol Chemie 1896-1897; 33:62-73.
2. Gustafsson BE. Lightweight stainless steel systems for rearing germfree animals. Ann N Y
AcadSci 1959;78:17-28.
3. Midtvedt T. Influence of antibiotics on biochemical intestinal microflora-associated
characteristics in man and animals. In: Gillessen G, Opferkuch W, Peters G, Pulverer G,
eds. The Influence of Antibiotics on the Host-Parasite Relationship III. Berlin, Heidelberg:
Springer Verlag, 1989:209-215.
4. Midtvedt T, Bjorneklett A, Carlstedt-Duke B, et al. Germfree research; microflora control and
its application to the biomedical sciences. In: Wostmann BS, Pleasants JR, Pollard M,
Teah BA, Wagner M, eds. The Influence of Antibiotics Upon Microflora- Associated
Characteristics in Man and Animals. New York: Alan R Liss Inc, 1985:241-244.
5. Collinder E, Bjornhag G, Cardona M, Norin E, Rehbinder C, Midtvedt T. Gastrointestinal host-
microbial interactions in mammals and fish. Comparative studies in man, mice, rats, pigs,
horses, cows, elks, reindeers, salmon, and cod. Microb Ecol Health Dis 2003; 15:66-78.
6. Falk GP, Hooper LV, Midtvedt T, Gordon JI. Creating and maintaining the gastrointestinal
ecosystem; what we know and need to know from gnotobiology. Microbiol Molecul Biol Rev
1998;1 157-1 170.
7. Hooper LV, Midtvedt T, Gordon JI. How host-microbial interactions shape the nutrient
environment of the mammalian intestine. Ann Rev Nutr 2002; 22:283-307.
8. Midtvedt T. Probiotics, other nutritional factors, and intestinal microflora: microbial functional
o
activities. In: Hansson LA, Yolken RH, eds. In: Nestle Nutrition Workshop Series.
Philadelphia: Lippincott-Raven Publishers, 1999:79-96.
9. Gustafsson BE. Vitamin K deficiency in germfree rats. Ann N Y Acad Sci 1959;
78:166-174.
10. Gustafsson BE, Draft FS, McDaniel EG, Smith JC, Fitzgerald RJ. Effects of vitamin K-active
compounds and intestinal s in vitamin K deficient germfree rats. J Nutr 1962; 78:461-468.
11. Strandberg K, Sedvall G, Midtvedt T, Gustafsson BE. Effect of some biologically active
amines on the cecum wall of germ-free rats. Proc Soc Exp Biol Med 1966; 121:699-702.
282 Norin and Midtvedt
12. Gustafsson BE, Midtvedt T, Strandberg K. Effects of microbial contamination on the cecum
enlargement of germ-free rats. Scand J Gastroent 1970; 5:309-314.
13. Banasaz M, Alam M, Norin E, Midtvedt T. Gender, age, and microbial status influence upon
cell kinetics in a compartmentalised manner. An experimental study in germ-free and
conventional rats. Microb Ecol Health Dis 2000; 12:208-218.
14. Banasaz M, Norin E, Midtvedt T. The role of gender, age, and microbial status on cell kinetics
in the gastrointestinal tract of mice. An experimental study in germ-free and conventional mice.
Microb Ecol Health Dis 2001; 13:135-142.
o
15. Banasaz M, Akerlund T, Norin E, Burman L, Midtvedt T. Reduced mitotic activity of intestinal
mucosal cells in germ-free rats mono-associated with toxin producing Clostridium difficile.
Microb Ecol Health Dis 2003; 4:146-152.
16. Husebye E, Hellstrom PM, Midtvedt T. Intestinal microflora stimulates myoelectric activity of
rat wall intestine by promoting cyclic initiation and abnormal propagation of migrating
myoelectric complexes. Dig Dis Sci 1992;946-956.
17. Alam M, Midtvedt T. In: Hashimoto K, ed. Microflora and Gastrointestinal Peptides.
Shiozawa, Japan: XII IGS Publishing Committee, 1996:409-412.
18. Bothin C, Okada M, Midtvedt T, Perbeck L. The intestinal flora influences adhesion formation
around surgical anastomoses. Br J Surg 2001; 88:143-145.
19. Rod TO, Midtvedt T. The origin of intestinal ^-glucuronidase in germfree, monocontaminated,
and conventional rats. Acta Path Microbiol Scand Sect B 1977; 85:271-276.
20. Gadelle D, Raibaud P, Sacquet E. (3-glucuronidase activities of intestinal bacteria
determined both in vitro and in vivo in gnotobiotic rats. Appl Environ Microbiol 1985;
49:682-685.
21. Gustafsson BE, Swenander-Lanke L. Bilirubin, and urobilins in germ-free, ex-germ-free, and
conventional rats. J Exp Med 1960; 112:975-981.
22. Midtvedt T, Gustafsson BE. Microbial conversion of bilirubin to urobilins in vitro and in vivo.
Acta Pathol Microbiol Scand Sect B 1981; 89:57-60.
23. Midtvedt AC, Carlstedt-Duke B, Norin KE, Saxerholt H, Midtvedt T. Development of five
metabolic activities associated with the intestinal microflora of healthy infants. J Pediatr
Gastroenterol Nutr 1988; 7:559-567.
24. Benno P, Alam M, Collinder E, Norin E, Midtvedt T. Fecal tryptic activity and excretion of
urobilinogens in 573 healthy subjects living in Sweden, Norway, and Scotland. Microb Ecol
Health Dis 2003; 15:169-175.
25. Saxerholt H, Carlstedt-Duke B, Hoverstad T, et al. Influence of antibiotics on the fecal
excretion of bile pigments in healthy subjects. J Gastroenterol 1986; 2:991-996.
26. Midtvedt T. Metabolism of endogenous substances. In: Clercq De, ed. Frontiers in
Microbiology. From Antibiotics to AIDS. Dordrecht/Boston/Lancaster: Martinus Nijhoff
Publishers, 1987:79-87.
27. Danielsson H, Gustafsson BE. On serum-cholesterol levels and neutral fecal sterols in germfree
rats. Bile acids and steroids 59. Arch Biochem Biophys 1959; 83:482-485.
28. Gustafsson B, Carlstedt-Duke B. Intestinal water-soluble mucins in germfree, ex-germfree, and
conventional animals. Acta Path Microbiol Immunol Scand Sect B 1984; 92:247-252.
29. Hoskins LC, Agustines M, McKee WB, Boulding ET, Kriaris M, Niedermeyer G. Mucin
degradation in human colon ecosystems. Isolation and properties of fecal strains that degrade
ABH blood group antigens and oligosacharrides from mucin glycoproteins. J Clin Invest 1985;
75:944-953.
30. Carlstedt-Duke B, Midtvedt T, Nord CE, Gustafsson BE. Isolation and characterization of a
mucindegrading strain of Peptostreptococcus from rat intestinal tract. Acta Path Microbiol
Immunol Scand Sec B 1986; 94:292-300.
3 1 . Karlsson KA. Animal glucosphingolipids as membrane attachment sites for bacteria. Ann Rev
Biochem 1989; 58:309-350.
32. Freitas M, Axelsson LG, Cayuela C, Midtvedt T, Trugnan G. Microbial-host interactions
specifically control the glycosylation pattern in intestinal mouse mucosa. Histochem Cell Biol
2002; 118:149-161.
Born Germ-Free — Microbial Dependent 283
33. Bry L, Falk PG, Midtvedt T, Gordon JI. A model of host-microbial interactions in an open
mammalian ecosystem. Science 1996; 6:1380-1383.
34. Carlstedt-Duke B, H0verstad T, Lingaas E, et al. Influence of antibiotics on intestinal mucin in
healthy subjects. Eur J Clin Microbiol 1986; 5:634-638.
35. Carlstedt-Duke B, Aim L, H0verstad T, et al. Influence of clindamycin, administered together
with or without lactobacilli, upon intestinal ecology in rats. FEMS Microbiol Ecol 1987;
45:251-259.
36. Norin KE, Midtvedt T, Gustafsson BE. Influence of the intestinal microflora on the tryptic
activity during lactation. Lab Anim 1986; 20:234-237.
37. Norin KE. The regulatory and protective role of the normal microflora. In: Grubb R,
Midtvedt T, Norin KE, eds. The Normal Microflora and Intestinal Enzymes. New York:
Stockton Press, 1988:219-237.
38. Norin KE, Gustafsson BE, Midtvedt T. Strain differences in fecal tryptic activity of germfree
and conventional rats. Lab Anim 1986; 20:67-69.
39. Ramare F, Hautefort I, Verhe F, Raibaud P, Iovanna J. Inactivation of tryptic activity by a
human-derived strain of Bacteroides distasonis in the large intestines of gnotobiotic rats and
mice. Appl Environ Microbiol 1996; 62:1434-1436.
40. Welling GW, Helmus G, de Vries-Hospers HG, et al. Germ-free research; microflora control,
and its application to the biomedical sciences. In: Wostmann BS, Pleasants JR, Pollard M,
Teah BA, Wagner M, eds. Rationale for Use of (3-Aspartylglycine as Indicator of Colonization
Resistance. New York: Alan R Liss Inc., 1985:155-158.
41. Welling GW, Groen G, Tuinte HM, et al. Biochemical effects on germ-free mice of association
with several strains of anaerobic bacteria. J Gen Microbiol 1980; 117:57-63.
42. van der Waaij D, van der Waaij BD. The colonization resistance of the digestive tract in
different animal species and in man: a comparative study. Epidemiology and Infections 1990;
105:237-243.
43. H0verstad T, Midtvedt T. Short-chain fatty acids in germ-free mice and rats. J Nutr 1986;
116:1772-1776.
44. Bottcher M, Norin EK, Sandin A, Midtvedt T, Bjorksten B. Microflora associated
characteristics in faeces from allergig and nonallergic infants. Clin Exp Allergy 2000;
30:1590-1596.
45. H0verstad T, Carlstedt-Duke B, Lingaas E, et al. Influence of ampicillin, clindamycin, and
metronidazole on fecal excretion of short-chain fatty acids in healthy subjects. Scand
J Gastroenterol 1986; 21:621-626.
46. H0verstad T, Carlstedt-Duke B, Lingaas E, et al. Influence of oral intake of seven different
antibiotics on fecal of short-chain fatty acid excretion in healthy subjects. Scand J Gastroent
1986;21:997-1003.
47. Siigur U, Norin KE, Allgood G, Schlagheck T, Midtvedt T. Effects of olestra on fecal water and
short-chain fatty acids. Microb Ecol Health Dis 1996; 9:9-17.
48. Siigur U, Norin KE, Allgood G, Schlagheck T, Midtvedt T. Effect of olestra upon intestinal
microecology as reflected by five microflora associated characteristics in man. Microb Ecol
Health Dis 1996; 9:297-303.
49. Trippestad A, Midtvedt T. The phagocytic activity of polynuclear leucocytes from germfree
and conventional rats. Acta Path Microbiol Scand Sect B 1971; 79:519-522.
50. Trippestad A, Midtvedt T. Chemotaxis of polymorphonuclear leucocytes from germfree rats
and generation of chemotactic activity in germfree rat sera. Clin Exp Immunol 1971;
8:639-646.
51. Midtvedt T, Trippestad A. Specificity of opsonic and bactericidal response of gnotobiotic rat
sera. Acta Path Microbiol Scand Sect B 1971; 79:291-296.
52. Brandtzaeg P, Halstensen TS, Kett K, et al. Immunobiology and immunopathology of human gut
mucosa; humoral immun intraepithelial lymphocytes. Gastroenterology 1989; 97:1562-1584.
16
Modifying the Human Intestinal
Microbiota with Prebiotics
Ross Crittenden
The Preventative Health Flagship, Food Science Australia, Werribee, Victoria, Australia
Martin J. Playne
Melbourne Biotechnology, Hampton, Victoria, Australia
INTRODUCTION
The aim of both prebiotic and probiotic functional food ingredients is to improve the
health of consumers by selectively altering the composition and/or activity of microbial
populations within the gastrointestinal tract. While the probiotic approach endeavors to
directly deliver supplemental beneficial bacteria to the gut, prebiotics offer an alternative
strategy. Rather than supplying an exogenous source of live bacteria, prebiotics aim to
selectively stimulate the proliferation and/or activity of desirable bacterial populations
already resident in the consumer's intestinal tract.
The prebiotic strategy offers a number of practical and theoretical advantages over
modifying the intestinal microbiota using probiotics or antibiotics. This chapter aims to
provide an overview of the prebiotic approach, modes of action, and an evaluation of their
effectiveness in modulating intestinal microbial populations and providing health benefits
to consumers. The production, properties and applications of prebiotics are outlined and
likely future developments in prebiotics are discussed. However, before exploring the
concept of modifying the intestinal microbiota using prebiotics, it is perhaps pertinent to
first reflect briefly on why we might want to alter the composition and activity of the
intestinal microbiota in the first place.
WHY MODIFY THE INTESTINAL MICROBIOTA?
Far from being inconsequential to our lives, the bacteria residing within our
gastrointestinal tracts are highly important to our health and well-being. They provide
us with a barrier to infection by intestinal pathogens (1), much of the metabolic fuel for our
colonic epithelial cells (2), and contribute to normal immune development and func-
tion (3,4). Intestinal bacteria have also been implicated in the etiology of some chronic
diseases of the gut such as inflammatory bowel disease (IBD) (5,6). As we age, changes
285
286 Crittenden and Playne
occur in the composition of the intestinal microbiota that may contribute to an increased
level of undesirable microbial metabolic activity and subsequent degenerative diseases of
the intestinal tract (7,8).
Modifying the composition of the intestinal microbiota to restore or maintain a
beneficial population of micro-organisms would appear to be a reasonable approach in
cases where a deleterious or sub-optimal population of micro-organisms has colonized the
gut. The difficulty facing intestinal microbiologists is trying to determine what constitutes
a "normal," healthy intestinal microbiota. A switch in recent years from culture-based,
phenotypic examination of microbial ecosystems to the application of culture-
independent, molecular techniques has helped speed progress. It has also provided new
insights into the great diversity of bacteria within the human intestinal tract. Historical
estimates based on culture methods did recognize the complexity of the ecosystem,
placing the number of bacterial species within the gastrointestinal microbiota at around
400, dominated by perhaps 30-40 (9). However, it is now believed to be far richer, with
the number of identified taxa expected to eventually exceed 1000 (10).
It is clear that we are only at the very beginning of understanding the role of
individual bacterial populations in health and disease and their interactions with each
other, the host, and the diet. Addressing these fundamental questions is an essential
prerequisite to targeted disease intervention strategies involving modification of the
intestinal microbiota. While acknowledging that the science of manipulating the intestinal
microbiota to achieve improved health is still very much in its infancy, progress is being
made, and strategies that may lead to tangible health benefits in specific populations
are emerging.
THE PREBIOTIC STRATEGY TO MODIFYING
THE INTESTINAL MICROBIOTA
For a variety of reasons, the two bacterial genera most often advocated as beneficial
organisms with which to augment the intestinal microbiota are lactobacilli and
bifidobacteria, both of which are common members of the human intestinal microbiota
(11,12). These bacteria are numerically common, non-pathogenic, non-putrefactive, non-
toxigenic, saccharolytic organisms that appear from available knowledge to provide little
opportunity for deleterious activity in the intestinal tract. As such, they are reasonable
candidates to target in terms of restoring a favorable balance of intestinal species.
While the probiotic strategy aims to supplement the intestinal microbiota via the
ingestion of live bacteria, the prebiotic strategy aims to stimulate the proliferation and/or
activity of beneficial microbial populations already resident in the intestine. The
characteristics shared by all successful prebiotics is that they remain largely undigested
during passage through the stomach and small intestine and selectively stimulate only
beneficial populations of bacteria in the colon. That is not to say that prebiotics cannot be
theoretically designed to target bacteria within the stomach and small intestine, but rather
those currently developed tend to target bifidobacteria, which predominantly reside in the
colon. Importantly, prebiotics should not stimulate the proliferation or pathogenicity of
potentially deleterious micro-organisms within the intestinal microbiota. To date, most
prebiotics have been non-digestible carbohydrates, particularly oligosaccharides. Since
the prebiotics identified to date promote the proliferation of bifidobacteria in particular,
they are often referred to as bifidogenic factors or bifidus factors. Historically, lactobacilli
and bifidobacteria have been targeted as beneficial organisms with which to augment the
intestinal tract. However, as discussed later in this chapter, the manipulation more broadly
Modifying the Human Intestinal Microbiota with Prebiotics
287
of the metabolic activity of the microbiota is of increasing interest for improving intestinal
health (13).
A number of largely prophylactic health targets have been proposed for prebiotics
that, as might be expected, overlap considerably with the targets of probiotic interventions.
The mechanisms of action remain largely theoretical, but rational hypotheses have been
developed as our understanding of the intestinal microbiota has advanced. Proposed
benefits in the gut include protection against enteric infections, increased mineral
absorption, immunomodulation, trophic and anti-neoplastic effects of short chain fatty
acids (SCFA), fecal bulking, and reduced toxigenic microbial metabolism (Figs. 1-4).
A BRIEF HISTORY OF THE DEVELOPMENT OF BIFIDUS FACTORS
AND PREBIOTICS
Bifidogenic or bifidus factors were recognized as early as 1954 with Gyorgy et al.
(14,15) describing such components in milk and colostrum, including a range of amino
sugars and non-glycosylated casein peptides. Glycoproteins from whey were also
shown to have bifidogenic potential (16) along with lactoferrin (17,18). Bifidogenic
effects have been reported for pantethine from carrot extracts (19,20) and for 2-amino-
3-carboxy-l,4-naphthoquinone (ACNQ), a compound isolated from Propionibacterium
freudenreichii (21,22).
Interest in bifidogenic compounds accelerated with the identification of non-
digestible oligosaccharides (NDOs) in human milk as major factors responsible for
maintaining an intestinal microbiota numerically dominated by bifidobacteria in breast-
feeding infants. In contrast, infants fed cow's milk-based formula developed a mixed
microbiota, including higher levels of potentially deleterious organisms (23,24). Human
prebiotics
OOOO 00
ooo
intestinal lumen
stimulate growth
of bifidobacteria
colonocytes
lamina propria
immunomodulation IgE-mediated allergy
IL-12
suppression
►
allergy prevention
IL-4
Figure 1 Proposed mechanisms of immunomodulation by prebiotics for the prevention of IgE-
mediated food allergies that are mediated by a skewing of the immune response at the T helper (Th)
cell level towards a Th2 response. Prebiotics stimulate the growth of bifidobacteria that are sampled
by the gut-associated lymphoid tissue via M-cells or dendritic cells (DC). The commensal bacteria
drive a counterbalancing Thl response producing interferon-y (IFN-y), and/or a tolerogenic
response by regulatory T-cells (Tr) producing the anti-inflammatory cytokines interleukin-10
(IL-10) and transorming growth factor-(3 (TGF-(3) that quell the allergenic Th2 response.
288
Crittenden and Playne
00
prebiotics
oooo
ooo
intestinal lumen + . , *
stimulate growth
and fermentation
eliminate pro-IBD
microbial antigens
SCFA +
I
*^>
trophic effects fj Jju Sj
colonization
resistance
on mucosa
rYY^fYWYYWYl f\nT\
colonocyte >
lamina propria
Mcell
1
nnn
o
fYY^nnn
o
nnn
o
-t/
immunomodulation
IL-10
TGF-P
anti-inflammatory
suppress
IBD
inflammation
Figure 2 Proposed mechanisms by which prebiotics may ameliorate inflammatory bowel disease
(IBD). Abbreviations'. DC, dendritic cell; IL, interleukin; SCFA, short chain fatty acids; Tr,
regulatory T cell; TGF, transforming growth factor.
milk oligosaccharides (HMOs) (discussed later in this chapter) were then, and remain
today, too complex to be synthesized commercially. However, other NDOs were shown
to replicate the bifidogenic effect of milk oligosaccharides. The Japanese research
community in particular studied the ability to modify the intestinal microbiota using
lactulose and fructo- and galacto-oligosaccharides. Although often lacking rigorous
design, early studies (25-30) at least provided the impetus for later, randomized controlled
studies that have demonstrated the notion that some NDOs selectively promote the
proliferation of bifidobacteria in the intestinal tract.
Concurrently in the late 1980s and early 1990s, interest was rising in the use of
probiotics to modify the intestinal microbial balance. The term "prebiotic" was coined by
selective growth
and fermentation
prebiotics
0000
oo
ooo
block ligand
adhesion to
mucosa
nnnnnn
o
S £/
nutrient and
niche
competition
► SCFA
antimicrobials
> lower intestinal pH
antagonism
nnnnnn
o
-ZS
rinn
o
-a>
^nnr^nr\
-ZS
o
o
nnnnnn
-£/
-<^
nnn
o
Figure 3 Proposed mechanisms by which prebiotics may enhance colonization resistance against
bacterial pathogens in the gastrointestinal tract. Abbreviation: SCFA, short chain fatty acids.
Modifying the Human Intestinal Microbiota with Prebiotics
289
alleviate constipation
de novo
lipo genesis
controlled
p. serum lipids
and cholesterol
ooooo
prebiotics
0000
JUL JUL
increased
mineral
absorption
selective
fermentation
► lower intestinal pH
antagonism of
■► fewer toxic
trophic and
anti-neoplastic
effects ^
putrefactive bacteria
microbial
metabolites
nnn
nnn
r v^r
^nr
^nr
fYY^fYY^fYY^fYY^r ^innnnn
c
. i)
*■ 6
e)
■ o
^ o
o
k £/
\ £/
■ o
« £/
. £/
reduced cancer risk
reduced cancer risk
Figure 4 Proposed mechanisms by which the selective fermentation of prebiotics and subsequent
production of short chain fatty acids (SCFA) improve bowel habit, increase dietary mineral
absorption, and may reduce the risk of colon cancer.
Gibson and Roberfroid in 1995 (31) and effectively linked these two concepts for promoting
beneficial populations of intestinal bacteria. Gibson and Roberfroid (31) broadened the
narrow bifidogenic target to include the specific stimulation of any potentially beneficial
microbial genera. There is an obvious potential for synergy between prebiotic and probiotic
ingredients, and hence, foods containing both prebiotic and probiotics ingredients were
termed "synbiotics."
CURRENTLY AVAILABLE PREBIOTIC CARBOHYDRATES
The prebiotics most commonly used as functional food ingredients are non-digestible
oligosaccharides (NDOs), of which a variety of types are commercially available (32).
Most of these NDOs are natural components of many common foods including honey,
milk, and various fruits and vegetables (32-34). Commercially, they are produced as food
ingredients by four main processes:
1. Extraction and purification from plants, e.g., soybean oligosaccharides and
inulin from chicory
2. Controlled enzymatic degradation of polysaccharides, e.g., xylo-oligosacchar-
ides, isomalto-oligosaccharides, and some fructo-oligosaccharides
3. Enzymatic synthesis from disaccharides, e.g., some fructo-oligosaccharides,
galacto-oligosaccharides and lactosucrose (32,33)
4. Chemical isomerization, e.g., lactulose.
290 Crittenden and Playne
In nearly all cases, the commercial oligosaccharide products contain a range of
oligosaccharide structures of differing molecular weights and often with a variety of
glycosidic linkages between sugar moieties. To date, the largest number of reported
studies and the most consistent evidence accumulated for prebiotic effects have been for
fructo-oligosaccharides and the polyfructan inulin (34-39). Good evidence from human
studies also exists for the prebiotic activities of galacto-oligosaccharides (40-43) and
lactulose (44-47). Boehm and Stahl (48) have summarized 28 of the human studies
conducted on the physiological effects of galacto-oligosaccharides and fructans (fructo-
oligosaccharides and inulin). Most of these studies were between one and three weeks in
duration. Commercial food-grade oligosaccharide was fed at between 8 and 15 g/day in
most experiments. Higher levels (40 g/day) were fed when inulin was used. They list 14
trials on galacto-oligosaccharides involving 298 adults and 27 infants, and another 14 with
fructans involving 238 adults and 34 infants. In nearly all cases, only healthy volunteers
were tested.
A number of other NDOs, to which less rigorous study has been so far applied, have
at least indications of prebiotic potential. These include lactosucrose (49-52), gluco- (53),
xylo- (54,55), isomalto- (56-59), and soybean oligosaccharides (60-63). Additionally,
bifidogenic effects have been reported for lactitol (45), polydextrose (64) and glucono-5-
lactone (65) in small human feeding studies.
Evidence that some dietary fibers, such as resistant starches (66-72), arabinoxylan
(73,74) and plant gums (75) have prebiotic potential is accumulating, but to date remains
limited largely to in vitro and animal studies. These large carbohydrates may have some
advantages in the intestinal tract over rapidly fermented oligosaccharides. They minimize
rapid gas formation and osmotic effects in the gut, which can lead to intestinal discomfort,
flatulence and diarrhea at high doses of NDOs (typically above 15-20 g per day).
Additionally, they persist as substrates for saccharolytic fermentation more distally in the
colon where carbohydrate limitation is believed to promote toxigenic microbial reactions
leading to an increased risk of colorectal cancer (76-79).
The molecular structure of the prebiotic can be expected to determine its
physiological effects as well as which microbial species are able to utilize it as a carbon
and energy source in the bowel. However, it appears that despite the diversity in molecular
sizes, sugar compositions, and structural linkages within the range of prebiotic carbo-
hydrates, it is the bifidobacteria that are almost universally observed to respond. Some
established and emerging prebiotics, including lactulose (46), galacto-oligosaccharides
(40,80,81) and resistant starches (69,71) have been sporadically reported to stimulate
intestinal Lactobacillus populations. Indeed, some lactobacilli have been shown to possess
the metabolic machinery to use fructo-oligosaccharides (82,83). Despite this, bifidobacteria
remain the major beneficiaries of these substrates in the gut. Given the benefits attributed to
probiotic lactobacilli, the development of novel prebiotics directly targeting Lactobacillus
species remains an opportunity. The rise in these beneficial bacterial populations during
prebiotic feeding has often been shown to be accompanied by concomitant reductions in the
numbers of putrefactive organisms such as Clostridia and Bacteroides spp. and
Enterobacteriaceae (31,44-46,60,84), possibly due to antagonism by SCFA production,
acidification of the colonic environment, or direct antagonism (Figs. 3-4).
MODIFYING THE INTESTINAL BIFIDOBACTERIUM POPULATION
The composition of the human intestinal microbiota changes naturally with age, and
prebiotic strategies need to be targeted to reflect the desired outcome for specific
Modifying the Human Intestinal Microbiota with Prebiotics
291
demographics. This section describes how prebiotics might provide benefits for specific
human populations in relation to the characteristics of their own particular intestinal
microbiota, and outlines some of the evidence for health effects accumulated so far. A
brief summary of the main physiological effects of prebiotics is listed in Table 1 .
Infants
Bifidobacteria colonize the human intestinal tract during or soon after birth and in breast-fed
infants they eventually dominate the microbiota (85). The numerical dominance of
bifidobacteria is induced by bifidogenic components in breast milk, including
oligosaccharides (85,86). Indeed, human milk oligosaccharides (HMOs) are the original
prebiotics. The concentration of oligosaccharides found in human milk (5 to 10 g/L) is
about 100 times that found in cow's milk (0.03 to 0.06 g/L). HMOs are complex with more
than 130 identified structures (87). Each individual oligosaccharide is based on a variable
Table 1 Summary of Physiological Effects of Prebiotics
Level of
substantiation
Effect
Comments
Strong
Moderate
Weak
Increase intestinal
numbers of
bifidobacteria
Improved bowel
habit
Alleviate hepatic
encephalopathy
Increase calcium
absorption
Control of serum
lipid levels
Prevention of
colorectal
cancer
Improved
colonization
resistance
Immune
modulation
Magnitude of bifidogenic effect is inversely
proportional to the size of the initial intestinal
Bifidobacterium population. Best evidence for FOS,
inulin, lactulose, and GOS, with emerging evidence
for a range of NDOs and some dietary fibers.
Improved frequency of defecation and stool consistency
demonstrated with many prebitoics. Lactulose has a
long history of pharmaceutical use as a laxative.
Lactulose has a long history of use as a pharmaceutical.
Positive results in animal studies and now more
consistently in human trials. Prebiotics appear to
enhance colonic Ca + + uptake. Indications that larger
prebiotics with sustained colonic fermentation may
be the more effective.
Consistently positive results in animal studies, but
mixed results in human trials. Mechanism appears to
be control of de novo lipogenesis via SCFA.
Demonstrations of anti-cancer effects in rodent models
for a range of prebiotics. Reduced intestinal
genotoxicity in human studies.
Lactulose effective against chronic Salmonella
infection. Some evidence from animal studies for
other prebiotics against intestinal and systemic
infections. Possible deleterious effects of rapid
acidification on gut mucosa require investigation.
Limited evidence from animal studies for anti-allergy
effects. Suggestions of immunomodulation from
antiviral effects and enhanced immune responses to
vaccination.
Abbreviations: NDOs, nondigestible oligosaccharides; SCFA, short chain fatty acids; FOS, fructo-
oligosaccharides; GOS, galacto-oligosaccharides.
292 Crittenden and Playne
combination of glucose, galactose, sialic acid, fucose and/or TV-acetylglucosamine, with
varied sizes and linkages accounting for the considerable variety (88).
In contrast to breast-fed infants, infants fed cow's milk-based formulae develop a
more mixed intestinal microbiota, with lower counts of bifidobacteria and higher counts of
Clostridia and enterococci (89). Formula-fed infants have also been observed to have
higher fecal ammonia and other potentially harmful bacterial products (90,91). The
bifidogenic effect of HMOs can be emulated using FOS and GOS (40,41,92). However,
there is increasing evidence for roles of HMO outside their bifidogenic impact in the gut.
These include blocking adhesion of pathogens to the intestinal mucosa (93-95) and roles
in developing cognition (96). Hence, Af-acetylneuraminic acid derivatives or sialyl-lactose
are also commonly added to infant milk formulae. The complexity of HMOs has thwarted
attempts to synthesize their full range of structures commercially, although specific
oligosaccharides have been synthesized using chemical and biotechnological approaches
(97-100). There is a ready market in infant milk formulas for oligosaccharides that more
closely replicate all of the properties of HMOs and research to synthesize them will no
doubt continue.
Effects on Immune System Maturation
There is a growing recognition of the importance of the intestinal microbiota to the healthy
maturation of the host's immune system, including appropriate programming of oral
tolerance to dietary antigens (101). Differences have been observed between the intestinal
bacterial populations of healthy infants and those suffering from atopic eczema. These
included differences within the genus Bifidobacterium, which are found in lower numbers
in the feces of allergic infants (102-108) and with a more adult-like species composition
dominated by Bif. adolescentis (109,1 10) rather than the usual species associated with the
infant intestine such as Bif. bifidum, Bif. breve, and Bif longum ( = Bif infantis) (111,112).
Recent indications that probiotics may reduce the severity of atopic eczema in
infants (113,114) has led to interest in understanding if similar effects can be achieved with
prebiotics. The proposed mechanisms are outlined in Figure 1 and involve stimulation of
Thl cells and/or regulatory T cells. Nagura et al. (115) tested the ability of raffinose
consumption to re-balance a Th2-biased immune response in a controlled study using an
engineered murine model of IgE-mediated allergy to ovalbumin. Feeding a relatively high
dose of raffinose stimulated a counterbalancing Thl -type immune response, reduced Th2
cell activity and suppressed the synthesis of serum IgE to ovalbumin in response to long-
term allergen challenge. Using a similar model, Yoshida et al. (116) recently reported
similar positive results for bifidogenic alginate-oligosaccharides, indicating that prebiotics
may be able to replicate the benefits seen for probiotics in allergy prevention.
Adults
The proportion of bifidobacteria in the colonic microbiota drops following weaning and
the introduction of solid food. In adults, they account for 1-5% of the total bacteria in
feces. Although they form a slightly higher proportion of total bacteria in the caecum
(117-121), the total numbers of bifidobacteria per gram of intestinal contents increases
approximately 100-fold with passage from the caecum to the colon. In the feces of healthy
o i r\
adults bifidobacteria are found in numbers generally in the order of 10 -10 cells per
gram. (10,122-125). While these figures represent the typical Bifidobacterium cell density,
a proportion of healthy adults harbor considerably lower numbers of Bifidobacteria in their
gut (by several orders of magnitude) without any discernable adverse effects (125-128).
Modifying the Human Intestinal Microbiota with Prebiotics 293
It is yet to be determined how the total number of bifidobacteria within a stable microbiota
influences the long-term health of the human host. In individuals with naturally low levels
of bifidobacteria, other micro-organisms with similar functionalities may occupy a similar
niche and fulfill a similar role in the intestinal tract.
It is clear from the number of human feeding studies reported to date that
consumption of prebiotics can increase the numbers of bifidobacteria in the colon of
adults. For NDOs, consumption of typically 10-15 g/day can induce 10- to 100-fold
increases in Bifidobacterium numbers (129,130). However, a range of factors may
influence the size of any increase in Bifidobacterium numbers, the most important being
the initial size of the population within the intestinal tract. In comparing different trials
conducted using fructo-oligosaccharides, Rao (130) observed that the size of the
bifidogenic response was inversely proportional to the size of the initial Bifidobacterium
population rather than showing a strong dose response. In individuals colonized with an
already large population of bifidobacteria, prebiotic consumption appears not to increase
the total Bifidobacterium population size further.
Bif. adolescentis, Bif.catenulatum/pseudocatenulatum, Bif. bifidum, and Bif. longum
are the most frequently reported Bifidobacterium species in the intestines of adults, with
considerable variation between individuals (121,125,126,131,132). To date, no clear
rationale for promoting one species of Bifidobacterium over others has emerged. Indeed, it
may be quite difficult to achieve major shifts within the population dynamic of
bifidobacteria at the species level even if this was desirable. In one study to investigate
this, feeding 8 g/day of galacto-oligosaccharides to healthy adult volunteers did not result
in marked changes in the composition of their intestinal bifidobacterial populations at the
species level (133-135). Similarly, despite observing increases in total Bifidobacterium
numbers, Harmsen et al. (136) also saw no changes in the species composition of
bifidobacteria in a study where adult volunteers were fed 9 g/day of inulin. The species
composition within intestinal bifidobacteria has been shown to remain fairly stable over
many months in adults (10,121,125,137,138) suggesting that day-to-day fluctuations in
diet have little impact on the species dynamic.
Even if they do not significantly alter the bacterial population dynamics in all
individuals, prebiotics may still be effective in providing benefits to the consumer if they
beneficially modulate the metabolic activity of the microbiota. Hypothetical examples
might be increased production of SCFA or vitamins that benefit the health of the colonic
epithelium, or synthesis of antagonistic metabolites that augment colonization resistance
against pathogens. Tannock et al. (139) used molecular techniques to investigate both
phylogenetic (DNA-DGGE) and metabolic (RNA-DGGE) changes in the intestinal
microbiota induced by galacto- or fructo-oligosaccharides. While no discernable changes
were observed in bacterial communities using DNA-DGGE (nor increases in total
Bifidobacterium numbers by traditional culturing), RNA-DGGE analysis revealed that the
prebiotics increased the activity of some bacterial groups including bifidobacteria. A
current research need is to identify metabolic activities of the microbiota that affect the
health of the host (positively or negatively) and to demonstrate that these can be
specifically modulated with prebiotics in situ.
Prebiotics in the Treatment of Inflammatory Bowel Disease
A genetic predisposition to develop an over-zealous inflammatory immune response to
components of the intestinal microbiota has been implicated in the etiology of IBD (140).
Elimination of specific bacterial antigens, immunomodulation, and trophic effects of
SCFA on the intestinal epithelium have all been proposed as mechanisms by which
294 Crittenden and Playne
prebiotics could alleviate IBD (Fig. 2). The size of the intestinal Bifidobacterium
population has been shown to be relatively small (141,142) in subjects afflicted with IBD,
although cause and effect links between disease and a diminished intestinal
Bifidobacterium population remain to be established. Interventions with prebiotics have
shown some benefit in ameliorating inflammation in both animal and human feeding trials.
Using differing rodent models of IBD, a number of research groups have demonstrated
amelioration of inflammation using prebiotic interventions. These include studies with
lactulose (143), inulin (140) and fructo-oligosaccharides (144). In contrast, Holma et al.
(145) observed no reduction in inflammation by intervention with galacto-oligosacchar-
ides despite an increase in Bifidobacterium numbers.
In addition to NDOs, larger polysaccharides with prebiotic potential have also been
shown to have promise in the treatment of IBD. Resistant starch was demonstrated to
ameliorate IBD in rodent models of disease (146,147), and in one study (147) out-
performed a diet with an equivalent dose of fructo-oligosaccharides. Additionally, an
arabinoxylan-rich germinated barley product has been reported to have benefits in the
treatment of active IBD. This ingredient was shown to induce the proliferation of
bifidobacteria in the human intestine (148), consistent with other in vitro and animal
studies of the fermentation of arabinoxylans by intestinal bacteria (73,74,149). In rodent
models of IBD, and in two small, non-blinded human studies of subjects with ulcerative
colitis, consumption of the germinated barley product reduced inflammation (150-153).
These results suggest that prebiotics have at least some potential to benefit IBD
sufferers. However, convincing evidence of a consistent clinical benefit in the treatment of
IBD remains to be demonstrated in large, randomized, double-blind, placebo-controlled
trials.
Elderly
The proposed benefits of prebiotics for the elderly have been based on early studies using
culture methods that showed Bifidobacterium levels substantially decreased as a
proportion of the total fecal microbiota in elderly Japanese, while the numbers of
putrefactive bacteria such as Clostridia increased (154). These findings have only recently
been re-addressed using modern bacteriological and molecular techniques, with mixed
results. While a study from the United Kingdom (155,156) supported the earlier
observations of a drop in Bifidobacterium numbers, other studies of elderly Italians and
Dutch did not show any reduction in the size of the Bifidobacterium population (157,158).
Still, prebiotics may be of benefit in elderly subjects with a low level of bifidobacteria and
high levels of deleterious bacteria. One such group is elderly people with Clostridium
difficile -associated diarrhea (CDAC) who have been shown to have a diminished
bifidobacterial population (159). Prebiotic intervention may eventually prove to be
beneficial in the prevention of such conditions in the elderly.
Prebiotics are also hypothesized to have potential to provide protection for
degenerative diseases in the elderly such as colon cancer and osteoporosis, and
experimental evidence for benefits in these conditions are discussed in a later section of
this chapter.
SYNBIOTICS
Products containing both prebiotic and probiotic ingredients are termed "synbiotics" due
to the obvious potential for synergy between these ingredients. Although the prebiotic may
Modifying the Human Intestinal Microbiota with Prebiotics 295
not necessarily be utilized by the included probiotic bacteria in a synbiotic food, attempts
have been made to maximize potential synergies by using complementary prebiotics that
may aid the colonization and in situ functionality of the included probiotic strains. In a
study in pigs, Brown et al. (160) showed that the inclusion of resistant starch or
oligosaccharides in a synbiotic combination with a probiotic Bifidobacterium resulted in
significantly higher numbers of bifidobacteria in the intestinal tract than with feeding of
the probiotic alone. Continuing prebiotic feeding after the cessation of probiotic feeding
also significantly extended the intestinal persistence of the probiotic.
In terms of potential health benefits, synbiotic combinations have shown enhanced
impact over feeding solely probiotics or prebiotics in rodent models investigating anti-
cancer effects (161-164) and colonization resistance (165). To increase the specificity of
synbiotics for the added probiotic strains, bifidobacteria have themselves been exploited as
a source of enzymes to synthesize NDOs (166-168) including synthesis of galacto-
oligosaccharides in yoghurt during fermentation (166).
MECHANISMS OF THE BIFIDOGENIC EFFECT
The mechanism(s) by which prebiotics promote the relatively specific proliferation of
bifidobacteria remain speculative. It is probably due to the efficient utilization of these
carbohydrates as carbon and energy sources by bifidobacteria relative to other intestinal
bacteria, and their tolerance to the SCFA and acidification of the microenvironment
resulting from fermentation. Additionally, many bifidobacteria adhere to large granular
substrates such as resistant starch and these may provide a site for colonization as well as
a substrate (13,169). The ability of bifidobacteria to use a wide variety of oligosaccharides
and other complex carbohydrates reflects their evolution in the hind-gut of humans and
animals where the ability to metabolize a diverse range of food and host-derived complex
carbohydrates and glycoproteins provides a competitive advantage. Analysis of the
Bif. longum genome has revealed a large number of proteins specialized for the catabolism
of carbohydrates (170).
Interestingly, while many bifidobacteria grow well when cultured with prebiotic
oligosaccharides as their sole carbon and energy source, they often do not grow when
supplied only with the monosaccharides from which these oligosaccharides are
composed (74,171,172). This physiology may be another consequence of their evolution
in an environment with a limited availability of simple sugars. It suggests that
bifidobacteria lack transport mechanisms for many monosaccharides and import
prebiotic oligosaccharides before hydrolyzing and metabolizing them. This presumably
minimizes the availability of released simple sugars for cross-feeding by other intestinal
bacteria and may be another factor contributing to the specific bifidogenic effect
of NDOs.
ADVANTAGES OF THE PREBIOTIC STRATEGY
While both antibiotics (see chapter by Sullivan and Nord) and probiotics (see chapter by
Khedkar and Ouwehand) can modify the intestinal microecology, the prebiotic strategy
offers a number of advantages over these two approaches.
296 Crittenden and Playne
Advantages over Antibiotics
Eliminating pathogenic groups with antibiotics is an obvious approach to beneficially
modifying the intestinal microbiota. However, perturbation of indigenous microbial
ecosystems caused by the collateral damage to desirable populations can lead to
potentially serious side effects. These include antibiotic-associated diarrhea and
pseudomembranous colitis involving overgrowth of Clostridium difficile as well as oral
or vaginal candidiasis (173-175). Prebiotics and probiotics can ameliorate the potential of
opportunistic infections caused by disturbances to the microbiota by restoring populations
of beneficial bacteria (176-179). No long-term side effects have been reported for either
prebiotic or probiotic ingredients, enabling their safe long-term use in prophylactic
strategies to minimize disease. In contrast, long-term use of antibiotics may elicit a range
of side-effects including liver damage, hypersensitivity, sensitivity to sunlight, and
increasing the risk of developing antibiotic-resistant bacterial strains (180,181). This latter
risk is particularly serious, and applies also to the sub-therapeutic use of antibiotics in
intensive livestock farming in order to minimize infections and maximize yields,
particularly for poultry and pork. Alternatives to antibiotics are urgently sought, and there
has been considerable interest in the use of both prebiotics and probiotics in animal feeds
to aid production. Although they have shown some promise (182,183), further research is
needed into their application within an overall management strategy in order to match the
performance of antibiotics.
Advantages over Probiotics
Storage Stability
With the exception of some mechanisms of immunomodulation, the theoretical basis for
many of the anticipated probiotic effects of bifidobacteria rely on the bacteria being viable
in the intestinal tract. Currently, probiotics are limited by their stability largely to fresh
food products such as fermented dairy products and juices, and nutraceutical products
where they are formulated as dried powders. In contrast, prebiotics are stable, can be heat-
processed, and can therefore be incorporated into a wider range of processed foods and
beverages with longer shelf lives than probiotics.
Host-Microbiota Compatibility
It is clear that selected probiotic bifidobacteria do survive transit through the stomach and
small intestine and can be recovered in feces. However, in most cases, ingested probiotic
strains persist only transiently in the intestine (134,184-188). An introduced probiotic
strain must compete with an already established microbiota. The application of molecular
techniques to profile the complex microbial communities has revealed that each person has
a unique intestinal microbiota at the community, genus, and species level (137-139). This
has been demonstrated in the case of bifidobacteria using PCR-DGGE analysis of
Bifidobacterium species in feces, where each individual has their own particular
combination of species (121,125). This uniqueness appears to extend to the strain level
too, with molecular fingerprinting techniques showing that each person generally harbors
multiple and unique Bifidobacterium strains (138,189-191). This host-microbiota stability
and individuality suggests that certain host-microbiota compatibilities exist, and using
prebiotics that augment an individual's own bacteria may prove more successful than
introducing an exogenous strain for some applications.
Modifying the Human Intestinal Microbiota with Prebiotics 297
The importance of host species/probiotic species specificity remains a contentious
question. It is often recommended that probiotics be selected from bacteria indigenous to
the intestinal tract of the targeted host species (192). However, the predominant probiotic
Bifidobacterium species currently used in human probiotics is Bifi animalis ( = Bif. lactis)
(11), which is not an autochthonous member of the human intestinal microbiota. This
species is taxonomically distant from human intestinal species (193), but is used because
of its superior technological stability compared with human intestinal isolates. The
prebiotic strategy overcomes any potential host/probiotic strain compatibility issues by
targeting those strains already resident in the intestinal tract of an individual.
Inhibition of Pathogen Adhesion
One mechanism by which oligosaccharides may provide protection against infection by
pathogenic micro-organisms has been hypothesized to be that of blocking adhesion to
intestinal mucosa by acting as soluble receptor analogues (Fig. 3) (194-196). Microbial
virulence factors, such as fimbriae and other membrane-based adhesins, control mucosal
attachment and colonization of tissues. The recognition domains of fimbriae are similar to
lectins that bind to carbohydrate epitopes on membrane glycocojugates of epithelial cells.
Kunz and Rudloff (197) have listed the receptor specificities of glyco- and lactose-derived
oligosaccharides and various pathogenic bacteria and viruses. Carbohydrate-mediated cell
interactions affect cell-cell interactions, as well as bacterium, viral and toxin interactions
with epithelial cells. The specificity of attachment provides potential for control of gastro-
intestinal infections through the use of specific oligosaccharide structures.
Stimulation of Fermentative Activity in the Gut
In addition to modifying population dynamics, prebiotics also modify the activity of the
microbiota by providing a source of readily fermentable carbohydrate. Indeed, it may be
this dietary fiber-like characteristic of modifying the fermentative activity of the existing
microbiota that is the important factor in providing a number of health benefits to
consumers (Figs. 2-4). Proposed health effects of prebiotics that are speculated to be
largely contingent on modifications to metabolic activity of the microbiota include
reductions in risk factors for colon cancer, increased mineral absorption, improved lipid
metabolism, and increased resistance to intestinal pathogens.
Reduced Risk Factors for Colon Cancer. The intestinal microbiota has a number
of biochemical activities relevant to colon cancer risk that relate to the composition and
activity of different bacterial populations. Hence, prebiotics may have a role in reducing
risk factors for colon cancer. Since they supply a source of fermentable carbohydrate to the
colon, dietary fiber-like anti-carcinogenic effects have been proposed for prebiotics
(Fig. 4). Proposed mechanisms include supplying the colonic epithelium with SCFA
(particularly butyrate); suppression of microbial protein metabolism, bile acid conversion
and other mutagenic and toxigenic bacterial reactions; and immunomodulation. Butyrate
production in the distal colon is suspected to be beneficial in preventing the development
of colorectal cancers (198-200). While Lactobacillus and Bifidobacterium probiotics do
not produce butyrate as major fermentation end products, prebiotics can stimulate butyrate
production by the colonic microbiota, which provides a potential advantage of this
approach (37,201). To date, the capacity of prebiotics to significantly contribute to a
reduced incidence of colorectal cancer remains unproven. However, the results of
preliminary human and animal experiments have provided sufficient encouragement to
maintain the impetus for continued research into the protective effects of prebiotics.
298 Crittenden and Playne
Numerous studies in humans and animals have shown that consumption of
prebiotics can produce an improved colonic environment in terms of reducing the levels
of mutagenic enzyme activities (e.g., (3-glucuronidase and azoreductase) and bacterial
metabolites (e.g., secondary bile acids, phenols and indoles) that are purportedly
associated with colon cancer risk. Examples include studies with lactulose (44,45,202),
galacto-oligosaccharides (203), resistant starch (69,204-206) and lactosucrose (51).
However, not all prebiotic feeding studies have shown improvements in these parameters
(46,47,66,207), and in any case, the quantitative importance of these markers to eventual
cancer development remains to be established.
A growing number of studies report protection by prebiotics against the
development of pre-neoplastic lesions and/or tumors in rodent models of colon
carcinogenesis. Again, these have used a variety of prebiotics including fructo-
oligosaccharides and inulin (summarized by Pool-Zobel et al. (37)), lactulose (161,208)
and resistant starch (209,210). Dose effects have been observed (37), but in general, very
high doses of NDOs have been used in the animal studies. An important question that is
beginning to be addressed is the significance of the sustainability of fermentation provided
by different prebiotics during passage through the colon on their effectiveness in
preventing colon cancer. The distal colon and rectum are the major sites of disease
in humans, but SCFA produced by bacterial fermentation in the colon are rapidly absorbed
by the colonic mucosa near the site of their production. Hence, prebiotics that can supply a
persistent source of fermentable carbohydrate that sustains SCFA synthesis through to the
distal colon may prove to be the most effective. Indeed, studies with different molecular
sized fructan prebiotics have reported increased protection with the larger, more slowly
fermented prebiotics (37).
Improving Mineral Absorption. As seen for dietary fibres, a number of prebiotics
have been shown to increase mineral absorption in animal models (21 1-214). The precise
mechanisms of prebiotic-mediated improvements in mineral uptake remain unclear, but
fermentative activities of the microbiota including SCFA production and reductions in
luminal pH are believed to be involved (Fig. 4) (213). Calcium and magnesium are the
main minerals for which uptake is improved. Under normal circumstances dietary calcium
is predominately absorbed in the small intestine with little calcium absorbed in the colon
(215). However, prebiotic fermentation is believed to extend calcium uptake into
the colon (34). In rats, increased calcium uptake has led to improved bone mineralization
for animals fed galacto-oligosaccharides (216), lactulose (217) and fructo-oligosac-
charides (218).
Although two human studies have shown little impact on mineral uptake (219,220), a
number have reported beneficial effects on calcium (221-225) and magnesium absorption
(226) using fructo-oligosaccharides, inulin and galacto-oligosaccharides. Differences in
results have been attributed to differences in study designs and treatment populations
(212,225). Griffin et al. (225) saw no effect with short chain fructo-oligosaccharides in a
population of pubertal girls, but a significant increase in the calcium absorption and balance
was observed when the girls consumed a mixture of fructo-oligosaccharides and inulin,
perhaps reflecting a more sustained colonic fermentation. Overall, results so far are
encouraging of a role for prebiotics in improving calcium uptake. Further research is
warranted to investigate links between long-term prebiotic consumption and improved bone
density in humans at risk of developing osteoporosis.
Effects on Serum Lipids and Cholesterol. A role for prebiotics in controlling
hyperlipidemia has been proposed and a relatively large number of animal and human
studies have focused on the effects of oligosaccharide and inulin intake on lipid
metabolism. These include eight human trials summarized by van Loo et al. (34), and
Modifying the Human Intestinal Microbiota with Prebiotics 299
more recent trials (227-231). The mechanism by which lowering of serum lipids and
cholesterol may occur has been speculated to be regulation of host de novo lipogenesis via
SCFA absorbed from the gut (Fig. 4) (232). While convincing positive effects on lowering
serum triglycerols and cholesterol have often been reported in animal studies (233) the
results from human studies have tended to be contradictory, although no deleterious effects
have been reported (232). The trials conducted to date indicate that while there is certainly
potential for prebiotics to control serum lipids, more research is needed to identify the
most appropriate target populations, the impact of background diet, and the mechanisms
of action.
Improving Colonization Resistance in the Gut. The ability of prebiotics to
improve colonization resistance and prevent bacterial infections from the gut has been
only scantly explored, but results so far indicate a potential application for lactulose and
NDOs in this capacity. Lactulose has the most accumulated evidence. Ozaslan et al. (234)
observed lower caecal overgrowth and translocation of Escherichia coli in rats with
obstructive jaundice when they were fed lactulose, while Bovee-Oudenhoven et al. (235)
reported that consumption of lactulose increased colonization resistance against the
invasive pathogen Salmonella enteritidis in rats. Indeed, lactulose consumption at high
doses (up to 60 g per day) is effective in eliminating salmonella from the intestinal tract of
chronic human carriers and is used as a pharmaceutical for this purpose in some countries
(236). The mode of action is speculated to be acidification of the gut that prevents growth
of this acid-sensitive pathogen.
The anti-infective effects of fructo-oligosaccharides and inulin have been examined
in mice challenged with the enteric pathogen Candida albicans and with systemic
infections of Salmonella and Listeria monocytogenes (237). Prebiotic feeding significantly
reduced intestinal colonization by Candida and the mortality of the mice with the systemic
infections, the latter effect hypothesized as being due to gut microbiota-induced
immunomodulation. However, two randomized, blinded, and controlled trials in which
Peruvian infants living in environments with a high burden of gastrointestinal and other
infections were fed oligofructose failed to show any significant benefit in terms of
preventing diarrhea or the use of health care resources (238), although a high level of
breast feeding amongst these infants may have limited the opportunity for effect. Prebiotic
intervention may prove effective in rapidly restoring colonization resistance and
preventing infections in cases where the intestinal microbiota has been perturbed.
Other Physiological and Technological Benefits of Prebiotics
In addition to the effects elicited by prebiotics discussed thus far, prebiotics have a
number of other functional properties that make them attractive pharmaceuticals and
food ingredients. Through their action in fecal bulking and water retention in the
bowel, prebiotics are effective in relieving constipation and maintaining normal stool
frequency (34). Additionally, by stimulating bacterial protein synthesis and reducing
production of ammonia by the microbiota, lactulose is effective in the treatment of
hepatic encephalopathy (236). NDOs are sweet and can be used as low-cariogenic and
low-calorific sugar substitutes, while polysaccharides such as inulin are used as fat
replacers. Their indigestibility and subsequent impact on glucose and insulin responses
also make them suitable for diabetics. In terms of food technology, NDOs supply a
number of valuable physicochemical functionalities. They can be used to increase
viscosity, reduce Malliard reactions, alter water retention, depress freezing points, and
suppress crystal formation. Hence, they are used commercially in a wide variety of
foods and beverages.
300 Crittenden and Playne
DISADVANTAGES OF THE PREBIOTIC APPROACH
While there are many advantages of the prebiotic approach, the use of this strategy to
modify the intestinal microbiota is not without its disadvantages. First among these is the
potential for intestinal side-effects if excessive doses of prebiotic oligosaccharides are
consumed (discussed in more detail in the following section). Secondly, there are
instances where probiotics may be more applicable to restoring colonization resistance in
the gut. One example is during episodes of diarrhea when mucosal damage may lead to
reduced capacity for sugar digestion. Ingestion of prebiotic oligosaccharides under these
conditions may exacerbate symptoms associated with sugar malabsorption even at usually
tolerable doses. Thirdly, there may be mechanisms, such as immunomodulation, where the
introduction of an exogenous probiotic strain could theoretically provide a superior
stimulus. Finally, some effects of probiotics are known to be strain specific and prebiotics
cannot at this stage emulate that specificity.
SAFE DOSAGE LEVELS
Safety of use must always be a dominant issue in the development of new food products.
Fortunately, it is well established that lactulose, short-chain oligosaccharides, inulin,
resistant starch and dietary fiber are not toxic, even in high doses. Non-digestible
carbohydrates are consumed as part of the normal daily diet, as they are natural
components of most plants (239). Estimates of resulting intakes of fructo-oligosaccharides
and inulin are between 1 and 10 g/day from normal diets in Europe and the United States
of America (239,240). It is likely that intakes of around 8 g/day by adults are normal.
Thus, any recommended dosages of non-digestible carbohydrates will be additional to the
natural basal dose consumed. Recommended effective doses of prebiotic oligosaccharides
in adults usually range from 10 to 15 g/day. With the shorter chain oligosaccharides, such
as fructo- and galacto-oligosaccharides, intakes exceeding 15 g/day in adults can lead to
flatulence, abdominal discomfort and cramping (241-243). With adaptation, larger doses
of up to of 25-30 g/day can be tolerated with few ill effects. Excessive consumption of
lactulose and NDOs can result in diarrhea due to osmotic water retention in the colon, with
the offending dose depending on the weight of the individual, rate of consumption (single
dose or frequent smaller doses spread over the day), and the composition and activity of
the intestinal microbiota.
A possible side-effect from the consumption of rapidly fermented, acidogenic
prebiotic sugars was recently identified by Dutch researchers (244,245). While
investigating the effects of lactulose and fructo-oligosaccharides on the translocation of
Salmonella in rats, the researchers noted that feeding the prebiotics left the animals more
susceptible to pathogen translocation from the gut. Intestinal acidification was observed
due to the rapid prebiotic fermentation, and while this inhibited the acid-sensitive
pathogen in the intestinal lumen, it possibly also damaged the mucosa leading to an
impaired barrier effect. Further research is needed to investigate possible negative impacts
of high doses of rapidly fermented sugars on the intestinal mucosa.
CONCLUSION AND FUTURE DIRECTIONS
There is little doubt from the volume of accumulated evidence from human and animal
studies that prebiotics can modify the dynamics of the colonic microbiota. Bifidobacteria
Modifying the Human Intestinal Microbiota with Prebiotics 301
are the dominant group of bacteria stimulated by all prebiotics developed so far. That such
a range of diverse carbohydrate structures can promote the selective proliferation of
bifidobacteria is testament to the remarkable metabolic agility of these organisms. The
magnitude of the bifidogenic effect is largely affected by the size of the intestinal
Bifidobacterium population, and little impact on Bifidobacterium numbers is observed in
individuals who already harbor high numbers of these bacteria.
Beyond Bifidobacteria
Although traditional microbiology culture methods have enabled some assessment of the
selectivity of prebiotics, new molecular techniques that enable analysis of non-cultivable
bacteria are starting to be applied in studies investigating the impact of prebiotics on the
colonic microbiota. Almost certainly, other bacterial populations that are affected by
the intake of current prebiotics will emerge. While evidence to date supports the beneficial
role of bifidobacteria and lactobacilli in the intestinal tract (11,12), they are but two of a
multitude of bacterial genera within the intestinal microbiota that potentially confer
benefits to the host. As we gradually shed light on the activities of newly identified
intestinal bacteria and their interactions with the host in health and disease new beneficial
and detrimental organisms will be undoubtedly be identified. The challenge will be to find
or design selective prebiotics to modulate populations and activities of these
particular organisms.
Phylogenetic vs. Physiological Modulation of the Microbiota
It should be emphasized that altering the microbial population dynamic is only one aspect
of prebiotic action. While stimulating the proliferation of particular groups of bacteria
might be important for some health effects (e.g., immunomodulation), this may be
secondary to specifically altering the metabolic activity of the microbiota for other effects
(e.g., anti-cancer). Marked differences between the phylogenetic and physiologic effects of
prebiotics on particular groups of organisms have been observed (139). Because of its
trophic and anti-neoplasic effects on the colonic epithelium, stimulating specific
populations of butyrigenic bacteria in the colon may well be the next important target
for prebiotics. In situ measurement of specific bacterial activities remains problematic, but
advances in functional genomics may provide a new avenue to explore the interactions
between prebiotics, the intestinal microbiota and the host in health and disease.
Blurring the Distinctions Between Prebiotics, Dietary Fibers, and Other
Fermentable Dietary Carbohydrates in the Colon
The greatest volume of research and evidence for prebiotic effects has been accrued for
fructo-oligosaccharides and inulin, but there is accumulating evidence of prebiotic actions
by a number of non-digestible carbohydrates. Lactulose and galacto-oligosaccharides
have strong claims to be classified as prebiotics, while there is promising evidence for
prebiotic activity by isomalto-, xylo-, and soybean-oligosaccharides. There is growing
interest in the impact of dietary fibers on the composition as well as the activity of the
intestinal microbiota, and resistant starches and arabinoxylans in particular warrant further
study for bifidogenic and other prebiotic effects.
It has been hypothesized that synergies might exist between NDOs that stimulate a
bifidogenic response and SCFA production in the proximal colon and larger
polysaccharides that sustain a source of fermentable carbohydrate through to the distal
302 Crittenden and Playne
colon. ORAFTI (Belgium) market a prebiotic (Synergy 1) that includes both short chain
fructo-oligosaccharides and the longer chain fructan inulin and have reported synergistic
effects in this combination for a range of physiological effects (246). Similarly,
complementary effects have been noted for FOS/inulin and resistant starches (72,247).
Development of synergistic prebiotic combinations to optimize the composition and
activity of the microbiota throughout the length of the intestinal tract, or to target specific
intestinal regions (e.g., for treatment of IBD) is set to provide continuing avenues for
future research.
Effects on Human Health
A growing understanding of the intestinal microbiota and its contribution to health and
disease has enabled rational hypotheses to be developed for prebiotic interventions
targeted to specific human populations. Testing of these hypotheses is still mostly centered
at the animal model or pilot human trial stage. Prebiotic oligosaccharides are already used
in some infant formulas and efforts to replicate the activities of HMOs are likely to
continue. Although the effects of prebiotics overlap somewhat with probiotics, the
prebiotic strategy does provide some potential advantages. Despite these physical and
potentially physiological advantages, research into the clinical effects of prebiotics still
lags that devoted to probiotics.
There is good evidence that prebiotics can relieve constipation and control hepatic
encephalopathy, and lactulose is currently used pharmaceutically for these purposes.
Additionally, a number of other health targets proposed for prebiotics have accumulating
evidence of benefits. The most promising targets have been discussed in this chapter and
include increasing calcium uptake, boosting colonization resistance against intestinal
pathogens, and ameliorating IBD. Evidence for these benefits is still largely preliminary,
but is sufficiently encouraging to warrant continuing investigation. While research efforts
have naturally focused on the health benefits of prebiotics, and to date few reports of
deleterious effects have surfaced, further quantification of the potential risks of prebiotics
at different doses, in combination with different diets, and for different demographics, both
healthy and diseased should be conducted. It is also important that prebiotics be trialed in
the context of total diets, since other dietary components, for example the presence of
dietary fibers that influence intestinal transit rates, can be expected to affect the
clinical outcomes.
Recent years have seen marked progress in our understanding of the microecology
of the gastrointestinal tract. However, we are still only at the very beginning of developing
an appreciation of the functional relationships between the microbiota and the host, in
health and disease. A more profound understanding of what constitutes a "healthy"
intestinal microbiota composition, and which microbial groups and activities are involved
in health and disease, is a prerequisite to the future development of prebiotics with
specifically targeted health effects. The challenge remains to demonstrate clinically
relevant benefits to health by prebiotic interventions in well-designed and controlled
human trials.
REFERENCES
1. Bourlioux P, Koletzko B, Guarner F, Braesco V. The intestine and its microflora are partners
for the protection of the host: report on the Danone Symposium " The Intelligent Intestine,"
held in Paris, June 14, 2002. Am J Clin Nutr 2003; 78:675-683.
Modifying the Human Intestinal Microbiota with Prebiotics 303
2. Topping DL, Clifton PM. Short-chain fatty acids and human colonic function: roles of
resistant starch and nonstarch polysaccharides. Physiol Rev 2001; 81:1031-1064.
3. Blum S, Schiffrin EJ. Intestinal Microflora and Homeostasis of the Mucosal Immune
Response: Implications for Probiotic Bacteria? Curr Issues Intest Microbiol 2003; 4:53-60.
4. Tlaskalova-Hogenova H, Stepankova R, Hudcovic T, et al. Commensal bacteria (normal
microflora), mucosal immunity and chronic inflammatory and autoimmune diseases.
Immunol Lett 2004; 93:97-108.
5. Cummings JH, Macfarlane GT, Macfarlane S. Intestinal bacteria and ulcerative colitis. Curr
Issues Intest Microbiol 2003; 4:9-20.
6. Marteau P, Seksik P, Shanahan F. Manipulation of the bacterial flora in inflammatory bowel
disease. Best practice res:. Clin Gastroenterol 2003; 17:47-61.
7. Saunier K, Dore J. Gastrointestinal tract and the elderly: functional foods, gut microflora and
healthy ageing. Dig Liver Dis 2002; 34:S19-S24.
8. Guarner F, Malagelada JR. Gut flora in health and disease. Lancet 2003; 361:512-519.
9. Tannock GW. Molecular assessment of intestinal microflora. Am J Clin Nutr 2001;
73:410S^14S.
10. Vaughan EE, de Vries MC, Zoetendal EG, Ben-Amor K, Akkermans ACL, de Vos WM. The
intestinal LABs. Antonie van Leeuwenhoek 2002; 82:341-352.
11. Crittenden R. An update on probiotic bifidobacteria. In: Salminen S, von Wright A,
Ouwerhand A, eds. Lactic Acid Bacteria: Microbiological and Functional Aspects. New
York: Marcel Dekker, 2004:125-157.
12. Salminen S, Gorbach S, Lee Y-K, Benno Y. Human studies on probiotics: what
is scientifically proven today? In: Salminen S, von Wright A, Ouwerhand A, eds. Lactic
Acid Bacteria: Microbiological and Functional Aspects. New York: Marcel Dekker,
2004:515-530.
13. Topping DL, Fukushima M, Bird AR. Resistant starch as a prebiotic and synbiotic: state of the
art. Proc Nutr Soc 2003; 62:171-176.
14. Gyorgy P, Norris RF, Rose CS. Bifidus factor I. A variant of Lactobacillus bifidus requiring a
special growth factor. Arch Biochem Biophys 1954; 48:193-201.
15. Gyorgy P, Kuhn R, Rose CS, Zilliken F. Bifidus factor II. Its occurrence in milk from different
species and in other natural products. Arch Biochem Biophys 1954; 48:202-208.
16. Rasic JL, Kurmann JA. Bifidobacteria and their role. Boston, MA, U.S.A.: Birkhauser Verlag,
1983.
17. Modler HW. Bifidogenic factors — sources, metabolism and applications. Int Dairy J 1994;
4:383-407.
18. Saito H, Miyakawa H, Ishibashi N, Tamura Y, Hayasawa H, Shimamura S. Effect of iron-free
and metal-bound forms of lactoferrin on the growth of bifidobacteria E.coli and S. aureus.
Biosci Microflora 1996; 15:1-7.
19. Samejima K, Yoshioka M, Tamura Z. Bifidus factors in carrot I. Chem Pharm Bull (Tokyo)
1971; 19:166-177.
20. Yoshioka M, Tamura Z. Bifidus factors in carrot II. Chem Pharm Bull (Tokyo) 1971;
19:178-185.
21. Kaneko T. A novel bifidogenic growth stimulator produced by Propionibacterium
freudenreichii. Biosci Microflora 1999; 18:73-80.
22. Mori H, Sato Y, Taketomo N, et al. Isolation and structural identification of bifidogenic
growth stimulator produced by Propionibacterium freudenreichii. J Dairy Sci 1997;
80:1959-1964.
23. Benno K, Sawada T. The intestinal microflora of infants: composition of fecal flora in breast-
fed and bottle-fed infants. Microbiol Immunol 1984; 28:975-986.
24. Balmer SE, Wharton BA. Diet and fecal flora in the newborn: breast milk and infant formula.
Arch Dis Child 1989; 64:1672-1677.
25. Petuely F. Bifidusflora bei flaschenkindern durch bifidogene substanzen (bifidusfaktor). Z
Kinderheilkd 1957; 79:174-179 (In German).
304 Crittenden and Playne
26. Ruttloff H, Taufel A, Krause W, Haenel H, Taufel K. Die intestinal-enzymatische spaltung
von galakto-oligosacchariden im darm von tier und menschen mit besonderer berucksichti-
gung von Lactobacillus bifidus. II. Mitt, zum intestinalen verhalten der lactulose. Nahrung
1967; 11:39-46 (In German).
27. Yazawa K, Imai K, Tamura Z. Oligosaccharides and polysaccharides specifically utilizable by
bifidobacteria. Chem Pharm Bull (Tokyo) 1978; 26:3306-3311.
28. Minami Y, Yazawa K, Tamura Z, Tanaka T, Yamamoto T. Selectivity of utilisation of
galactosyl-oligosaccharides by bifidobacteria. Chem Pharm Bull 1983; 31: 1688—1691.
29. Hidaka H, Eida T, Takizawa T, Tokunaga T, Tashiro Y. Effects of fructooligosaccharides on
intestinal flora and human health. Bifidobacteria Microflora 1986; 5:37-50.
30. Mitsuoka T, Hidaka H, Eida T. Effect of fructooligosaccharides on intestinal microflora.
Nahrung 1987; 31:427-436.
31. Gibson GR, Roberfroid MB. Dietary modulation of the human colonic microbiota —
Introducing the concept of prebiotics. J Nutr 1995; 125:1401-1412.
32. Playne MJ, Crittenden R. Commercially available oligosaccharides. Bull Int Dairy Fed 1996;
313:10-22.
33. Crittenden RG, Playne MJ. Production, properties and applications of food-grade
oligosaccharides. Trends Food Sci Technol 1996; 7:353-361.
34. van Loo J, Cummings J, Delzenne N, et al. Functional food properties of non-digestible
oligosaccharides: a consensus report from the ENDO project (DGXII AIRII-CT94-1095). Br J
Nutr 1999; 81:121-132.
35. Kolida S, Tuohy K, Gibson GR. Prebiotic effects of inulin and oligofructose. Br J Nutr 2002;
87:S193-S197.
36. Taper HS, Roberfroid MB. Inulin/oligofructose and anticancer therapy. Br J Nutr 2002;
87:S283-S286.
37. Pool-Zobel B, van Loo J, Rowland I, Roberfroid MB. Experimental evidences on the potential
of prebiotic fructans to reduce the risk of colon cancer. Br J Nutr 2002; 87:S273-S281.
38. Buddington KK, Donahoo JB, Buddington RK. Dietary oligofructose and inulin protect mice
from enteric and systemic pathogens and tumor inducers. J Nutr 2002; 132:472-477.
39. Harmsen HJM, Raangs GC, Franks AH, Wildeboer-Veloo ACM, Welling GW. The effect of
the prebiotic inulin and the probiotic Bifidobacterium longum on the fecal microflora of
healthy volunteers measured by FISH and DGGE. Microb Ecol Health Dis 2002; 14:21 1-219.
40. Ben XM, Zhou XY, Zhao WH, et al. Supplementation of milk formula with galacto-
oligosaccharides improves intestinal micro-flora and fermentation in term infants. Chinese
Med J 2004; 117:927-931.
41. Boehm G, Lidestri M, Casetta P, et al. Supplementation of a bovine milk formula with an
oligosaccharide mixture increases counts of fecal bifidobacteria in preterm infants. Arch Dis
Childhood 2002; 86:F178-F181.
42. Bouhnik Y, Flourie B, D'Agay-Abensour L, et al. Administration of transgalacto-
oligosaccharides increases fecal bifidobacteria and modifies colonic fermentation metabolism
in healthy humans. J Nutr 1997; 127:444-448.
43. Ito M, Deguchi Y, Matsumoto K, Kimura M, Onodera N, Yajima T. Influence of galacto-
oligosaccharides on human fecal microflora. J Nutr Sci Vitaminol 1993; 39:635-640.
44. Terada A, Hara H, Kataoka M, Mitsuoka T. Effect of lactulose on the composition and
metabolic activity of the human fecal flora. Microbial Ecol Health Dis 1992; 5:43-50.
45. Ballongue J, Schumann C, Quignon P. Effects of lactulose and lactitol on colonic microflora
and enzymatic activity. Scand J Gastroenterol 1997; 32:41-44.
46. Tuohy KM, Ziemer CJ, Klinder A, Knobel Y, Pool-Zobel BL, Gibson GR. A human volunteer
study to determine the prebiotic effects of lactulose powder on human colonic microbiota.
Microb Ecol Health Dis 2002; 14:165-173.
47. Bouhnik Y, Attar A, Joly FA, Riottot M, Dyard F, Flourie B. Lactulose ingestion increases
fecal bifidobacterial counts: a randomised double-blind study in healthy humans. Eur J Clin
Nutr 2004; 58:462-466.
Modifying the Human Intestinal Microbiota with Prebiotics 305
48. Boehm G, Stahl B. In: Mattila-Sandholm T, Saarela M, eds. Oligosaccharides. In: Functional
Dairy Products. Cambridge: Woodhead Publishing/CRC Press, 2003:203-243.
49. Fujita K, Hara K, Sakai S, et al. Effects of 4-(3-D-galactosylsucrose (lactosucrose) on
intestinal flora and its digestibility in humans. J Jpn Soc Starch Sci 1991; 38:249-255.
50. Yoneyama M, Mandai T, Aga H, Fujii K, Sakai S, Katayama Y. Effects of 4-(3-D-
galactosylsucrose (lactosucrose) intake on intestinal flora in healthy humans. J Jpn Soc Nutr
Food Sci 1992;45:101-107.
51. Hara H, Li S-T, Sasaki M, et al. Effective dose of lactosucrose on fecal flora and fecal
metabolites of humans. Bifidobacteria Microflora 1994; 13:51-63.
52. Ohkusa T, Ozaki Y, Sato C, Mikuni K, Ikeda H. Long-term ingestion of lactosucrose increases
bifidobacterium sp. in human fecal flora. Digestion 1995; 56:415-420.
53. Djouzi Z, Andrieux C, Pelenc V, et al. Degradation and fermentation of alpha-gluco-
oligosaccharides by bacterial strains from human colon: in vitro and in vivo studies in
gnotobiotic rats. J Appl Bacteriol 1995; 79:117-127.
54. Okazaki M, Fujikawa S, Matsumoto N. Effect of xylo-oligosaccharide on the growth of
bifidobacteria. Bifidobacteria Microflora 1990; 9:77-86.
55. Campbell JM, Jr., Fahey GC, Wolf BW. Selected indigestible oligosaccharides affect large
bowel mass, cecal and fecal short-chain fatty acids, pH and microflora in rats. J Nutr 1997;
127:130-136.
56. Kohmoto T, Fukui F, Takaku H, Machida Y, Arai M, Mitsuoka T. Effect of isomalto-
oligosaccharides on human facal flora. Bifidobacteria Microflora 1988; 7:61-69.
57. Kohmoto T, Fukui F, Takaku H, Mitsuoka T. Dose-response test of isomaltooligosaccharides
for increasing fecal bifidobacteria. Agric Biol Chem 1991; 55:2157-2159.
58. Kaneko T, Kohmoto T, Kikuchi H, et al. Effects of isomaltoologosaccharides intake on
defecation and intestinal environment in healthy volunteers. J Home Econ Jpn 1993;
44:245-254 (in Japanese).
59. Kaneko T, Kohmoto T, Kikuchi H, Shiota M, lino H, Mitsuoka T. Effects of
isomaltooligosaccharides with different degrees of polymerisation on human fecal
bifidobacteria. Biosci Biotech Biochem 1994; 58:2288-2290.
60. Benno Y, Endo K, Shiragani N, Sayama K, Mitsuoka T. Effects of raffinose intake on human
fecal microflora. Bifidobacteria Microflora 1987; 6:59-63.
61 . Hara T, Ikeda N, Hatsumi K, Watabe J, lino H, Mitsuoka T. Effects of small amount ingestion
of soybean oligosaccharides on bowel habits and fecal flora of volunteers. Jpn J Nutr 1997;
55:79-84.
62. Hayakawa K, Mitzutani J, Wada K, Masai T, Yoshihara I, Mitsuoka T. Effects of soybean
oligosaccharides on human fecal microflora. Microb Ecol Health Dis 1990; 3:293-303.
63. Wada K, Watabe J, Mizutani J, Tomoda M, Suzuki H, Saitoh Y. Effects of soybean
oligosaccharides in a beverage on human fecal flora and metabolites. J Agric Chem Soc Jpn
1992;66:127-135.
64. Jie Z, Bang-Yao L, Ming-Jie X, et al. Studies on the effects of polydextrose intake on
physiologic functions in Chinese people. Am J Clin Nutr 2000; 72:1503-1509.
65. Asano T, Yuasa K, Kunugita K, Teraja T, Mitsuoka T. Effects of gluconic acid on human fecal
bacteria. Microbial Ecol Health Dis 1994; 7:247-256.
66. Kleessen B, Stoof G, Proll J, Schmiedl D, Noack J, Blaut M. Feeding resistant starch affects
fecal and cecal microflora and short-chain fatty acids in rats. J Anim Sci 1997; 75:2453-2462.
67. Brown IL, Wang X, Topping DL, Playne MJ, Conway PL. High amylose maize starch as a
versatile prebiotic for use with probiotic bacteria. Food Aust 1998; 50:603-610.
68. Wang X, Brown IL, Evans AJ, Conway PL. The protective effects of high amylose maize
(amylomaize) starch granules on the survival of Bifidobacterium spp. in the mouse intestinal
tract. J Appl Microbiol 1999; 87:631-639.
69. Silvi S, Rumney CJ, Cresci A, Rowland IR. Resistant starch modifies gut microflora and
microbial metabolism in human flora-associated rats inoculated with feces from Italian and
U.K. donors. J Appl Microbiol 1999; 86:521-530.
306 Crittenden and Playne
70. Bielecka M, Biedrzycka E, Majkowska A, Juskiewicz J, Wroblewska M. Effect of non-
digestible oligosaccharides on gut microecosystem in rats. Food Res Int 2002; 35:139-144.
7 1 . Wang X, Brown IL, Khaled D, Mahoney MC, Evans AJ, Conway PL. Manipulation of colonic
bacteria and volatile fatty acid production by dietary high amylose maize (amylomaize) starch
granules. J Appl Microbiol 2002; 93:390-397.
72. Le Blay G, Michel C, Blottiere H, Cherbut C. Raw potato starch and short-chain fructo-
oligosaccharides affect the composition and metabolic activity of rat intestinal microbiota
differently depending on the caecocolonic segment involved. J Appl Microbiol 2003;
94:312-320.
73. van Laere KM, Hartemink R, Bosveld M, Schols HA, Voragen AG. Fermentation of plant cell
wall derived polysaccharides and their corresponding oligosaccharides by intestinal bacteria.
J Agric Food Chem 2000; 48:1644-1652.
74. Crittenden R, Karppinen S, Ojanen S, et al. In vitro fermentation of cereal dietary fiber
carbohydrates by probiotic and intestinal bacteria. J Sci Food Agric 2002; 82:1-9.
75. Okubo T, Ishihara N, Takahashi H, et al. Effects of partially hydrolyzed guar gum intake on
human intestinal microflora and its metabolism. Biosci Biotech Biochem 1994; 58:364-1369.
76. Muir JG, Yeow EG, Keogh J, et al. Combining wheat bran with resistant starch has more
beneficial effects on fecal indexes than does wheat bran alone. Am J Clin Nutr 2004;
79:1020-1028.
77. Champ MM. Physiological aspects of resistant starch and in vivo measurements. J AOAC Int
2004; 87:749-755.
78. Andoh A, Tsujikawa T, Fujiyama Y. Role of dietary fiber and short-chain fatty acids in the
colon. Curr Pharm Design 2003; 9:347-358.
79. Muir JG, Yeow EGW. Importance of combining indigestible carbohydrate with protein
sources in the diet: implications for reducing colorectal cancer risk. Proc Nutr Soc Aust 2000;
24:196-204.
80. Smiricky-Tjardes MR, Grieshop CM, Flickinger EA, Bauer LL, Fahey GC, Jr. Dietary
galactooligosaccharides affect ileal and total-tract nutrient digestibility, ileal and fecal
bacterial concentrations, and ileal fermentative characteristics of growing pigs. J Animal Sci
2003; 81:2535-2545.
81. Ito M, Deguchi Y, Miyamori A, et al. Effects of administration of galacto-oligosaccharides on
the human fecal microflora, stool weight and abdominal sensation. Microb Ecol Health Dis
1990; 3:285-292.
82. Barrangou R, Altermann E, Hutkins R, Cano R, Klaenhammer TR. Functional and
comparative genomic analyses of an operon involved in fructooligosaccharide utilization by
Lactobacillus acidophilus. Proc Nat Acad Sci USA 2003; 100:8957-8962.
83. Kaplan H, Hutkins RW. Metabolism of fructooligosaccharides by Lactobacillus paracasei
1195. Appl Environ Microbiol 2003; 69:2217-2222.
84. Roberfroid MB, Van Loo JAE, Gibson GR. The bifidogenic nature of chicory inulin and its
hydrolysis products. J Nutr 1998; 128:11-19.
85. Harmsen HJM, Wildeboer-Veloo ACM, Raangs GC, et al. Analysis of intestinal flora
development in breast-fed and formula-fed infants by using molecular identification and
detection methods. J Pediatr Gastroenterol Nutr 2000; 30:61-67.
86. Mountzouris KC, McCartney AL, Gibson GR. Intestinal microflora of human infants and
current trends for its nutritional modulation. Br J Nutr 2002; 87:405-420.
87. Brand-Miller J, McVeagh P. Human milk oligosaccharides: 130 reasons to breast-feed. Br
J Nutr 1999; 82:333-335.
88. Kunz C, Rudloff S, Baier W, Klein N, Strobel S. Oligosaccharides in human milk: structural,
functional, and metabolic aspects. Ann Rev Nutr 2000; 20:699-722.
89. Adlerberth I. Establishment of a normal intestinal microflora in the newborn infant. In:
Hansen LA, Yolken RH, eds. Probiotics,Other Nutritional Factors and Intestinal Microflora
(Nestle Nutrition Workshop Series, Vol 42, Nestec Ltd, Vevey). Philadelphia: Lippincott-
Raven, 1999:63-78.
Modifying the Human Intestinal Microbiota with Prebiotics 307
90. Heavey PM, Savage SA, Parrett A, Cecchini C, Edwards CA, Rowland IR. Protein-
degradation products and bacterial enzyme activities in feces of breast-fed and formula-fed
infants. Br J Nutr 2003; 89:509-515.
91. Edwards CA, Parrett AM. Intestinal flora during the first months of life: new perspectives. Br
J Nutr 2002; 88:S11-S18.
92. Moro G, Minoli I, Mosca M, et al. Dosage-related bifidogenic effects of galacto- and
fructooligosaccharides in formula-fed term infants. J Pediatr Gastroenterol Nutr 2002;
34:291-295.
93. Newburg DS. Human milk glycoconjugates that inhibit pathogens. Curr Med Chem 1999;
6:117-127.
94. Martin-Sosa S, Martin MJ, Hueso P. The sialylated fraction of milk oligosaccharides is
partially responsible for binding to enterotoxigenic and uropathogenic Escherichia coli
human strains. J Nutr 2002; 132:3067-3072.
95. Morrow AL, Ruiz-Palacios GM, Altaye M, et al. Human milk oligosaccharides are associated
with protection against diarrhea in breast-fed infants. J Pediatr 2004; 145:297-303.
96. Wang B, Brand-Miller J. The role and potential of sialic acid in human nutrition. Eur J Clin
Nutr 2003; 57:1351-1369.
97. Vincent SJ, Faber EJ, Neeser JR, Stingele F, Kamerling JP. Structure and properties of the
exopolysaccharide produced by Streptococcus macedonicus Scl36. Glycobiology 2001;
11:131-139.
98. Rencurosi A, Poletti L, Guerrini M, Russo G, Lay L. Human milk oligosaccharides: an
enzymatic protection step simplifies the synthesis of 3'- and 6 / -0-sialyllactose and their
analogues. Carbohydr Res 2002; 337:473-483.
99. La Ferla B, Prosperi D, Lay L, Russo G, Panza L. Synthesis of building blocks of human milk
oligosaccharides. Fucosylated derivatives of the lacto- and neolacto-series. Carbohydr Res
2002; 337:1333-1342.
100. Dumon C, Samain E, Priem B. Assessment of the two Helicobacter pylori alpha-
1,3-fucosyltransferase ortholog genes for the large-scale synthesis of LewisX human milk
oligosaccharides by metabolically engineered Escherichia coli. Biotechnol Prog 2004;
20:412-419.
101. Ouwehand A, Isolauri E, Salminen S . The role of the intestinal microflora for the development
of the immune system in early childhood. Eur J Nutr 2002; 41:132-137.
102. Bjorksten B, Naaber P, Sepp E, Mikelsaar M. The intestinal microflora in allergic Estonian
and Swedish 2-year old children. Clin Exp Allergy 1999; 29:342-346.
103. Bjorksten B, Sepp E, Julge K, Voor T, Mikelsaar M. Allergy development and the intestinal
microflora during the first year of life. J Allergy Clin Immunol 2001; 108:516-520.
104. Bottcher M, Sandin A, Norin E, Midtvedt T, Bjorksten B. Microflora associated
characteristics in feces from allergic and non-allergic children. Clin Exp Allergy 2000;
30:590-596.
105. Gronlund MM, Arvilommi H, Kero P, Lehtonen OP, Isolauri E. Importance of intestinal
colonization in the maturation of humoral immunity in early infancy: a prospective follow up
study of healthy infants aged 0-6 months. Arch Dis Child 2000; 83:F186-F192.
106. Kalliomaki M, Kirjavainen P, Eerola E, Kero P, Salminen S, Isolauri E. Distinct patterns of
neonatal gut microflora in infants in whom atopy was and was not developing. J Allergy Clin
Immunol 2001; 107:129-134.
107. Kirjavainen PV, Apostolou E, Arvola T, Salminen SJ, Gibson GR, Isolauri E. Characterizing
the composition of intestinal microflora as a prospective treatment target in infant allergic
disease. FEMS Immunol Med Micrbiol 2001; 32:1-7.
108. Kirjavainen PV, Arvola T, Salminen SJ, Isolauri E. Aberrant composition of gut microbiota of
allergic infants: a target of bifidobacterial therapy at weaning? Gut 2002; 51:51-55.
109. He F, Ouwehand AC, Isolauri E, Hashimoto H, Benno Y, Salminen S. Comparison of mucosal
adhesion and species identification of bifidobacteria isolated from healthy and allergic infants.
FEMS Immunol Med Microbiol 2001; 30:43-47.
308 Crittenden and Playne
110. Ouwehand AC, Isolauri E, He F, Hashimoto H, Benno Y, Salminen S. Differences in
Bifidobacterium flora composition in allergic and healthy infants. J Allergy Clin Immunol
2001; 108:144-145.
111. Mackie RI, Sghir A, Gaskins HR. Developmental microbial ecology of the neonatal
gastrointestinal tract. Am J Clin Nutr 1999; 69:1035S-1045S.
112. Matsuki T, Watanabe K, Tanaka R, Fukuda M, Oyaizu H. Distribution of bifidobacterial
species in human intestinal microflora examined with 16S rRNA-gene-targeted species-
specific primers. Appl Environ Microbiol 1999; 65:4506-4512.
113. Kalliomaki M, Salminen S, Arvilommi H, Kero P, Koskinen P, Isolauri E. Probiotics in
primary prevention of atopic disease: a randomised placebo-controlled trial. Lancet 2001;
357:1076-1079.
1 14. Kalliomaki M, Salminen S, Poussa T, Arvilommi H, Isolauri E E. Probiotics and prevention of
atopic disease: 4-year follow-up of a randomised placebo-controlled trial. Lancet 2003;
361:1869-1871.
115. Nagura T, Hachimura S, Hashiguchi M, et al. Suppressive effect of dietary raffinose on
T-helper 2 cell-mediated immunity. Br J Nutr 2002; 88:421-427.
116. Yoshida T, Hirano A, Wada H, Takahashi K, Hattori M. Alginic acid oligosaccharide
suppresses Th2 development and IgE production by inducing IL-12 production. Int Arch
Allergy Immunol 2004; 133:239-247.
117. Marteau P, Pochart P, Dore J, Bera-Maillet C, Bernalier A, Corthier G. Comparative study of
bacterial groups within the human cecal and fecal microbiota. Appl Environ Microbiol 2001;
67:4939-4942.
118. Franks AH, Harmsen HJ, Raangs GC, Jansen F, Schut GW. Variations of bacterial
populations in human feces measured by fluorescent in situ hybridization with group-specific
16S rRNA-targeted oligonucleotide probes. Appl Environ Microbiol 1998; 64:3336-3345.
119. Sghir A, Gramet G, Suau A, Rochet V, Pochart P, Dore J. Quantification of bacterial groups
within human fecal flora by oligonucleotide probe hybridization. Appl Environ Microbiol
2000; 66:2263-2266.
120. Harmsen HJ, Wildeboer-Veloo AC, Grijpstra J, Knol J, Degener JE, Welling GW.
Development of 16S rRNA-based probes for the Coriobacterium group and the Atopobium
cluster and their application for enumeration of Coriobacteriaceae in human feces from
volunteers of different age groups. Appl Environ Microbiol 2000; 66:4523-4527.
121. Requena T, Burton J, Matsuki T, et al. Identification, detection, and enumeration of human
Bifidobacterium species by PCR targeting the transaldolase gene. Appl Environ Microbiol
2002; 68:2420-2427.
122. Tannock GW. Analysis of the intestinal microflora using molecular methods. Eur J Clin Nutr
2002; 56:S44-S49.
123. Mangin I, Bouhnik Y, Bisetti N, Decaris B. Molecular monitoring of human intestinal
Bifidobacterium strain diversity. Res Mincrobiol 1999; 150:343-350.
124. Tannock GW. The bifidobacterial and Lactobacillus microflora of humans. Clin Rev Allergy
Immunol 2002; 22:231-253.
125. Satokari RM, Vaughan EE, Akkermans ADL, Saarela M, de Vos WM. Bifidobacterial
diversity in human feces detected by genus-specific PCR and denaturing gradient gel
electrophoresis. Appl Environ Microbiol 2001; 67:504-513.
126. Matsuki T, Watanabe K, Tanaka R, Fukuda M, Oyaizu H. Distribution of bifidobacterial
species in human intestinal microflora examined with 16S rRNA-gene-targeted species-
specific primers. Appl Environ Microbiol 1999; 65:4506-4512.
127. Hayashi H, Sakamoto M, Benno Y. Phylogenetic analysis of the human gut microbiota using
16S rDNA clone libraries and strictly anaerobic culture-based methods. Microbiol Immunol
2002; 46:535-548.
128. Matsuki T, Watanabe K, Fujimoto J, et al. Development of 16S rRNA-gene-targeted group-
specific primers for the detection and identification of predominant bacteria in human feces.
Appl Environ Micrbiol 2002; 68:5445-5451.
Modifying the Human Intestinal Microbiota with Prebiotics 309
129. Crittenden RG. Prebiotics. In: Tannock GW, ed. Probitoics: A Critical Review. Wymondham
U.K.: Horizon Scientific Press, 1999:141-156.
130. Rao AV. Dose-response effects of inulin and oligofructose on intestinal bifidogenesis effects.
JNutr 1999; 129:1442S-1445S.
131. Saito Y, Hamanaka Y, Saito K, Takizawa S, Benno Y. Stability of species composition of
fecal bifidobacteria in human subjects during fermented milk administration. Curr Microbiol
2002; 44:368-373.
132. Ventura M, Elli M, Reniero R, Zink R. Molecular microbial analysis of Bifidobacterium
isolates from different environments by the species-specific amplified ribosomal DNA
restriction analysis (ARDRA). FEMS Microbiol Ecol 2001; 36:113-121.
133. Alander M, Matto J, Kneifel W, et al. Effect of galacto-oligosaccharide supplementation on
human fecal microflora and on survival and persistence of Bifidobacterium lactis Bb-12 in the
gastrointestinal tract. Int Dairy J 2001; 11:817-825.
134. Satokari RM, Vaughan EE, Akkermans ADL, Saarela M, de Vos WM. Polymerase chain
reaction and denaturing gradient gel electrophoresis monitoring of fecal Bifidobacterium
populations in a prebiotic and probiotic feeding trial. Syst Appl Microbiol 2001; 24:227-231.
135. Malinen E, Matto J, Salmitie M, Alander M, Saarela M, Palva A. PCR-ELISA— II: Analysis
of Bifidobacterium populations in human fecal samples from a consumption trial with
Bifidobacterium lactis Bb-12 and a galacto-oligosaccharide preparation. Syst Appl Microbiol
2002; 25:249-258.
136. Harmsen HJM, Raangs GC, Franks AH, Wildeboer-Veloo ACM, Welling GW. The effect of
the prebiotic inulin and the probiotic Bifidobacterium longum on the fecal microflora of
healthy volunteers measured by FISH and DGGE. Microb Ecol Health Dis 2002;
14:211-219.
137. Zoetendal EG, Akkermans AD, de Vos WM. Temperature gradient gel electrophoresis
analysis of 16S rRNA from human fecal samples reveals stable and host-specific communities
of active bacteria. Appl Environ Microbiol 1998; 64:3854-3859.
138. Tannock GW. A fresh look at feces. Microbiol Aust 2003; 24:34-35.
139. Tannock GW, Munro K, Bibiloni R, et al. Impact of consumption of oligosaccharide-
containing biscuits on the fecal microbiota of humans. Appl Environ Microbiol 2004;
70:2129-2136.
140. Schultz M, Timmer A, Herfarth HH, Sartor RB, Vanderhoof JA, Rath HC. Lactobacillus GG
in inducing and maintaining remission of Crohn's disease. BMC Gastroenterol 2004; 15:5.
141. Linskens RK, Huijsdens XW, Savelkoul PHM, Vandenbroucke-Grauls CMJE,
Meuwissen SMG. The bacterial flora in inflammatory bowel disease: Current insights in
pathogenesis and the influence of antibiotics and probiotics. Scand J Gastroenterol 2001;
36:S29-S40.
142. Favier C, Neut C, Mizon C, Cortot A, Colombel JF, Mizon J. Fecal beta-D-galactosidase
production and Bifidobacteria are decreased in Crohn's disease. Dig Dis Sci 1997;
42:817-822.
143. Rumi G, Tsubouchi R, Okayama M, Kato S, Mozsik G, Takeuchi K. Protective effect of
lactulose on dextran sulfate sodium-induced colonic inflammation in rats. Dig Dis Sci 2004;
49:1466-1472.
144. Cherbut C, Michel C, Lecannu G. The prebiotic characteristics of fructooligosaccharides are
necessary for reduction of TNBS-induced colitis in rats. J Nutr 2003; 133:21-27.
145. Holma R, Juvonen P, Asmawi MZ, Vapaatalo H, Korpela R. Galacto-oligosaccharides
stimulate the growth of bifidobacteria but fail to attenuate inflammation in experimental
colitis in rats. Scand J Gastroenterol 2002; 37:1042-1047.
146. Jacobasch G, Schmiedl D, Kruschewski M, Schmehl K. Dietary resistant starch and chronic
inflammatory bowel diseases. Int J Colorectal Dis 1999; 14:201-211.
147. Moreau NM, Martin LJ, Toquet CS, et al. Restoration of the integrity of rat caeco-colonic
mucosa by resistant starch, but not by fructo-oligosaccharides, in dextran sulfate sodium-
induced experimental colitis. Br J Nutr 2003; 90:75-85.
310 Crittenden and Playne
148. Kanauchi Y, Fujiyama K, Mitsuyama Y, et al. Increased growth of Bifidobacterium and
Eubacterium by germinated barley foodstuff, accompanied by enhanced butyrate production
in healthy volunteers. Int J Mol Med 1999; 3:175-179.
149. Oikarinen S, Heinonen S, Karppinen S, et al. Plasma enterolactone or intestinal
Bifidobacterium levels do not explain adenoma formation in multiple intestinal neoplasia
(Min) mice fed with two different types of rye-bran fractions. Br J Nutr 2003; 90:1 19-125.
150. Bamba T, Kanauchi O, Andoh A, Fujiyama Y. A new prebiotic from germinated barley for
nutraceutical treatment of ulcerative colitis. J Gastroenterol Hepatol 2002; 17:818-824.
151. Fukuda M, Kanauchi O, Araki Y, et al. Prebiotic treatment of experimental colitis with
germinated barley foodstuff: a comparison with probiotic or antibiotic treatment. Int J Mol
Med 2002; 9:65-70.
152. Kanauchi K, Mitsuyama Y, Araki A, Andoh A. Modification of intestinal flora in the
treatment of inflammatory bowel disease. Curr Pharm Des 2003; 9:333-346.
153. Kanauchi T, Suga M, Tochihara T, et al. Treatment of ulcerative colitis by feeding with
germinated barley foodstuff: first report of a multicenter open control trial. J Gastroenterol
2002; 37:67-72.
154. Mitsuoka T. Recent trends in research on intestinal flora. Bifidobacteria Microflora 1982;
1:3-24.
155. Hopkins MJ, Sharp R, Macfarlane GT. Age and disease related changes in intestinal bacterial
populations assessed by cell culture, 16S rRNA abundance, and community cellular fatty acid
profiles. Gut 2001; 48:198-205.
156. Hopkins MJ, Sharp R, Macfarlane GT. Variation in human intestinal microbiota with age. Dig
Liver Dis 2002; 34:S12-S18.
157. Canzi E, Casiraghi MC, Zanchi R, et al. Yogurt in the diet of the elderly: a preliminary
investigation into its effect on the gut ecosystem and lipid metabolism. Lait 2002;
82:713-723.
158. Silvi S, Verdenelli MC, Orpianesi C, Cresci A. EU project Crownalife: functional foods, gut
microflora and healthy ageing - Isolation and identification of Lactobacillus and
Bifidobacterium strains from fecal samples of elderly subjects for a possible probiotic use
in functional foods. J Food Eng 2003; 56:195-200.
159. Hopkins MJ, MacFarlane GT. Changes in predominant bacterial populations in human feces
with age and with Clostridium difficile infection. J Med Micrbiol 2002; 51:448-454.
160. Brown I, Warhurst M, Arcot J, et al. Fecal numbers of bifidobacteria are higher in pigs fed
Bifidobacterium longum with a high amylose cornstarch than with a low amylose cornstarch.
J Nutr 1997; 127:1822-1827.
161. Challa A, Rao DR, Chawan CB, Shackelford L. Bifidobacterium longum and lactulose
suppress azoxymethane-induced colonic aberrant crypt foci in rats. Carcinogenesis 1997;
18:517-521.
162. Rowland IR, Rumney CJ, Coutts JT, Lievense LC. Effect of Bifidobacterium longum and
inulin on gut bacterial metabolism and carcinogen-induced aberrant crypt foci in rats.
Carcinogenesis 1998; 19:281-285.
163. Gallaher DD, Khil J. The effect of synbiotics on colon carcinogenesis in rats. J Nutr 1999;
129:1483S-1487S.
164. Femia AP, Luceri C, Dolara P, et al. Antitumorigenic activity of the prebiotic inulin enriched
with oligofructose in combination with the probiotics Lactobacillus rhamnosus and
Bifidobacterium lactis on azoxymethane-induced colon carcinogenesis in rats Carcinogenesis
2002;23:1953-1960.
165. Asahara T, Nomoto K, Shimizu K, Watanuki M, Tanaka R. Increased resistance of mice
to Salmonella enterica serovar Typhimurium infection by synbiotic administration of
Bifidobacteria and transgalactosylated oligosaccharides. J Appl Microbiol 2001;
91:985-996.
166. Lamoureux L, Roy D, Gauthier SF. Production of oligosaccharides in yogurt containing
bifidobacteria and yogurt cultures. J Dairy Sci 2002; 85:1058-1069.
Modifying the Human Intestinal Microbiota with Prebiotics 311
167. Hung MN, Lee BH. Purification and characterization of a recombinant beta-galactosidase
with transgalactosylation activity from Bifidobacterium infantis HL96. Appl Micrbiol
Biotechnol 2002; 58:439-445.
168. Jorgensen F, Hansen OC, Stougaard P. High-efficiency synthesis of oligosaccharides with a
truncated beta-galactosidase from Bifidobacterium bifidum. Appl Microbiol Biotechnol 2001;
57:647-652.
169. Crittenden R, Laitila A, Forssell P, et al. Adhesion of bifidobacteria to granular starch and its
implications in probiotic technologies. Appl Environ Microbiol 2001; 67:3469-3475.
170. Schell MA, Karmirantzou M, Snel B, et al. The genome sequence of Bifidobacterium longum
reflects its adaptation to the human gastrointestinal tract. Proc Natl Acad Sci USA 2002;
99:14422-14427.
171. Hopkins MJ, Cummings JH, Macfarlane GT. Inter-species differences in maximum specific
growth rates and cell yields of bifidobacteria cultured on oligosaccharides and other simple
carbohydrate sources. J Appl Microbiol 1998; 85:381-386.
172. Crittenden RG, Morris LF, Harvey ML, Tran LT, Mitchell HL, Playne MJ. Selection of a
Bifidobacterium strain to complement resistant starch in a synbiotic yoghurt. J Appl Microbiol
2001;90:268-278.
173. Beaugerie L, Petit JC. Microbial-gut interactions in health and disease. Antibiotic-associated.
Best Pract Res Clin Gastroenterol 2004; 18:337-352.
174. Sherman RG, Prusinski L, Ravenel MC, Joralmon RA. Oral candidosis. Quintessence Int
2002; 33:521-532.
175. Dan M, Kaneti N, Levin D, Poch F, Samra Z. Vaginitis in a gynecologic practice in Israel:
causes and risk factors. Isr Med Assoc J 2003; 5:629-632.
176. Plummer S, Weaver MA, Harris JC, Dee P, Hunter J. Clostridium difficile pilot study:
effects of probiotic supplementation on the incidence of C. difficile. Int Microbiol 2004;
7:59-62.
177. Gill HS. Probiotics to enhance anti-infective defences in the gastrointestinal tract. Best Pract
Res Clin Gastroenterol 2003; 17:755-773.
178. Marteau P, Seksik P, Jian R. Probiotics and intestinal health effects: a clinical perspective. Br
JNutr2002; 88:S51-S57.
179. Kanamori Y, Hashizume K, Kitano Y, et al. Anaerobic dominant flora was reconstructed by
synbiotics in an infant with MRSA enteritis. Pediatr Int 2003; 45:359-362.
180. Stern RS. Photocarcinogenicity of drugs. Toxicol Lett 1998; 102-103:389-392.
181. Dancer SJ. The problem with cephalosporins. J Antimicrob Chemother 2001; 48:463-478.
182. Patterson JA, Burkholder KM. Application of prebiotics and probiotics in poultry production.
Poultry Sci 2003; 82:627-631.
183. Flickinger EA, van Loo J, Jr., Fahey GC. Nutritional responses to the presence of inulin and
oligofructose in the diets of domesticated animals: a review. Crit Rev Food Sci Nutr 2003;
43:19-60.
184. Mattila-Sandholm T, Blum S, Collins JK, et al. Probiotics: towards demonstrating efficacy.
Trends Food Sci Technol 1999; 10:393-399.
185. von Wright A, Vilpponen-Salmela T, Llopis MP, et al. The survival and colonic adhesion of
Bifidobacterium infantis in patients with ulcerative colitis. Int Dairy J 2002; 12:197-200.
186. Shimakawa Y, Matsubara S, Yuki N, Ikeda M, Ishikawa F. Evaluation of Bifidobacterium
breve strain Yakult-fermented soymilk as a probiotic food. Int J Food Microbiol 2003;
81:131-136.
187. Fujiwara S, Seto Y, Kimura A, Hashiba H. Intestinal transit of an orally administered
streptomycin-rifampicin-resistant variant of Bifidobacterium longum SBT2928: its long-term
survival and effect on the intestinal microflora and metabolism. J Appl Micrbiol 2001;
90:43-52.
188. Brigidi P, Swennen E, Vitali B, Rossi M, Matteuzzi D. PCR detection of Bifidobacterium
strains and Streptococcus thermophilus in feces of human subjects after oral bacteriotherapy
and yogurt consumption. Int J Food Microbiol 2003; 81:203-209.
312 Crittenden and Playne
189. McCartney AL, Wenzhi W, Tannock GW. Molecular analysis of the composition of the
bifidobacteria! and Lactobacillus microflora of humans. Appl Environ Microbiol 1996;
62:4608-4613.
190. Kimura K, McCartney AL, McConnell MA, Tannock GW. Analysis of fecal populations of
bifidobacteria and lactobacilli and investigation of the immunological responses of their
human hosts to the predominant strains. Appl Environ Microbiol 1997; 63:3394-3398.
191. Mangin I, Bouhnik Y, Bisetti N, Decaris B. Molecular monitoring of human intestinal
Bifidobacterium strain diversity. Res Mincrobiol 1999; 150:343-350.
192. Dunne C, O'Mahony L, Murphy L, et al. In vitro selection criteria for probiotic bacteria of
human origin: correlation with in vivo findings. Am J Clin Nutr 2001; 73:386S-392S.
193. Germond JE, Mamin O, Mollet B. Species specific identification of nine human
Bifidobacterium spp. in feces. Syst Appl Micrbiol 2002; 25:536-543.
194. Zopf D, Roth S. Oligosaccharide anti-infective agents. Lancet 1996; 347:1017-1021.
195. Kunz C. Microbial receptor analogs in human milk: structural and functional aspects. In:
Hansen LA, Yolken RH, eds. Probiotics, Other Nutritional Factors and Intestinal Microflora.
(Nestle Nutrition Workshop Series, Vol. 42, Nestec Ltd, Vevey). Philadelphia: Lippincott-
Raven, 1999:157-173.
196. Kunz C, Rudloff S. Health benefits of milk-derived carbohydrates. Bull Int Dairy Fed 2002;
375:72-79.
197. Kunz C, Rudloff S. Biological functions of oligosaccharides in human milk. Acta Paediatr
1993; 82:903-912.
198. Orchel A, Dzierzewicz Z, Parfiniewicz B, Weglarz L, Wilczok T. Butyrate-induced
differentiation of colon cancer cells is PKC and JNK dependent. Dig Dis Sci 2005;
50:490-498.
199. Miller SJ. Cellular and physiological effects of short-chain fatty acids. Mini Rev Med Chem
2004; 4:839-845.
200. Lupton JR. Microbial degradation products influence colon cancer risk: the butyrate
controversy. J Nutr 2004; 134:479-482.
201. Young GP, Le Leu RK. Resistant starch and colorectal neoplasia. J AOAC Int 2004;
87:775-786.
202. De Preter V, Geboes K, Verbrugghe K, et al. The in vivo use of the stable isotope-labelled
biomarkers lactose- [N-15]ureide and [H-2(4)]tyrosine to assess the effects of pro- and
prebiotics on the intestinal flora of healthy human volunteers. Br J Nutr 2004; 92:439-446.
203. Rowland IR, Tanaka R. The effects of transgalactosylated oligosaccharides on gut flora
metabolism in rats associated with a human fecal microflora. J Appl Bacteriol 1993;
74:667-674.
204. Phillips J, Muir JG, Birkett A, et al. Effect of resistant starch on fecal bulk and fermentation-
dependent events in humans. Am J Clin Nutr 1995; 62:121-130.
205. Hylla S, Gostner A, Dusel G, et al. Effects of resistant starch on the colon in healthy
volunteers: possible implications for cancer prevention. Am J Clin Nutr 1998; 67:136-142.
206. Grubben MJ, van den Braak CC, Essenberg M, et al. Effect of resistant starch on potential
biomarkers for colonic cancer risk in patients with colonic adenomas: a controlled trial. Dig
Dis Sci 2001; 46:750-756.
207. Bouhnik Y, Flourie B, Ouarne F, et al. Effects of prolonged ingestion of fructo-
oligosaccharides (FOS) on colonic bifidobacteria, fecal enzymes and bile acids in humans.
Gastroenterol 1994; 106:A598.
208. Rowland IR, Bearne CA, Fischer R, Pool-Zobel BL. The effect of lactulose on DNA damage
induced by DMH in the colon of human flora-associated rats. Nutr Cancer 1996; 26:37-47.
209. Perrin P, Pierre F, Patry Y, et al. Only fibers promoting a stable butyrate producing colonic
ecosystem decrease the rate of aberrant crypt foci in rats. Gut 2001; 48:53-61.
210. Nakanishi S, Kataoka K, Kuwahara T, Ohnishi Y. Effects of high amy lose maize starch and
Clostridium butyricum on metabolism in colonic microbiota and formation of azoxymethane-
induced aberrant crypt foci in the rat colon. Microbiol Immunol 2003; 47:951-958.
Modifying the Human Intestinal Microbiota with Prebiotics 313
211. Scholz-Ahrens KE, Schaafsma G, van den Heuvel EG, Schrezenmeir J. Effects of prebiotics
on mineral metabolism. Am J Clin Nutr 2001; 73:459S-464S.
212. Scholz-Ahrens KE, Schrezenmeir J. Inulin, oligofructose and mineral metabolism —
experimental data and mechanism. Br J Nutr 2002; 87:S179-S186.
213. Morohashi T. The effect on bone of stimulated intestinal mineral absorption following
fructooligosaccharide consumption in rats. Biosci Microflora 2002; 21:21-25.
214. Sakuma K. Molecular mechanism of the effect of fructooligosaccharides on calcium
absorption. Biosci Microflora 2002; 21:13-20.
215. Hillman LS, Tack E, Covell DG, Vieira NE, Yergey AL. Measurement of true calcium
absorption in premature infants using intravenous 46 Ca and oral 44 Ca. Pediatr Res 1988;
23:589-594.
216. Chonan K, Matsumoto M, Watanuki. Effects of galactooligosaccharides on calcium
absorption and preventing bone loss in ovariectomized rats. Biosci Biotechnol Biochem
1995; 59:236-239.
217. Mizota T. Lactulose as a growth- promoting factor for Bifidobacterium and its physiological
aspects. Bull Int Dairy Fed 1996; 313:43-48.
218. Ohta A, Osakabe N, Yamada K, Saito Y, Hidaka H. Effects of fructooligosaccharideson Ca,
Mg and P absorption in rats. J Jap Soc Nutr Food Sci 1993; 46:123-129.
219. van den Heuvel EG, Schaafsma G, Muys T, van Dokkum W. Nondigestible oligosaccharides
do not interfere with calcium and nonheme-iron absorption in young, healthy men. Am J Clin
Nutr 1998; 67:445-451.
220. Teuri U, Korpela R, Saxelin M, Montonen L, Salminen S. Increased fecal frequency and
gastrointestinal symptoms following ingestion of galacto-oligosaccharide-containing yogurt.
J Nutr Sci Vitaminol 1998; 44:465-471.
221. Coudray C, Bellanger J, Castiglia-Delavaud C, Remesy C, Vermorel M, Rayssignuier Y.
Effect of soluble or partly soluble dietary fibers supplementation on absorption and balance of
calcium, magnesium, iron and zinc in healthy young men. Eur J Clin Nutr 1997; 51:375-380.
222. van den Heuvel EG, Muijs T, van Dokkum W, Schaafsma G. Lactulose stimulates calcium
absorption in postmenopausal women. J Bone Miner Res 1999; 14:1211-1216.
223. van den Heuvel EG, Muys T, van Dokkum W, Schaafsma G. Oligofructose stimulates calcium
absorption in adolescents. Am J Clin Nutr 1999; 69:544-548.
224. van den Heuvel EG, Schoterman MHC, Muijs T. Transgalactooligosaccharides stimulate
calcium absorption in postmenopausal women. J Nutr 2000; 130:2938-2942.
225. Griffin IJ, Davila PM, Abrams SA. Non-digestible oligosaccharides and calcium absorption in
girls with adequate calcium intakes. Br J Nutr 2002; 87:S187-S191.
226. Coudray C, Demigne C, Rayssiguier Y. Effects of dietary fibers on magnesium absorption in
animals and humans. J Nutr 2003; 133:1-4.
227. van Dokkum W, Wezendonk B, Srikumar TS, van den Heuvel EG. Effect of nondigestible
oligosaccharides on large-bowel functions, blood lipid concentrations and glucose absorption
in young healthy male subjects. Eur J Clin Nutr 1999; 53:1-7.
228. Jackson KG, Taylor GR, Clohessy AM, Williams CM. The effect of the daily intake of inulin
on fasting lipid, insulin and glucose concentrations in middle-aged men and women. Br J Nutr
1999; 82:23-30.
229. Kruse HP, Kleessen B, Blaut M. Effects of inulin on fecal bifidobacteria in human subjects. Br
J Nutr 1999; 82:375-382.
230. Brighenti F, Casiraghi MC, Canzi F, Ferrari A. Effect of consumption of a ready-to-eat
breakfast cereal containing inulin on the intestinal milieu and blood lipids in healthy male
volunteers. Eur J Clin Nutr 1999; 53:726-733.
23 1 . Alles MS, de Roos MN, Bakx JC, van de Lisdonk E, Zock PL, Hautvast JGAC. Consumption
of fructo-oligosaccharides does not favourably affect blood glucose and serum lipids in non-
insulin dependent diabetic patients. Am J Clin Nutr 1999; 69:64-69.
232. Williams CM, Jackson KG. Inulin and oligofructose: effects on lipid metabolism from human
studies. Br J Nutr 2002; 87:S261-S264.
314 Crittenden and Playne
233. Delzenne NM, Daubioul C, Neyrinck A, Lasa M, Taper HS. Inulin and oligofructose
modulate lipid metabolism in animals: review of biochemical events and future prospects. Br
J Nutr 2002; 87:S255-S259.
234. Ozaslan C, Tiirkcapar AG, Kesenci M, et al. Effect of Lactulose on Bacterial Translocation.
Eur J Surg 1997; 163:463-467.
235. Bovee-Oudenhoven IMJ, Termont DMSL, Heidt PJ, Van der Meer R. Increasing the intestinal
resistance of rats to the invasive pathogen Salmonella enteritidis: additive effects of dietary
lactulose and calcium. Gut 1997; 40:497-504.
236. Schumann C. Medical, nutritional and technological properties of lactulose. An update. Eur
J Nutr 2002; 41:17-25.
237. Buddington KK, Donahoo JB, Buddington RK. Dietary oligofructose and inulin protect mice
from enteric and systemic pathogens and tumor inducers. J Nutr 2002; 132:472-477.
238. Duggan C, Penny ME, Hibberd P, et al. Oligofructose-supplemented infant cereal:
2 randomized, blinded, community-based trials in Peruvian infants. Am J Clin Nutr 2003;
77:937-942.
239. Moshfegh AJ, Friday JE, Goldman JP, Chug Ahuja JK. Presence of inulin and oligofructose in
the diets of Americans. J Nutr 1999; 129:1407S-1411S.
240. van Loo J, Coussement P, De Leenheer L, Hoebregs H, Smits G. On the presence of inulin and
oligofructose as natural ingredients in the Western diet. Crit Rev Food Sci Nutr 1995;
35:525-552.
241. Smith PB. Safety of short-chain fructo-oligosaccharides and GRAS affirmation by the
U.S.FDA. Biosci Microflora 2002; 21:27-29.
242. Deguchi Y, Matsumoto K, Ito A, Watanuki M. Effects of 3 1-4 galacto-oligosaccharides
administration on defaecation of healthy volunteers with a tendency to constipation. Jap J
Nutr 1997;55:13-22.
243. Saavedra JM, Tschernia A. Human studies with probiotics and prebiotics: clinical
implications. Br J Nutr 2002; 87:S241-S246.
244. Bovee-Oudenhoven IMJ, ten Bruggencate SJM, Lettink-Wissink MLG, van der Meer R.
Dietary fructo-oligosaccharides and lactulose inhibit intestinal colonization but stimulate
translocation of Salmonella in rats. Gut 2003; 52:1572-1578.
245. ten Bruggencate SJ, Bovee-Oudenhoven IM, Lettink-Wissink ML, van der Meer R. Dietary
fructo-oligosaccharides dose-dependently increase translocation of Salmonella in rats. J Nutr
2003; 133:2313-2318.
246. van Loo JA. Prebiotics promote good health: the basis, the potential, and the emerging
evidence. J Clin Gastroenterol 2004; 38:S70-S75.
247. Younes H, Coudray C, Bellanger J, Demigne C, Rayssiguier Y, Remesy C. Effects of two
fermentable carbohydrates (inulin and resistant starch) and their combination on calcium and
magnesium balance in rats. Br J Nutr 2001; 86:479-485.
17
Modifying the Gastrointestinal Microbiota
with Probiotics
Chandraprakash D. Khedkar
Department of Dairy Microbiology and Biotechnology (Maharashtra Animal
and Fishery Sciences University Nagpur), College of Dairy Technology
Warud (Pusad), India
Arthur C. Ouwehand
Danisco Innovation, Kantvik, and Functional Foods Forum, University
of Turku, Turku, Finland
INTRODUCTION
The origin of fermentations involving the production of lactic acid are lost in the ancient
times, but it is not difficult to imagine how nomadic communities gradually acquired the
art of preserving their meager supplies of milk by storing them in animal skins or crude
earthenware pots. Initially, the intention could well have been simply to keep the milk cool
through the evaporation of whey from the porous surface, but the chance transformation of
the raw milk into a refreshing, slightly viscous foodstuff would soon have been recognized
as a desirable innovation resulting in yogurt-like products.
At the beginning of last century, Eli Metchnikoff proposed the, now classic, theory
that the apparent longevity of Bulgarian tribesmen was a direct result of their lifelong
consumption of yogurt-like fermented milk products, probably mostly fermented by
lactobacilli (1). This inspired an interest in the nutritional and therapeutic characteristics of
these products. The validity of these hypotheses was debated for many years but one
undeniable effect of his work was a marked increase in the popularity of yogurt throughout
Europe. At about the same time, Henri Tissier suggested that bifidobacteria could be
administered to children with diarrhea to help restore their gut microbiota balance (2).
Fermented milk products like yogurt and other products containing beneficial or
"probiotic" cultures, such as lactobacilli, bifidobacteria, lactococci, and propionibacteria
are currently among the best-known examples of functional foods in many countries
around the world. These products are associated with a range of health claims, some more
documented then others, including alleviation of symptoms of lactose intolerance (3),
treatment of diarrhea (4), cancer risk reduction (5) and restoration of gastrointestinal (6)
and urogenital microbiota (7), and constipation (8). Milk is an ideal food system to act as a
carrier of these versatile bacteria to the human gastrointestinal tract (GIT) and support
315
316
Khedkar and Ouwehand
their viability. From these beginnings, the probiotic concept has progressed considerably
and is now the focus of much research attention worldwide. Significant advances have
been made in the selection and characterization of specific cultures and substantiation of
health claims relating to their consumption. Subsequently, the area of probiotics has
advanced from anecdotal reports, with scientific evidence now accumulating to back up
health claim properties of specific strains. Nowadays the majority of scientific and
commercial attention is concentrated on probiotic microorganisms like Lactobacillus and
Bifidobacterium, with the result that an expanding range of probiotic dairy products
containing these species are now available to the consumer.
This paper will critically examine the health claims and evidence for beneficial
effects of probiotic organisms in relation to modifying the gastrointestinal microflora and
its functioning.
PROBIOTICS
Definition
The term probiotic is derived from Greek, meaning "for life" and originated to describe
substances produced by one microorganism which stimulate the growth of others (9). The
Food and Agriculture Organization of the United Nations (FAO) and the World Health
Organization (WHO) have stated that there is adequate scientific evidence to indicate that
there is potential for probiotic foods to provide health benefits and that specific strains are
safe for human consumption (10). An expert panel commissioned by FAO and WHO
defined probiotics as "Live microorganisms which when administered in adequate
amounts confer a health benefit on the host." This definition will be used in the current
chapter instead of the term biotherapeutic agents (11) which is sometimes used as well to
indicate probiotics.
Probiotic Microorganisms
Lactobacillus and Bifidobacterium are the principal bacterial genera central to both
probiotic and prebiotic approaches to dietary modulation of the intestinal microflora. In
Table 1 Commonly Used Probiotic Microorganisms
Lacto-
Bifido-
coccus
Strepto-
Entero-
Lactobacillus
bacterium
lactis subsp
coccus
coccus
Saccharomyces
acidophilus, brevis,
adolescentis,
cremoris,
thermophilus
faecium
cerevisiae
delbruekii,
animalis/
lactis
(boulardii)
fermentum, gasseri,
lactis?
johnsonii, lactis,
bifidum, breve,
paracasei,
infantis, lactis,
plantarum, rham-
longum,
nosus, reuteri
thermophilum
a The current taxonomic status of B. animalis and B. lactis is unclear.
b Saccharomyces boulardii is likely to be identical to Saccharomyces cerevisiae.
Source: From Refs. 12-16.
Modifying the Gastrointestinal Microbiota with Probiotics 317
addition, there are many different microorganisms currently used as probiotics. A list of
microbes commonly used as probiotics is given in Table 1. Some of these organisms have
been studied much more extensively than others. It is therefore important that probiotics
are referred to by their strain designation as well as their species. Although other members
of the same species share most characteristics, different probiotic strains may differ in
some essential properties (17).
Desirable Characteristics of Probiotic Microorganisms
Many desirable characteristics have been proposed by various researchers for probiotic
lactobacilli and bifidobacteria (and other microbes) to be used as dietary adjuncts for
gastrointestinal and related health benefits. These organisms should have the ability to
survive in sufficient numbers, the acidity of the gastric juices and to pass in a viable state to
the small intestinal region (18-23). Ability of these organisms to proliferate and/or
colonize the gut is also an important desirable, although appears not so common, property.
In practice the desired properties of these microorganisms are dependent on the host for
which probiotic administration is intended, the anatomical site within the host toward
which the probiotic is directed (most often the GIT) and the desired effect at that site are
the principal focus of probiotic applications (19,21,23).
A general set of desirable properties of probiotic microorganisms, regardless of the
intended host or site of application is presented in Table 2. In vitro tests based on these
selection criteria, although not a definite means of strain selection, may provide useful initial
information. In addition, well-characterized, and validated model systems such as the TNO
Intestinal Models (TIM-I and II) and the Simulator of the Human Intestinal Microbial
Ecosystem (SHIME), which aim to mimic complex physiological and physicochemical
in vivo reactions, may also be of value in strain selection (for a description of
intestinal models, see the chapter by Makivuokko and Nurminen). Several tests for gastric
passage and gastric digestion of the candidature organisms, as well as pH resistance and
ability to pass through the stomach are presented in Table 3. Such types of tests are less
expensive than human or animal trials and do not have the associated ethical drawbacks
(29). However, ultimate proof of probiotic effects requires validation in well-designed,
randomized, double-blind, placebo controlled, statistically sound clinical trials (30).
Administration of a large number of these organisms will increase the number of
surviving microbes, but various strains of these organisms may differ in acid tolerance and
survival. However, as the transit time of fermented milk products through the stomach is
shorter than many other foods (31), and fermented dairy products provide a buffer towards
gastric juice (32), this has been shown to lead to the appearance in high numbers of the
administered strains in the feces (33).
PROPOSED HEALTH BENEFITS OF PROBIOTICS
The health benefits of probiotics can be direct or indirect through modulation of the
composition and/or activity of the endogenous microbiota or of the immune system. Many
health claims have been made concerning probiotics, especially concerning their potential
to prevent or help cure gastrointestinal and related ailments. These include improved lactose
digestion and other direct enzymatic effects, prevention, and curative treatment of
gastroenteritis, antibiotic-associated diarrhea, traveler's diarrhea, constipation, intestinal
318
Khedkar and Ouwehand
Table 2 Desirable Properties of Probiotics
Probiotic characteristics
Technological/Functional properties
Stability: bile salts and
gastric acidity
Adherence: ability to
adhere to the intestinal
mucosa
Transient colonization
Safety
Antagonism: against
pathogenic and putre-
factive organisms
Proven health effects
Stability: stability/viabil-
ity during processing
and storage
Technological suitability
Survival in human gastrointestinal tract
Immune cell modulation and competitive inhibition of the
pathogenic organisms
Growth and multiplication in the human gastrointestinal tract
Well-documented clinical safety, organism must be accurately
identified to strain level before recommending its use. It should
be non-toxic, non-pathogenic, non-allergenic, non-mutagenic,
non-carcinogenic and have no transferable antibiotic resistance
Prevention of pathogen colonization through competition for
nutrients and binding sites and through production of
antimicrobial substances
Clinically documented and validated therapeutic effects. Dose-
response data for minimum effective dosage of the probiotic
organism in different formulations
All of the aforementioned desirable characteristics should be
maintained during processing and storage of these products
organism should be genetically stable, no plasmid transfer
Culture should be suitable for production of acceptable quality
finished products with desirable viable counts
infections and to suppress colonization of the gut by pathogenic organisms colonized in gut,
irritable bowel syndrome (IBS) and various conditions of diarrhea, hypocholesterolaemea,
urogenital tract infection, atopic diseases, skin diseases, gastrointestinal well-being,
inflammatory bowel disease (IBD) and colon cancer (16,31,34,35).
Table 3 Experiments Demonstrating Resistance Tests for Survival of an Organism in the Upper
Digestive Tract for Selected Probiotic Strains
Resistance test method
Organisms tested
Reference
Gastric digestion in vivo (mixture
of HC1 + pepsin + rennet)
PH
Human gastric juices conditions of
the stomach: cultured milk
mixed with gastric juice (70:30)
Artificial gastric juices (at pH 3.0
incubation by 37°C)
Lb. acidophilus (survival)
Propionibacterium freudenreichii (survival
without loss of vitality)
Yogurt, buttermilk and sour milk cultures
(survival with different digestion times)
Bif. bifidum (4 strains) 2 hours at pH 2.4 and
6.5 (strong action at pH 2)
Lb. acidophilus (survival) yogurt and sour
milk cultures (addition of gastric juices
with pH 3.48-6.75, no bacteriocidal or
bacteriostatic effect observed)
Lb. acidophilus and Lb. plantarum survive
3 hours; Lb. bulgaricus less resistant,
survives only for 1 hour
(24)
(25)
(26)
(27)
(28)
Modifying the Gastrointestinal Microbiota with Probiotics 319
These microorganisms possess various immunological functions viz., mitogenic
activity (36), adjuvant activity (21), macrophage activation (37), enhancement of antibody
production (38), induction of interferon-y production (39) and antitumor effects (40),
amongst others. It has further been indicated by a number of studies that both the cell wall
and cytoplasm of specific probiotic bacteria induced mitogenic responses of spleen
cells (37,41,42).
Health benefits of probiotic organisms related that may impact on the gut microbiota
are summarized in the following paragraphs.
Use of Probiotics to Combat Gastrointestinal Infections
Probiotics have been shown to be useful in the treatment of a variety of gastrointestinal
disorders, and the details are presented in Table 4. A number of these disorders have a
significant inflammatory component in the small and/or large intestine and there is a
growing body of research to suggest that probiotic bacteria may be useful particularly in
many of these pediatric gastrointestinal conditions. Specific strains of Lactobacillus
rhamnosus, Lb. reuteri, Lb. plantarum, Bifidobacterium lactis, and Saccharomyces
cerevisiae (boulardii) have all been extensively studied. Probiotics can reduce the duration
and severity of rotaviral enteritis, as well as decrease the risk of antibiotic-associated
diarrhea in children and Clostridium difficile diarrhea in adults. Prevention of viral
diarrhea in day-care centers as well as traveler's diarrhea has been demonstrated with
some probiotics, although not all are equally effective (67). Small bowel bacterial
overgrowth conditions may respond to probiotic use. How the probiotic bacteria
counteract the inflammatory process by enhancing the degradation of external antigens,
reducing the secretion of inflammatory mediators and maintaining the healthy gut
microbiota by exclusion of pathogens is schematically shown in Figure 1 .
Possible Mode of Action of Probiotics in Reducing the Duration of Diarrhea
Several potential mechanisms have been proposed for how probiotics reduce the duration
of rotavirus diarrhea, but none have been proven and each theory has its limitations. The
first is competitive blockage of receptor sites (69) in which probiotics bind to receptors,
thereby preventing adhesion and invasion of the virus. This concept might be plausible if
there was evidence for specific receptor competition. In most cases, by the time a probiotic
is ingested, the patient will already have had diarrhea for possibly 12 hours. By this time,
the virus has infected mature enterocytes in the mid- and upper region of the small
intestinal villi. The virus and/or its entero toxin, NSP4, will then have disturbed fluid and
electrolyte transport, thereby lowering fluid and glucose absorption. The toxin could have
then potentially activated secretory reflexes, causing loss of fluids from secretory epithelia,
resulting in diarrhea (70). At best, subsequent competitive exclusion of viruses would only
be effective for attachment of progeny, and it is not known whether such inhibition would
reduce diarrhea. If probiotic organisms somehow competed with the toxin or peptides
released from villous endocrine cells, it is feasible that the cascade that leads to diarrhea
could be prevented.
The second potential mechanism may be that the immune response is enhanced by
probiotics, leading to the observed clinical effect (45). This is supported by the protective
effect which local immunoglobulin A (IgA) antibodies appear to confer against rotavirus
(71). However, a problem with this theory is given that diarrhea appears to cease within 1
to 3 days in patients who would otherwise suffer for 4 to 6 days; the probiotics would need
320
Khedkar and Ouwehand
Table 4 Examples of the Effects of Probiotics on Microbial Infections
Disorder
Subject
Probiotics
Effect
Reference
Infantile
Human
Lactobacillus
Reduced duration of
(43-47)
diarrhea
GG
diarrhea etc.
Human
Lb. reuteri
Reduced duration
of diarrhea
(49)
Human
Bif. Bifidum-\-
Str. thermo-
philus
Prevention of diarrhea
(23)
Human
Bif. breve
Prevention of diarrhea
(51)
Antibiotic-
Human
Bif. longum
Decreased course of erythromy-
(52)
associated
cin-induced diarrhea
diarrhea
Human
Lactobacillus
GG
Decreased course of erythromy-
cin-induced diarrhea, and other
side effects of erythromycin
(53)
Human
Str. faecium
Decreased diarrhea associated
with anti-tubercular drugs
administered for pulmonary TB
(54)
Human
Sc. boulardii
Reduce incidence of diarrhea
(55)
(56)
(56a)
Relapsing C.
Human
Lactobacillus
Improves/terminates colitis
(57)
difficile
GG
(58)
colitis
Human
Lactobacillus
Eradicated associated
(59)
GG
diarrhea
(60)
Travelers'
Human
Lb. acidophilus
Decrease frequency, not
(61)
diarrhea
-\-Bif. bifidum
duration of diarrhea
(61a)
Human
Lactobacillus
GG
(62)
Foodborne
Male
Lb. casei Shirota
Increased resistance to lethal
(62a)
pathogen
BALB/c
infection with Salmonella, E.
exclusion
Mice
coli, and L. monocytogenes
Male rat
Increased resistance to
salmonellosis infection
(63)
Mice
Bif. lactis HN019
Increased survival of
Salmonella infection
(49a)
Mice
Lb. rhamnosus
HN001
Increased survival of E. coli
0157:H7 infection
(50)
In vitro
Yogurt bacteria
Inhibit growth of Salmonella
(64,65)
Human
Lb. acidophilus
+ Lactobacil-
lus GG
Decreased shigellosis-associated
diarrhea
(66)
Abbreviations: Bif, Bifidobacterium; C, Clostridium; E, Escherichia; L, Listeria; Lb, Lactobacillus;
Sc, Saccharomyces; Str, Streptococcus.
to trigger the antibody response rapidly so that it interfered with further viral activity.
Animal studies do indicate that secretory IgA can be triggered by probiotic ingestion (72),
but the rate was not determined, nor was the influence on cessation of fluid loss across the
secretory cell membranes. Modification of the cytokine profile to one that enhances
Modifying the Gastrointestinal Microbiota with Probiotics
321
anti-inflammatory cytokines (73) or attenuation of the virus' and/or toxin's effect on the
enteric nervous system might provide rapid cessation of epithelial secretion and diarrhea.
Alternatively, stimulation of T cells to produce gamma interferon, leading to potential
inhibition of chloride secretion, might also inhibit diarrhea. One aspect of the immunity
theory that needs to be clarified is why lactobacilli, which we assume are present in the
child intestine, appear unable to prevent infection; yet those administered orally thereafter
help to clear the diarrhea.
A third mechanism could involve a signal(s) from probiotics to the host that down-
regulates the secretory and motility defenses designed to remove perceived noxious
substances. Glycosylated intestinal mucins inhibit rotaviruses (74), and MUC2 and MUC3
mRNA expression is increased in response to probiotics signaling, protecting cells against
pathogenic bacterial adhesion (13). However, direct host cell signaling between probiotic
organism and secretory cells has not yet been investigated. Attachment of the virus causes
cytokine prostaglandin and nitric oxide to be released from the enterocytes, both of which
could affect motility. The possibility exists that lactobacilli could alter this release (75).
The intestinal host defense mechanisms comprise complex systems involving the innate
and adaptive immune responses, and protective effects of the indigenous microbiota. The
commensal microorganisms colonizing the intestinal mucosa provide a barrier effect
against pathogens by using a variety of mechanisms, such as occupation of habitats,
competition for nutrients, and production of antimicrobials. It is also established that the
probiotic organisms can modulate the homeostasis of the host's defense mechanisms, both
innate and adaptive immune functions (4).
A final theory is that the probiotics produce substances that inactivate the viral
particles. This has been shown in vitro (76), with supernatants from Lactobacillus
rhamnosus GR-1 and L. fermentum RC-14 inactivating 10 9 particles of the double-stranded
DNA adenovirus and the negative-stranded RNA vesicular stomatitis virus within
10 minutes. The effect was likely due to acid, but more specific antiviral properties have
not been ruled out. Whether or not viral inactivation can inhibit diarrhea remains to
be confirmed.
Inflammation
Immune
reponse
Unbalanced
microbiota
Figure 1 Schematic representation of the possible ways by which probiotics may counteract ( => )
the intestinal inflammatory process. Source: From Ref. 68.
322 Khedkar and Ouwehand
More detailed investigation is needed to understand how probiotic strains reduce the
duration of diarrhea in conjunction with rehydration therapy. Such studies could lead to a
better understanding of the dynamics within the intestinal microbiota that is being
disrupted and depleted by rapid fecal loss. In doing so, new intervention therapies should
be generated to quickly and effectively trigger the cessation of not only rotavirus
infections but also other gastrointestinal infections that debilitate patients for 2 to 3 days.
The possible mode of action for diarrhea and other gastrointestinal diseases, such as
IBS and IBD, are the subject of intense investigation in many labs, using genomics,
knockout mice models, etc., (77,78).
MODIFYING INTESTINAL MICROBIOTA COMPOSITION
THROUGH INTAKE OF PROBIOTICS
In the human GIT, variability exists in bacterial numbers and composition between the
stomach, small intestine and colon. The total bacterial count in gastric contents is usually
below 10 3 per gram contents with numbers in the small intestine ranging from about 10 4 per
ml of contents to about 10-10 at the terminal ileum (79). In comparison to other regions of
the GIT, the human large intestine is a complex, heavily populated and diverse microbial
11 1
ecosystem. Bacterial numbers in the human large intestine are in the range of 10 -10 for
every gram of the gut contents (80). The colonic microbiota is capable of responding to
anatomical and physicochemical variations that are present. The right or proximal colon is
characterized by a relatively high substrate availability (due to dietary input), a pH of around
5.5-6.0 (from acids produced during microbial fermentation) and a more rapid transit than
the distal region. The left or distal area of colon has a lower concentration of available
substrate, in particular carbohydrates, the pH is approximately 6.5-7.0, and the flow of the
digesta is slower. The proximal region tends to be a more saccharolytic environment than
the distal gut, the latter having higher bacterial proteolysis. Several hundred different
species of bacteria are known to be present in the large intestine (see also the chapter by Ben
Amor and Vaughan). Gram-negative rods belonging to the Bacteroides fragilis group are
the numerically predominant culturable bacteria in the colon. The other main groups
consist of different (Gram-positive) rods and cocci, such as bifidobacteria, Clostridia,
peptococci, streptococci, eubacteria, lactobacilli, peptostreptococci, ruminococci, enter-
ococci, coliforms, methanogens, dissimilattory sulfate-reducing bacteria, and acetogens.
The microbiota includes saccharolytic organisms, proteolytic species and bacteria that can
metabolize gases. Despite the huge diversity of bacteria present in the large gut (estimated
over 1000 species), it is certain that the vast majority has hitherto not been identified or
cultured [(81), see also the chapter by Ben Amor and Vaughan].
Increasing Numbers of Beneficial Microbes
One of the properties thought to be important for the health benefits of consumed probiotic
organisms is their ability to adhere to the intestinal mucosa. As such they can resist
peristalsis and occupy a habitat at the expense of potentially harmful organisms. The
probiotic applications to the human gut are already widespread, and evidence is mounting
that these organisms have a beneficial effect on the host. It is now well established that the
probiotic organisms can transiently establish themselves in the GIT and inhibit the
Modifying the Gastrointestinal Microbiota with Probiotics
323
adhesion and growth of enteropathogens. Table 5 delineates the effect of feeding selected
probiotic preparations on the human gut microbiota.
Suppressing Numbers of Potentially Harmful Microbes
The artificial manipulation of the human intestinal microbiota by consumption of large
numbers of probiotic microorganisms may lead to the presence of large numbers of lactic
acid-producing microorganisms in the small intestine. Any available sugars will be quickly
fermented to various organic acids and/or ethanol. This leads to a change in the environment
where the production of various low-molecular toxic metabolites and antigenic
macromolecules by various intestinal, potentially pathogenic microbes and the effects of
endotoxins may be strongly reduced (Table 5). The intestinal growth of all other types of
nonintestinal pathogens is strongly inhibited by abundant probiotic fermentation in the
small intestine. Reduction of viral infectivity was attributed to ethanol or acid-mediated
denaturation of viral envelope proteins. In addition to organic acids, bacteriocins, such as
e.g., Lactacin F (88), and some unidentified compounds synthesized by probiotic organisms
Table 5 Effect of Feeding Selected Probiotic Preparations on Human Gut Microbiota
Type of probiotic organisms
Effect on gut microbiota
Reference
Lb. rhamnosus GG
Lb. rhamnosus GG
Lb. plantarum (VTTE-79098)
Lb. paracasei ssp. paracasei
(VTTE-94506)
Lb. paracasei ssp. paracasei
(VTTE-94510)
L. rhamnosus (VTTE-94510)
Bifidobacterium sp. (VTTE-
94508)
L. casei Shirota
Bif. bifidum
Lb. acidophilus-hBK}/3
Lb. acidophilus-LBKV3 suppli-
mented with Propionibacter-
ium freundenrichii ssp.
Shermanii
Bif. lactis HN019
Attachment of probiotic organism to CaCo-2
intestinal cell line and in vivo to human
colonic mucosa
Increased the number of fecal bifidobacteria and
lactobacilli
Concomitant decrease in Clostridia counts
Reduction in enterobacteriaceae counts of 4 log
cycles, Clostridia 1 log cycle, and slight
decreases in enterococci counts in a SHIME
reactor
Balancing of intestinal microbiota
Balancing of intestinal microbiota
Highly significant increases in fecal lactobacilli,
bifidobacteria, propionibacteria and lacto-
cocci counts and concomitant decreases in
coliforms, Clostridia, staphylococci and
enterococci in tribal kids of 2-5 years
Increases in vivo antimicrobial activity of the
microflora against putrefactive organisms in
the gut of tribal kids of 2-5 years
Increase in fecal lactobacilli and bifidobacteria
(82)
(83)
(82)
(84)
(84a)
(85)
(86)
(87)
Abbreviation'. SHIME, Simulator for Human Intestinal Microbiological Ecosystem.
324 Khedkar and Ouwehand
may confer an additional growth-inhibiting effect (89). However, it is still uncertain whether
such substances are produced in situ in the intestine and are effective.
MODIFYING THE MICROBIAL METABOLIC ACTIVITY
Due to its numbers and taxonomic diversity, the intestinal microbiota has an enormous
metabolic potential. The microbiota' s metabolic activity is comparable to that of the
liver, our metabolically most active organ. This metabolism has a pronounced influence
on the health and well being of the host, as described in more detail in the chapter by
Goldin. Probiotics have been shown to be able to change the metabolic activity of the
intestinal microbiota. In part, this may relate to a direct change in its composition, but it
may also relate to a change in metabolism of some members of the microbiota in
response to a shift in the intestinal environment. The main metabolic markers that are
potentially influenced by probiotics are the production of short chain fatty acids (SCFA)
and fecal enzyme activity.
Short Chain Fatty Acid Production
Principal end products of bacterial fermentation in the colon are SCFA, i.e., acetate,
propionate, and butyrate. Other fermentation products include ethanol, lactate, succinate,
formate, valerate, and caproate. Branched chain fatty acids such as isobutyrate, 2-methyl-
butyrate, and iso valerate may also be formed from the fermentation of amino acids.
Short Chain Fatty Acids
The production of SCFA by the intestinal microbiota serves to salvage energy from the
digesta that would otherwise be lost for the host (90). Butyrate provides an important
energy source for the intestinal epithelium. Propionate is metabolized in the liver where it
possibly serves as a precursor for gluconeogenesis. Acetate is mainly taken up by muscle
tissue but is also used by adipocytes for lipogenesis. Lactate is also metabolized by
muscle tissue. However, despite the fact that enterocytes only slowly absorb lactate, it is
usually found only at low concentrations in the digesta as it is used to a large extent by
members of the intestinal microbiota (91) and only accumulates in disease (92).
Probiotics and Short Chain Fatty Acids
Probiotics will, when they are metabolically active, produce organic acids in the intestine;
these will mainly be lactate and acetate. Furthermore, the metabolic activity will influence
the metabolism of other microbes present in the intestine, through competition for
nutrients and through the production of metabolites. It is, however, not really known to
what extent probiotics are metabolically active in the human intestine, in particular in the
colon, and whether probiotics produce antimicrobials such as bacteriocins in situ. Studies
in mice, colonized with a human microbiota, do however indicate metabolic activity (93).
Assessment of the data presented in Table 6 indicates that most probiotics tested do
not affect the composition of the fecal short chain fatty acid composition. This may be
explained by the lack of metabolic activity of the probiotics in the colon, but it is more
likely to reflect the efficient absorption of fatty acids by the colon (2). Therefore, to assess
the influence of probiotics, and for that matter also prebiotics, on the availability of SCFA,
Modifying the Gastrointestinal Microbiota with Probiotics
325
Table 6 Influence of Probiotics on Fecal Short Chain Fatty Acids (SCFA) and Fecal Enzyme
Activity in Humans, Selected References
Dose
SCFA
Fecal enzyme
Probiotic
(CFU/day)
Duration
Subjects
change
activity change
Reference
B. lactis
2.8X10 10
6 hours
Ileostomists
No change
—
(94)
Bb-12
S. cerevi-
lg
6 days
Healthy
No change
—
(95)
siae bou-
adults
lardii
S. cerevi-
lg
6 days
Patients
Increase
—
(95)
siae bou-
with total
lardii
enteral
nutrition
Yogurt +L
3X10 8 L.
6 months
Healthy
No change
—
(13)
acidophi-
acidophi-
adults
lus
lus
145+5.
3X10 7 B.
longum
longum
913
Kefir
Healthy
adults
Increase,
though not
different
from con-
trol (milk)
(96)
L. plan-
4 weeks
Healthy
No change
No change
(97)
tar um
adults
299v
L. casei
3X10 11
4 weeks
Healthy
Decrease
Decrease
(98)
Shirota
adults
L. rhamno-
1.6 X10 9
6 months
Healthy
No change
No change
(99)
sus
adults
HN019
L. casei
1.3X10 10
1 month
Healthy
No change
Decrease
(100)
DN-114
infants
001
L. gasseri
10 9 , 10 10 ,
41 days
Healthy
No change
Decrease/
(100a)
SBT2055
10 11
adults
no change
L. gasseri
2X10 10
11 days
Healthy
—
Decrease
(101)
ADH
elderly
Elderly
with
atrophic
gastritis
L. rhamno-
1.4X10 10
4 weeks
Healthy
—
No change
(86)
sus GG
adults
L. rhamno-
2X10 10
2 weeks
Healthy
—
Decrease
(102)
sus GG
elderly
L. rhamno-
1-2X10 10
2 weeks
Healthy
—
Decrease
(103)
sus GG
adults
L. rhamno-
4X10 10
4 weeks
Healthy
—
Decrease
(103a)
sus GG
adults
(Continued)
326
Khedkar and Ouwehand
Table 6 Influence of Probiotics on Fecal Short Chain Fatty Acids (SCFA) and Fecal Enzyme
Activity in Humans, Selected References (Continued)
Probiotic
Dose
(CFU/day) Duration Subjects
SCFA Fecal enzyme
change activity change Reference
L. rham
1-2X10 10
4 weeks
Healthy
nosus
L. rham
elderly
LC-705
nosus
P. freuden-
2-4X10 10
reichii JS
P. freu-
denrei-
chii
L. reuterii
7.2X10 8
4 weeks
Healthy
elderly
B. longum
1.3 X10 10
3-6 weeks
Healthy
adults
L. acido-
4X10 10
4 weeks
Healthy
philus
adults
NCFM
VSL#3
9X10 11
20 days
Irritable
(bifido-
bowel
bacteria
syn-
+ lacto-
drome
bacilli
patients
+ strep-
tococci)
Decrease
(104)
No change
(104)
Decrease
(105)
Decrease
(106)
Decrease/
(107)
increase
sampling should preferably take place in the proximal colon where substrates are more
abundant and the microbes more active.
Fecal Enzyme Activity
Fecal Enzymes
One of the detrimental effects the human intestinal microbiota may have on host health is
the production of tumor promoters, mutagens, and carcinogens from undigested dietary
substrates and endogenous residues. Bacterial enzymes involved in the formation of such
substances are (3-glucoronidase, azoreductase, nitroreductase, and nitrate reductase (108);
see also the chapters by Rafter and Rowland, and Goldin. A reduction in the activity of
these enzymes can be expected to lead to a reduced exposure to carcinogenic substances.
Animal models have suggested this also leads to a reduced incidence in colorectal
cancers (106). However, it is not clear if this also holds true for humans.
Probiotics and Fecal Enzyme Activity
Most of the probiotics (listed in Table 6) tend to induce a reduction in fecal enzyme
activity. This appears to be therefore one of the more general and reproducible properties
of probiotics. However, since fecal enzyme activity is not a definite biomarker for cancer
risk, one should be cautious when drawing conclusions and extrapolating from animal
Modifying the Gastrointestinal Microbiota with Probiotics 327
experiments to humans. As with SCFA production, the mechanism behind this is probably
competition for nutrients and production of inhibitory metabolites.
CONCLUSION
The area of modulation of gastrointestinal microbiota through intake of probiotics seems
to hold much promise for the prophylactic management and/or treatment of gut disorders,
as mediated by pathogens. The growing realization by consumers that our food profoundly
influences our health has fueled the introduction of food products with health claims such
as probiotics into the market. It seems that the use of probiotics in general clinical practice
is not far away, given that products such as VSL#3, containing a mixture of lactic acid
bacteria probiotics, are already being used. However, it is relevant to note that studies on
particular strains may not necessarily be extrapolated to all probiotic microorganisms.
Molecular tools will continue to be used to understand and manipulate probiotic bacteria
with a view to produce vaccines and new and improved products. The critical step in wider
application will be to make products available that are safe and clinically proven in a
specific formulation easily accessible to physicians and consumers. Systematically
randomized, double-blind and placebo-controlled studies including large numbers of
human volunteers are needed to advance the scientific knowledge of probiotics and
gastrointestinal microbiota. Technological advances like protective coating(s), micro-
encapsulation, or addition of prebiotic compounds that can serve as growth factors for
probiotic organisms will improve the survival of strains in the gut of consumers. It is
necessary to clearly understand the functionality of these organisms in the intestinal
ecosystem.
REFERENCES
1. Metchnikoff E. The Prolongation of Life. New York: G. Putnam's Sons, 1908.
2. Tissier H. Traitement des infections intestinales par la methode de la flore bacterienne de
l'intestin. Crit Rev Soc Biol 1906; 60:359-361.
3. Kim HS, Gilliland SE. Lactobacillus acidophilus as a dietary adjunct for milk to aid lactose
digestion in humans. J Dairy Sci 1983; 66:959-966.
4. van Niel CW, Freudtner C, Garrison MM. Christakis, D.A. Lactobacillus therapy for acute
infectious diarrhoea in children: a meta-analysis. Pediatrics 2002; 109:678-684.
5. Ohashi Y, Nakai S, Tsukamoto T, et al. Habitual intake of lactic acid bacteria and risk
reduction of bladder cancer. Urol Int 2002; 68:273-280.
6. Orrhage K, Sjostedt S, Nord CE. Effect of supplements with lactic acid bacteria and
oligofructose on the intestinal microflora during administration of cefpodoxime proxetil.
J Antimicrob Chemother 2000; 46:603-611.
7. Gardiner GE, Heinemann C, Bruce AW, Beuerman D, Reid G. Persistence of Lactobacillus
fermentrum RC-14 and Lactobacillus rhamnosus GR-1 but not L. rhamnosus GG in the
human vagina as demonstrated by randomly amplified polymorphic DNA. Clin Diag Lab
Immunol 2002; 9:92-96.
8. Marteau P, Cuillerier E, Meance S, et al. Bifidobacterium animalis strain DN-173 010
shortens the colonic transit time in healthy women: a double-blind, randomized, controlled
study. Aliment Pharmacol Ther 2002; 16:587-593.
9. Lilly DM, Stillwell RH. Therapeutic properties of substances produced by lactic acid
bacteria. Science 1965; 147:747-748.
10. Food and Agriculture Organization of United Nations and World Health Organization
2001. Regulatory and clinical aspects of dairy probiotics. Food and Agriculture
328 Khedkar and Ouwehand
Organization of United Nations and World Health Organization Expert Consultant Report.
Food and Agriculture Organization of United Nations and World Health Organization
Working Group Report (Online).
11. Food and Agriculture Organization of United Nations and World Health Organization
2002. Guidelines for the evaluation of probiotics in food. Food and Agriculture
Organization of United Nations and World Health Organization Working Group Report
(Online).
12. Dunne C, O'Mahony L, Murphy L. In vitro selection criteria for probiotic bacteria of
human originxorrelation with in vivo findings. Am J Clin Nutr 2001; 73:386S-392S.
13. Mack DR, Michail S, Wei S, McDougall L, Hollingsworth MA. Probiotics inhibit
enteropathogenic E. coli adherence in vitro by inducing intestinal mucin gene expression.
Am J Physiol 1999; 276:G941-G950.
14. Mattila-Sandholm T, Salminen S. Up-to-date on probiotics in Europe. Gastroenterol Intern
1998; 1:8-12.
15. Ventura M, Zink R. Rapid identification, differentiation, and proposed new taxonomic
classification of Bifidobacterium lactis. Appl Environ Microbiol 2002; 68:6429-6434.
16. Gardiner GE, Heinemann C, Baroja ML, et al. Oral administration of the probiotic
combination Lactobacillus rhamnosus GR-1 and L. fermentum RC-14 for human intestinal
applications. Int Dairy J 2002; 12:191-196.
17. Ouwehand AC, Vesterlund S. Health aspects of probiotics. IDrugs 2003; 6:573-580.
18. Collins JK, Thornton G, O' Sullivan G. Selection of probiotic strains for human
applications. Int Dairy J 1998; 8:487-490.
19. Gardiner GE, Ross RP, Kelly PM, Stanton C, Collins JK, Fitzgerald G. Microbiology of
therapeutic milks. In: Robinson RK, ed. Dairy Microbiology Handbook: The Microbiology
of Milk and Milk Products. New York: Wiley Interscience Publishers, 2002:431-468.
20. Havenaar R, Huis in't Veld JHJ. In: Wood BJB, ed. Lactic Acid Bacteria in Health and
Disease. London: Elsevier Applied Science Publishers, 1992:151-170.
21. Kohwi Y, Hashimoto Y, Tamura Z. Antitumor and immunological adjuvant effect of
Bifidobacterium adolescentis M 101-104. Biosci Biotech Biochem 1982; 57:2127-2132.
22. Lee YK, Salminen S. Probiotics in gastrointestinal disorders. Trends Food Sci Technol
1995; 6:241-245.
23. Saavedra JM, Bauman NA, Oung I, Perman JA, Yolken RH. Feeding of Bifidobacterium
bifidum and Streptococcus thermophilus to infants in hospital for prevention of diarrhoea
and shedding of rotavirus. Lancet 1994; 344:1046-1049.
24. Breslaw ES, Kleyn DH. Factors affecting growth of Bifidobacteria. Food Sci 1973;
38:1016-1021.
25. Mantere-Alhonen S. Fermented milks and human health. Meijeritieteellinen Aikakauskirja
1983;41:217-237.
26. Pattersson L, Graf W, Sewelin U. Symposium of the Swedish nutrition foundation. XV. In:
Hallgren Bo, ed. Nutrition and the Intestinal Flora. Stockholm, Sweden: Almquist &
Wiksell International, 1983.
27. Lindwall S, Fonden R. Fermented Milks and Health, FIL/IDF Doc. 1984; 179:21-33
28. Yakult Honsha Co. Ltd. 1971. The summary of Reports Yakult. Yakult Honsha Co. Ltd. 1-
1-19, Higshi Shinbashi, Minato-ku, Tokyo, Japan and Intestinal flora of microorganisms
and health. Prospectus.
29. Huis in't Veld JHJ, Shortt C. Gut flora and health- past, present and future. In: Leeds RA,
Rowland IR, eds. International Congress and Symposium Series No. 219. London: Royal
Society of Medicine Press, 1996:27-39.
30. Reid G, Jass J, Sebulsky MT, McCormick JK. Potential uses of probiotics in clinical
practice. Clin Microbiol Rev 2003; 16:658-672.
31. Fooks LJ, Gibson GR. Probiotics as modulators of the gut flora. Br J Nutr 2002;
88:S39-S49.
32. Conway PL, Gorbach SL, Goldin BR. Survival of lactic acid bacteria in the human stomach
and adhesion to intestinal cells. J Dairy Sci 1987; 70:1-12.
Modifying the Gastrointestinal Microbiota with Probiotics 329
33. Aim L, Leijenmark CE, Persson AK, Midtvedt T. The regulatory and protective role of the
normal microflora. In: WennerGren International Symposium Series. 1988;52: 293-297.
34. Mountzouris KC, McCartney AL, Gibson GR. Intestinal microflora of human and infants
and current trends for its nutritional modulation. Br J Nutr 2002; 87:405-420.
35. Salminen SJ, Gueimonde M, Isolauri E. Probiotics that modify disease risk. J Nutr 2005;
135:1294-1298.
36. Kado-oka Y, Fujiwara S, Hirota T. Effects of bifidobacteria cells on mitogenic response of
splenocytes and several functions of phagocytes. Milchwissenschaft 1991; 46:626-630.
37. Sekine K, Ohta J, Onishi M, et al. Analysis of antitumor properties of effector cells
stimulated with a cell wall preparation (WPG) of Bifidobacterium infantis. Biol Pharm Bull
1995; 18:148-152.
38. Yasui H, Nagaoka N, Mike A, Hayakawa K, Ohwaki M. Detection of Bifidobacterium
strains that induce large quantities of IgA. Microb Ecol Health Dis 1992; 5:155-162.
39. Kishi A, Uno K, Matsubara Y, Okuda C, Kishida T. Effect of the oral administration of
Lactobacillus brevis subsp. coagulans on interferon-a producing capacity in humans. J Am
Coll Nutr 1996; 15:408-412.
40. Sekine K, Kawashima T, Hashimoto Y. Comparison of the TNF-a levels induced by
human-derived Bifidobacterium longum and rat-derived Bifidobacterium animalis in mouse
peritoneal cells. Bifidobact Microflora 1994; 13:79-89.
41. Hosono A, Lee J, Ametani A, et al. Characterization of a water-soluble polysaccharide
fraction with immunopotentiating activity from Bifidobacterium adolescentis M 101-4.
Biosci Biotech Biochem 1997; 61:312-316.
42. Tone-Shimokawa Y, Toida T, Kawashima T. Isolation and structural analysis of
polysaccharide containing galactofuranose from the cell walls of Bifidobacterium infantis.
JBacteriol 1996; 178:317-320.
43. Isolauri E, Juntunen M, Rautanen T, Sillanaukee P, Koivula T. A human Lactobacillus
strain {Lactobacillus GG) promotes recovery from acute diarrhoea in children. Paediatrics
1991;88:90-97.
44. Isolauri E, Kaila M, Mykkanen H, Ling WH, Salminen S. Oral bacteriotherapy for
gastroenteritis. Digest Dis Sci 1994; 39:2595-2600.
45. Kalia M, Isolauri E, Soppi E, Virtanen E, Laine S, Arvilommi H. Enhancement of the
circulating antibody secreting cell response in human diarrhoea by human Lactobacillus
strain. Paed Res 1992; 32:141-144.
46. Majaama H, Isolauri E, Saxelin M, Vesikari T. Lactic acid bacteria in the treatment of acute
rotavirus gastroenteritis. J Paed Gastroenterol Nutr 1995; 20:333-339.
47. Raza S, Graham SM, Allen SJ, Sultana S, Cuevas L, Hart CA. Lactobacillus GG
promotes recovery form acute non-bloody diarrhoea in Pakistan. Pediatr Infect Dis J
1995; 14:107-111.
48. Salminen S, Ouwehand AG, Benno Y, Lee YK. Probiotics: how should they be defined?
Trends Food Sci Technol 1999; 10:107-110.
49. Shornikova AV, Casas I A, Isolauri E, Mykkanan H, Vesikari T. Lactobacillus re uteri as a
therapeutic agent in acute diarrhoea in young children. J Pediatr Gastroenterol Nutr 1997;
24:399-404.
49a. Shu Q, Hai L, Rutherfurd KJ, Fenwick SG, Gopal PK, Gill HS. Dietary Bifidobacterium
lactis (HN019) enhances resistance to oral Salmonella typhimurium in mice. Microbiol
Immunol 2000; 44:213-222.
50. Shu Q, Gill HS. Imune protection mediated by the probiotic Lactobacillus rhamnosus
HN001 (DR10™) against Escherichia coli 0157:H7 infection in mice. FEMS Immunol
Med Microbiol 2002; 34:59-64.
51. Hotta M, Sato SIN. Clinical effects of Bifidobacterium preparation on pediatric intractable
diarrhoea. Keio J Med 1987; 36:298-314.
52. Colombel JF, Corot A, Neut C, Romond C. Yogurt with Bifidobacterium longum reduces
erythromycin-induced gastro-intestinal effects. Lancet 1987; 2:43-44.
330 Khedkar and Ouwehand
53. Sittonen S, Vapaatalo H, Salminen S, et al. Effect of Lactobacillus GG yogurt in prevention
of antibiotic associated diarrhoea. Ann Med 1990; 22:57-59.
54. Borgia M, Sepe N, Brancato V, Borgia RA. A controlled clinical study on Streptococcus
faecium preparation for the prevention of side reactions during long-term antibiotic
therapy. Curr Therapeutic Res 1982; 31:265-271.
55. Surawicz CM, Elmer LW, Speelman P, McFarland LV, Chinn J, vanBelle G. Prevention of
antibiotic-associated diarrhoea by Saccharomyces boulardii: a prospective study.
Gastroenterology 1989; 96:981-988.
56. Macfarlane GT, Cummings JH. Probiotics and prebiotics: can regulating the activities of
intestinal bacteria benefit health. BMJ 1999; 318:999-1003.
56a. Elmer GW, Surawicz C, McFarland L. Biotherapeutic agents: a neglected modality for the
treatment and prevention of selected intestinal and vaginal infections. J. Am. Med. Asso.
1996; 275:870-876.
57. Gorbach SL, Chang TW, Goldin B. Successful treatment of relapsing Clostridium difficile
Colitis with Lactobacillus GG. Lancet 1987; 26:1519-1522.
58. Bartlett JG, Chang TW, Gurwith M. Antibiotic-associated pseudomembraneous colitis due
to toxin-producing Clostridia. N Engl J Med 1982; 57:141-145.
59. Bennet RG, Laughon B, Lindsay J. 1990. Lactobacillus GG treatment of Clostridium
difficile infection in nursing home patients. Abstract, 3rd International Conference on
Nosocomial Infections. Atlanta.
60. Biller JA, Katz AJ, Flores AF, Buie TM, Gorbach SL. Treatment of recurrent Clostridium
difficile colitis with Lactobacillus GG. J Pediatr Gastroenterol Nutr 1995; 21:224-226.
61. Black FT, Andersen PL, Orskov F, Gaarslev K, Laulund S. Prophylactic efficacy of
lactobacilli on traveller's diarrhoea. Travellers Med 1989; 8:1750-1753.
61a. Oksanen PJ, Salminen S, Saxelin M, Hamalmein P, Arja IV, Leena MI, Seppo N,
Oksanen T, Posti I, Salminen E, Siitonen S, Struckey H, Topilla A, Vapaatalo H.
Prevention of traveller's diarrhoea by Lactobacillus GG. Ann Med 1990; 22:53-56.
62. Hilton E, Kolakowski P, Smith M, Singer C. Efficacy of Lactobacillus GG as a diarrhoea
preventive measure. J Travellers Med 1996; 4:3-7.
62a. Nomoto K, Nagaoka M, Yokokura T, Mutai M. Augmentation of resistance of mice to
bacterial infection by a polysaccharide peptidoglycan complex (PSPG) extracted from
Lactobacillus casei. Biotherapy 1989; 1:169-171.
63. Hitchins AD, Wells P, McDonough FE, Wong NP. Amelioration of the adverse effect of
gastrointestinal challenge with Salmonella enteriditis on weaning rats by a yogurt diet. Am
J Clin Nutr 1986;41:91-100.
64. Bovee-Oudenhoven I, Termont D, Dekker R, Van der Meer R. Calcium in milk and
Fermentation by yogurt bacteria increase the resistance of rats to Salmonella infection. Gut
1996; 38:59-65.
65. Brassart D, Neeser JR, Michetti P, Sevin A. The selection of dairy bacterial strains with
probiotic properties based on their adhesion to human intestinal epithelial cells. Les
Bacteries Lactiques/Lact ic Acid Bacteria. Adria Normandie: Presses Unversitaires de Caen,
1995 pp. 201-202.
66. Sepp E, Tamm E, Torm S, Lutsar I, Mikelsaar M, Salminem S. Impact of a Lactobacillus
probiotics on the faecal microflora in children with shigellosis. Microecol Ther 1995;
23:74-80.
67. Majaama H, Isolauri E, Saxelin M, Vesikari T. Lactic acid bacteria in the treatment of acute
rotavirus gastroenteritis. J Pediatr Gastroenterol Nutr 1995; 20:333-338.
68. Isolauri E, Kirjavainen PV, Salminen S. Probiotics: a role in the treatment of intestinal
infection and inflammation? Gut 2002; 50:iii54-iii59.
69. Bernet MF, Brassart D, Neeser JR, Servin AL. Lactobacillus acidophilus LA 1 binds to
cultured human intestinal cell lines and inhibits cell attachment and cell invasion by
enterovirulent bacteria. Gut 1994; 35:483-489.
70. Lundgren O, Svensson L. Pathogenesis of rotavirus diarrhea. Microbes Infect 2001;
3:1145-1156.
Modifying the Gastrointestinal Microbiota with Probiotics 331
7 1 . Ward LA, Rosen BI, Yuan L, Saito LJ. Pathogenesis of an attenuated and a virulent strain of
group A human rotavirus in neonatal gnotobiotic pigs. J Gen Virol 1996; 77:1431-1441.
72. Reid G, Charbonneau D, Gonzalez S, Gardiner G, Erb J, Bruce AW. Ability of
Lactobacillus GR-1 and RC-14 to stimulate host defences and reduce gut translocation and
infectivity of Salmonella typhlmurium. Nutraceut Food 2002; 7:168-173.
73. Christensen HR, Frokiaer H, Pestka JJ. Lactobacilli differentially modulate expression of
cytokines and maturation surface markers in murine dendritic cells. J Immunol 2002;
168:171-178.
74. Yolken RH, Ojeh C, Khatri IA, Sajjan U, Forstner JF. Intestinal mucins inhibit rotavirus
replication in an oligosaccharide-dependent manner. J Infect Dis 1994; 169:1002-1006.
75. Xu J, Verstraete W. Evaluation of nitric oxide production by lactobacilli. Appl Microbiol
Biotechnol 2001; 56:504-507.
76. Cadieux P, Burton J, Gardiner G, et al. Lactobacillus strains and vaginal ecology. JAMA
2002;287:1940-1941.
77. Rachmilewitz D, Katakura K, Karmeli F, et al. Toll-like receptor 9 signaling mediates the
anti-inflammatory effects of probiotics in murine experimental colitis. Gastroenterology
2004; 126:520-528.
78. Mohamadzadeh M, Olson S, Kalina WV, et al. Lactobacilli activate human dendritic cells that
skew T cells toward T helper 1 polarization. Proc Natl Acad Sci USA 2005; 102:2880-2885.
79. Gorbach SL, Nahas L, Lerner PI. Studies on intestinal microflora I: Effects of diet, age and
periodic sampling on numbers of faecal microorganisms in man. Gastroenterology 1967;
53:845-855.
80. Cummings JH, Macfarlane GT. A review: the control and consequences of bacterial
fermentation in the human colon. J Appl Bacteriol 1991; 70:443-459.
81. Blaut M, Collins MD, Welling GW, Dore J, van Loo J, de Vos W. Molecular biological
methods for studying the gut microbiota: the EU human gut flora project. Br J Nutr May
2002;87:S203-S211.
82. Alander M, De Smet I, Nollet L, Verstraete W, Mattila-Sandholm T. The effect of probiotic
strains on the microbiota of the simulator of the human intestinal microbial ecosystem
(SHIME). Int J Food Microbiol 1999; 46:71-79.
83. Benno Y, Hosono M, Hashimoto H, Kojima T, Yamazaki K, lino H. Effects of
Lactobacillus GG yoghurt on human intestinal microecology in Japanese subjects. Nutr
Today 1996; 3L9S-12S.
84. Aso Y, Akazan H. Prophylactic effect of Lactobacillus casei preparation on the recurrence
of superficial bladder cancer. Urol Int 1992; 49:125-129.
84a. Marteau P, Flourie B, Pochart P. Effect of chronic ingestion of a fermented dairy product
containing lactobacillus and Bifidobacterium bifidum on metabolic activities of the colonic
flora in humans. Am J Clin Nutr 1990; 52:685-688.
85. Khedkar CD, Patil MR, Gyananath G, et al. Studies on implantationability of a probiotic
culture of Lactobacillus acidophilus in gastrointestinal tract of tribal children. In
Proceedings of International Seminar and Workshop on Fermented Foods, health status
and social well-being, held at Anand(India) 2003:62-63.
86. Khedkar CD, Gyananath G, Patil MR, Bajad DN, Khojare AS, Sarode AR. 2006. Studies on
effect of feeding probiotic Lactobacillus supplemented with Propionibacterium culture on
gastrointestinal microflora of tribal children. Lait (In press).
87. Gopla PK, Prasad J, Gill HS. Effects of consumption of Bifidobacterium lactis DR10 and
galactooligosaccharides on the microecology of the gastrointestinal tract in human subjects.
Nutr Res 2001; 23:1313-1318.
88. Altermann E, Russell WM, Azcarate-Peril MA, et al. Complete genome sequence of the
probiotic lactic acid bacterium Lactobacillus acidophilus NCFM. Proc Natl Acad Sci USA
2005; 102:3906-3912.
89. Bongaerts GPA, Severijnen RSVM. The beneficial, antimicrobial effect of probiotics. Med
Hypotheses 2001; 56:174-177.
332 Khedkar and Ouwehand
90. Hooper LV, Midtvedt T, Gordon JI. How host-microbial interactions shape the nutrient
environment of the mammalian intestine. Annu Rev Nutr 2002; 22:283-307.
91. van Nuenen MHMC, Meyer PD, Venema K. The effect of various inulins and Clostridium
difficile on the metabolic activity of the human colonic microbiota in vitro. Microb Ecol
Health Dis 2003; 15:137-144.
92. Tsukahara T, Iwasaki Y, Nakayama K, Ushida K. Microscopic structure of the large
intestinal mucosa in piglets during an antibiotic associated diarrhea. J Vet Med Sci 2003;
65:301-306.
93. Oozeer R, Mater DD, Goupil-Feuillerat N, Corthier G. Initiation of protein synthesis by a
labeled derivative of the Lactobacillus casei DN-114 001 strain during transit from the
stomach to the cecum in mice harboring human microbiota. Appl Environ Microbiol 2004;
70:6992-6997.
94. Hove H, Nordgaard-andersen I, Brobech Mortensen P. Effect of lactic acid bacteria on the
intestinal production of lactate and short-chain fatty acids, and the absorption of lactose. Am
J Clin Nutr 1994; 59:74-79.
95. Girard-Pipau F, Pompei A, Schneider S, et al. Intestinal microflora, short chain and cellular
fatty acids, influence of a probiotic Saccharomyces boulardii. Microb Ecol Health Dis 2002;
14:220-227.
96. St-Onge M-P, Farnworth ER, Savard T, Chabot D, Mafu A, Jones PJH. Kefir consumption
does not alter plasma lipid levels or cholesterol fractional synthesis rates relatiev to milk in
hyperlipidemic men: a randomized controlled trial. BMC Complement. Altern Med 2002;
2:1-789.
97. Goossens D, Jonkers D, Russel M, Stobberingh E, van den Bogaard A, Stockbriigger R. The
effect of Lactobacillus plantarum 299v on the bacterial composition and metabolic activity
in faeces of healthy volunteers: a placebo-controlled study on the onset and duration of
effects. Aliment Pharmacol Ther 2003; 18:495-505.
98. Spanhaak S, Havenaar R, Schaafsma G. The effect of consumption of milk fermented by
Lactobacillus casei strain Shirota on the intestinal microflora and immune parameters in
humans. Eur J Clin Nutr 1998; 52:899-907.
99. Tannock GW, Munro K, Harmsen HJM, Welling GW, Smart J, Gopal PK. Analysis of the
fecal microflora of human subjects consuming a probiotic product containing Lactobacillus
rhamnosus DR20. Appl Environ Microbiol 2000; 66:2578-2588.
100. Guerin-Danan C, Chabanet C, Pedone C, et al. Milk fermented with yogurt cultures and
Lactobacillus casei compared with yogurt and gelled milk: influence on intestinal microflora
in healthy infants. Am J Clin Nutr 1998; 67:111-117.
100a. Fujiwara S, Seto Y, Kimura A, Hashiba H. Establishment of orally administered
Lactobacillus gasseri SBT 2055 SR in the gastrointestinal tract of humans and its influence
on intestinal microflora and metabolism. J Appl Microbiol 2001; 90:343-352.
101. Pedrosa MC, Golner BB, Goldin BR, Barakat S, Dallal GE, Russell RM. Survival of yoghurt-
containing organisms and Lactobacillus gasseri (ADH) and their effect on bacterial enzyme
activity in the gastrointestinal tract of healthy and hypochlorhydric elderly subjects. Am
J Clin Nutr 1995; 61:353-359.
102. Ling WH, Hanninen O, Mykkanen H, Heikura M, Salminen S, von Wright A. Colonization
and fecal enzyme activities after oral Lactobacillus GG administration in elderly nursing
home residents. Ann Nutr Metab 1992; 36:162-166.
103. Hosoda M, He F, Kojima T, Hashimoto H, lino H. Effects of fermented- milk with
Lactobacillus rhamnosus GG strain administration on defecation, putrefactive metabolites
and fecal microflora of healthy volunteers. J Nutr Food 1998; 1:1-9.
103a. Goldin BR, Gorbach SL, Saxelin M, Barakat S, Gualtieri L, Salminen S. Survival of
Lactobacillus species (strain GG) in human gastrointestinal tract. Dig Dis Sci 1992;
37:121-128.
104. Ouwehand AC, Lagstrom H, Suomalainen T, Salminen S. The effect of probiotics on
constipation, faecal azoreductase activity and faecal mucins. Ann Nutr Metab 2002;
46:159-162.
Modifying the Gastrointestinal Microbiota with Probiotics 333
105. Tomoda T, Nakano Y, Kageyama T. Effect of yogurt and yogurt supplemented with
Bifidobacterium and/or lactulose in healthy persons: a comparative study. Bifidobact.
Microflora 1991; 10:123-130.
106. Goldin BR, Gorbach SL. The relationship between diet and rat faecal bacterial enzymes
implicated in colon cancer. J Natl Cancer Inst 1976; 57:371-375.
107. Brigidi P, Vitali B, Swennen E, Bazzocchi G, Matteuzzi D. Effects of probiotic
administration upon the composition and enzymatic activity of human faecal microbiotia
in patients with irritable bowel syndrome or functional diarrhea. Res Microbiol 2001;
152:735-741.
108. Hughes R, Rowland IR. Metabolic activities of the gut microflora in relation to cancer.
Microb Ecol Health Dis 2000; 11:179-185.
18
Modifying the Intestinal Microbiota
with Antibiotics
Asa Sullivan and Carl Erik Nord
Department of Laboratory Medicine, Karolinska University Hospital, Karolinska
Instituted Stockholm, Sweden
INTRODUCTION
The human host and the microorganisms colonizing skin and mucous surfaces constitute
dynamic biological communities or ecosystems. The composition of the microbiota is
relatively stable but fluctuations occur intra-individually over time, and there are also large
inter-individual differences. The specific microbiota at each ecological habitat is referred to
as the normal microbiota. The numerically and the most diverse human normal microbiota
is found in the gastrointestinal tract, and some of the species are potential pathogens that
may cause disease under certain circumstances (1). One of the functions of the
gastrointestinal microbiota is to act as a barrier against overgrowth of such organisms
and also to prevent colonization of pathogenic bacteria from the environment. This
phenomenon is termed, "colonization resistance" (2). Treatment with antimicrobial agents
disturbs the ecological balance between the host and the normal microbiota and overgrowth
of yeasts and Clostridium difficile, or of intrinsically or acquired resistant microorganisms,
may occur. Horizontal spread of resistance genes by conjugation or transformation to other
microbial species can take place. The gastrointestinal normal microbiota plays an important
role in this development (3).
Orally administered antimicrobial drugs that are incompletely absorbed or excreted
via bile or transluminally, frequently give rise to a reduced colonization resistance. Other
factors of importance are the antimicrobial spectrum of the agents, the dose as well as the
pharmacokinetic properties of the agents. The outcome of antimicrobial treatment with
respect to disturbances in the intestinal microbiota may further vary between individuals.
Apart from different anatomical and physiological qualities of the host, the ability of some
microorganisms to produce substances that inactivate antimicrobial agents and binding of
agents to intestinal material renders the prediction of the effects difficult (4). However, the
335
336 Sullivan and Nord
ecological impact is of great importance in the clinical situation and guidance may be
acquired by knowledge of the results from studies on the ecological influence of
antimicrobial agents on the normal microbiota.
ANTIMICROBIAL AGENTS THAT INHIBIT THE SYNTHESIS
OF THE BACTERIAL CELL WALL— p-LACTAM ANTIBIOTICS
Penicillins
The effect of penicillins on the gastrointestinal microbiota is summarized in Table 1
Phenoxymethylpenicillin
Phenoxymethylpenicillin has been shown to induce minor variations in numbers of aerobic
and anaerobic gastrointestinal microorganisms in healthy adults (5,6) and in infants treated
for upper or lower respiratory tract infections or otitis media (7). Penicillin that reaches the
gastrointestinal tract is destroyed by beta-lactamase produced by the microorganisms.
Despite the low concentration of the agent in feces, generally under the detection level,
occasional new colonization with Gram-negative aerobic rods has been observed
during administration.
Ampicillin
Ampicillin has a broader antimicrobial spectrum than phenoxymethylpenicillin and is
active also against species of Gram-negative microorganisms. The effect on the normal
gastrointestinal microbiota is moderate with suppressed numbers of enterococci,
streptococci, corynebacteria and enterobacteria. Minor effects on anaerobic species
have also been observed in one study. Overgrowth of resistant aerobic Gram-negative rods
is common and occasionally also of Candida species (8-10). The disturbances are
increasing with increased doses.
Ampicillin/Sulbactam
The impact of ampicillin/sulbactam on the intestinal microbiota has been studied in
patients undergoing colorectal surgery (11,12). From an ecological point of view it should
be expected that it would be less favorable to combine ampicillin with a beta-lactamase
inhibitor like sulbactam since the antimicrobial spectrum increases. The effect in
particular on the aerobic microbiota has been shown to be mild while the number of
anaerobic microorganisms was suppressed. With higher doses, overgrowth of yeasts has
been observed and occasionally also overgrowth of Pseudomonas fluorescens.
Amoxicillin
Amoxicillin is an agent closely related to ampicillin and with a similar spectrum.
Amoxicillin is acid-stable and is therefore better adsorbed. Overgrowth and emergence
of amoxicillin-resistant enterobacteria have been the main outcome in studies on the
effects on the normal gastrointestinal microbiota both in patients (13,14,16,19), in healthy
Modifying the Intestinal Microbiota with Antibiotics
337
C3
O
O
c3
C
• — <
4-4
0)
pC
•4— >
C
o
CO
c
o
• i-H
e
Oh
o
■4— '
o
Oh
.Q
(0
i
C
c
o
U
o
ft
Ofl
&
>
o
CJ
C
-— *
. -H
CO
o
cj
C
u
CO)
ft
s
tq
c
o
4-4
CJ
c3
Oh
a
O
C
<4H
„ G ,0 bp
8.S 9«a
B s r
SI
•-■-A 3
u
O
ft
Q ^
■ --
4H
i
o
s-
e y
i
O **H
ft o
d
W
*— <
1
o
i
!-H
cd
c3
o
c3
X)
• i-H
■4—4
d
o
<
X>
fc
i
CJ
c3
• i-H
4— 1
Cj
ft
c
X>
QJ
W
O
4—4
CJ
cj
o
cj
<
+
a
<4-
CO
53
4-4
cj
B
d
d
Z
«4-4
o
1
d
d
o
CO
(T-4
s
• i-H
4-4
c3
CO
8 5
Q ?
d
<
io vo
r» OO On
(imi-ir)\Ohoooo\
t--
(N <N
io
s
e
s
a
T3 *T3
V V
CD CD CD
dec
. I
d ^h
vo
(N
cdcdcdcdcdcdcd
O c c c c
a V V
c c c
•: v
CD CD
c d
+ +
+ + I
+
+
+
+
+ +
+
+
+ + + + + + +
+
+
+
+
+
+
+ + + +
+
+
+ + + + + + + + + +
+ +
+
+
+
o o
ON o o
o o
(N
Tf 00 so o o o o
00 Q\ CN ^O VO
O l>
(N
X
o
o
o
CN
X
o
o
0O
^ t> «n
en
0D
B X i
o o
o o o
in n h
lO CN
cN"^-»ni>t^t^t>int^
o
o
o
m
m
X
o
o
o
o
o
IO CN
en
X
o
o
o
en
X
o
o
m
o
o
CN
X
o
o
o
o
o
o
en en en en en en
X X X X X X
o o o o o o
o o o o m >n
i
r^
en
r--
en
en
en
~o"b
E
o
CN
X
o
>n
CN
X
CN
o
c5
o
a c
*-H (- 1 '-H
Oh
C cd
• i-H 4— »
£-H O
.a £
Oh 3
C GO
OJiniOiOiOfNM^OOinm
CJ
c -d
-d d
?3 *
•l-H
X
c
^3 "o
O 03
<
338
Sullivan and Nord
^3
C3
43
a
C
•1-H
■4— »
CJ
-c
c
o
c
o
•I-H
c
a)
cj
c-
E
0)
.q
(0
H
o
>
O
o
CJ
c
in
a)
S c <u w)
§2 ^
Cj
o
o
a
. -H
CJ
S-H
O
CJ
C
o
00
S-H
a
s
c
o
-1—1
CJ
cd
a
6
£ CD
rt 'o
PQ °
I <3
CJ
CJ
-4—'
"3 °
O "H
C O
CD O
o
CJ
c
tq
o
CD X)
c3
o
ctf ctf
53
o
I
S-H
CJ
o 2
pq o
CJ
• i-H
o
<
CO
CS
T3
Q c*
53
CJ
O
o
CJ
+
a
c
o
£» S F>
Kl
CD ctf
S 5
c
o
00
<
CN CN CO Tt
(N (N (N (N
Tf io vo o r- 00 On
i-h CN (N h (N CN (N
O O — t CN
m co en en
CN
(N
CD CD CD CD CD
d dec d
V
CJ
d
CJ
d
CJ
d
„„
^.
CN
©
1
(N
i
CN
T3
I
CN
V
CD
aj
V
d
c
i-H
I
V V
+
+
+ + + +
+ + +
+
+ +
+ +
+ +
+ + + + +
+
+
+ + +
+ + + I
+ + + + + I +
Tf Tf VD
OO CN O O VO O O
_ ^h ^_ CN CN
o m >n o
m m t>
io r- en io °° cn °°
t> r^ r^ r>
*co X
X »n
io t> c5
co
X
CN
t> 00 iO O
CO ^ CN CN
00 "*
B X
00 o
M O
<o
VO
CO Tt CO
XXX
o o o
O O IT)
CO CO
X X
o o
o o
o o
o
o
©
i-h ^- r- cm m ^ Tt
c e
i i %
>
C C
CO
X
©
©
10
6
©
^t CO CN S
X X x s
© © © ©
© © © ©
vo Tf Tt m
CO
X
N
C3 C3
CJ
N ^
O
N
CD CD aj
Oh Oh
CLh H < Oh Oh
CJ
CJ
>
•1-H
Cm
CJ
CJ
a
CJ
•1-H
H
3
-2 'CJ
CJ CS
o
CJ
o
-t— *
o
O
y5
o
J2
O
c
cd
CJ
cC
• r.
CJ
CJ
,0
'-i-H
00
a
CJ
00
o
A
CJ
cd
a
00
§
+
+
• c
CJ
CJ
,0
00
a
CJ
00
1
CN
CJ
ir,
6
CJ
o
CD
CJ
b
CJ
,0
CJ
CJ
03
CJ fc-
C3 _CD
CM
X5
1 •
X
r-
Ci
d
cd
<3
* —
O
u.
'<!(
-4— >
:.
c3
o
c
_ x
Modifying the Intestinal Microbiota with Antibiotics 339
volunteers (10,15,17,18) and in infants (7). In patients, in contrast to in healthy persons,
amoxicillin has also a suppressive effect on the anaerobic microbiota (13,14,19).
Amoxicillin/ 'Clavulanic Acid
Administration of amoxicillin/clavulanic acid has been shown to induce increased
numbers of amoxocillin-resistant enterobacteria both in healthy adults (15,20-23) and in
child patients (24). In some of the mentioned studies, there were also disturbances in the
numbers of aerobic cocci, mainly observed as increased numbers of enterococci.
Bacampicillin, Pivampicillin, and Talampicillin
Bacampicillin, pivampicillin and talampicillin are esters of ampicillin that are better
absorbed than ampicillin, and thereby a more favorable ecological effect on the intestinal
microbiota is expected.
No major changes in the intestinal microbiota have been observed during long-term
treatment of patients with bacampicillin (14) or in connection with shorter administration
to healthy volunteers (25). However, the anaerobic microbiota was affected in some of the
subjects in the latter study. Subjects receiving bacampicillin in tablets had an undisturbed
intestinal microbiota in contrast to subjects receiving bacampicillin in syrup.
Pivampicillin and talampicillin have been shown to give rise to increased numbers
of enterobacteria in healthy volunteers (10,26) and increased numbers of Candida species
have been observed in a few subjects during administration with pivampicillin.
Azlocillin
The impact of azlocillin on the intestinal microbiota has been studied in connection with
treatment of patients suffering from skin and soft tissue infections (27). Suppressed
numbers of both aerobic and anaerobic species were observed and overgrowth of resistant
enterobacteria occurred in some patients.
Piperacillin and Piperacillin/Tazobactam
Piperazillin is excreted in bile leading to high fecal concentrations. Short-term
administration to patients undergoing colorectal surgery has resulted in marked effects
on both the aerobic and anaerobic intestinal microbiota (28). Addition of tazobactam to
piperazillin in treatment of patients reduced the ecological disturbances in the anaerobic
microbiota while the aerobic microbiota was still suppressed (29).
Pivmecillinam
Pivmecillinam has a spectrum including in particular Gram-negative aerobic rods and the
main impact during administration to healthy volunteers has been seen as reduced
numbers of gastrointestinal Escherichia coli (30,31). More pronounced changes have been
observed to occur at higher doses with decreasing numbers of anaerobic species like
lactobacilli and bacteroides and increasing numbers of enterococci (30).
340 Sullivan and Nord
Ticarcillin/Clavulanic Acid
The effect of ticarcillin/clavulanate on the gastrointestinal microbiota has been evaluated
in healthy subjects. Only minor disturbances were detected, such as decreased numbers of
enterobacteria and a concomitant increase of aerobic cocci (32).
Parenterally Administered Cephalosporins
The spectra of cephalosporins are broader than that of penicillins. Several cephalosporins
are excreted biliary and a strong ecological impact can be expected. Enterococci are
intrinsically resistant to cephalosporins and their numbers usually increase
during administration.
The impact of parenterally administered cephalosporins on the gastrointestinal
normal microbiota is summarized in Table 2.
Cefazolin
The impact of intravenously administered cefazolin on the gastrointestinal microbiota has
been studied in patients at an intensive care unit (33) and in patients undergoing
gastrectomy (34). Overgrowth of resistant Pseudomonas species was detected in the first
study while increasing numbers of enterococci, reduced numbers of streptococci and also
suppressed numbers of some anaerobic species were observed in the second study.
Cefbuperazone
Changes in the intestinal microbiota in connection with short-term administration of
cefbuperazone have been studied in patients undergoing colorectal surgery (35). The agent
suppressed the aerobic cocci, enterobacteria as well as the anaerobic microbiota.
Cefepime
A selective reduction of the numbers of E. coli has been observed during administration of
cefepime in healthy volunteers (36).
Cefmenoxime
Significantly decreased numbers of enterobacteria, bifidobacteria and lactobacilli have
been observed in connection with parenteral administration of cefmenoxime in healthy
subjects. Furthermore, there was a concomitant increase in numbers of Clostridia and
Candida species (37).
Cefoperazone
Cefoperazone is mainly excreted in bile giving rise to high fecal concentrations and
thereby major changes in the intestinal microbiota can be expected. The impact of
cefoperazone on the fecal microbiota has been evaluated in adult patients (38) and in sick
children (39,40). The Gram-negative aerobic rods as well as numbers of staphylococci and
streptococci were markedly suppressed in all studies. Overgrowth of resistant
enterobacteria, enterococci and Candida species were observed and anaerobic species
were also suppressed.
Modifying the Intestinal Microbiota with Antibiotics
341
c3
X>
o
u
c3
C
• 1-H
■*— >
si
-t—>
d
c
Cfl
c
•1-H
s
c
Oh
</J
15
*d
Oh
u
S-h
<— i
CO
<
13
'—
-(—I
d
*—
Cm
Dm
CM
n
CO
H
c
•—
OX)
s-
>
o
O
C
cd
-*— i
Gfl
• 1-H
1/3
S-
o
d
OX)
<d
w
d
c
■4— '
o
c3
Oh
o
d
•—
,o
'-4—
<D
Ch*
.2 -*
p "ob
d c
O OX)
S C
O o3
u '-
s
a
in M
<3" s
i 03
° 'C
P-J ^D
i
O • —
O o
d
PJ
6
i
o
S-i
c-3
c3
c3
C
•c
cd
■4-J
<
• i-H
i
c3
C
X
CD
PJ
o
■4-J
•1-H
o
•I-H
o
X)
c
o
o
•—
CD
<
+
<+H
c/l
u
CD
X)
o
CD
E
■§
GO
«H
i
o
•I-H
d
d
c
^ S 03
Q ^ §
CD 03
S 3
d
a)
OX)
<
m
en
tj- \r> ^o r- oo on o o ^h m r^ cn m
mm mm mm^^j-'sj-m m 'xj- ^t
d
CD oo
d d
CD 0)
d d
+
CD
d
+
d
+
+ +
+
+ +
+ +
io
OO O
oo «n
m -<t
r- r- m
m m ^t
0) a) ? ^ <ii ai
d d
3 A V
d d
+ +
+
0) <D I <D
d d d
D 0) I (D
d d d
+
+ +
d d d
+ + +
+ + +
+ +
+ + +
+
OO \D V~) \Q ^O
"> m
o) o) a) a) d
d d d d d
+
+
+
+
+ + + + +
+ +
+
+ + + + + + +
+ +
+
+
+
+
+
+
100*0
OO O OO OO N
>n
-H
'sl-
i-H
00
m
Tf-
f-» «
S
c3
i-H
m
(N
m
Th
r-'
-H
^h m
7
7
1
i-H
1
(N
1
7
-<t
r-
^i-
OO
f-
s
OX)
OX)
^
m
(N
CN
(N
^
^
OX)
s
00
^J-
O
(N
(N
X
X
X
X
OX)
s
OX)
s
X
1
O
O
m
X
X
X
00
OX)
O
O
OX)
O
(N
O
O O
1
M O
O
O
1
-^
O
O
O O
O
O
O
O
O
m
^0
C3
><
(N
1
i-H cS
s
•^H
^sO
^0
<N
\D
d
c3
(N
i
8 »
d d
c
■H
'o
53
Oh
QJ
E
c
J
5-H
QJ
E
03
C
• i-H
*-H
• i-H
tH
Oh
O
E
c
• i-H
• i-H
N
c3
O c3
N
D
C
O-
Oh
C
+-I
4— '
X
N
f-H
2 -2
f W
q8
O
•^
1
O
O
O
O
,0
O
,Q-
;-^ .p
t|H
N
M-H
H-H
«+H
N
«4-H
«HH
M-H
H-H
«4-H
«4-H
U-> m-
O
<D
(D
<D
<D
<D
<u
(D
"D
<D
<D
D <D
u
u
u
u
u
u
u
U
U
u
U
u u
73
s
R
G
342
Sullivan and Nord
c3
X)
o
o
o3
d
-4—4
X3
■4-J
C
O
C
S-<
o
Oh
C/3
J3
-d
a
u
73
o
cd
•4—4
C/3
E
<
•4—4
c
Oh
cd
C3
a
S
CM
.a
re
c
•—
'—
cd
>
cd
d
■*— i
Gfl
1/3
CD
s-
CD
CD
d
CD
OX)
u
CD
PJ
d
c
■4— 4
CD
c3
O
CD
CD
a
CD
CD
||
c c
S c
O o3
U '-
s
CD
q -O
c3 £
CQ
o
CD
03
5-
CD
"5 y
2 o
03
d o
o
X)
o
d
° d
(/3 -IH
c3
C
CD
CD
f 03 03
•S3 03 C
d xi <d
CD
CD
c
CD
CD I
X?
CO
d
c
&* s $
73
03 C/5
CD 03
d
CD
<
^O h 00 ON O ^ ^tOO
o
o
O
p
1
en
CD
73
CD
CD
CD
CD
CD
1
I
CN
d
V
c
d
d
d
d
d
d
+ d + + +
3 +
s +
+
o
CD
C
o
d
+
CD
d
d d
+ + oj + + ,
+ + c + + " l "
+ + +
+ +
CD
+ d + + +
+ + +
O (N 0\ (N
00 o o
>n uo o
c3
oo
+
O
o
o
(N
o
o
o
o
o
o
o
o
o
o
o
o
r3
CN
X
o
o
X X
o o
o o
o o
o
o
o
(N CN
CD CD
d x>
o
X
03
u
03 CD O
o x «2
03 03 72
Ph 2
o
c
d
c
o
• —
■<— '
CJ
D
4—>
CJ
73
Cu>
v.
CJ
OX)
c
CJ
4—1
c
cd
CJ
cd
. —
a
• —
O
(=
CJ
CJ
W)
a
CJ
O
60
O
A
CJ
r3
OX)
C
O
—
■<— •
y:
y:
CJ
CJ
0X)
CJ
O
bx)
o
•^t
r 1 ,
CJ
EQ
cd
CJ
'—
CJ
CJ
TD
•—
o
CJ
se
CJ
•—
CJ
c
CJ
CJ
CJ
■4— '
cd
73
8
CD M
1 s
a .2 .
^ w 73
«S 2 c
73 p .a
Modifying the Intestinal Microbiota with Antibiotics 343
Cefotaxime
Cefotaxime is excreted in bile to a lesser extent than cefoperazone and the effects on the
intestinal microbiota are usually more moderate. The numbers of enterobacteria are
suppressed and overgrowth of Pseudomonas species and occasionally of enterococci have
been observed (33,40,41).
Cefotiam
Cefotiam has been shown to decrease the numbers of intestinal enterobacteria and
lactobacilli and to increase the numbers of Pseudomonas and Candida species (37).
Cefoxitin
Pronounced changes in the gastrointestinal microbiota have been shown to occur after
cefoxitin prophylaxis of patients undergoing colorectal surgery (42) and in hospitalized
male patients (43). In both studies the major changes observed were decreased numbers of
enterobacteria and Gram-negative anaerobic species, while there was a proliferation
of resistant enterococci and enterobacteria. Growth of C difficile was found in 5 of 6
hospitalized patients (43).
Cefozopran
In patients receiving prophylactic antimicrobial treatment after gastrointestinal surgery,
cefozopran induced decreased numbers of enterobacteria, streptococci, Veillonella and
Lactobacillus species and overgrowth of enterococci (34).
Cefpirome
Administration of cefpirome to healthy male volunteers suppressed the numbers of E. coli
below the detection limit (44). No other major changes were observed.
Ceftazidime and Ceftizoxime
The impact of a single dose of ceftazidime or ceftizoxime on the intestinal microbiota has
been investigated in healthy volunteers (37). Ceftazidime significantly reduced the
numbers of enterobacteria and lactobacilli. The number of enterobacteria was suppressed
also by administration of ceftizoxime, and resistant enterobacteria like Citrobacter and
Proteus species proliferated.
Ceftriaxone and Ceftriaxone/Loracarbef
Ceftriaxone is, as well as cefoperazone, to a large extent excreted biliary and the agent
induced marked changes in the intestinal microbiota (40,45-49). Ceftriaxone has been
shown to give rise to elimination or strong suppression of the numbers of Gram-negative
aerobic rods, reduced numbers of streptococci and staphylococci and also to reduced
numbers of anaerobic microorganisms. Overgrowth of species resistant to ceftriaxone like
enterococci and Candida species is common.
The ecological effect of ceftriaxone has been compared with a step-down therapy of
ceftriaxone followed by loracarbef in patients with community-acquired pneumonia (49).
344 Sullivan and Nord
Both the aerobic and the anaerobic microbiota were affected in a similar way as with
ceftriaxone only, although the reduction of enterobacteria occurred to a lesser extent.
Flomoxef or Moxalactam
Changes in intestinal microbiota have been investigated after administration of flomoxef
to patients undergoing gastrectomy (34). The effect on the aerobic microbiota was mainly
detected as decreased numbers of streptococci and overgrowth of enterococci. Anaerobic
Gram-positive rods and cocci as well as Gram-negative cocci were suppressed.
In an earlier study, the effect of a single dose of moxalactam was compared with a
three-dose prophylaxis (50). In both groups of patients there was a reduction in the
numbers of enterobacteria and streptococci while enterococci proliferated. Several
anaerobic species decreased significantly in connection with the administration.
Perorally Administered Cephalosporins
Studies on the effects of perorally administered cephalosporins are summarized in Table 3.
Cefaclor
Alterations in the intestinal microbiota during administration of cefaclor have been studied
in patients (19) and in healthy volunteers (51,52). In the microbiota of patients there were
reduced numbers of both aerobic and anaerobic Gram-positive cocci. Enterococci,
enterobacteria and Bacteroides species increased and there were also increased numbers of
Candida albicans. In healthy subjects only minor changes occurred in the anaerobic
microbiota.
Cefadroxil
Reduced numbers of intestinal viridans streptococci have been observed during
administration of cefadroxil in adult healthy subjects (5). In infants being treated for
infections, disturbances were restricted to the anaerobic microbiota with reduced numbers
of bifidobacteria and bacteroides (7).
Cefetamet/Pivoxil
Cefetamet has a broad spectrum of activity against both aerobic Gram-positive and Gram-
negative microorganisms. The modification on the intestinal microbiota during treatment
of patients has, however, been shown to be slight and nonsignificant (53).
Cefexime
The ecological effects on the intestinal microbiota of cefixime have been investigated in
healthy volunteers (51,54) and in patients with exacerbation of chronic bronchitis (53).
In all three studies, disturbances were observed in the aerobic microbiota as reduced
numbers of enterobacteria and increased numbers of enterococci. Growth of C difficile
was common in all studies while the impact on the anaerobic microbiota varied between
the studies, from reduced numbers of Clostridia to reductions of several species
including bacteroides.
Modifying the Intestinal Microbiota with Antibiotics
345
cd
o
O
C
CO
CD
a
c
1/3
a
C
CO
o
13
a.
CD
u
-a
•—
CD
■«— >
CO
<
13
s-
c
•—
CD
cd
a*
CO
a>
n
CO
H
o
OD
CD
>
o
CD
O
a
c3
*— <
ex;
• i-H
CO
CD
CD
CD
a
CD
W
c
o
o
C3
Oh
CD
O
a
CD
»H
.D
<+H
<D
C*
<D
W)
1
c
§ &o
<D
2 ^
O
a
fi W)
o
U
.2 E
-t— <
o3
b
Q
^
•**i4
t3
S
Q
U
*}
*■■«*
••■■A
o
^
••-i 5
~^3
U
b? co
§3
£' s
i o3
ero
teri
a °
6 •«
Sh o
0) o
c °
i
c
o
'—
03 o3
CD
C
o 3
<
4=>
i
■4—'
O 03
5 ' c
c
pO CD
w
O **
•l-H
.a 8
4=) O
o o
U
CD _|_
«M
O M
1 =
j CO
fc
«+-
CO
c
a S
CO
•3 o
>^
§ -d
cd
Q
"2 2
03 -4— >
>^
03
CD T3
CO -««.
O W)
Q E
■fcj
c
CD
bfl
<
m
m t>
a a V V
a
+
+
+ I +
I +
+
+ I +
^O On o o
C«~) ^H i— <
>n
en
m en en cn =^
X X X X
o o o o
m io io o
CN CN (N lO CO
E
romH^o\Ti^hrHroooo\OminrH
ioioio>n^->nioio(Nm>nm^ocN^HVo
r^
00
00
CO
•A
V
CN O
On r-
<D cd" ^ CD CD
a c V V d d
+
«
(N
CO
CN
CN
CO
CO
1
i-H
1
T— 1
I
o
-i
QJ
CD
■A
CD
"A
CD
CD
CN
CD
V
C
a
V
a
V
a
C
O
C
+
+
+ + + + + + + I + +
I + +
+
+
+
+
+
+ + + + + + + + + I + +
+++++I++I+++
+
OOOO l OOOOOO'st-VOOOOOO^OOO l O
y— ( i—i t— I i-H i-H cN , — I 'sj" CN
oO'sj-i^r^r^ooocnoor^woi^r-r^^o
en
CN Tt
X X
o o
o o
CN CN CN CN
X X X X
o o o o
o o o o
o
o
Tfr CN CN
o
o
en cN cn cN CN
X X X X X
o o o o o
O m in m in
in Tt vo CN CN CN CN
CN
X
o
o
o
CN CN ^
X X §>
o o G
o o o
cn cn cn
CD
o
1
c^-H
CD
u
x
o
T3
CD
u
5^ ^
■4-J
,o
CD
u
CD
E
X
.$ ( CD
CD
u
x
o
C
CD
E
• —
x
o
Qj t ^— l t|— < C<_(
CD CD CD
u u u
CD N
X O
O t -
CD
u
c
CD
9
CD
X
cd
2^ «w
C (D
-5 03
CD O
C
C
c
c
c
— '
o
— '
0)
(U
'V.
h
c
o
— '
c
o
cn
'S
is:
C
c
4h
a
o
O
two
o
A
— -
o
a.
C
c
— <
+
+
u
o
4h
00
o
O
two
o
t
0)
0)
•—
o
<D
u_
C
0)
Cfl
cd
0)
•—
a
c
o
— '
CD
T3
. O
c e
O O
•a w
' ' — —
c 5
4H
o
•2 <u
346 Sullivan and Nord
Cefpodoxime Proxetil
A marked decrease in numbers of aerobic intestinal microorganisms with disappearance of
E. coli has been seen during administration of cefpodoxime proxetil in healthy volunteers
(18,55). The anaerobic microbiota was also affected and after treatment overgrowth of
enterococci, Candida and C. difficile occurred.
Cefprozil
The ecological impact of cefprozil was determined in a double-blind placebo-controlled
study (56). Analysis of the fecal microbiota revealed mainly a moderate decrease in
enterobacteria and a few subjects became colonized with C. difficile.
Ceftibuten
Ceftibuten administration has been shown to partly affect the aerobic intestinal microbiota
(57). The numbers of E. coli was significantly reduced while there was an overgrowth of
enterococci. Four subjects became colonized with yeasts, mainly C. albicans. The
anaerobic microbiota was disturbed to a lesser degree. However, six volunteers were
colonized by C. difficile.
Cefuroxime/Axetil
The effect of cefuroxime/axetil on the gastrointestinal microbiota has been evaluated in
patients (53) and in healthy subjects (21,53,58-60). Ecological disturbances have mainly
been observed as decreased numbers of enterobacteria, overgrowth of enterococci and in
varied changes in the anaerobic microbiota. In several studies, colonization with Candida
species and C. difficile has been observed. Fecal concentrations of cefuroxime/axetil, when
measured, have generally been rather low. In one study though, four subjects had very high
amounts of the agent in feces and thereby also more pronounced disturbances in the
microbiota (60).
Cephradine
Elimination of staphylococci has been shown to be the major significant change in the
microbiota occurring during administration of cephradine in healthy volunteers (23).
Loracarbef
No major ecological disturbances in the intestinal microbiota have been detected in
connection with administration of loracarbef as treatment for acute bronchitis (16) or
in healthy volunteers (61). In patients, new aerobic Gram-negative species were detected
during the investigation period. However, all strains were susceptible to loracarbef.
Loracarbef therapy caused increasing levels of enterococci in infants but had no significant
effect on the anaerobic microbiota (7).
Monobactams
The ecological impact of monobactams on the gastrointestinal microbiota is shown in
Table 4.
Modifying the Intestinal Microbiota with Antibiotics
347
C3
X
O
S-H
CJ
c3
C
• — <
03
X
<— >
d
o
CJ
• i-H
Oh
03
Q-
O
cj
5
d
a
c
cu
03
03
u
I
03
cj
03
X)
o
c
o
<4H
o
cj
a,
a
(0
o
H
03
>
o
CJ
c
03
■*— i
. -H
03
O
c
03
01)
§3
PJ
c
o
+— I
cj
a
Oh
a
CJ
CJ
d
CJ
S-H
.13
«H-H
CJ
C*
03
OX)
d
c3
01)
03
U
^
C
d
01)
o
_o
a
U
'-4— >
c3
'—
•*— *
s
*3
••"■a
* ""mi-
u
i
S-H
C/3
03
-<— '
o
03
73
c3
i
• i-H
o
03
c
■—
i)
■*— >
d
ffl
• i-H
S-H
CJ
■4-J
CJ
03
i
o
• ^H
Jh
o
0)
CJ
■4— '
d
ffl
o
CJ
6
i
o
S-H
cd
03
03
c3
C
X
O
•I-H
CJ
<
S-l
i
CJ
03
• i-H
*-l
C3
S-H
c
X
CJ
W
o
4-J
• ^H
O
CJ
CJ
X)
O
O
CJ
•—
03
<
+
a
<4-
c
C/J
s-
03
CJ
03
E
3
X?
C/3
Z
<H-H
o
i
"3
c
O
CZ3
>>
s
• i-H
03
03
a
c3
S-H
-<— '
C/3
0)
03
Bfl
T3
c
Q
*5b
a
— -
c
CJ
OD
<
(N cn cn tj- tj- tj- in
\o \o ^ ^ ^o \o ^o
m
X)
t^ OO O O C7\ On On
^O no O t> in VO \Q
CJ
d
o
o
^t
o
O
<n
CN
1
A
i
o
1
o
I
^
>
1
i
T3
1
T3
i
73
1
d
V
V
V
V
d
I
d
V
CJ
d
V
o
ra
o
O
o
O
r^
o
O
oo
O
On
oo
00
^f
i-H
1-H
T-H
•
A
|
o
V
A
13
l
in
(N
1
1
d'
T3
i— i
in
T3
TD
+
+ +
+ + + + +
+ I
+ +
+
+ +
+ + + +
+ + ^ + + ^ '
+ +
+
+ + +
I + + I
+ +
+++++++
On On O O O O O
O \D X> O O X> O
X
(N
On On (N in in in (N
I I
CN
m
CN
o t>
CN CN
\D
**
X
^t
-<t
<n cn
m
X
o
X
o
X X
X
cn
X
cn
X
cn
o
^ o
o o
o
X
o o
■
o
■ —
o
o o
o
o
o
O h
o
in
o
in
o o
o
o
o
o
o
o
o
CN ^h
1 '
in
1— <
CN
i-H
in
m
6
c3
S d
d
cj -j--
o
d C<3
CJ
CJ 03
^H
Oh^:
-t— »
N
<
| °
cn cn ^j- Tf Tt cN cN
X X X X X X X
o o m in m o o
O O CN CN CN O O
in in ' — i '-h i— < cn "— i
2a 8 £
a Oh o
* c S
CJ 03
CJ
2 j >
.s
Oh
o
CJ
"53
H
c
c
1)
d
c
•—
t3
CJ
CJ
73
CJ
CJ
4-
CJ
CJ
c
• ■--
c
c
CJ
CJ
4h
00
CJ
O
M
O
—
A
— i
6
0X)
c
c
d
+
+
CJ
0X)
CJ
O
r—
OX)
o
CJ
-r.
%
•8
5
CJ
09
CJ
CJ
CJ
CJ
CJ
— <
b
C
s
c
o
•rt o
s ^
•> 2
Q S
"2 +
03
•S cj
c > a
C3 "^3 CJ
348 Sullivan and Nord
Aztreonam
The effects of aztreonam on the intestinal microbiota have been studied in patient groups
(62,63) and in healthy volunteers (64). The dominating effects of aztreonam on aerobic
species have been observed as a marked decrease in numbers of enterobacteria.
Emergence of aztreonam-resistant enterococci and reduced numbers of anaerobic
microbiota occurred in connection with higher dosing (64).
Carbapenems
The effect of carbapenems on the fecal normal microbiota is shown in Table 4.
Imipenem
The effects of parenteral imipenem/cilastin therapy have been evaluated after prophylactic
treatment of patients undergoing colorectal surgery (65) and in hospitalized patients with
serious infections (66). In the first study, aerobic Gram-positive cocci, enterobacteria as
well as several anaerobic species were significantly suppressed. The major effect in the
latter study was observed as decreased numbers of enterobacteria.
Meropenem
The gastrointestinal microbiota has been studied in connection with administration of
meropenem to healthy male volunteers (67). No measurable concentrations of meropenem
were found in feces but disturbances were seen both in the aerobic and anaerobic
microbiota. The numbers of streptococci and enterobacteria decreased while enterococci
increased. Clostridia, Gram-negative anaerobic cocci and Bacteroides species were
also suppressed.
Lenapenem
In a study where lenapenem was given to healthy male volunteers (68), the antimicrobial
agent did not influence the total numbers of aerobic or anaerobic bacteria but streptococci
and Veillonella species were suppressed in numbers.
OTHER AGENTS WITH INHIBITORY EFFECT ON THE SYNTHESIS
OF THE CELL WALL— GLYCOPEPTIDES
Glycopeptides are poorly absorbed and reach very high fecal concentrations and major
disturbances are expected in the gastrointestinal microbiota.
A summary of the ecological impact of glycopeptides on the intestinal microbiota is
shown in Table 4.
Vancomycin
Perorally administered vancomycin has been given to healthy subjects and the effects on
the intestinal microbiota have been analyzed (59,69,70). In the aerobic microbiota the total
numbers of enterococci and staphylococci have been seen to decrease while resistant
Modifying the Intestinal Microbiota with Antibiotics 349
Gram-negative rods and enterococci emerged. Dramatic increase of other naturally
resistant species like pediococci and lactobacilli has also been observed. Suppressed
numbers of bacteroides and Bifidobacterium species were seen in two of the studies
(59,70).
Teicoplanin
The ecological impact of teicoplanin has been evaluated in two dosing regimes in healthy
volunteers (69). Highly glycopeptide-resistant Pediococcus species, enterococci and
lactobacilli increased during the administration. After the high-dose regimen treatment the
numbers of staphylococci decreased while enterobacteria increased.
ANTIMICROBIAL AGENTS INTERFERING WITH THE SYNTHESIS
OF PROTEINS
The impact of macrolides, azalide, ketolide, lincosamide and streptogramin on the
gastrointestinal microbiota is shown in Table 5 and the impact of tetracyclines,
aminoglycosides, nitrofurantoin and oxazolidone in Table 6.
Macrolides
Clarithromycin
The ecological impact of clarithromycin on the gastrointestinal microbiota has been
investigated in several studies on healthy volunteers (71-74). In the aerobic microbiota the
numbers of E. coli have been observed to decrease significantly while there has been a
concomitant overgrowth of other aerobic Gram-negative species. The degree of the
disturbances in numbers of enterobacteria has varied depending on the dosing regimen. In
the study where the lowest dose was applied, there was a suppression also of the number of
streptococci (74). In the anaerobic microbiota decreased numbers have been detected
mainly of bifidobacteria, lactobacilli, Clostridia and Bacteroides species.
Dirithromycin
The influence of dirithromycin on the normal human intestinal microbiota has been
evaluated in healthy persons (75). The major route of elimination of the agent is fecal, and
high fecal concentrations were demonstrated with apparent disturbances in both the
aerobic and anaerobic microbiota. The numbers of E. coli decreased, streptococci and
staphylococci increased and there was overgrowth of dirithromycin-resistant enterobac-
teria. Anaerobic Gram-positive cocci, bifidobacteria, eubacteria and Bacteroides
decreased while Clostridia and lactobacilli increased during the treatment period.
Erythromycin
Marked disturbances have been observed in the intestinal microbiota during oral
administration of erythromycin in healthy adults (74,76) and in infants (7). The aerobic
Gram-positive cocci were reduced in numbers and there were marked reductions in the
350
Sullivan and Nord
c3
■*—>
O
•I-H
X
o
S-H
o
0)
o
q
• i-H
cS
s
■4— >
C/3
C/3
03
CD
e
• i-H
tM
4— >
o
C/3
CD
0)
■4-J
o
c
q
1— 1
CD
(D
ox
x
■4— >
c
o
1-4
CD
e
o
-4— '
Oh
CD
H
C/3
73
q
r«
<D
73
c3
O
o
q
• i-H
-J
r-
<D
73
■ H
o
<D
73
•i-H
N
<
<D
■H
'o
S-H
o
c3
a,
in
o
n
CO
2
OX)
S3
>
O
o
•4—4
o
c-3
i
q
CD
o
q
o
U
i
o
<
CD
q
e
CD
CD
OX)
OX)
e
c
o
— »
x
<D
O
CO
2
— -
q
q
c
•—
o
— I
q
PJ
o
o
•—
o
<
•—
<D
X)
£
o -g
C/3 • —
^ a
=3
c3
Co
"a
CD
-a
•i-H
5-H
CD
•*— '
CJ
cd
2 o
o
o
Q _
x -c
•c
CD
•*— '
O
X
CD
O
o
a
o
CO
x 5
q
o
•*— *
CD C3
s s
Q I
a
ox)
H N m t IT) ^ VO
t-» r- r- t-» r- r-» r»
r-
r- m
00 ON O
(N
hhhhhOOOCOO
00
73
V
IT)
00
(N
(N
o
(N
q
73 73 73 73
V V V V
+ +
o
o
en
o
O
^t-
m
o
<N
i
i-H
1
i
1)
■A
ij
4
73
1)
q
V
d
V
CN
V
q
£ OO %~-
JL. — ^
\/ On CN
+ + +
+
+ I
+ + + + + + + +
+ I + +
+ + + + + ^^ +
+ + + +
+ + + +
+ + + + +
<N
CM
(N
(N
X
o
(N
OX)
(N
en
^t
^J-
^1-
X
X
X
X
X
OX)
s
X
X
X
X
X
o
o
O
o
o
O
o
o
o
O
o
o
o
o
o
o
O
in
o
o
o
O
«n
o
o
o
in
in
in
in
in
in
CN|
in
^™
in
^1"
^
in
00
^o
— >
i— i
i— i
q
■ —
c
c
Pi
a
•1-H
o
•^H
o
o
•i-H
CD
O
■ —
B
2
B
c
E
c
2
S
o
i
•—
X
■i—>
•I-H
s-
•!-H
J-H
X
— ->
X
X
c
•i— i
N
4— »
■H
(1)
C3
c
•-H
u
tt
W
Csi
<
H
u
+ +
+
+
^^^ + + ^^ + + + + I + + + +
++++++
OCNVOOOOOCNVOVOOinOOeNO
r^ r-< ^H Ol '— I »-H i— I i— I i— I ^H ^H ^H f>l
ot^r^c^r^i>r--'sOinrnocnr-r--r-in
^H | i-H
cn
OX)
OX)
s
in
CN
X
^
•i-H CO
3 -a
o
d
d
. —
s
a
o
•—
CJ
4— I
CJ
TD
CJ
CJ
00
X
o
p
OX)
• —
o
y:
CJ
O
'—
OX)
o
o
*oo
o
A
c^
a.
0/J
q
o
*3
+
+
CJ
,B
t|-H
OX)
a
o
o
—
OX)
o
CJ
CO
cd
b
■8
o
CJ
y.
c^3
CJ
—
O
CJ
CJ
ta
S3
. O
a s
2 o
x ♦ j
CD q
Q H .
•2 +
73
n
&5
— '
CO
• -— .
73
CJ
c
—
c
rt
^>
. —
O
k
b
S
"C5
•^ CD
Modifying the Intestinal Microbiota with Antibiotics
351
0)
o
c
s
^_^
s
^_^
^_^
^.^
s
/
s
• l-H
J3
2h
cn
en
^~
in
>n
vo
o
VO
r^
l>
o
CD
00
00
00
oo
00
OO
(N
00
00
c
<H-H
s — y
^— **
s — y
s — -'
*•«■ ^
^— **
s — y
^— y
s — ^
o
0)
•l-H
C.
__
03
c
•l-H
-4-*
co
<D
1
e
2 M
r^
o
o
o
■4—"
c
o
"^ » ' '
^D
o
o
^D
c
C t>0
in
i-H
T-H
•
o
•1 6
o3
1
1
1
CN
CO
U
CD
QJ
-d
T3
TD
CD
^
6
CD
T3
■4— »
c
o
b
d
d
V
V
V
•
r^
d
d
V
CO
<D
M-H
o
+
+
1
|
1
1
1
I
1
1
N
43
C "<3
03
-4— »
T3
£
i
o
»H
^
• i-H
01)
•~~4
o
•I-H
CD
>
CD
CD
!
6
d
QJ
!
oJ
|
|
^
o
•i^
d
d
d
d
d
d
i
1
u
03
CO
1
CO
-4— '
CO
•I-H
CD
o
o
03
4 -S
1
|
+
aj
o
oi
+
aj
1
1
O
e
03
CO
w o
d
d
d
d
OD
-4—'
03
CO
-4— '
c
<
•I-H
o
CO
CD
S-H
O
CD
+
+
+
■
1
1
1
■
1
1
<
a
o
CD
•I-H
01)
i
o
»h
o # rt
Ph
CD
a
1
1
1
1
1
1
1
1
1
1
,,
"£ o
i
i
i
i
i
i
i
i
i
1
<D
c
w
[§ u
o
c
•I-H
X3
i
i
■H
o
o
o
N
03 03
X3 -a
1
|
1
X)
+
QJ
•
+
QJ
+
I
03
WW
a
CD 3
C
+
d
X
O
c
<
• i-H
c
o
o
•I-H
o
-4-*
o
■03
»h
CD
-4—"
1
|
+
+
+
|
+
+
i
1
1
c
Qi
c
4-J 4-»
+
2
£
w
3
HH
tfi
O
• i-H
•l-H
4=> o
£
o o
S-H
|
|
+
+
+
|
+
|
1
1
CO
<0
3
"co
O
M-H
O
O CO
J^
5-- *-?
*W)
1.8.
i =
1 w
lO
in
o
00
oo
t>
(N
r-
oo
o
o
^■^
^m^
i-H
i-H
l-H
c
•I-H
e
<
co"
c
<4-H
o
CO
.a e
c 2
o
o
r--
"<t
"fr
o
m
c--
o
cn
*?
T
03
6 &
—3 5-H
7
oo
7
oo
cn
lO
Q
T3 j3
03
03
S-H
-4-J
ra
CD
H
'■4-
>>
CD 03
co T3J
^
T-H
X
en
+
CN
<N
o
^ cn
o
O
03
o ■>
X
o
+ 8
o
X
o
x §
o cn
o
X
o
o
CN
o
^X
B o
lO
o
o
o
o
o
o
o
o
a-
(N
(N
1— <
*- '
>-H
i-H
^o
^t
vB
^t
CD
c
• H
C3
CO
n
(0
-4— >
c
CD
•I-H
CD
O
03
S-H
-4— <
1)
CD
S
c3
S-H
O
-H
o
• H
T3
■H
o j>
• l-H
X
o
B
• H
s
6
CD
N
03
•H
o M
& o
H
<
H
Q
H
z
J
u
"9
a
s
•-— <
♦Hi
e
a
352
Sullivan and Nord
c3
CO
4—4
CO
•a
o
top
o3
T3
•-H
o
<
o
•-H
o
5
c
o
a
X
O
c
• -H
o
l-H
to
CO
0)
"^3
c
u
pa
>
o
o
c
c3
4—4
CO
• I-H
CO
<D
S-.
<4-h
c
O
e
<d
E?
w
d
c
-4— 1
o
cd
Oh
CD
O
a
CD
J-l
,<D
«4-H
CD
0*
CD
W)
c
c3
00
Jh
^
c
C
W)
o
U
O
• I-H
4— '
s-
4— >
a
1
u
•»■■*
u
CO
6
1
CD
c3
f— <
CD
T3
PQ
4— '
1
O
o3
o
•—
CD
•*— <
C
•I-H
5-
CD
4W
o
X>
i
o
• w*
s-
CD
CD
O
o
o
6
i
o
u
c3
cd
C3
C
X>
o
CD
<
• i-H
o
S-.
i
03
<D
o
•c
<— »
03
C
CD
4-»
•l-H
O
•I-H
o
o
X>
o
o
o
•—
CD
<
+
tM
o
CO
CD
3
-4— »
o
CD
3
CO
£
o
i
CO
•I-H
G
f A
c
O
VJ
• '—
•I-H
03
£
4—4
03
Q
T3
o3
CD
03
CO
T3
Q
"5h
a
4— <
a
CD
<
00
00
ON O
OO ON
O
On
On
>^
X
OO
c
E
1
03
T3
T3 T3
V
V V
o
•—
P0
4—4
1— 1
•a
^O
03
^
o
I
OO
^"^
CD
•
OO
c
+
+
+
+
+ +
+
+
+
+ +
+ +
+
+
+
o
O ^t
\D
m
(N
r- r-»
r-
o
+
X
o
o
X
o
o
X
o
"^J-
o
o
o
m
o
OO
i-H
^t
r^D
1
c3
'o
N
T3
• l-H
03
• i-H
O
-4—4
CD
a
CD
N
• i-H
H
S
o
(N
(N
o X o
o o
(N
X
CJ
>^
X
IS
03
i
03
C
o
to o
5 N
>^
o
73
CJ
>
§
■4—4
cd
to
c
CJ
c
o
u
cu
C
• ^H
o
bo
o
o
2h ^o
Ph
■j:
cd
i
CO.
crj
o
o
00
—
o
E
o
o
(N
CD
Q
13
X)
—
CJ
CJ
S-H
cd
00
CJ
d
a
c
• ^H
•4— I
u
CJ
4-J
a)
73
CJ
X!
■v.
CJ
W>
C
-a
u
4-1
S3
O
a
b/j
C
■j-.
CJ
CJ
r^
'•4-H
u
O
— -H
bi)
O
A
4-4
CJ
D-
6
• .-H
b0
C
c
+
+
CJ
CJ
b0
CJ
O
— H
b0
O
CJ
c^
cd
CJ
5-
u
CJ
T3
s-
C
CJ
c^
cd
CJ
CJ
C
CJ
«4-H
a)
CJ
■4—4
cd
l-H
CJ
T3
c
.2 o
> ^
Q
+
T3
CJ
In
3 -
C/3 g
0) 0)
CJ
g
E
03
ft) ><
f3
C3 -O
O
c
Modifying the Intestinal Microbiota with Antibiotics 353
numbers of enterobacteria while new species of resistant Gram-negative rods proliferated.
Several subjects became colonized with yeasts. Anaerobic species like bifidobacteria,
lactobacilli, Clostridia and Bacteroides were also suppressed to a varying degree.
Roxithromycin
The consequences of oral treatment with roxithromycin on the intestinal microbiota are
more limited than the effects of erythromycin in healthy volunteers (77). The fecal
concentrations were also lower and the changes were restricted to a decrease in total
counts of Enterobacteriaceae.
Azalide
Azithromycin
The ecological effect of azithromycin has been compared with the effect of clarithromycin
in healthy volunteers (73). The main impact of azithromycin was detected as decreased
numbers of bacterial species in the family Enterobacteriaceae.
Ketolide
Telithromycin
Moderate disturbances in the gastrointestinal microbiota have been recorded during
administration of telithromycin to healthy subjects (71). The numbers of E. coli were
significantly reduced and overgrowth of staphylococci and resistant enterobacteria was
observed. In the anaerobic microbiota there were reduced numbers of lactobacilli and
bifidobacteria. A selection of highly resistant Bacteroides isolates was also recorded
during and after treatment.
Lincosamide
Clindamycin
The ecological impact of clindamycin on the fecal microbiota has been studied after
intravenous clindamycin prophylaxis in patients undergoing colorectal surgery (78) and
after oral administration in healthy subjects (79-81). Clindamycin is excreted in the bile
and high fecal concentrations have been detected with marked disturbances, in particular
in the anaerobic microbiota. Enterococci are not susceptible to clindamycin and their
numbers have usually increased and so have the numbers of clindamycin-resistant
enterobacteria. Anaerobic Gram-positive cocci and rods and anaerobic Gram-negative
rods have been markedly suppressed or eliminated during treatment. Emergence of
clindamycin-resistant Bacteroides species has been detected in one of the studies and
colonization with C. difficile was common.
354 Sullivan and Nord
Streptogramin
Quin up ristin/Dalfopristin
In healthy volunteers treated with quinupristin/dalfopristin (RP59500), the impact on the
fecal microbiota has been investigated (82). The numbers of enterococci and
Enterobacteriaceae increased significantly and anaerobic non-sporulating and Gram-
negative bacteria decreased. The total numbers of quinupristin/dalfopristin-resistant and
also erythromycin-resistant anaerobes and enterococci increased significantly. The
observed modifications disappeared within 12 weeks after the administration.
Tetracyclines
Tetracycline
The ecological effect of tetracycline hydrochloride on the gastrointestinal microbiota has
been examined in healthy volunteers (83). Tetracycline had no major effect on the total
numbers of intestinal microorganisms although a few subjects acquired new strains of
C. albicans. However, the major finding was the emergence of resistant E. coli strains in
10 of 15 subjects.
Doxycycline
The effect of doxycycline has been evaluated in two studies in healthy subjects (83,84).
The results are partly consistent in that new resistant strains were detected during
treatment. Acquisition of C. albicans occurred in subjects in the first mentioned study and
new strains of Enterobacteriaceae in the latter. In this study, the aerobic microbiota was
also suppressed while the anaerobic microbiota was not influenced. However, the number
of fusobacteria was reduced and a marked emergence of resistance was also observed in
anaerobic microorganisms (84).
Aminoglycosides
Tobramycin
Two dosing regimens of tobramycin have been compared for the selective decontamina-
tion effect of the digestive tract in healthy volunteers (85). Both regimens markedly
suppressed the number of aerobic Gram-negative rods while the higher dose also had an
effect on the anaerobic microbiota as evidenced by low concentrations of beta-
aspartylglycine.
Nitrofurantoin
Nitrofurantoin has been used for prophylaxis in women with recurrent urinary tract
infections (86). The effect on the fecal microbiota was examined semi-quantitatively. The
agent had no effect on the numbers of enterococci or enterobacteria and no resistant strains
or overgrowth of strains was detected.
Modifying the Intestinal Microbiota with Antibiotics 355
Oxazolidinone
Linezolid
Linezolid is a relatively new synthetic antimicrobial agent that has been evaluated for the
effects on the gastrointestinal microbiota in healthy male subjects (20). There was a statis-
tically significant reduction of enterococci whereas the numbers of resistant Klebsiella
strains increased. The agent also exerted changes in the anaerobic microbiota with
decreased numbers of lactobacilli, bifidobacteria, Clostridia and strains of Bacteroides. The
minimum inhibitory concentrations (MIC) values of Bacteroides fragilis strains increased
during administration and returned to pre-treatment levels on day 35.
AGENTS BLOCKING THE METABOLISM OF FOLIC ACID
The impact of folic acid antagonists is summarized in Table 6.
Co-trimoxazole
The ecological effects of co-trimoxazole on the intestinal microbiota have been evaluated
in a scheme for prophylaxis in women suffering from recurrent urinary tract infections
and in infants being treated for various infections (7,86). In women there was a marked
decrease in numbers of Enterobacteriaceae and resistant E. coli strains were detected in
samples of one woman. In infants, lactobacilli and bifidobacteria were nearly absent but no
other significant changes were observed.
ANTIMICROBIAL AGENTS THAT INTERFERE
WITH THE SYNTHESIS OF DNA
The ecological impact of nitroimidazoles and combinations of metronidazole and
penicillin or macrolide is shown in Table 6 and the impact of quinolones is shown in
Table 7.
Nitroimidazoles
Metronidazole
Only minor alterations of the aerobic and anaerobic gastrointestinal microbiota have been
shown to occur during metronidazole treatment of patients with different infections (87).
Tinidazole
Parenterally administered tinidazole has been used in order to prevent postoperative
infections after abdominal surgery (88). Analyses of the intestinal microbiota revealed that
the treatment induced proliferation of the numbers of enterococci and staphylococci.
Anaerobic Gram-positive cocci, fusobacteria and bacteroides were also significantly
affected during and immediately after the administration period. In connection with oral
356
Sullivan and Nord
C3
o
1-H
CJ
c3
C
. -H
4— '
CJ
CJ
■4-J
d
o
CJ
C
o
'o
d
• i-H
P
cj
en
Oh
o
5o
CD
>
O
o
d
■i—>
CO
• i-H
CO
cj
o
o
d
cj
Jh
CJ
w
d
o
■*— i
o
ed
a
S
<D
O
d
CD
Jh
.<L>
<-4-H
<d
Pn
a>
bU
1
c
d
en
W)
CJ
o
^H
^
c
d
W)
o
U
a
•I-H
■4-J
en
a
i
Q
a
u
^3
•••^
u
CJ
CJ
CO
CD
T3
CO
O
o
CJ
-4— >
■t— »
d
o
en
X>
6
• I-H
S-H
o
aj
o
d
o
o
i
o
o
J-
en
a
CJ
d
CJ
•I-H
S-H
CD
<
• i-H
i
O
•—
CJ
o
en
•c
CD
-4— >
a
X)
W
•I-H
o
• i-H
o
o
X
o
o
o
Ih
CJ
<
+
a
«4H
o
CO
cj
X)
-4—'
CJ
CD
d
p
P
CO
Z
•■+-
,
o
CO
• i-H
d
^
d
• — «
o
•I-H
(Tt
s
-4— '
en
Q
73
K3
!-H
■4-J
CJ
en
o
T3
Q
a
<D
<
on aNaNONONaNONONOOOOOOOOO
00
in
00
1
o
o
1
73
aj ^
V
d v
+
+
+
(N
(N
+
X
O
in
o
^ o
[--- en
CD CD CD _.
d d d m
m 73
V
o
mom
«p"?S
dididiaJdJoJr-O^
dd'dddd'^'-Hm
+
CJ
d
CJ
d
CJ
d
+
CJ
d
+
+ I +
+
+
+
+ +
+ +
CJ
d
CJ
d
+
+
+ +,+ + +,+ + + + + + + +,
+ + " h + + + " h + + + + + + + + " h
+ + +
+
+
+
dd'tinrjooo^iohhhfiio
o o
i— i m
CN
CJ
V-) r- m
r- ^i-
oo
m r^ m m m *sO
(N
X
o
o
(N M (N M (N M
X X X X X X
o o o o o o
o o o o o o
o
>n
X)
CN i— ' CN CN
X X X X
o o o o o
o >n o <n m
X
o
inininmTj-^j-i^mcNmcNcNincN
X
O
5-H •!-(
Oh O
• i-H
u
Tf-
^t
r-
I-H
o
o
CN
CN
X
|
o
o
o
o
o
CN
Tf
d
•i-H
o
d
en
• i-H
X
CJ
n
en
X
d
0)
u
*—
d
en
pj a
Modifying the Intestinal Microbiota with Antibiotics
357
00 On O i— ' CS CO cN 't"OT)>«D^^hhOOO\\o^O'- ( CN
"^5
c
• -— I
e
a
d
CN
oo
^1-
CO
CO
o\
^o
a
o
«
1
1
r^
7
in
1
lO
1
CN
V
V
V
d c d c d c d c co
o o
On CO
CO
O CO
o
CO
oo
<D HJ
c r» c c
CO
3 V
+ I +
d
d
+
d
d
<3J
d
+
(D
+ + + +
+ ^ ^ + ^ + +
+ + + + + + +
+ + + + + + +
+ + + + + + +
+ + + + + + +
+ + I + +
+
+
+
+ + + +
00 O CN ^O O O
CN
O^^OOOOOOOCNI^O
>n tj- ^o
CN
r-
t^ c — c^
r-
ooioioininmr-r^r^
o
ro h in
CO
X
o o o o o o
O CN CN O O O
Tf CO CO CN lO 'nI"
X O
O <G
53 -3 C
a a
i,
X
O
O
d § °
c3
X
o
o
o
o
C3
X
o
qd
S o o o e
CN CN CN CN CN CN (N
X X X X X X X
o o o o o o o
o o o o o o o
^- ^" CN ^1" CN i-h Tt
o
X
o
o
CN
CN
CN
X
X
X
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
o
CN
CN
^1-
CN
c
•1-H
o
X
o
o
CN
^t
c
o
a
X
o
c:
Oh
358
Sullivan and Nord
^3
s
4— '
o
•I-H
X)
o
U
o
c3
.9
■i— •
co
CJ
CD
M
■*— >
d
o
co
<D
c
c>
'o
c
d
a
<4-H
o
4— '
CJ
Cd
o-
E
.Q
o
S-H
>
o
O
d
03
-I—'
BO
&
u
C
8?
W
c
o
CJ
c3
Oh
u
c
I
e
4— '
C
O
d
J-l
.1)
CD
bo
§ bp
i
d
CD
c d 61)
•9 .2 E
o3
*3
^
<u
4-J
CJ
c3
CQ
d
i
c
u
< X5
o
c3
-O
CJ
O
S-H
d
CO .2
o3 _S
Q 1
CO
CO
CD
T3
i o3
a) £
d §
M-4 Xi
2 -3
CD O
O
o
CJ
03 03
5-
CJ
C3
• r^
s-
CD
CJ
CJ
C
CJ
<D _|_
CO
-t-J
CJ
CD
£?
CO
d
c
c3
CD 03
S 3
c
CJ
<
^t o> co ^j- >n vo o
O i-H CN CN CN (N ^h
r3
O
o
o
m
cd
(N
O
co
1
d
O
co
CJ
1
V
(N
d
^o
^f
d
+
+
+
I + +
+
+ + +
+ + + + + +
+ + + + + +
+
+
+
+
+ +
ID M (N ^3 00 (N (N
IT)
co
I
O
CN
X
o
o
o
o
o
o
Tt CN
.9
o
X
c
3
I> 00
o
O
O
CO CN
X +
o o
o o
o
o
o
o
CN CN
d .s
CJ
c3
X
d ,
O cJJ
03 X
x c
O CC
03
>
+2 5 o
00 00 H
CJ
r3
. —
>
a
•—
03
C
cd
4— '
c
cd
o
CN
j-.
t
b/j
S
O
m
CN
r-
S-H
o
c
c
u
I
CJ
■a
■j~.
CJ
X!
CJ
b0
. r
CJ
b0
a
u
O
b0
O
A
4-J
b/j
§
4—<
J-,
. r-
■j;
CJ
o
CJ
b0
o
O
i— i
b0
O
—i
■8
C
CJ
c^
u
CJ
CJ
CJ
4— »
b
C
B
on
B
o
o
+
CN
X
CJ
o
bO T3
S
cd
O
CN
S
•2 cj
2 1
5 x
•^ CJ
Modifying the Intestinal Microbiota with Antibiotics 359
administration of tinidazole to healthy subjects, no significant changes have been detected
in the gastrointestinal microbiota (89).
Metronidazole in Combination with Amoxycillin
In patients with Helicobacter pylori infection treated with omeprazole, metronidazole and
amoxycillin, the alterations in the intestinal microbiota have been evaluated (90). Marked
ecological disturbances were seen. The numbers of enterococci, enterobacteria, other than
E. coli, and peptostreptococci increased significantly. Several patients became colonized
with Klebsiella and Citrobacter species as well as with yeasts.
Metronidazole in Combination with Clarithromycin
The influence of H. pylori treatment with omeprazole, metronidazole and clarithromycin
on the intestinal microbiota has been examined in two groups of patients (90,91). In the
first mentioned study, it was found that the numbers of bifidobacteria, Clostridia and
species of Bacteroides were significantly decreased during treatment whereas the numbers
of enterococci increased. Strains of enterococci, Enterobacteriaceae and Bacteroides spp.
had significantly increased MIC values during the administration. In the second study the
microbiota was compared to that of healthy subjects. Before treatment, patients were
characterized by high concentrations of lactobacilli. Immediately after treatment there was
an increased colonization with yeasts and enterobacteria, other than E. coli, while the
growth of lactobacilli, Clostridia and bacteroides decreased. Four weeks after the start of
the study the microbiota of patients was similar to that in healthy subjects.
Quinolones
The ecological impact of quinolone administration on the fecal microbiota is described in
Table 7.
Ciprofloxacin
The ecological consequences of ciprofloxacin have been evaluated in patients in connection
with colorectal surgery (92), in patients with acute leukaemia in remission (96),
in prevention of bacterial infections in cirrhosis (101,102) and in treatment of travelers'
diarrhea (103). A number of studies have also been performed on healthy volunteers
(93-95,97-100,104,105). Ciprofloxacin is excreted in feces in extremely high concen-
trations and has an activity mainly against Gram-negative aerobic rods. Marked
suppression or elimination of enterobacteria has also been shown to occur, both in patients
and in the healthy subjects examined. The extension of disturbances has varied depending
on the doses. Minor alterations of numbers of Gram-positive aerobic cocci, mainly
enterococci, have further been observed and in some studies minor alterations were
detected also in the anaerobic microbiota. Ciprofloxacin-resistant species of Pseudomonas
and Acinetobacter have been detected during treatment of patients with acute leukaemia
(96) and in healthy volunteers who were given ciprofloxacin intravenously (98).
Furthermore, 4 of 7 ciprofloxacin-treated patients with travelers' diarrhea acquired multi-
resistant E. coli and in 4 subjects increased MIC values of ciprofloxacin for Bacteroides spp.
were detected (103).
360 Sullivan and Nord
Enoxacin
The effect of enoxacin on the colonic microbiota in human volunteers has been examined
(106). Enterobacteria were almost completely suppressed during administration of the
drug whereas other aerobic and anaerobic species were not significantly affected.
Garenoxacin
The ecological effect of garenoxacin has been evaluated in healthy individuals receiving
oral doses ranging between 100 and 1200 mg daily (107). Higher doses resulted in marked
effects on the intestinal microbiota; the strongest effect was noticed in reduced numbers of
Bacteroides species. Fecal concentrations of garenoxacin also increased with higher doses
as well as the selection of resistant strains, mainly enterococci and enterobacteria. In
comparison, the Bacteroides species strains were less susceptible to the quinolone agent.
Gatifloxacin
Gatifloxacin has been given to healthy subjects in order to study the impact on the normal
intestinal microbiota (108). Gatifloxacin possesses a broad spectrum of antimicrobial
activity and the administration resulted in not only elimination or strong suppression of
E. coli strains but also in decreased numbers of enterococci and increased numbers
of staphylococci. The numbers of Clostridia and fusobacteria decreased significantly in the
anaerobic microbiota.
Gemifloxacin
Gemifloxacin is another agent with a broad spectrum of antimicrobial activity. It is active
both against Gram-positive and Gram-negative bacteria. The ecological impact of the
agent has been investigated in a placebo-controlled study in healthy volunteers (109) and
in a randomized cross-over study where the effect of a single dose was investigated in
healthy subjects (110). In the first mentioned study, the effect of gemifloxacin was shown
to be selective with reduced numbers mainly of enterococci, streptococci and
enterobacteria. The single dose caused a pronounced reduction in the numbers of
E. coli and to a lesser extent also of enterococci and Bacteroides species. New quinolone-
resistant isolates of Gram-negative aerobes appeared in some subjects.
Levofloxacin
Levofloxacin has been shown to cause a selective reduction in the normal microbiota of
healthy subjects, mainly directed towards Gram-negative aerobic rods (111,112). The
numbers of enterococci were reduced to a lesser extent. Increased MIC values against
strains of Bacteroides was detected in one study (111).
Lomefloxacin
Almost a complete eradication of Gram-negative aerobic rods have been shown to occur in
the intestinal microbiota of volunteers during administration of lomefloxacin (113).
Aerobic Gram-positive and anaerobic microorganisms were virtually unaffected.
Modifying the Intestinal Microbiota with Antibiotics 361
Moxifloxacin
The ecological impact of moxifloxacin has been evaluated in healthy subjects (72). The
administration caused significant decreases of enterococci and enterobacteria while no
other major changes were observed.
Norfloxacin
A number of studies have investigated the ecological effects of norfloxacin on the normal
intestinal microbiota (86,114-119). All studies have been performed in healthy subjects
and the results have been consistent. Elimination or strong suppression of enterobacteria
has been observed and slight reductions of enterococci have been detected in connection
with the highest dosing regimens. Only minor fluctuations of other species have been seen.
Ofloxacin
The potential of ofloxacin to disturb the intestinal microbiota has been studied in healthy
volunteers (112,120) as well as in patients undergoing gastric surgery (121). In
both volunteers and in patients the numbers of enterobacteria were strongly suppressed
or eliminated and the numbers of enterococci were significantly reduced. In patients the
numbers of lactobacilli, bifidobacteria, eubacteria and species of Veillonella and
Bacteroides were also affected.
Pefloxacin
The influence of pefloxacin on the gastrointestinal microbiota with regard to colonization
resistance has been evaluated in two studies on healthy volunteers (104,122). Gram-
negative aerobic rods were eliminated during treatment while the numbers of enterococci
were slightly suppressed. In one of the studies a significant increase of yeasts was detected
in half of the subjects (122).
Rufloxacin
The impact of rufloxacin on intestinal microbiota has been studied in healthy male
volunteers after a single dose (119) and in connection with prophylactic treatment of
patients with cancer (123). The single dose significantly reduced the numbers of
Enterobacteriaceae. This was also observed in patients but the number of Bacteroides
species was affected as well, however to a lesser extent. The MIC values of rufloxacin for
enterococci increased significantly during the second week of treatment.
Sitafloxacin
Sitafloxacin has been shown to markedly suppress both the aerobic and anaerobic
intestinal microbiota in healthy persons (124). Most anaerobic microorganisms as well as
the aerobic Gram-negative rods were eliminated on the third day of administration until
one day after the discontinuation of the drug.
Sparfloxacin
Administration of sparfloxacin to male volunteers has been shown to have a strong impact
on E. coli and to moderately reduce the numbers of enterococci (125).
362 Sullivan and Nord
Trovafloxacin
The ecological impact of trovafloxacin has been evaluated in connection with multiple
(126) and single doses (110) administered to healthy males. The numbers of
Enterobacteriaceae were suppressed in both studies, after long-term use below the
detection limit. A single dose also resulted in decreased counts of B. fragilis group species
in some subjects.
CONCLUSION
Antibiotics have a profound place in modern medicine and are indispensable in the
treatment of infectious diseases. However, their antimicrobial properties may also affect
members of the intestinal microbiota and thereby alter its composition and activity. This
may lead to unwanted side effects. It is therefore important to select the appropriate
antibiotic and dose that will cause the eradication of the infectious agent but will
minimally affect the intestinal microbiota.
REFERENCES
1. Guarner F, Malagelada JR. Gut flora in health and disease. Lancet 2003; 361:512-519
discussion 63-65.
2. Vollaard EJ, Clasener HA. Colonization resistance. Antimicrob Agents Chemother
1994; 38:409-414.
3. Hoiby N. Ecological antibiotic policy. J Antimicrob Chemother 2000; 46:59-62.
4. van der Waaij D, Nord CE. Development and persistence of multi-resistance to
antibiotics in bacteria; an analysis and a new approach to this urgent problem. Int
J Antimicrob Agents 2000; 16:191-197.
5. Adamsson I, Edlund C, Sjostedt S, Nord CE. Comparative effects of cefadroxil and
phenoxymethylpenicillin on the normal oropharyngeal and intestinal microflora.
Infection 1997; 25:154-158.
6. Heimdahl A, Kager L, Nord CE. Changes in the oropharyngeal and colon microflora in
relation to antimicrobial concentrations in saliva and faeces. Scand J Infect Dis Suppl
1985; 44:52-58.
7. Bennet R, Eriksson M, Nord CE. The fecal microflora of 1-3-month-old infants during
treatment with eight oral antibiotics. Infection 2002; 30:158-160.
8. Black F, Einarsson K, Lidbeck A, Orrhage K, Nord CE. Effect of lactic acid producing
bacteria on the human intestinal microflora during ampicillin treatment. Scand J Infect
Dis 1991;23:247-254.
9. Knothe H, Wiedemann B. Die Wirkung von Ampicillin auf die Darmflora des gesunden
Menschen. Zentralbl Bakteriol Hyg I Abt 1965; 197:234-243.
10. Leigh DA. Pharmacology and toxological studies with amoxycillin, talampicillin and
ampicillin and a clinical trial of parenteral amoxycillin in serious hospital infections.
Drugs Exp Clin 1979; 5:129-139.
11. Kager L, Malmborg AS, Sjostedt S, Nord CE. Concentrations of ampicillin plus
sulbactam in serum and intestinal mucosa and effects on the colonic microflora in
patients undergoing colorectal surgery. Eur J Clin Microbiol 1983; 2:559-563.
12. Kager L, Liljeqvist L, Malmborg AS, Nord CE, Pieper R. Effects of ampicillin plus
sulbactam on bowel flora in patients undergoing colorectal surgery. Antimicrob Agents
Chemother 1982; 22:208-212.
Modifying the Intestinal Microbiota with Antibiotics 363
13. Stark CA, Adamsson I, Edlund C, et al. Effects of omeprazole and amoxycillin on the
human oral and gastrointestinal microflora in patients with Helicobacter pylori infection.
J Antimicrob Chemother 1996; 38:927-939.
14. Gipponi M, Sciutto C, Accornero L, et al. Assessing modifications of the intestinal
bacterial flora in patients on long-term oral treatment with bacampicillin or amoxicillin:
a random study. Chemioterapia 1985; 4:214-217.
15. Mittermayer HW. The effect of amoxycillin and amoxycillin plus clavulanic acid on
human bowel microflora. In: Croydon EAP, Michel MF, eds. Augmentin. Amsterdam:
Elsevier Science, 1983.
16. Floor M, van Akkeren F, Rozenberg-Arska M, et al. Effect of loracarbef and amoxicillin
on the oropharyngeal and intestinal microflora of patients with bronchitis. Scand J Infect
Dis 1994;26:191-197.
17. Edlund C, Stark C, Nord CE. The relationship between an increase in beta-lactamase
activity after oral administration of three new cephalosporins and protection against
intestinal ecological disturbances. J Antimicrob Chemother 1994; 34:127-138.
18. Brismar B, Edlund C, Nord CE. Impact of cefpodoxime proxetil and amoxicillin on the
normal oral and intestinal microflora. Eur J Clin Microbiol Infect Dis 1993;
12:714-719.
19. Christensson B, Nilsson-Ehle I, Ljungberg B, et al. Swedish Study Group. A randomized
multicenter trial to compare the influence of cefaclor and amoxycillin on the colonization
resistance of the digestive tract in patients with lower respiratory tract infection.
Infection 1991; 19:208-215.
20. Lode H, Von der Hoh N, Ziege S, Borner K, Nord CE. Ecological effects of linezolid
versus amoxicillin/clavulanic acid on the normal intestinal microflora. Scand J Infect Dis
2001;33:899-903.
21. Wise R, Bennett SA, Dent J. The pharmacokinetics of orally absorbed cefuroxime
compared with amoxycillin/clavulanic acid. J Antimicrob Chemother 1984;
13:603-610.
22. Motohiro T, Tanaka K, Koga T, et al. Effect of BRL 25000 (clavulanic acid-amoxicillin)
on bacterial flora in human feces. Jpn J Antibiot 1985; 38:441-480.
23. Brumfitt W, Franklin I, Grady D, Hamilton-Miller JM. Effect of amoxicillin-clavulanate
and cephradine on the fecal flora of healthy volunteers not exposed to a hospital
environment. Antimicrob Agents Chemother 1986; 30:335-337.
24. Lambert-Zechovsky N, Bingen E, Proux MC, Aujard Y, Mathieu H. Effect of
amoxycillin combined with clavulanic acid on the fecal flora of children. Pathol Biol
1984; 32:436-442.
25. Heimdahl A, Nord CE, Weilander K. Effect of bacampicillin on human mouth, throat
and colon flora. Infection 1979; 7:S446-S451.
26. Knothe H, Lembke U. The effect of ampicillin and pivampicillin on the intestinal flora of
man. Zentralbl Bakteriol [Orig A] 1973; 223:324-332.
27. Nord CE, Bergan T, Aase S. Impact of azlocillin on the colon microflora. Scand J Infect
Dis 1986; 18:163-166.
28. Kager L, Malmborg AS, Nord CE, Sjostedt S. The effect of piperacillin prophylaxis on
the colonic microflora in patients undergoing colorectal surgery. Infection 1983;
11:251-254.
29. Nord CE, Brismar B, Kasholm-Tengve B, Tunevall G. Effect of piperacillin/tazobactam
treatment on human bowel microflora. J Antimicrob Chemother 1993; 31:61-65.
30. Knothe H. The influence of pivmecillinam on the human gut flora. Arzneimittel-
forschung Forschung (Drug Reg) 1976; 26:427-431.
31. Sullivan A, Edlund C, Svenungsson B, Emtestam L, Nord CE. Effect of perorally
administered pivmecillinam on the normal oropharyngeal, intestinal and skin microflora.
J Chemother 2001; 13:299-308.
364 Sullivan and Nord
32. Nord CE, Bergan T, Thorsteinsson SB. Impact of ticarcillin/clavulanate on the intestinal
microflora. J Antimicrob Chemother 1989; 24:221-226.
33. Vogel F, Knothe H. Changes in aerobic fecal bacterial flora of severely ill patients during
antibiotic treatment. Klin Wochenschr 1985; 63:1174-1179.
34. Takesue Y, Yokoyama T, Akagi S, et al. Changes in the intestinal flora after the
administration of prophylactic antibiotics to patients undergoing a gastrectomy. Surg
Today 2002; 32:581-586.
35. Kager L, Brismar B, Malmborg AS, Nord CE. Impact of cefbuperazone on the colonic
microflora in patients undergoing colorectal surgery. Drugs Exp Clin Res 1986;
12:983-986.
36. Bacher K, Schaeffer M, Lode H, Nord CE, Borner K, Koeppe P. Multiple dose
pharmacokinetics, safety, and effects on fecal microflora, of cefepime in healthy
volunteers. J Antimicrob Chemother 1992; 30:365-375.
37. Knothe H, Dette GA, Shah PM. Impact of injectable cephalosporins on the
gastrointestinal microflora: observations in healthy volunteers and hospitalized patients.
Infection 1985; 13:S129-S133.
38. Alestig K, Carlberg H, Nord CE, Trollfors B. Effect of cefoperazone on fecal flora.
J Antimicrob Chemother 1983; 12:163-167.
39. Lambert-Zechovsky N, Bingen E, Proux MC, Aujard Y, Mathieu H. Effects of
cefoperazone on children's fecal flora. Pathol boil 1984; 32:439-442.
40. Guggenbichler JP, Kofler J. Influence of third-generation cephalosporins on aerobic
intestinal flora. J Antimicrob Chemother 1984; 14:67-70.
41. Lambert-Zechovsky N, Bingen E, Aujard Y, Mathieu H. Impact of cefotaxime on the
fecal flora in children. Infection 1985; 13:S140-S144.
42. Kager L, Ljungdahl I, Malmborg AS, Nord CE, Pieper R, Dahlgren P. Antibiotic
prophylaxis with cefoxitin in colorectal surgery: effect on the colon microflora and septic
complications-a clinical model for prediction of the benefit and risks in using a new
antibiotic in prophylaxis. Ann Surg 1981; 193:277-282.
43. Mulligan ME, Citron D, Gabay E, Kirby BD, George WL, Finegold SM. Alterations in
human fecal flora, including ingrowth of Clostridium difficile, related to cefoxitin
therapy. Antimicrob Agents Chemother 1984; 26:343-346.
44. Knothe H, Schafer V, Sammann A, Badian M, Shah PM. Influence of cefpirome
on pharyngeal and fecal flora after single and multiple intravenous adminis-
trations of cefpirome to healthy volunteers. J Antimicrob Chemother 1992;
29:81-86.
45. Nilsson-Ehle I, Nord CE, Ursing B. Ceftriaxone: pharmacokinetics and effect on the
intestinal microflora in patients with acute bacterial infections. Scand J Infect Dis 1985;
17:77-82.
46. Cavallaro V, Catania V, Bonaccorso R, et al. Effect of a broad-spectrum cephalosporin
on the oral and intestinal microflora in patients undergoing colorectal surgery.
J Chemother 1992; 4:82-87.
47. de Vries-Hospers HG, Tonk RH, van der Waaij D. Effect of intramuscular ceftriaxone on
aerobic oral and fecal flora of 11 healthy volunteers. Scand J Infect Dis 1991;
23:625-633.
48. Welling GW, Meijer-Severs GJ, Helmus G, et al. The effect of ceftriaxone on the
anaerobic bacterial flora and the bacterial enzymatic activity in the intestinal tract.
Infection 1991; 19:313-316.
49. Vogel F, Ochs HR, Wettich K, et al. Effect of step-down therapy of ceftriaxone plus
loracarbef versus parenteral therapy of ceftriaxone on the intestinal microflora in
patients with community-acquired pneumonia. Clin Microbiol Infect 2001;
7:376-379.
Modifying the Intestinal Microbiota with Antibiotics 365
50. Kager L, Malmborg AS, Nord CE, Sjostedt S. Impact of single dose as compared to three
dose prophylaxis with latamoxef (moxalactam) on the colonic microflora in patients
undergoing colorectal surgery. J Antimicrob Chemother 1984; 14:171-177.
51. Finegold SM, Ingram-Drake L, Gee R, et al. Bowel flora changes in humans
receiving cefixime (CL 284,635) or cefaclor. Antimicrob Agents Chemother 1987;
31:443-446.
52. Nord CE, Heimdahl A, Lundberg C, Marklund G. Impact of cefaclor on the normal
human oropharyngeal and intestinal microflora. Scand J Infect Dis 1987; 19:681-685.
53. No velli A, Mazzei T, Fallani S, Dei R, Cassetta MI, Conti S. Betalactam therapy and
intestinal flora. J Chemother 1995; 7:25-31.
54. Nord CE, Movin G, Stalberg D. Impact of cefixime on the normal intestinal microflora.
Scand J Infect Dis 1988; 20:547-552.
55. Orrhage K, Sjostedt S, Nord CE. Effect of supplements with lactic acid bacteria and
oligofructose on the intestinal microflora during administration of cefpodoxime proxetil.
J Antimicrob Chemother 2000; 46:603-612.
56. Lode H, Muller C, Borner K, Nord CE, Koeppe P. Multiple-dose pharmacokinetics of
cefprozil and its impact on intestinal flora of volunteers. Antimicrob Agents Chemother
1992; 36:144-149.
57. Brismar B, Edlund C, Nord CE. Effect of ceftibuten on the normal intestinal microflora.
Infection 1993; 21:373-375.
58. Edlund C, Brismar B, Sakamoto H, Nord CE. Impact of cefuroxime-axetil on the normal
intestinal microflora. Microb Ecol Health Dis 1993; 6:185-189.
59. Edlund C, Barkholt L, Olsson-Liljequist B, Nord CE. Effect of vancomycin on intestinal
flora of patients who previously received antimicrobial therapy. Clin Infect Dis 1997;
25:729-732.
60. Leigh DA, Walsh B, Leung A, Tait S, Peatey K, Hancock P. The effect of cefuroxime
axetil on the fecal flora of healthy volunteers. J Antimicrob Chemother 1990;
26:261-268.
61. Nord CE, Grahnen A, Eckernas SA. Effect of loracarbef on the normal
oropharyngeal and intestinal microflora. Scand J Infect Dis 1991; 23:255-260.
62. Jones PG, Bodey GP, Swabb EA, Rosenbaum B. Effect of aztreonam on throat and
stool flora of cancer patients. Antimicrob Agents Chemother 1984; 26:941-943.
63. Kager L, Brismar B, Malmborg AS, Nord CE. Effect of aztreonam on the colon
microflora in patients undergoing colorectal surgery. Infection 1985; 13:111-114.
64. de Vries-Hospers HG, Welling GW, Swabb EA, van der Waaij D. Selective
decontamination of the digestive tract with aztreonam: a study of 10 healthy volunteers.
J Infect Dis 1984; 150:636-642.
65. Kager L, Brismar B, Malmborg AS, Nord CE. Imipenem concentrations in colorectal
surgery and impact on the colonic microflora. Antimicrob Agents Chemother 1989;
33:204-208.
66. Nord CE, Kager L, Philipson A, Stiernstedt G. Impact of imipenem/cilastatin therapy on
fecal flora. Eur J Clin Microbiol 1984; 3:475-477.
67. Bergan T, Nord CE, Thorsteinsson SB. Effect of meropenem on the intestinal microflora.
Eur J Clin Microb Infect Dis 1991; 10:524-527.
68. Nakashima M, Uematsu T, Kosuge K, Nakagawa S, Hata S, Sanada M. Pharmacoki-
netics and safety of BO-2727, a new injectable 1 -beta-methyl carbapenem antibiotic, and
its effect on the fecal microflora in healthy male volunteers. J Antimicrob Chemother
1994; 33:987-998.
69. Van der Auwera P, Pensart N, Korten V, Murray BE, Leclercq R. Influence of oral
glycopeptides on the fecal flora of human volunteers: selection of highly glycopeptide-
resistant enterococci. J Infect Dis 1996; 173:1129-1136.
366 Sullivan and Nord
70. Lund B, Edlund C, Barkholt L, Nord CE, Tvede M, Poulsen RL. Impact on human
intestinal microflora of an Enterococcus faecium probiotic and vancomycin. Scand
J Infect Dis 2000; 32:627-632.
71. Edlund C, Alvan G, Barkholt L, Vacheron F, Nord CE. Pharmacokinetics and
comparative effects of telithromycin (HMR 3647) and clarithromycin on the
oropharyngeal and intestinal microflora. J Antimicrob Chemother 2000; 46:741-749.
72. Edlund C, Beyer G, Hiemer-Bau M, Ziege S, Lode H, Nord CE. Comparative effects of
moxifloxacin and clarithromycin on the normal intestinal microflora. Scand J Infect Dis
2000; 32:81-85.
73. Matute AJ, Schurink CA, Krijnen RM, Florijn A, Rozenberg-Arska M, Hoepelman IM.
Double-blind, placebo-controlled study comparing the effect of azithromycin with
clarithromycin on oropharyngeal and bowel microflora in volunteers. Eur J Clin
Microbiol Infect Dis 2002; 21:427-431.
74. Brismar B, Edlund C, Nord CE. Comparative effects of clarithromycin and erythromycin
on the normal intestinal microflora. Scand J Infect Dis 1991; 23:635-642.
75. Eckernas SA, Grahnen A, Nord CE. Impact of dirithromycin on the normal oral and
intestinal microflora. Eur J Clin Microbiol Infect Dis 1991; 10:688-692.
76. Heimdahl A, Nord CE. Influence of erythromycin on the normal human flora and
colonization of the oral cavity, throat and colon. Scand J Infect Dis 1982;
14:49_56.
77. Pecquet S, Chachaty E, Tancrede C, Andremont A. Effects of roxithromycin on fecal
bacteria in human volunteers and resistance to colonization in gnotobiotic mice.
Antimicrob Agents Chemother 1991; 35:548-552.
78. Kager L, Liljeqvist L, Malmborg AS, Nord CE. Effect of clindamycin prophylaxis on the
colonic microflora in patients undergoing colorectal surgery. Antimicrob Agents
Chemother 1981; 20:736-740.
79. Heimdahl A, Nord CE. Effect of erythromycin and clindamycin on the indigenous
human anaerobic flora and new colonization of the gastrointestinal tract. Eur J Clin
Microbiol 1982; 1:38-48.
80. Orrhage K, Brismar B, Nord CE. Effect of supplements with Bifidobacterium longum
and Lactobacillus acidophilus on the intestinal microbiota during administration of
clindamycin. Microb Ecol Health Dis 1994; 7:17-25.
81. Sullivan A, Barkholt L, Nord CE. Lactobacillus acidophilus. Bifidobacterium lactis and
Lactobacillus F19 prevent antibiotic-associated ecological disturbances of Bacteroides
fragilis in the intestine. J Antimicrob Chemother 2003; 52:308-311.
82. Scanvic-Hameg A, Chachaty E, Rey J, et al. Impact of quinupristin/dalfopristin
(RP59500) on the fecal microflora in healthy volunteers. J Antimicrob Chemother 2002;
49:135-139.
83. Bartlett JG, Bustetter LA, Gorbach SL, Onderdonk AB. Comparative effect of
tetracycline and doxycycline on the occurrence of resistant Escherichia coli in the
fecal flora. Antimicrob Agents Chemother 1975; 7:55-57.
84. Heimdahl A, Nord CE. Influence of doxycycline on the normal human flora and
colonization of the oral cavity and colon. Scand J Infect Dis 1983; 15:293-302.
85. Mulder JG, Wiersma WE, Welling GW, van der Waaij D. Low dose oral tobramycin
treatment for selective decontamination of the digestive tract: a study in human
volunteers. J Antimicrob Chemother 1984; 13:495-504.
86. Mavromanolakis E, Maraki S, Samonis G, Tselentis Y, Cranidis A. Effect of norfloxacin,
trimethoprim-sulfamethoxazole and nitrofurantoin on fecal flora of women with
recurrent urinary tract infections. J Chemother 1997; 9:203-207.
87. Nord CE. Ecological impact of narrow spectrum antimicrobial agents compared to broad
spectrum agents on the human intestinal microflora. In: Nord CE, Heidt PJ, Rusch VC,
Modifying the Intestinal Microbiota with Antibiotics 367
van der Waaij D, eds. Old Herborn University Monograph: Consequences of
Antimicrobial Therapy for the Composition of the Microflora of the Digestive Tract.
Herborn: Institute for Microbiology and Biochemistry, 1993:8-19.
88. Kager L, Ljungdahl I, Malmborg AS, Nord CE. Effect of tinidazole prophylaxis on the
normal microflora in patients undergoing colorectal surgery. Scand J Infect Dis Suppl
1981;26:84-91.
89. Heimdahl A, Nord CE, Okuda K. Effect of tinidazole on the oral, throat, and colon
microflora of man. Med Microbiol Immunol (Berl) 1980; 168:1-10.
90. Adamsson I, Nord CE, Lundquist P, Sjostedt S, Edlund C. Comparative effects of
omeprazole, amoxycillin plus metronidazole versus omeprazole, clarithromycin
plus metronidazole on the oral, gastric and intestinal microflora in Helicobacter
pylori-infected patients. J Antimicrob Chemother 1999; 44:629-640.
91. Buhling A, Radun D, Muller WA, Malfertheiner P. Influence of anti-Helicobacter triple-
therapy with metronidazole, omeprazole and clarithromycin on intestinal microflora.
Aliment Pharmacol Ther 2001; 15:1445-1452.
92. Brismar B, Edlund C, Malmborg AS, Nord CE. Ciprofloxacin concentrations and impact
of the colon microflora in patients undergoing colorectal surgery. Antimicrob Agents
Chemother 1990; 34:481-483.
93. Bergan T, Delin C, Johansen S, Kolstad IM, Nord CE, Thorsteinsson SB.
Pharmacokinetics of ciprofloxacin and effect of repeated dosage on salivary and fecal
microflora. Antimicrob Agents Chemother 1986; 29:298-302.
94. Brumfitt W, Franklin I, Grady D, Hamilton-Miller JM, Iliffe A. Changes in the
pharmacokinetics of ciprofloxacin and fecal flora during administration of a 7-day
course to human volunteers. Antimicrob Agents Chemother 1984; 26:757-761.
95. Ljungberg B, Nilsson-Ehle I, Edlund C, Nord CE. Influence of ciprofloxacin on the
colonic microflora in young and elderly volunteers: no impact of the altered drug
absorption. Scand J Infect Dis 1990; 22:205-208.
96. Rozenberg-Arska M, Dekker AW, Verhoef J. Ciprofloxacin for selective decontamina-
tion of the alimentary tract in patients with acute leukemia during remission induction
treatment: the effect on fecal flora. J Infect Dis 1985; 152:104-107.
97. Enzensberger R, Shah PM, Knothe H. Impact of oral ciprofloxacin on the fecal flora of
healthy volunteers. Infection 1985; 13:273-275.
98. Krueger WA, Ruckdeschel G, Unertl K. Influence of intravenously administered
ciprofloxacin on aerobic intestinal microflora and fecal drug levels when administered
simultaneously with sucralfate. Antimicrob Agents Chemother 1997; 41:1725-1730.
99. Pecquet S, Ravoire S, Andremont A. Fecal excretion of ciprofloxacin after a single oral
dose and its effect on fecal bacteria in healthy volunteers. J Antimicrob Chemother 1990;
26:125-129.
100. Holt HA, Lewis DA, White LO, Bastable SY, Reeves DS. Effect of oral ciprofloxacin on
the fecal flora of healthy volunteers. Eur J Clin Microbiol 1986; 5:201-205.
101. Borzio M, Salerno F, Saudelli M, Galvagno D, Piantoni L, Fragiacomo L. Efficacy of
oral ciprofloxacin as selective intestinal decontaminant in cirrhosis. Ital J Gastroenterol
Hepatol 1997; 29:262-266.
102. Esposito S, Barba D, Galante D, Gaeta GB, Laghezza O. Intestinal microflora changes
induced by ciprofloxacin and treatment of portal-systemic encephalopathy (PSE). Drugs
Exp Clin Res 1987; 13:641-646.
103. Wistrom J, Gentry LO, Palmgren AC, et al. Ecological effects of short-term
ciprofloxacin treatment of travellers' diarrhoea. J Antimicrob Chemother 1992;
30:693-706.
104. Van Saene JJ, Van Saene HK, Geitz JN, Tarko-Smit NJ, Lerk CF. Quinolones and
colonization resistance in human volunteers. Pharm Weekbl Sci 1986; 8:67-71.
368 Sullivan and Nord
105. van de Leur JJ, Vollaard EJ, Janssen AJ, Dofferhoff AS. Influence of low dose
ciprofloxacin on microbial colonization of the digestive tract in healthy volunteers
during normal and during impaired colonization resistance. Scand J Infect Dis 1997;
29:297-300.
106. Edlund C, Lidbeck A, Kager L, Nord CE. Effect of enoxacin on colonic microflora of
healthy volunteers. Eur J Clin Microbiol 1987; 6:298-300.
107. Nord CE, Gajjar DA, Grasela DM. Ecological impact of the des-F(6)-quinolone, BMS-
284756, on the normal intestinal microflora. Clin Microbiol Infect 2002; 8:229-239.
108. Edlund C, Nord CE. Ecological effect of gatifloxacin on the normal human intestinal
microflora. J Chemother 1999; 11:50-53.
109. Barker PJ, Sheehan R, Teillol-Foo M, Palmgren AC, Nord CE. Impact of gemifloxacin
on the normal human intestinal microflora. J Chemother 2001; 13:47-51.
110. Garcia-Calvo G, Molleja A, Gimenez MJ, et al. Effects of single oral doses of
gemifloxacin (320 milligrams) versus trovafloxacin (200 milligrams) on fecal flora in
healthy volunteers. Antimicrob Agents Chemother 2001; 45:608-611.
111. Inagaki Y, Nakaya R, Chida T, Hashimoto S. The effect of levofloxacin, an optically-
active isomer of ofloxacin, on fecal microflora in human volunteers. Jpn J Antibiot 1992;
45:241-252.
112. Edlund C, Sjostedt S, Nord CE. Comparative effects of levofloxacin and ofloxacin on
the normal oral and intestinal microflora. Scand J Infect Dis 1997; 29:383-386.
113. Edlund C, Brismar B, Nord CE. Effect of lomefloxacin on the normal oral and intestinal
microflora. Eur J Clin Microbiol Infect Dis 1990; 9:35-39.
1 14. Leigh DA, Emmanuel FXS, Tighe C, Hancock P, Boddy S, Pharmacokinetic studies on
norfloxacin in healthy volunteers and effect on the fecal flora. 14th International
Congress of Chemotherapy, Kyoto, Japan, 1985.
115. Pecquet S, Andremont A, Tancrede C. Selective antimicrobial modulation of the
intestinal tract by norfloxacin in human volunteers and in gnotobiotic mice associated
with a human fecal flora. Antimicrob Agents Chemother 1986; 29:1047-1052.
116. De Vries-Hospers HG, Welling GW, Van der Waaij D. Norfloxacin for selective
decontamination: a study in human volunteers. Prog Clin Biol Res 1985; 181:259-262.
117. Meckenstock R, Haralambie E, Linzenmeier G, Wendt F. Die Beeinflussung der Darmflora
diirch norfloxacin bei gesunden Menschen. Z Antimikr Antineoplast Chemother 1985;
1:27-34.
118. Edlund C, Bergan T, Josefsson K, Solberg R, Nord CE. Effect of norfloxacin on human
oropharyngeal and colonic microflora and multiple-dose pharmacokinetics. Scand
J Infect Dis 1987; 19:113-121.
119. Marco F, Gimenez MJ, Jimenez de Anta MT, Marcos MA, Salva P, Aguilar L.
Comparison of rufloxacin and norfloxacin effects on fecal flora. J Antimicrob Chemother
1995; 35:895-901.
120. Pecquet S, Andremont A, Tancrede C. Effect of oral ofloxacin on fecal bacteria in human
volunteers. Antimicrob Agents Chemother 1987; 31:124-125.
121. Edlund C, Kager L, Malmborg AS, Sjostedt S, Nord CE. Effect of ofloxacin on oral and
gastrointestinal microflora in patients undergoing gastric surgery. Eur J Clin Microbiol
Infect Dis 1988;7:135-143.
122. Vollaard EJ, Clasener HA, Janssen AJ. Influence of pefloxacin on microbial colonization
resistance in healthy volunteers. Eur J Clin Microbiol Infect Dis 1992; 11:257-260.
123. D' Antonio D, Pizzigallo E, Lacone A, et al. The impact of rufloxacin given as
prophylaxis to patients with cancer on their oral and fecal microflora. J Antimicrob
Chemother 1996; 38:839-847.
124. Inagaki Y, Yamamoto N, Chida T, Okamura N, Tanaka M. The effect of DU-6859a, a
new potent fluoroquinolone, on fecal microflora in human volunteers. Jpn J Antibiot
1995; 48:368-379.
Modifying the Intestinal Microbiota with Antibiotics 369
125. Ritz M, Lode H, Fassbender M, Borner K, Koeppe P, Nord CE. Multiple-dose
pharmacokinetics of sparfloxacin and its influence on fecal flora. Antimicrob Agents
Chemother 1994; 38:455-459.
126. van Nispen CH, Hoepelman AI, Rozenberg-Arska M, Verhoef J, Purkins L,
Willavize SA. A double-blind, placebo-controlled, parallel group study of oral
trovafloxacin on bowel microflora in healthy male volunteers. Am J Surg 1998;
176:27S-31S.
19
The Intestinal Microbiota of Pets
Dogs and Cats
Minna Rinkinen
Department of Clinical Veterinary Sciences, Faculty of Veterinary Medicine,
University of Helsinki, Helsinki, Finland
INTRODUCTION
The knowledge of canine and feline intestinal microbiota is relatively scarce and based
mainly on data from laboratory animals, on responses to dietary interventions, or on
animals suffering from chronic intestinal disorders believed to be of bacterial nature. Most
of the studies are performed on quite low numbers of animals that were often sacrificed
and samples of intestinal material collected post-mortem (1,2).
As obtaining fecal samples is much more feasible than sampling the contents of upper
intestinal tract, most of the papers have focused on fecal microbiota, which may not be
considered to represent the whole intestinal microecology. In addition, observations based
on the cultivation of luminal contents may not reflect the microbiota adhered to mucosa.
Most of the bacterial studies have been performed with traditional cultivation and
characterization methods, which may have biased the identification and taxonomy of
microbiota. In humans, it is estimated that only 40% of intestinal bacteria are culturable (3);
a similar outcome can be expected also in dogs and cats. In addition, the bacterial
taxonomy and nomenclature have changed during time, so bacteria identified in earlier
studies may currently be re-classified under a different name. For a more in-depth
description on the analysis of the intestinal microbiota, see the chapter by Ben- Amor and
Vaughan in this book.
Proximal small intestine harbors total bacteria of 10 ~ CFU/ml of luminal
content. The number of intestinal bacteria increases distally, reaching up to 10 14 CFU/g
in feces. In the small intestine aerobic and facultative aerobic bacteria outnumber anaerobic
bacteria (4). When moving aborally in the gut, anaerobic bacteria start to dominate and
finally gain numbers as high as 10 10 of CFU anaerobic bacteria/g fecal material (5).
DEVELOPMENT OF INTESTINAL MICROBIOTA IN DOGS AND CATS
Although there is paucity of research data concerning the development of intestinal
microbiota of dogs and cats, it can be considered to follow a similar pattern as known for
371
372 Rinkinen
other mammals. Intestinal colonization is a gradual process starting immediately after
birth. In newborn puppies and kittens the alimentary canal is sterile but is quickly
inhabited by bacteria from birth canal and environment. The dam usually licks the
newborn thoroughly thus transferring its own indigenous bacteria to her offspring. Within
24 hours the numbers of bacteria in various parts of the gastrointestinal tract of a newborn
puppy are similar to those of an adult dog (2).
The indigenous intestinal microbiota is considered an integral part of the host
defense mechanisms. It forms a barrier against pathogen colonization and also influences
the host's immunological, biochemical, and physiological features (6).
Once the microbiota has become established, it is relatively stable. Oral antibiotics
may have a marked effect on the homeostasis of intestinal microbiota. However, these
changes will be re-established relatively soon (7-9). Disturbances in the gut microbiota
may result in diarrhea, malabsorption, and chronic intestinal inflammation (10). Acute
diarrhea may be fatal as pathogens may invade the host's tissues resulting in bacteremia
and sepsis.
Ageing has documented effects on the constitution of intestinal microbiota in dogs.
Numbers of bifidobacteria and peptostreptococci diminish with ageing whereas Clostri-
dium perfringens and streptococci are more prevalent in the large bowel of elderly dogs (1).
CANINE AND FELINE GASTROINTESTINAL MICROBIOTA
Gram-Positive Intestinal Bacteria
Amongst Gram-positive bacteria residing in the gut, lactic acid bacteria (LAB) make up
the largest and most important part of the intestinal microbiota. Although they have a
significant protective function in the gut, the present knowledge of canine and feline
Gram-positive intestinal microbiota is scant.
Most of the canine LAB belong to the genera Streptococcus and Lactobacillus. In a
recent study, Streptococcus alactolyticus was found to be a predominant culturable LAB
in jejunal and fecal samples of four beagle dogs. In addition, Lactobacillus animalis,
L. reuteri, L. murinus, L. ruminus and S. bovis are reported to harbor in the gut (11,12).
The presence of bifidobacteria in canine GI tract is controversial. Many papers
report absence of bifidobacteria in the canine fecal samples (11,13), whereas others
described bifidobacteria as a substantial part of canine fecal microbiota (14-17). Willard
and co-workers isolated fecal bifidobacteria from dogs inconstantly and independent on
the diet. It was concluded that bifidobacteria may be only sporadically present in the feces
of healthy dogs (18).
In healthy cats, the total number of duodenal microbiota is reported to range from
10 5 to 10 9 cfu/ml, most of the bacteria being anaerobic (10,19). The most common
anaerobic isolates belonged to groups Bacteroides, Clostridium, Eubacteria and
Fusobacteria, whereas Pasteurella spp were the most prevailing aerobic bacteria in
feline proximal small intestine. In addition, Acinetobacter spp, Pseudomonas spp and
Lactobacillus spp were detected in the duodenal samples of healthy cats (10,19).
Lactobacilli were also isolated from feline fecal samples (20).
Intestinal Pathogenic Bacteria
Bacteria are seldom the sole pathogenic factor in canine and feline gastrointestinal
disturbances. Some of the pathogens have been linked to clinical disease, but these
pathogenic organisms are frequently isolated also in healthy individuals (21-26).
The Intestinal Microbiota of Pets 373
Escherichia Coli
Escherichia coli is a normal intestinal inhabitant in warm-blooded animals, including cats
and dogs, although its clinical significance as canine and feline enteropathogen is not very
well documented. Colonization is believed to take place within the first days of a newborn
animal. Certain strains of E. coli may act as intestinal pathogens causing gastrointestinal
infections. Enteropathogenic E. coli and enterotoxigenic E. coli are known to associate
with canine diarrhea, especially in young dogs (27-30). However, these strains have been
isolated from non-diarrheic animals, too (28,30,31).
Enterohemorrhagic E. coli (EHEC) has been isolated occasionally from dogs. Most
of these reports are from dogs living in contact with cattle. EHEC has never been
documented in cats (24).
Clostridia
Clostridium perfringens
Clostridium perfringens is an anaerobic, spore-forming bacillus associated with acute and
chronic diarrhea in dogs and cats. However, the role of C perfringens as an intestinal
pathogen is questionable, as it commonly harbors in the intestinal tract of healthy dogs,
too (23,32). C. perfringens produces toxins, which are classified in five toxigenic types
(A-E). C. perfringens enterotoxin (CPE) is the best characterized virulence factor and
coregulated with sporulation. All C. perfringens types can produce CPE, but type A strains
are most frequently involved. CPE has been reported to cause nosocomial diarrhea, severe
hemorrhagic enteritis, and acute and chronic large bowel diarrhea in dogs (33). On the
other hand, CPE is also found in feces of non-diarrheic animals (23,32), although a
significant association was present with diarrhea and detection of CPE (23).
One study reports C perfringens carrying 62 toxin gene (cpb2) isolated from
diarrheic dogs, suggesting 62 toxin alone or together with CPE may play a role in canine
clostridial diarrhea (34).
Clostridium difficile
C difficile is associated with diarrhea in dogs, although it has been frequently isolated from
dogs with no signs of diarrhea (23,35). C difficile-related diarrhea in humans is principally
associated with hospitalization and use of antimicrobials. In dogs, no significant
association was found in the prevalence of C. difficile along with hospitalization and
antibiotic administration, but increased carriage rate was observed in non-hospitalized
dogs receiving antibiotics (23).
Salmonella
Both healthy and diarrheic dogs and cats may carry Salmonella. Prevalence in healthy
dogs is reported to be between 1% and 38% (24,36). Furthermore, Salmonella isolation
rates in dogs with clinical enteritis is reported low (21,25,37).
The prevalence of Salmonella in canine fecal isolates examined has reduced during
the past decades. This most likely reflects the change in feeding of dogs, as commercial pet
foods have replaced raw meat and offal (36). Feeding bones and raw food diet yielded a
30% Salmonella isolation rate in stool samples of dogs consuming this type of diet.
Feeding raw chicken and meat to dogs may therefore be a risk for potential transfer of
Salmonella to humans, too (38,39).
374 Rinkinen
Salmonella is regarded relatively rare in cats, isolation prevalence varying between
0.8% and 18%; in most reports it is approximately 1%. Also cats may be asymptomatic
carriers (22,24,40). An outbreak of Salmonella enterica serovar Typhimurium in cats was
reported in Sweden, where salmonellosis was probably transmitted from wild infected
birds hunted by the cats (41).
Campylobacters
Campylobacters are regarded as important zoonotic pathogens. Most of the human
infections are food- or water-borne, but infections from pets may also be of concern,
especially with immunocompromised people (42-44). Campylobacters have been
associated with acute and chronic diarrhea in dogs and cats (43). However, as they are
frequently isolated from both healthy and diarrheic animals, it is suggested they are not
primary pathogens but more likely opportunistic microbes producing clinical signs in
predisposing conditions, such as poor nutrition or housing, or high animal density (45,46).
Young dogs seem to be more prone to carry Campylobacters, carriage rate being up to 75%
of dogs less than 12 months old, whereas the isolation rate in adult dogs was only 32.7%
(47,48).
Campylobacter shedding correlates clearly with diarrhea in young dogs, but for dogs
older than 12 months there was no evident correlation with shedding and clinical disease.
In cats, no significant association was found between campylobacteriosis and diarrhea in
any age group (49,50).
In cats and dogs, C. helveticus, C jejuni, and C. upsaliensis are most prevalent
Campylobacter strains. C helveticus has been isolated in healthy cats and dogs (47,51,52).
One study reported C helveticus to inhabit 21.7% of the cats examined, being the most
prevalent Campylobacter species isolated (47). In addition, C coli, and C lari have been
isolated to lesser extent (43,45,48,50,53-55). However, the traditional phenotypic
identification methods have been criticized for being unreliable when identifying thermo-
philic Campylobacters (56). The clinical relevance of these Campylobacters is unclear.
Campylobacter upsaliensis
C upsaliensis is a catalase-negative thermotolerant Campylobacter recognized as an
emerging human pathogen. In humans it is associated with gastroenteritis and bactere-
mia (57). It was first isolated from canine feces (54) and some years later also from feline
feces (58). It has been reported to be the most prevalent Campylobacter in dogs (47,50,56)
and cats (50,56). Thus, it is of interest whether household pets may comprise a reservoir
for this zoonotic pathogen although human and canine strains are reported to be
genotypically distinct (51).
C. upsaliensis has been isolated from feces of both diarrheic and healthy dogs and
cats. It is documented to infect puppies at approximately six weeks of age without causing
a clinical disease when puppies were raised separately in a breeding kennel, presumably in
acceptable conditions. Poor sanitation and high animal density are marked risk factors,
increasing the carriage rate of C. upsaliensis up to 2.6-fold. These findings support the
opportunistic nature of this organism as a canine and feline pathogen (51,59).
Helicobacters
Helicobacter spp. are Gram-negative, microaerophilic curved or spiral-shaped motile
bacteria. Many gastric Helicobacter-like organisms (GHLO) are frequently found in cats
The Intestinal Microbiota of Pets 375
and dogs. Virtually all dogs can be expected to harbor gastric GHLO (60,61), although
most of the dogs are asymptomatic. Additionally, the clinical signs in dogs suffering from
gastritis may persist despite the eradication of helicobacters. Therefore the role of GHLO
as an etiological factor in canine gastritis is currently unclear (62,63).
In dogs, H. felis, H. bizzozeronii, H. salomonis, "Flexispira rappini, " H. bilis, and
"H. heilmannii" have been reported to inhabit the gastric mucosa. The human pathogen
H. pylori has not yet been isolated in canine gastric biopsies. However, a recent paper
reports presumably non-cultivable H. pylori, or a closely related Helicobacter in two
dogs, results based on its 16S rRNA sequence (64). Unlike dogs, cats have been
documented to acquire H. pylori, although very infrequently. Feline H. pylori infection has
been suggested to be an anthroponosis, i.e., cats are infected by humans carrying H. pylori
(63,65-67).
In addition to GHLOs, dogs and cats are reported to have also enteric helicobacters.
H. canis has been isolated from diarrheic cats and dogs (68,69), and H. marmotae from cat
feces (70).
MODIFYING THE INTESTINAL MICROBIOTA: PRE- AND PROBIOTICS
First documented studies of dietary manipulation of canine and feline intestinal microbiota
date back to the beginning of the twentieth century (71).
Today, there is growing interest in modifying their gut microbiota towards what is
considered a healthy composition, i.e., increase in LAB and bifidobacteria, and decrease in
potential pathogenic bacteria (72). Many commercial pet foods now contain prebiotics
(e.g., fructo-oligosaccharides, FOS). In addition, probiotics are also marketed for dogs
and cats.
Prebiotics
Prebiotics are reported to have a variable impact on canine fecal and intestinal microbiota.
Supplementing dogs' food with FOS and mannanoligosaccharides increased ileal
lactobacilli and fecal lactobacilli and bifidobacteria concentrations (73). Feeding short
chain FOS to dogs increased the total number of fecal anaerobes and lowered the number
of Clostridium perfringens (17,74). Similar outcome was achieved with arabinogalactan
supplementation (15). On the other hand, no significant differences were noticed in the
denaturing gradient gel electrophoresis analysis of fecal bacterial profiles when dogs were
fed a diet containing 10% fiber (16), and another study revealed no significant effect of
FOS supplementation on canine fecal Clostridium spp (18).
FOS supplementation increased fecal lactobacilli and decreased numbers of E. coli
in healthy cats, but did not alter the duodenal microbiota (75,76). This supports the notion
that, as FOS are nondigestible fibers fermented in the proximal gut in humans (mainly in
the large intestine) (77), also in cats FOS have only a minimal effect on the microbes
residing in the proximal part of GI tract. In a study of eight cats, feeding lactosucrose
increased fecal lactobacilli and bifidobacteria counts significantly, while numbers of
Clostridia and Enterobacteriaceace decreased significantly (78).
Probiotics
Currently, there are no commerically available probiotics fulfilling the species specificity
criterion applied to probiotics as stated by Saarela and co-workers (79). Despite that,
376 Rinkinen
probiotics are utilized in pet animals in the hope to create beneficial alterations in the
intestinal microbiota.
Enterococcus faecium SF68 has been documented to enhance specific immuno-
logical responses in young dogs (80) and E. faecalis FK-23 stimulated non-specific
immune functions in healthy adult dogs (81). E. faecium is also reported to have an effect
on canine enteropathogens. It significantly decreased the canine in vitro mucus adhesion
of C. perfringens (82). This finding was supported also in vivo (83). On the other hand,
E. faecium increased both the in vitro adhesion and fecal shedding of Campylobacters
(82,83). Pasupathy and co-workers (84) evaluated the effect of Lactobacillus acidophilus
on the digestibility of food and growth of puppies. They concluded that Lactobacillus
supplementation has a favorable effect during the active growth period, although
differences between the study group and control group were not significant.
CONCLUSION
In the recent years the interest in canine and feline gastrointestinal microbiota has
increased, resulting in a fair amount of documented information. However, the current
knowledge of canine and feline gastrointestinal microbiota is still rather scarce. The
growing interest in pre- and probiotics together with the novel microbiological methods
has already made a scientific contribution to the field of small animal intestinal
microbiology. With this trend likely to continue in the future, our knowledge of the canine
and feline gastrointestinal microbiota and the factors related to its regulation will expand.
REFERENCES
1. Benno Y, Nakao H, Uchida K, Mitsuoka T. Impact of the advances in age on the
gastrointestinal microflora of beagle dogs. J Vet Med Sci 1992; 54:703-706.
2. Buddington RK. Postnatal changes in bacterial populations in the gastrointestinal tract of dogs.
Am J Vet Res 2003; 64:646-651.
3. Tannock GW, Munro K, Harmsen HJM, Welling GW, Smart J, Gopal PK. Analysis of the fecal
microflora of human subjects consuming a probiotic product containing Lactobacillus
rhamnosus DR20. Appl Environ Microbiol 2000; 66:2578-2588.
4. Delles EK, Willard MD, Simpson RB, et al. Comparison of species and numbers of bacteria in
concurrently cultured samples of proximal small intestinal fluid and endoscopically obtained
duodenal mucosa in dogs with intestinal bacterial overgrowth. Am J Vet Res 1994;
55:957-964.
5. Davis CP, Cleven D, Balish E, Yale CE. Bacterial association in the gastrointestinal tract of
beagle dogs. Appl Environ Microbiol 1977; 34:194-206.
6. Tannock GW. The normal microflora: an introduction. In: Tannock GW, ed. Medical
Importance of Normal Microflora. London: Kluwer Academic Publishers, 1999:1-23.
7. Lode H, Von der Hoh N, Ziege S, Borner K, Nord CE. Ecological effects of linezolid versus
amoxicillin/clavulanic acid on the normal intestinal microflora. Scand J Infect Dis 2001;
33:899-903.
o
8. Sullivan A, Edlund C, Nord CE. Effect of antimicrobial agents on the ecological balance of
human microflora. Lancet Infect Dis 2001; 1:101-114.
9. Nord CE, Gajjar DA, Grasela DM. Ecological impact of the des-F(6)-quinolone, BMS-284756,
on the normal intestinal microflora. Clin Microbiol Infect 2002; 8:229-239.
10. Johnston KL. Small intestinal bacterial overgrowth. In: Simpson KW, ed. The Veterinary
Clinics of North America, Small Animal Practice. Saunders, Philadelphia: Progress in
Gastroenterology, 1999:523-550.
The Intestinal Microbiota of Pets 377
11. Greetham HL, Giffard C, Hutson RA, Collins MD, Gibson GR. Bacteriology of the Labrador
dog gut: a cultural and genotypic approach. J Appl Microbiol 2002; 93:640-646.
12. Rinkinen ML, Koort JMK, Ouwehand AC, Westermarck E, Bjorkroth JK. Streptococcus
alactolyticus is the dominating culturable lactic acid bacterium species in canine jejunum and
feces of four fistulated dogs. FEMS Microbiol Lett 2004; 230:35-39.
13. Martineau B. Comparison of four media for the selection of bifidobacteria in dog fecal samples.
Anaerobe 1999;5:123-127.
14. Beynen AC, Baas JC, Hoekemeijer PE, et al. Faecal bacterial profile, nitrogen excretion, and
mineral absorption in healthy dogs fed supplemental oligofructose. J Anim Physiol Anim Nutr
2002; 86:298-305.
15. Grieshop CM, Flickinger EA, Fahey GC, Jr. Oral administration of arabinogalactan affects
immune status and fecal microbial populations in dogs. J Nutr 2002; 132:478-482.
16. Simpson JM, Martineau B, Jones WE, Ballam JM, Mackie RI. Characterization of fecal
bacterial populations in canines: effects of age, breed, and dietary fiber. Microb Ecol 2002;
44:186-197.
17. Swanson KS, Grieshop CM, Flickinger EA, et al. Fructooligosaccharides and Lactobacillus
acidophilus modify gut microbial populations, total tract nutrient digestibilities, and fecal
protein catabolite concentrations in healthy adult dogs. J Nutr 2002; 132:3721-3731.
18. Willard MD, Simpson RB, Cohen ND, Clancy JS. Effects of dietary fructooligosaccharide on
selected bacterial populations in feces of dogs. Am J Vet Res 2000; 61:820-825.
19. Johnston KL, Swift NC, Forster-van Hijfte M. Comparison of the bacterial flora of the
duodenum in healthy cats and cats with signs of gastrointestinal tract disease. J Am Vet Med
Assoc 2001; 218:48-51.
20. Hartemink R, Rombouts FM. Comparison of media for the detection of bifidobacteria,
lactobacilli, and total anaerobes from faecal samples. J Microbiol Methods 1999; 36:181-192.
21 . Buogo C, Burnens AP, Perrin J, Nicolet J. Presence of Campylobacter spp Clostridium difficile,
C. perfringens, and salmonellae in litters of puppies and in adult dogs in a shelter. Schweiz
Arch Tierheilkd 1995; 137:165-171.
22. Spain CV, Scarlett JM, Wade SE, McDonough P. Prevalence of enteric zoonotic agents in cats
less than 1 year old in central New York State. J Vet Intern Med 2001; 15:33-38.
23. Marks SL, Kather EJ, Kass PH, Melli AC. Genotypic and phenotypic characterization of
Clostridium perfringens and Clostridium difficile in diarrheic and healthy dogs. J Vet Intern
Med 2002; 16:533-540.
24. Sanchez S, Lee MD, Harmon BG, Maurer JJ, Doyle MP. Animal issues associated with
Escherichia coli 0157:H7. J Am Vet Med Assoc 2002; 221:1122-1126.
25. Hackett T, Lappin MR. Prevalence of enteric pathogens in dogs of north-central Colorado.
J Am Anim Hosp Assoc 2003; 39:52-56.
26. Staats JJ, Chengappa MM, DeBey MC, Fickbohm B, Oberst RD. Detection of Escherichia coli
Shiga toxin (stx) and enterotoxin (estA and elt) genes in fecal samples from non-diarrheic and
diarrheic greyhounds. Vet Microbiol 2003; 94:303-312.
27. Drolet R, Fairbrother JM, Harel J, Helie P. Attaching and effacing and enterotoxigenic
Escherichia coli associated with enteric colibacillosis in the dog. Can J Vet Res 1994;
58:87-92.
28. Hammermueller J, Kruth S, Prescott J, Gyles C. Detection of toxin genes in Escherichia coli
isolated from normal dogs and dogs with diarrhea. Can J Vet Res 1995; 59:265-270.
29. Beutin L. Escherichia coli as a pathogen in dogs and cats. Vet Res 1999; 30:285-298.
30. Starcic M, Johnson JR, Stell AL, et al. Haemolytic Escherichia coli isolated from dogs with
diarrhea have characteristics of both uropathogenic and necrotoxigenic strains. Vet Microbiol
2002; 85:361-377.
31. Holland RE, Walker RD, Sriranganathan N, Wilson RA, Ruhl DC. Characterization of
Escherichia coli isolated from healthy dogs. Vet Microbiol 1999; 70:261-268.
32. Weese JS, Staempfli HR, Prescott JF, Kruth SA, Greenwood SJ, Weese HE. The roles of
Clostridium difficile and enterotoxigenic Clostridium perfringens in diarrhea in dogs. J Vet
Intern Med 2001; 15:374-378.
378 Rinkinen
33. Sasaki J, Goryo M, Asahina M, Makara M, Shishido S, Okada K. Hemorrhagic enteritis
associated with Clostridium perfringens type A in a dog. J Vet Med Sci 1999; 61:175-177.
34. Thiede S, Goethe R, Amtsberg G. Prevalence of (2 toxin gene of Clostridium perfringens type
A from diarrhoiec dogs. Vet Rec 2001; 149:273-274.
35. Struble AL, Tang YJ, Kass PH, Gumerlock PH, Madewell BR, Silva J, Jr. Fecal shedding of
Clostridium difficile in dogs: a period prevalence survey in a veterinary medical teaching
hospital. J Vet Diagn Invest 1994; 6:342-347.
36. Cave NJ, Marks SL, Kass PH, Melli AC, Brophy MA. Evaluation of a routine diagnostic fecal
panel for dogs with diarrhea. J Am Vet Med Assoc 2002; 221:52-59.
37. van Duijkeren E, Houwers D. Salmonella enteritis in dogs, not relevant? Tijdschr Diergeneeskd
2002; 127:716-717.
38. LeJeune JT, Hancock DD. Public health concerns associated with feeding raw meat diets to
dogs. J Am Vet Med Assoc 2001; 219:1222-1225.
39. Joffe DJ, Schlesinger DP. Preliminary assessment of the risk of Salmonella infection in dogs
fed raw chicken diets. Can Vet J 2002; 43:441-442.
40. Hill SL, Cheney JM, Taton-Allen GF, Reif JS, Bruns C, Lappin MR. Prevalence of enteric
zoonotic organisms in cats. J Am Vet Med Assoc 2000; 216:687-692.
41. Tauni MA, Osterlund A. Outbreak of Salmonella typhimurium in cats and humans associated
with infection in wild birds. J Small Anim Pract 2000; 41:339-341.
42. Ketley JM. Pathogenesis of enteric infection by Campylobacter. Microbiology 1997; 143:5-21.
43. Steinhauserova I, Fojtikova K, Klimes J. The incidence and PCR detection of Campylobacter
upsaliensis in dogs and cats. Lett Appl Microbiol 2000; 31:209-212.
44. Alios BM. Campylobacter jejuni infections: update on emerging issues and trends. Clin Infect
Dis2001; 32:1201-1206.
45. Torre E, Tello M. Factors influencing fecal shedding of Campylobacter jejuni in dogs without
diarrhea. Am J Vet Res 1993; 54:260-262.
46. Fernandez H, Martin R. Campylobacter intestinal carriage among stray and pet dogs. Rev
Saude Publica 1991; 25:473-475.
47. Moser I, Rieksneuwohner B, Lentzsch P, Schwerk P, Wieler LH. Genomic heterogeneity and
O-antigenic diversity of Campylobacter upsaliensis and Campylobacter helveticus strains
isolated from dogs and cats in Germany. J Clin Microbiol 2001; 39:2548-2557.
48. Engvall EO, Brandstrom B, Andersson L, Baverud V, Trowald-Wigh G, Englund L. Isolation
and identification of thermophilic Campylobacter species in faecal samples from Swedish
dogs. Scand J Infect Dis 2003; 35:713-718.
49. Burnens AP, Angeloz-Wick B, Nicolet J. Comparison of Campylobacter carriage rates in
diarrheic and healthy pet animals. J Vet Med 1992; 39:175-780.
50. Sandberg M, Bergsjo B, Hofshagen M, Skjerve E, Kruse H. Risk factors for Campylobacter
infection in Norwegian cats and dogs. Prev Vet Med 2002; 55:241-253.
51. Stanley J, Jones C, Burnens A, Owen RJ. Distinct genotypes of human and canine isolates of
Campylobacter upsaliensis determined by 16S rRNA gene typing and plasmid profiling. J Clin
Microbiol 1994; 32:1788-1794.
52. Shen Z, Feng Y, Dewhirst FE, Fox JG. Coinfection of enteric Helicobacter spp. and
Campylobacter spp. in cats. J Clin Microbiol 2001; 39:2166-2172.
53. Prescott JF, Munroe DL. Campylobacter jejuni enteritis in man and domestic animals. J Am
Vet Med Assoc 1982; 81:1524-1530.
54. Sandstedt K, Ursing J, Walder M. Thermotolerant Campylobacter with no or weak catalase
activity isolated from dogs. Curr Microbiol 1983; 8:209-213.
55. Duim B, Vandamme PA, Rigter A, Laevens S, Dijkstra JR, Wagenaar JA. Differentiation of
Campylobacter species by AFLP fingerprinting. Microbiology 2001; 147:2729-2737.
56. Engvall EO, Brandstrom B, Gunnarsson A, Morner T, Wahlstrom H, Fermer C. Validation of a
polymerase chain reaction/restriction enzyme analysis method for species identification of
thermophilic Campylobacters isolated from domestic and wild animals. J Appl Microbiol 2002;
92:47-54.
The Intestinal Microbiota of Pets 379
57. Patton CM, Shaffer N, Edmonds P, et al. Human disease associated with "Campylobacter
upsaliensis" (catalase -negative or weakly positive Campylobacter species) in the United
States. J Clin Microbiol 1989; 27:66-73.
58. Fox JG, Maxwell KO, Taylor NS, Runsick CD, Edmonds P, Brenner DJ. "Campylobacter
upsaliensis" isolated from cats as identified by DNA relatedness and biochemical features.
J Clin Microbiol 1989; 27:2376-2378.
59. Baker J, Barton MD, Lanser J. Campylobacter species in cats and dogs in South Australia. Aust
Vet J 1999; 77:662-666.
60. Happonen I, Linden J, Saari S, et al. Detection and effects of helicobacters in healthy dogs and
dogs with signs of gastritis. J Am Vet Med Assoc 1998; 213:1767-1774.
61. Strauss-Ayali D, Simpson KW. Gastric Helicobacter infection in dogs. Vet Clin North Am
Small Anim Pract 1999; 29:397-414.
62. Happonen I, Linden J, Westermarck E. Effect of triple therapy on eradication of canine gastric
helicobacters and gastric disease. J Small Anim Pract 2000; 41:1-6.
63. Neiger R, Simpson KW. Helicobacter infection in dogs and cats: facts and fiction. J Vet Intern
Med 2000; 14:125-133.
64. Buczolits S, Hirt R, Rosengarten R, Busse HJ. PCR-based genetic evidence for occurrence of
Helicobacter pylori and novel Helicobacter species in the canine gastric mucosa. Vet
Microbiol 2003; 24:259-270.
65. Handt LK, Fox JG, Stalis IH, et al. Characterization of feline Helicobacter pylori strains and
associated gastritis in a colony of domestic cats. J Clin Microbiol 1995; 33:2280-2289.
66. El-Zaatari FA, Woo JS, Badr A, et al. Failure to isolate Helicobacter pylori from stray cats
indicates that H. pylori in cats may be an anthroponosis — an animal infection with a human
pathogen. J Med Microbiol 1997; 46:372-376.
67. Simpson KW, Strauss-Ayali D, Straubinger RK, et al. Helicobacter pylori infection in the cat:
evaluation of gastric colonization, inflammation and function. Helicobacter 2001; 6:1-14.
68. Stanley J, Linton D, Burens AP, et al. Helicobacter canis sp. nov. a new species from dogs: an
integrated study of phenotype and genotype. J Gen Microbiol 1993; 139:2495-2504.
69. Foley JE, Marks S, Munson L, et al. Isolation of Helicobacter canis from a colony of Bengal
cats with endemic diarrhea. J Clin Microbiol 1999; 37:3271-3275.
70. Fox JG, Shen Z, Xu S, et al. Helicobacter marmotae sp. nov. isolated from livers of
woodchucks and intestines of cats. J Clin Microbiol 2002; 40:2513-2519.
71. Torrey JC. The regulation of the intestinal flora of dogs through diet. J Med Res 1918;
39:415-477.
72. Hussein HS, Flickinger EA, Fahey GC, Jr. Petfood applications of inulin and oligofructose.
J Nutr 1999; 129:1454S-1456S.
73. Swanson KS, Grieshop CM, Flickinger EA, et al. Effects of supplemental fructooligosacchar-
ides plus mannanoligosaccharides on immune function and ileal and fecal microbial
populations in adult dogs. Arch Anim Nutr 2002; 56:309-318.
74. Flickinger EA, Schreijen EM, Patil AR, et al. Nutrient digestibilities, microbial populations,
and protein catabolites as affected by fructan supplementation of dog diets. J Anim Sci 2003;
81:2008-2018.
75. Sparkes AH, Papasouliotis K, Sunvold G, et al. Bacterial flora in the duodenum of healthy cats,
and effect of dietary supplementation with fructo-oligosaccharides. Am J Vet Res 1998;
59:431-435.
76. Sparkes AH, Papasouliotis K, Sunvold G, et al. Effect of dietary supplementation with fructo-
oligosaccharides on fecal flora of healthy cats. Am J Vet Res 1998; 59:436-440.
77. Molis C, Flourie B, Ouarne F, et al. Digestion, excretion, and energy value of
fructooligosaccharides in healthy humans. Am J Clin Nutr 1996; 64:324-328.
78. Terada A, Hara H, Kato S, et al. Effect of lactosucrose (4G-beta-D-galactosylsucrose) on fecal
flora and fecal putrefactive products of cats. J Vet Med Sci 1993; 55:291-295.
79. Saarela M, Mogensen G, Fonden R, Matto J, Mattila-Sandholm T. Probiotic bacteria: safety,
functional and technological properties. J Biotechnol 2000; 84:197-215.
380 Rinkinen
80. Benyacoub J, Czarnecki-Maulden GL, Cavadini C, et al. Supplementation of food with
Enterococcus faecium (SF68) stimulates immune functions in young dogs. J Nutr 2003;
133:1158-1162.
81. Kanasugi H, Hasegawa T, Goto Y, Ohtsuka H, Makimura S, Yamamoto T. Single
administration of enterococcal preparation (FK-23) augments non-specific immune responses
in healthy dogs. Int J Immunopharmacol 1997; 19:655-659.
82. Rinkinen M, Jalava K, Westermarck E, Salminen S, Ouwehand AC. Interaction between
probiotic lactic acid bacteria and canine enteric pathogens: a risk factor for intestinal
Enterococcus faecium colonization? Vet Microbiol 2003; 92: 111—119.
83. Vahjen W, Manner K. The effect of a probiotic Enterococcus faecium product in diets of
healthy dogs on bacteriological counts of Salmonella spp. Campylobacter spp. and Clostridium
spp. in faeces. Arch Anim Nutr 2003; 57:229-233.
84. Pasupathy K, Sahoo A, Pathak NN. Effect of Lactobacillus supplementation on growth and
nutrient utilization in mongrel pups. Arch Tierernahr 2001; 55:243-253.
20
The Gastrointestinal Microbiota
of Farm Animals
Alojz Bomba, Zuzana Jonecova, Sofia Gancarcikova, and Radomfra Nemcova
Institute of Gnotobiology and Prevention of Diseases in Young,
University of Veterinary Medicine, Kosice, Slovak Republic
INTRODUCTION
The colonization of the digestive tract in animals begins soon after birth or hatching and
the normal microbiota changes dramatically during the life of the host. The composition
of gastrointestinal microbiota differs between animal species, between individuals within
the same species and between the body sites of the host. The gut microbiota is a complex
interactive community of organisms and its functions are the result of activities of all
microbial components. Together with the host, the microorganisms constitute an
ecological system, beneficial for the host, as well as for the microbial species. In
principle, the role of gut microbiota in animals is the same as in humans — salvaging
energy from the undigested feed components through fermentation, providing the basis
for a barrier that prevents pathogenic bacteria from invading the gastrointestinal tract,
protective functions together with the gut immune system, a role in metabolism
of xenobiotics and contribution to the vitamin and amino acids requirements of the
animals (1). Some of these functions are emphasized in farm animals with regard to their
environment, character of their feed and the economy of farm animals' rearing. The
composition and metabolism of the gastrointestinal microbiota affects the performance of
farm animals in many ways, especially in the young, which are subjected to many
stressful conditions.
Farm animals can be divided into three main groups according to the degree of
development of their gastrointestinal tract and efficacy of feed digestion: (1) omnivorous
animals — the feed of plant origin with small content of cellulose and lignin, as well as the
feed of animal origin is easily and quickly digested with a help of enzymes produced in
the gastrointestinal tract of the animal (pigs), (2) carnivorous animals — under natural
conditions they consume mostly feed of animal origin, (3) herbivorous animals — consume
feed of plant origin with high content of cellulose and lignin, which the animal is able to
digest exclusively through microbial fermentation by its gastrointestinal microbiota
(ruminants, horses). Herbivorous animals have some part of their gastrointestinal tract
adapted to microbial fermentation. The ruminants are polygastric animals with foregut
381
382 Bomba et al.
capacity 150-180L in adult cows. In horses, which are monogastric, the caecum with
capacity 100-140L is developed for microbial fermentation of lignin and cellulose.
The greatest differences in the composition of the microbiota of the gastrointestinal
ecosystem have been shown to occur between ruminants and monogastric animals.
Gradual changes in the composition of the gastrointestinal microbiota that take place
within an animal species are related to age (2). At an early age the microbiota of the
digestive tract of young animals is very similar. With the exception of poultry, this
similarity is related to the intake of maternal milk. During the suckling period, bacteria,
which can utilize the components of milk, predominate in the upper tract, and the milk
constituents evidently largely determine which microbe can be implanted in the
intestines. The forestomachs of ruminants have not yet started functioning and
the physiology of the digestive tract compares to that of monogastric animals. After
the animals start to consume creep feed and they are finally weaned, an adult type of
microbiota begins to develop in the upper and lower intestinal tract. At the same time the
main site of bacterial fermentation changes from the stomach to the large intestine or, in
ruminants, to the rumen.
Due to progressing of age, changes in the composition of the ingested feed and a
different morphological and functional development of the gastrointestinal tract, certain
differences gradually occur in the composition of the microbiota in calves, lambs, suckling
piglets and chicks that are typical for the given farm animal species. The gut ecosystem of
adult animals is stable and changes only due to the effects of external factors of an
adequate intensity (long-lasting change of feeds, stress, administration of antibiotics).
MICROBIOTA OF THE GASTROINTESTINAL TRACT IN FARM ANIMALS
The gastrointestinal ecosystem of animals is a complex, open, interactive system involving
the animal's environment and diet, the animal itself, and many microbial species. This
system regulates the course of the successional events and the population levels and
geographic distribution of the climax communities once they are formed. In adult animals
the microbial communities occupy many niches in habitats distributed from the center
of the lumen to the depths of the crypts, and from the oral cavity to the anus. Depending
upon the animal species any or all habitats may be occupied. The microbial communities
occupying the habitats are usually composed of autochthonous (indigenous) microbes.
A sample from any given habitat may at any given time yield allochthonous (non-
indigenous) microbes as well as indigenous ones. The allochthonous microbes derive from
what the animal ingested (feed, water, faeces) or from habitats above the one in question.
The gastrointestinal microbiota interact profoundly with their animal host,
influencing its early development, quality of life, ageing and resistance to infectious
diseases. One of the functions of the microbiota is to degrade dietary components such as
fiber in order to provide short-chain fatty acids and other essential nutrients that are
absorbed by the host. Animal hosts have incubation chambers such as the rumen (cattle,
sheep, goat) or the caecum (horse, chicken) in which bacterial fermentation proceeds
under optimal conditions. Those animals that have only small caeca, (pigs), have a
microbiota which has adapted to use "fast food" such as simple carbohydrates and proteins
that are consumed with the diet and available in the host's secretions such as saliva or
mucus (3).
In horses and poultry, so-called hind gut fermenters, the caecum fulfill a function
that is similar to that of the rumen in ruminants. The caecum is found in the anterior part of
The Gastrointestinal Microbiota of Farm Animals 383
the large intestine and its microbial activity can provide for about 30% of the nutritional
requirements of these animals.
In monogastric animals, the enzymes of the host ensure digestion of the feed despite
the fact that their digestive tract is rather short. Of the farm animal species pigs are typical
representatives of this group of animals. Humans are equipped with a similar type of
digestive tract. The large intestinal microbiota of pigs is the most numerous and most
varied one. Recent knowledge indicates a pronounced similarity of the ruminal, caecal and
large intestinal microbiota in animals.
Regulation of the composition and localization of microbial communities in the
gastrointestinal tract is a multi-factorial process in which any or all of these numerous
forces may come into play (4). Stability of the microecosystem of the digestive tract is
maintained by the interrelations of the microecosystem and the macroorganism as well as
by the interactions of the microorganisms in the ecosystem. On the part of the host,
both endogenous (age, host immunity, digestive tract motility and length, acidity) and
exogenous factors (diet) play an important role (5). On the other hand, the microbiota of the
digestive tract greatly affects the development of the host animal, mainly at an early age,
and plays a very important role in the animal's resistance to infectious diseases. The
interactions between microorganisms are mediated by competition for gut receptors and
nutrients as well as by the production of antimicrobial substances (6,7). The mechanisms of
bacterial interactions also mediate the barrier effect (8) or competitive exclusion (9), which
is the ability of the indigenous microbiota to prevent the implantation of allochthonous
microbes in the gastrointestinal tract. Knowledge of the mechanism of bacterial
interactions is an inevitable presupposition if optimization of the composition of the
gastrointestinal microbiota and stimulation of the beneficial effects of the latter on the host
animal are desired (10).
Pigs
The gastrointestinal tract of the piglets at parturition is sterile, but the gut microbiota
develops very rapidly. The first bacteria, which become established in the digestive tract of
the piglet, originate from the dam or the environment, but they are not the most abundant
ones of the ecosystems encountered by the young (11). The newborn possesses very
efficient selection systems enabling it to favor certain bacterial species among the bacteria
of the different ecosystems. Many factors might be involved in this selection — diet,
environmental conditions such as hygienic stage, temperature, the microbial interactions
in the digestive tract and the barrier effect of the dominant microbiota against the
environmental bacteria.
The indigenous microbiota exerts a profound influence on both the morphological
structure and on the digestive and absorptive capabilities of the gastrointestinal tract (12).
From the stomach of suckling piglets significant populations of microorganisms have been
isolated upto 10 viable counts per 1 cm of the tissue (13). The microbial population
adhering to the pars esophagea varies little from birth until after weaning and the anaerobic
microbiota, particularly lactobacilli, might be important in maintaining the pars esophagea
free from colonization by other microorganisms. The stratified squamosus epithelium, of
which the pars esophagea is composed, is continuously desquamating releasing cells with
attached bacteria into the lumen and may serve as a continuous inoculum of specific lactic
acid bacteria into the gastric contents (14).
In the small intestine, a fast transit time and digestive secretions such as bile acids
limit bacterial numbers and diversity. The gastrointestinal microbiota of the young piglets
is composed of facultatively anaerobic microorganisms in the proximal intestine
384 Bomba et al.
(duodenum, jejunum) whose number ranges from 10 to 10 per g content (11). This
number increases progressively in the ileum, and in the last parts of the digestive tract
strictly anaerobic bacteria are found among the dominant microbiota. In very young
piglets, Escherichia coli is the dominant microbe of all gut segments, together with species
of the genera Lactobacillus and Streptococcus. The microbiota of the piglet progressively
changes with age, the number of Escherichia coli decreases in all segments and the
lactobacilli and streptococci constitute the dominant microbiota of the proximal intestine.
The presence of lactobacilli as a constituent of the normal microbiota of the
gastrointestinal tract is considered to be beneficial to the porcine host (15). The strictly
anaerobic microbiota becomes more diversified in the distal segments, where Bacteroides,
Eubacterium, Peptostreptococcus and many Clostridium species are found (11).
The change of the gut environment occurs in connection to weaning of the piglets.
Weaning and weaning age have significant effects on microbial population and volatile
fatty acids concentration (16). During the first week after weaning, pH and the content of
dry matter decrease, as well as the count of lactobacilli, while the number of coliform
bacteria increases (17). These changes contribute to low weight gains and predisposition to
diarrhea. Associated with weaning there are marked changes to the histology and
biochemistry of the small intestine, such as villous atrophy and crypt hyperplasia, which
caused decreased digestive and absorptive capacity (18) and contribute to post- weaning
diarrhea. The major factors implicated in the etiology of these changes are: change in
nutrition, stress due to separation from mother and littermates, new environment, the
withdrawal of milk-borne growth promoting factors, as well as enteropathogens and their
interactions with the gut microbiota. Enterotoxigenic Escherichia coli strains are generally
considered to be the main cause of diarrhea at weaning and the period immediately
thereafter. The colonizing of the small intestine by enterotoxigenic E. coli strains may be
possible for several reasons (19): (1) the brush border of the intestinal epithelium of newly
weaned pigs may be damaged by components in the feed or by viruses allowing E. coli to
adhere and colonize the damaged epithelium, (2) after weaning the pigs are no longer
protected by the milk of the sow, an important factor that prevents E. coli colonization
during the suckling period, (3) newly weaned pigs have a shortage of digestive enzymes
and feed is poorly digested and absorbed.
Concentrations of bacteria in contents of the gastrointestinal tract of pigs are much
higher in the caecum and in colon than in more proximal portions of the tract. The
microbiota is dominated by strict anaerobes and the most numerous species are members
of the genera Bacteroides, Selenomonas, Butyrivibrio, Lactobacillus, Peptostreptococus
and Eubacterium (20). The development of a complex microbiota in the large intestine
takes 2-3 weeks after weaning. Starch and some oligosaccharides are mainly digested in
the small intestine of monogastric animals by enzymes of the salivary glands, pancreas and
intestinal brush border. Cellulose, hemicelluloses, pectins and some oligosaccharides are
partly digested by the microbiota of the large intestine. Fiber total digestibility varies
considerably and depends on the nature of the fiber and the animal species. It is less than
10% in chickens, whereas pigs seem to digest fibers as well as sheep (21). Dietary fiber
may contribute up to 30% of the maintenance energy needs of growing pigs. Higher
energy contributions may be obtained from dietary fiber fed to sows, along with some
improvements in reproduction, health, and well-being. Swine microbiota constitutes
highly active ruminal cellulolytic and hemicellulolytic bacterial species, which include
Fibrobacter succinogenes (intestinalis), Ruminococcus albus, Ruminococcus flavefaciens,
Butyrivibrio species, and Prevotella (Bacteroides) ruminicola (22). Additionally, a new
highly active cellulolytic bacterium, Clostridium herbivorans, has been isolated from pig
large intestine (23). The populations of these microorganisms are known to increase in
The Gastrointestinal Microbiota of Farm Animals 385
response to the ingestion of diets high in plant cell wall material. The numbers of
cellulolytic bacteria from adult animals are approximately 6 to 7 times greater than those
found in growing pigs. None of these highly active cellulolytic bacterial species are found
in the human large intestine. Thus, the pig large intestinal fermentation of fiber seems to
more closely resemble that of ruminants than that of humans (22).
Poultry
Bacterial colonization of the intestinal tract of poultry occurs after hatching when
the young bird starts to receive the feed. The esophagus of gallinaceous poultry creates the
crop, which serve as a store of the feed. The ingested feed in the crop is softened by water
and by secretion of salivary glands and the glands of esophagus. In water poultry, the
esophagus is able to widen throughout its length. The gastric juice produced in the gizzard
helps in chemical digestion of the feed. The gut of poultry is short and the caecum is
doubled. Soft feed passes through the digestive tract very fast (2 to 4 hours), crude feed
takes much longer (up to 20 hours). The poultry should be fed with feed of high nutritive
value due to the shortness and fast transit time of the intestinal content.
Lactobacillus microbiota lining the crop of the chicken gastrointestinal tract
becomes established within a few days after hatching and the specific adherence of avian
associated lactobacilli onto the crop epithelium plays a role in the colonization (24). From
the third day of life, large numbers of lactobacilli are present throughout the alimentary
tract (25). Recent research showed that freshly isolated lactobacilli from chickens are able
to adhere to the epithelium of crop, as well as to the follicle-associated epithelium and the
apical surface of mature enterocytes of intestinal villi (26).
Enterobacteriaceae and enterococci are present in large numbers in 3 -day-old
broilers but they start to decrease with the age. Lactobacilli, however, remain stable during
the growth of broilers. The presence of volatile fatty acids is responsible for the reduction
of Enterobacteriaceae in the broiler chicken. The amounts of acetate, butyrate and
propionate increase from undetectable amounts in 1 -day-old broilers to high
concentrations in 15-day-old broilers (27). Facultative anaerobic microbiota (streptococci,
lactobacilli and E. coli) comprise the predominant microbiota of the small intestine and
Salanitro and coworkers (28) found that the above-mentioned bacteria represent 60-90%
of the isolated bacteria. While the number of aerobic and anaerobic bacteria in duodenum
and ileum were in their study very similar, they found 10 1 ] anaerobic bacteria per g of dry
tissue in the caecum and the latter exceeded aerobe plate count by at least a factor 100. The
use of anaerobic methods developed for rumen bacteria have shown that the dominant
microbiota of the caecum is composed of strict anaerobes and the most frequently isolated
genera were Eubacterium, Clostridium, Eusobacterium, Bacteroides, Bifidobacterium,
Peptostreptococcus, and Lactobacillus (28,29). Scanning electron microscopy of the
intestinal epithelia of 14-day-old chickens revealed populations of microbes on the
duodenal, ileal and caecal mucosa surfaces (28).
The study of intestinal microbiota composition has relied almost exclusively on the
quantitative cultivation of microbes from samples. Culture results obtained in these studies
compose between 50 and 80% of total microscopic counts (30). Culture-based techniques
can be very selective, but never capture the total microbial community of complex
anaerobic habitats such as the avian gastrointestinal tract. Apajalahti and coworkers (31)
analyzed broiler chickens from eight commercial farms in Southern Finland for the
structure of their gastrointestinal microbial community by a non-selective DNA-based
method, percent G + C-based profiling and, in addition, a phylogenetic 16S rRNA gene-
based study was carried out to aid interpretation of the percent G + C profiles. Most of the
386 Bomba et al.
16S rRNA sequences found could not be assigned to any previously known bacterial genus
or they represented an unknown species of one of the taxonomically heterogeneous genera
such as Clostridium, Bacteroides and Eubacterium. Bacteria related to ruminococci and
streptococci were the most abundant members observed. The source of the feed and feed
amendment changed the bacterial profile significantly.
Horses
The intestinal tract of horses and other monogastric herbivores is characterized by a
combination of a large caecum and an even larger colon where fermentation and
absorption occurs. Bacteriological studies have shown that the equine intestinal
ecosystems contain several hundreds of microbial species, of which most are strict
anaerobes (32) and metabolic products from this microbiota provide the horse with a
significant part of its energy requirements. There is little information about the microbiota
of the small intestine in horses. However, like in the other species of animals, the total
microbial counts as well as E. coli and streptococci rise continuously from duodenum to
ileum; lactobacilli predominate in the duodenum (33). The acetate concentration increases
along the length of the small intestine and molar proportion of acetate, propionate and
butyrate 85:10:3 were found in hindgut (34). Acetate is a common fermentation end
product from intestinal anaerobes of the genera Bacteroides, Bifidobacterium,
Eubacterium, Propionibacterium and Selenomonas (35), and it is indicative for a diet
that is low in rapidly fermentable sugars or concentrates. From the data given by Colinder
and coworkers (36), horses have a lower total concentration of faecal short-chain fatty
acids than pigs, rats and man and even lower than the values in cows. The significantly
higher proportion of acetate can depend on its correlation to high-fiber diets and reflects a
difference in diets between horses and other monogastric species. Reduced faecal
excretion of absorbable compounds, as short-chain fatty acids, is probably due to
prolonged stay of digesta in the hindgut; four days or more (37). Daly and Shirgazi-
Beechey (38) obtained quantitative data on the predominant bacterial populations
inhabiting the equine large intestine by using group-specific oligonucletide probes. Results
showed the Spirochetaceae, the Cytophaga-Flexibacter '-Bacteroides assemblage, the
Eubacterium re dale- Clostridium coccoides group and unknown cluster C of Clostridia-
ceae to be the largest populations in the equine gut, each comprising 10-30% of the total
microbiota in each horse sampled. Other detected notable populations were the Bacillus-
Lactobacillus-Streptococcus group, Fibrobacter and unknown cluster B, each comprising
1-10% of the total microbial community.
Ruminants
The forestomach of cattle, sheep and goats consists of the reticulum, rumen and omasum
that are followed by the abomasum; the latter is an analogy of the stomach of monogastric
animals.
In young ruminants after birth, only the fourth stomach (abomasum) is functional and
its capacity is about twice that of the other compartments. In the adult ruminants, abomasum
represents only 8% of the total capacity. The volume of the rumen represents 80% of the
total (39). The difference between ruminants and non-ruminant animals results from the
morphological adaptation of their gastrointestinal tract to the consumption and utilization of
cellulose as well as their adaptation to utilization of the end products from the rumen
fermentation. The rumen provides an ideal environment for fermentation with relative
stable temperature and a continuous supply of the nutrients (40). The ruminal pH value in a
The Gastrointestinal Microbiota of Farm Animals 387
healthy animal is 6.2-6.8 and it is influenced by food, buffer capacity of the saliva, by
products of fermentation and by the animals' ability to absorb the latter through the rumen
wall. The microbial ecosystem of the rumen is one of the most complex, with wide variety of
interactions between microorganisms, between microorganisms and the host and between
microorganisms and the feed (41). The rumen microbial population consists of bacteria,
protozoa and fungi. The amount of rumen protozoa depends on the diet, but usually ranges
from 10 4 to 10 7 per ml of rumen digesta. Because of their sensitivity to low pH and sufficient
amount of nutrients, they can completely disappear from the rumen content. The rumen
anaerobic fungi take part in rumen fiber digestion (42).
The population of rumen bacteria is characteristic and indispensable for the
ruminal ecosystem. Bacteria in the rumen adhere to the epithelium of the rumen wall, to
feed particles, or they move freely in the contents (43). Bacteria adhering to the
epithelium of the rumen wall are considered to be the regulating factor of the rumen
microbiota (44). At the age of 9 to 13 weeks the ruminal microbiota of the calf is similar
to that of an adult animal. The number of rumen bacteria ranges from 10 9 to 10 11 per ml
of rumen digesta and depends on the diet and the time of sampling after feeding (45).
The permanent microbiota consists of more than 60 species of bacteria and the
concentration of dominant species ranges from 10 to 10 per ml of rumen digesta. The
most important species are divided in to metabolic groups according to their main
substrates which they are able to ferment (46) — cellulolytic (Bacteroides succinogenes,
Ruminococcus albus, Ruminococcus flavefaciens), amylo- and dextrinolytic (Bacteroides
amylophylus, Streptococcus bovis, Succinomonas amylolytica, Succinivibrio dextrino-
solvens), saccharolytic (Bacteroides ruminicola, Butyrivibrio fibrisolvens, Megasphaera
elsdenii, Selenomonas ruminantium) and hydrogen-utilizing bacteria (Methanobacter
ruminantium, Vibrio succinogenes). The most important attributes of the ruminal
microbiota are the ability to hydrolyse cellulose, synthesize amino acids, produce
volatile fatty acids and vitamins. In the young of ruminants, lactate-utilizing bacteria,
among them Megasphaera elsdenii, Veillonella alcalescens and Selenomonas
ruminantium (47), are of great importance. Comparative Polymerase Chain Reaction
(PCR) assays were developed for enumeration of the rumen cellulolytic bacterial species:
Fibrobacter succinogenes, Ruminococcus albus and Ruminococcus flevefaciens (48).
Enumeration of the cellulolytic species in the rumen and alimentary tract of sheep found
Fibrobacter succinogenes dominant; 10 per ml of rumen digesta compared to
Ruminococcus species (10 4-6 per ml). All three species were detected in the rumen,
omasum, caecum, colon and rectum, the numbers at these sites varied within and
between animals.
INFLUENCING THE ECOSYSTEM OF THE DIGESTIVE TRACT
IN FARM ANIMALS
In farm animals the microbiota of the digestive tract plays an important role both in
the process of optimal development and growth of the organism as well as in securing the
resistance of animals to diseases. However, due to various adverse impacts, disturbances
of optimum growth, production and health state of the animals are rather frequent in
animal production.
Abrupt change of feed, weaning, stress, administration of antibiotics at therapeutical
dosage and pathogenic microorganisms can all be classified among these adverse factors.
All of them disturb the stability and composition of the natural microbiota of the digestive
tract, thus disturbing physiological processes and resistance of the organism to diseases;
388 Bomba et al.
they slow down growth, decrease the performance or lead to diseases of farm animals.
From these facts it is obvious that in order to minimize the negative effects of adverse
factors it is essential to give targeted and efficient support to the beneficial microbiota of
the digestive tract that plays an important part in the physiological processes and in the
resistance of the organism to diseases. In order to ensure optimum growth, production and
health of the farm animals the beneficial microbiota of the ecosystem of the digestive tract
can be supported by manipulation of the diet and application of probiotic microoraganisms.
Growth-promoting antibiotics will be banned in the European Union by 2006 and similar
measures may be expected in other countries in the future. From this point of view, it is
necessary to search for naturally occurring alternatives to antibiotics. The manipulation of
the gastrointestinal microbiota by diet and application of probiotics could represent such
safe alternative to antimicrobials.
Manipulation of the Gastrointestinal Microbiota by Diet
Dietetic methods can be used to positively influence the development of the rumen
microbiota of young ruminants during the period of milk nutrition and transition from milk
to plant feeding; in monogastric animals, mainly pigs, these methods can be used for the
same purpose mainly at the time of weaning.
The influence of the feed amount and quality upon the ecosystem of the digestive
tract is of extraordinary importance (49). If the diet is changed from roughage to grain, the
rumen microbiota and microfauna and the final products of these elements undergo
changes as well (50). Dietetic stimulation of the rumen microbiota of ruminants comprises
several ways of manipulating the feeds offered to the animals, among them changing the
composition of the feeds, the form of the feeds as well as the time of starting feeding dry
feeds to milk-fed animals. Adverse factors such as regulation of milk feeding or feeding
frequency may also be used to influence the development of the rumen microbiota or
rumen digestion. A gradual decrease of the amount of milk forces the animals to
supplement the missing nutrients by taking in dry grain and later forage feeds, which
accelerates the functional and morphological development of the rumen (51-53).
Cruy wagen and Horn (54) point at the possibility of influencing dry fodder intake by the
composition of the liquid diet. According to these authors a factor is present in the bovine
colostrum that stimulates the intake of dry concentrate feed. Bush and Nicholson (55) also
stated that it would be possible to increase the intake of dry feeds during the period of milk
nutrition and thus to affect changes in the microbiota of the digestive tract of calves by the
addition of formic acid. In these animals feeding a pre-starter mixture and weaning at an
early age have a very positive effect on the functional development of the rumen (56).
Feed composition is of decisive importance for the stimulation of rumen digestion in
ruminant young in the period of predominant milk nutrition. The amount of dry feeds is
only of secondary importance. Easily fermentable grains are vital for the development of
the amylolytic microbiota while roughage, silage, hayage and hay are decisive for the
cellulolytic one. With respect to the development of the functions of the forestomachs
intake of high-quality hay and grain is of vital importance (57,58). Since calves do not
consume great amounts of hay in the first eight weeks of life, the level of rumen
metabolism during the period of milk nutrition can be positively affected mainly by a
suitable composition of the starter mixture (59). With progressing age and maturation of
the rumen, cellulolytic microbiota gradually develops and increased amounts of hay,
hayage and silage can be offered to the calves. The cellulolytic activity of rumen bacteria
is stimulated by isoacids that develop during the catabolism of certain amino acids. Isoacid
levels in the rumen can be increased by a diet that is rich in concentrate and proteins (60).
The Gastrointestinal Microbiota of Farm Animals 389
Dietetic methods can also be used to influence the microeco system of the intestinal
tract in piglets during weaning. At this period important morphological and functional
changes occur in the digestive tract of piglets that are also accompanied by changes in the
composition of the gut microbiota (17,61). In the first days after weaning Lactobacillus
populations decrease considerably whereas the numbers of coliforms increase. In piglets
the brush border of the intestinal epithelium can be damaged by feed components (62) or
viruses (63); such damage enables enterotoxigenic E. coli to colonize the injured
epithelium. Important factors that the piglets had been receiving by maternal milk and that
prevented E. coli from colonizing the gut (64) are no more at the animals' disposal. All
these changes support the tendency to low weight gain and predispose to the occurrence of
the diarrheic syndrome. Several researchers tried to influence the morphological and
functional development of pigs during the weaning period in order to optimize digestion
and to minimize the danger of the post- weaning diarrheic syndrome. Adjustment of the
form of feeds seems to positively influence morphological development of the intestinal
epithelium in weaned piglets. On days 8 and 1 1 after weaning Deprez and coworkers (65)
observed the intestinal villi to be higher in the piglets fed pulpy feeds than in those
receiving the same composition in pellets. The higher villi observed in the piglets
receiving pulpy feeds may reflect an increased level of energy intake. This assumption has
been confirmed by the findings of Partridge and coworkers (66) who stated weanlings
receiving dry feed in the form of a pulp consume more feed and grow more rapidly than
piglets receiving the same feed as pellets. Beers-Schreurs and coworkers (67) concluded a
decreased energy intake during the post-weaning period to be the main cause of villar
atrophy. If it is our aim to influence the development of the digestive tract during the
weaning period, then the finding of Kelly and coworkers (12) according to whom
continuous presence of feeds in the lumen plays an important part in the integrity of
intestinal morphology and function is of extreme importance. McCracken (68) stated that a
low intake of feed after weaning might cause morphological and functional changes in the
intestinal tract. Pluske (69) pointed out that if nutritional stress caused by discontinuation
of feed intake at weaning could be overcome, transition from maternal milk to solid feeds
would be less traumatic to the piglets. Milk intake after weaning seems to have
pronounced stimulating effects upon growth and functioning of the mucosa; it promotes
the integrity of the small intestine and supports the growth of piglets by increasing or
maintaining the digestive and absorption capacity. Pluske and Williams (70) demonstrated
that the height of villi and depth of crypts in weanlings can be maintained by feeding fresh
cow's milk at two-hour intervals immediately after weaning.
It is important to stress that current modern methods of rearing frequently employ
early and abrupt weaning, which increases the predisposition to diseases of the digestive
tract. The most pronounced changes in the morphology of the intestine, its enzyme
capacity, in the physiology of digestion and the microbiota of the digestive tract occur in
the period after weaning. For this reason the composition of feeds during the period of
transition from milk to plant-based nutrition should take into account the morphological
changes of the digestive tract and the level of its functional development.
Manipulation of the Gastrointestinal Microbiota by Application
of Probiotic Microorganisms
Administration of preparations based on autochthonous microorganisms is a very effective
method of affecting the microbiota of the gastrointestinal tract in farm animals. In this way
development of the microbiota of the young at an early age and around weaning can
be influenced.
390 Bomba et al.
Development of the rumen microbiota in calves and lambs can be supported by
microbial preparations mainly at the start of dry feeding. Effective use of microbial
preparations in the young depends also on the level of knowledge of the so-called
environmental factors in the rumen which determine the age at which a given
microorganism may colonize the rumen and enable the development of cellulolytic
microbiota (71). The specificity of using probiotics in calves, lambs and goatlings consists
in the possibility of influencing the formation of the ruminal ecosystem; application of
selected strains of rumen microorganisms lays the foundation of a future population
showing a high fermentation activity. Colonization with selected cultures of living
microorganisms should enable an earlier and more stable onset of the ruminal type of
digestion. Controlled action on the rumen microbiota in the young during milk nutrition is
mainly related to the effect upon development of the microbiota adhering to the epithelium
of the rumen wall. The effects of stimulation can be expected to be most pronounced at the
period of the most rapid development of the adherent microbiota, at 2 to 3 weeks of age.
Autochthonous species colonizing the rumen immediately after birth are of decisive
importance. This microbiota, though simple at the beginning, enables the development of
a cellulolytic population and that of ruminal digestion. Strains of Streptococcus bovis may
be used to stabilize rumen fermentation. During a 4-week administration of a colonizing
preparation containing S. bovis AO 24/85 to lambs the numbers of S. bovis germs adhering
to the rumen epithelium were significantly increased (p< 0.001) and so was their alpha-
amylase activity (72). In order to promote the development of the ruminal microbiota
Kopecny and Simunek (73) used a mixture of rumen bacteria that contained amylolytic,
cellulolytic, hemicellulolytic, saccharolytic, proteolytic and lactate-utilizing strains.
It is of great importance to influence the intestinal microbiota of calves, piglets and
poultry at an early age since this is the period when the danger of diarrhea-accompanied
diseases of the digestive tract reaches its maximum. Due to their high morbidity and
mortality rates such diseases present an extraordinarily serious health and economic issue.
Preventive application of probiotics at an early age helps to optimize the composition of the
gut microbiota and has an inhibitory effect upon the pathogens of the digestive tract in the
young of farm animals. Preventive application of Lactobacillus casei at a dose of 1.10
germs decreased the counts of enterotoxigenic E. coli O101:K99 adhering to the small
intestinal mucosa of gnotobiotic lambs by 99. 1 % and 76.0% on day 2 and 4 after inoculation,
respectively (74). Perdigon and coworkers (75) found the preventive effect of L. casei and
yoghurt against Salmonella typhimurium infections in mice to depend on the duration of
administration. The short-term preventive application of Lactobacillus paracasei (76)
induced slight decrease in number of E. coli adhered to jejunal mucosa of gnotobiotic
piglets, while continuous application led to significant (p < 0.05) decrease (Fig. 1). Thomke
and El winger (77) and Mead (78) suggested that it seems possible to lower enteropathogens
(E. coli and Salmonella) but not to control them by administering Lactobacillus acidophilus.
Increased lactic acid production in the small intestine of pigs fed lactobacilli and
yeast caused a decrease in intestinal pH and the presence of E. coli within in intestinal
content (79).
Potentiation of the probiotic effect of microorganisms seems to be possible by
combining them with synergically acting components of natural origin. As such, prebiotics
(mainly oligosaccharides), substrates and metabolites of microorganisms and phyto-
components are taken into consideration. Bomba and coworkers (80) showed that the
administration of L. paracasei alone had almost no inhibitory effect on the adhesion of
E. coli to the jejunal mucosa of gnotobiotic and conventional piglets while L. paracasei
administered together with maltodextrin decreased the number of E. coli colonizing the
The Gastrointestinal Microbiota of Farm Animals
391
log 10. cm- 2
short-term
continual
Figure 1 Colonization of the jejunal mucosa of gnotobiotic piglets by Escherichia coli 08: K88 at
short-term and continual preventive application of Lactobacillus paracasei. ( □ ) Control group E;
( ■ ) experimental group L-E. Source: From Ref. 76.
jejunal mucosa of conventional piglets by 2.7 logarithm (4.75 log 10/cm ) in comparison
to the control group (7.42 log 10/cm , p<0.05).
Findings reported by Nemcova and coworkers (81) pointed at the fact that the
probiotic effect of microorganisms could be potentiated by combining them with
prebiotics. The application of L. paracasei combined with fructooligosaccharides to
piglets for the first 10 days of life and 10 days after weaning revealed an effect upon
bacterial counts in the faeces that was significantly more positive than that of lactobacilli
only. With this combination significantly increased counts of Lactobacillus species,
Bifidobacterium species, total anaerobes and aerobes as well as significantly decreased
counts of enterococci were stated in the faeces when compared to the control as well as the
Lactobacillus only group. Comparison with the controls revealed the combination of
lactobacilli and fructooligosaccharides to result in a significant decrease of Clostridium
and Enterobacteriaceae and an insignificant decrease of coliform counts in the faeces of
piglets. These results prove a synergically positive effect of L. paracasei and
fructooligosaccharides in the faecal microbiota of piglets (Table 1).
Our results showed that the application of L. paracasei combined with
fructooligosaccharides and maltodextrin decreased the preweaning mortality of piglets
(Fig. 2). The field trial lasted eight months and comprised 4000 heads of 1-35 days old
piglets and the results were compared with the same period of the previous year in which
antibiotic feed additivies were used.
Competition for receptors on the intestinal wall is one of the mechanisms that
mediates the inhibitory effect of probiotic microorganisms on the adhesion of pathogens to
the intestinal mucosa. Based on this fact it can be hypothesized that an increase in the
number of probiotic microorganisms colonizing the intestinal epithelium may potentiate
their probiotic effect. From this point of view the findings of Ring0 and coworkers (82)
about the effects of lipids containing feeds on the gastrointestinal microbiota and
especially on the population of lactobacilli are of great interest. According to Kankaanpaa
and coworkers (83) higher concentrations of polyunsaturated fatty acids inhibited the
growth and mucus adhesion of selected lactobacilli whilst growth and mucus adhesion of
Lactobacillus casei Shirota was promoted by low concentrations of y-linolenic acid and
arachidonic acid. In gnotobiotic piglets oral administration of oil that contained
polyunsaturated fatty acids significantly increased the numbers of Lactobacillus paracasei
392
Bomba et al.
Table 1 Composition of Fecal Microbiota in Weanling Pigs Receiving Lactobacillus paracasei
and Mixture of Lactobacillus paracasei and Fructooligosaccharides
Organisms
Group 1
Group 2
Group 3
Total anaerobes
9.8±0.2
9.8 + 0.3
10.2 + 0.2 a*, b*
Total aerobes
8.0 + 0.5
8.2 + 0.2
9.3 + 0.7 a*, b*
Bifidobacterium
7.5 + 0.3
7.1+0.7
8.3 + 0.3 a*, b*
Lactobacillus
9.9 + 0.1
9.9 + 0.3
10.3 + 0.1 a**, b*
Enterococcus
9.3 + 0.1
9.3 + 0.3
8.2 + 0.2 a ***,b***
Clostridium
8.1+0.1
7.4 + 0.4 a*
7.7 + 0.3 a*
Enterobacteriaceae
7.9 + 0.4
6.5 ±0.9 a*
5.9 + 0.9 a"
Coliforms
6.8±0.7
6.3 + 0.7
5.8 + 0.7
Values are mean + SEM of log bacteria counts per gram of wet feces (n = 7). Group 1-
Group 2 — Lactobacillus paracasei. Group 3 — Lactobacillus paracasei and FOS.
(a) Significantly different from control group.
(b) Significantly different from Lactobacillus paracasei group.
*p<0.05; **p<0.01; ***p<0.001.
Source: From Ref. 81.
-control.
adhering to the jejunal mucosa as compared to the control group (84). It is suggested that
polyunsaturated fatty acids could modify the adhesion sites for gastrointestinal
microorganisms by changing the fatty acid composition of the membranes of the
intestinal epithelial cells (82). The ability of probiotics to adhere to mucosal surfaces is a
presupposition of their health-promoting effects. The stimulatory effect of polyunsaturated
fatty acids upon the adhesion of lactobacilli could be used to enhance the effectiveness of
probiotics in inhibiting the pathogens of the digestive tract.
Early colonization of the gut by an autochthonous microbiota protects chickens from
Salmonella infection. The direct competition for the site of attachment is suggested to be
the prime mechanism for the competitive exclusion (85) and development of a bionTm
of protective microbiota was observed using scanning electron microscopy. The method of
competitive exclusion constitutes an additional prophylactic method that may be applied
directly in the animal to enhance its resistance towards Salmonella infection (86). It is also
considered a possible application in preventing colonization of poultry with E. coll 0157
%
August September October November December January February
Figure 2 Total preweaning mortality of the piglets during control period July 2000-February
2001 and during experimental period July 2001-February 2002. (□) 2000, 2001 (■) 2001, 2002.
The Gastrointestinal Microbiota of Farm Animals 393
and Campylobacter jejuni (78). Optimal protection against S. typhimurium was observed
when broiler chicks were treated with a culture of caecal microbiota in combination with
dietary lactose (87). The same results were described in turkey poultry (88) and layer
chicks (89). In poultry, lactose can also be considered a prebiotic because of absence of the
endogenous lactase. The lactose is converted into lactic acid by fermentation of hindgut
microbiota. The decrease of intestinal pH results in reduction of the S. typhimurium
concentration.
THE USE OF GNOTOBIOTIC ANIMALS IN STUDIES OF THE
GASTROINTESTINAL MICROBIOTA IN FARM ANIMALS
Gnotobiotic animals proved to be a very useful model for studying the physiology of
the digestive tract. They mainly enable observation of the role of microorganisms in the
process of the functional and morphological development of the digestive tract and
the investigation of bacterial interactions and their influence on the macroorganism. A key
experimental strategy for defining the conversations that occur between microorganisms
and their hosts is to first define cellular function in the absence of bacteria (under germ-free
conditions) and then to evaluate the effects of adding a single or defined population of
microbes. The power of germ-technology lies in the ability to control the composition of the
environment in which a multicellular organism develops and functions. The combined use
of genetically manipulatable model organisms and gnotobiotic has the potential to provide
new and important information about how bacteria affect normal development, establish-
ment and maintenance of the mucosa-associated immune system, and epithelial cell
functions. Gnotobiology can help to provide new insights into the aetiology of infectious
diseases. The combination of gnotobiotics and molecular genetics should provide a deeper
understanding of how pathogens arise, how they gain control of their habitat, and what
contributions are made by the "normal" gut inhabitants to the pathogenesis of diseases.
Such understanding, in turn, could lead to the development of novel chemicals and
microbes for use in prebiotic and probiotic strategies in order to prevent or cure infectious
diseases and perhaps also immune disorders. For a more extensive review on research with
germ-free and gnotobiotic animals, see the chapter by Norin and Midtvedt.
Gnotobiotic Ruminants in Studies into the Microbiota
of the Gastrointestinal Tract
Gnotobiotic ruminants can be used to observe the development of the rumen ecosystem as
well as to study the relations between rumen and its microbiota. The rumen microbiota
directly affects the development of the rumen epithelium and the level of intermediary
metabolism by the action of rumen fermentation and its final metabolites. Fonty and
coworkers (90), using meroxenic lambs demonstrated that the functions of the rumen
and the stability of the ecosystem depended on the complexity and diversity of the
microbiota. In the light of the present knowledge it is not possible to precisely determine
the composition of the minimum microbiota enabling rumen development and function.
Fonty and coworkers (91) also studied the role of rumen microbiota in the development of
the rumen ecosystem and functional development of the rumen at an early age. Their
results suggest that the rumen microbiota of the very young lamb plays an essential role in
the establishment of the rumen ecosystem and in the onset of the digestive functions.
Those bacterial species that colonize the rumen immediately after birth when this organ is
not yet active, contribute to a biotope favoring the establishment of cellulolytic strains and
394 Bomba et al.
the set-up of digestive processes that affect both degradation of the lignocellulose-rich
feeds and fermentation of the resulting soluble compounds. Ecological factors controlling
the establishment of cellulotytic bacteria and ciliate protozoa in the lamb rumen were
studied in meroxenic lambs (92). The results obtained in this study suggested that the
establishment of cellulolytic bacteria and protozoa required an abundant and complex
microbiota and was favored by an early inoculation of the animals. All above-mentioned
results point at the extremely important role of the microbiota in the development of the
rumen. There is a good relationship between the development of rumen function and
the complexity of its microbiota. The presence of a simple microbiota cannot assure the
digestive function as properly as a complex microbiota can. Bomba and coworkers (93)
used the gnotobiotic approach to observe the development of rumen fermentation in lambs
from birth up to 7 weeks of age in association to the complexity of the digestive tract
ecosystem. The results obtained indicated that complexity of rumen microbiota
significantly affected the development of rumen fermentation both from the quantitative
and the qualitative viewpoint.
The fact that early inoculation of the animals is a factor favoring fermentation and
digestive activities in the rumen is probably related to the action of bacteria on the
development of papillae, the rumen mucosa and the digestive tract (94). A complex
microbiota presents an inevitable presupposition of optimal development of the alimentary
tract in ruminants.
Colonization of the individual gut segments by lactobacilli and the inhibitory effect
of Lactobacillus casei upon the adhesion of enterotoxigenic E. coli K 99 to the intestinal
wall were also studied in gnotobiotic lambs (74). Soares and coworkers (95) and Lysons
and coworkers (96) compared several parameters of the morphological and functional
development in germ-free, gnotobiotic and conventional lambs.
Monogastric Gnotobiotic Animals in Studies
of the Gastrointestinal Microbiota
Monogastric gnotobiotic animals were also used to study the functional and morphological
development of the digestive tract. Nemcova and coworkers (97) studied the colonization
ability of selected strains of lactobacilli in the small intestine of gnotobiotic piglets.
Studies were also aimed at the effects of lactobacilli on the intestinal metabolism during
the first 3 weeks of life (98). The numbers of lactobacilli adhering to the jejunal and ileal
mucosa and found in the jejunal and ileal contents were comparable to the data reported by
other authors (99,100) in conventional and gnotobiotic piglets. Bomba and coworkers
(101) investigated the effect of the inoculation of three Lactobacillus strains upon organic
acid levels in the mucosal film and intestinal contents of gnotobiotic pigs. In the jejunum
of inoculated animals, the mucosal film revealed significantly increased levels of lactic,
propionic and acetic acids when compared to the contents. In the ileum of gnotobiotic pigs
propionic acid levels in the mucosal film were significantly higher than those in the
contents. The above results suggest that significantly increased levels of the lactobacilli-
produced organic acids in the intestinal mucosal film may present an efficient barrier to
inhibit the adherence of digestive tract pathogens to the intestinal mucosa.
Gnotobiotic animals present a very good model to determine bacterial interactions in
the digestive tract. The interactions of lactobacilli and enterotoxigenic E. coli in the
intestinal tract of gnotobiotic piglets were observed by Bomba and coworkers (80).
In experiments carried out in gnotobiotic animals the interest focused on the effects of
the microbiota upon morphology, motility, secretion and absorption in the digestive
tract (102,103). The use of germ-free, gnotobiotic and conventional animals facilitated
The Gastrointestinal Microbiota of Farm Animals 395
considerable progress in the knowledge of the complex ecological system of the
gastrointestinal tract in birds (104).
CONCLUSION
The gastrointestinal microbiota plays a very important role in the physiology of farm
animals. Despite substantial knowledge of this ecosystem, it is necessary to obtain
additional information on the mechanisms mediating their interactions. Such knowledge
will facilitate the optimization of the development and function of gastrointestinal
microbiota of, especially young, farm animals. It can be expected, that new
biotechnological and natural methods for manipulation of gastrointestinal microbiota
will be developed. These methods will enable to replace prophylactic antibiotic use in
farm animals' diet and will contribute to the production of healthy and safe foods while at
the same time benefiting the environment. Several useful in vitro methods are used to
study gastrointestinal microbiota. It seems that germ-free and gnotobiotic animals could
represent, in conjunction with in vitro methods, a helpful base for the complex study of
gastrointestinal ecosystem in farm animals.
REFERENCES
1. Salminen S, Boulez C, Boutron-Ruault M-C, et al. Functional food science and
gastrointestinal physiology and function. Brit J Nutr 1998; 1:147-171.
2. Smith HW. The development of the flora of the alimentary tract in young animals. J Path Bact
1965;90:495-513.
3. Carman RJ, Roger L, van TMS, Tracy DW. The normal intestinal microflora: ecology
variability and stability. Vet Human Toxicol 1993; 35:11-14.
4. Savage DC. Microbial ecology of the gastrointestinal tract. Ann Rev Microbiol 1977;
31:107-133.
5. Tannock GW. Effects of dietary of environmental stress on the gastrointestinal microbiota. In:
Hentges DJ, ed. Human Intestinal Microbiota in Health and Disease. London: Academic
Press, 1983:517-539.
6. Piard JC, Desmazeaud M. Inhibiting factors produced by lactic acid bacteria. 1. Oxygen
metabolites and catabolism and products. Lait 1991; 71:525-541.
7. Freter R. Factors affecting the microecology of the gut. In: Fuller R, ed. Probiotics: The
Scientific Basis. London: Chapman and Hall, 1992:111-114.
8. Ducluzeau R, Bellier M, Raibaud P. Transit digestif de divers inoculums bacteriens into duits
"per os" chez des souris axeniques ou "holoxeniques" (conventionelles) effect antagoniste de
la microteore dutractus gastrointestinal. Zbl Bacteriol I Abt Orig 1970; 213:533-548.
9. Lloyd AB, Cumming RB, Kent RD. Prevention of Salmonella typhimurium infection in
poultry by pretreatment of chickens and poults with intestinal extracts. Austral Vet J 1977;
53:82-87.
10. Stavric S, Kornegay ET. Microbial probiotic for pigs and poultry. In: Wallace RJ, Chesson A,
eds. Biotechnology in Animal Feeds and Animal Feeding. Weinheim, Germany: VCH
Verlagsgesellschaft mbH, 1995:205-231.
1 1 . Ducluzeau R. Implantation and development of the gut flora in the newborn piglet. Pigs News
Inf 1985; 4:415-418.
12. Kelly D, Begbie R, King TP. Postnatal intestinal development. In: Valey MA, Williams PEV,
Lawrence TLJ, eds. Neonatal Survival and Growth. Edinburgh, UK: Occasional Publication,
British Society of Animal Production, 1992; 15:63-79.
396 Bomba et al.
13. McGillvery DJ. Anaerobic microflora associated with the pars oesophagea of the pig. Res Vet
Sci 1992;53:110-115.
14. Fuller R, Barrow PA, Brooker BE. Bacteria associated with the gastric epithelium of neonatal
pigs. Appl Environ Microb 1978; 35:582-591.
15. Tannock GV. The microecology of lactobacilli inhabiting the gastroinetstinal tract. Adv
Microb Ecol 1990; 11:147-171.
16. Franklin MA, Mathew AG, Vickers JR, Clift RA. Characterization of microbial populations
and volatile fatty acid concentrations in the jejunum, ileum, and cecum of pigs weaned at 17
versus 24 days of age. J Anim Sci 2002; 80:2904-2910.
17. Jensen BB. The impact of feed additions on the microbial ecology of the gut in young pigs.
J Anim Feed Sci 1998; 7:45-64.
18. Pluske JR, Hampson DJ, Williams IH. Factors influencing the structure and function of the
small intestine in the weaned pig: a review. Liv Prod Sci 1997; 51:215-236.
19. Nabuurus MJA. Microbiological, structural and functional changes of the small intestine of
pigs at weaning. Pig News Inf 1995; 16:93-97.
20. Robinson IM, Allison MJ, Bucklin JA. Characterization of the cecal bacteria of normal pigs.
Appl Environ Microbiol 1981; 41:950-955.
21. Champ M. Carbohydrate digestion in monogastric animals. Reprod Nutr Dev 1985; 25:819-842.
22. Varel VH, Yen JT. Microbial perspective on fiber utilization by swine. J Anim Sci 1997;
75:15-22.
23. Varel VH, Tanner RS, Woese CR. Clostridium herbivorans sp.nov. a cellulolytic anaerobe
from the pig intestine. Int J Syst Bacteriol 1995; 45:490-494.
24. Fuller R. Ecological studies of the Lactobacillus flora associated with the crop epithelium of
the fowl. J Appl Bacteriol 1973; 36:131-139.
25. Barnes EM, Impey CS, Cooper DM. Manipulation of the crop and intestinal flora of the newly
hatchet chicks. Am J Clin Nutr 1980; 33:2426-2433.
26. Edelman S, Westerlund-Wikstrom B, Leskela S, et al. In vitro adhesion specificity of
indigenous lactobacilli, within the avian intestinal tract. Appl Environ Microb 2002;
68:5155-5159.
27. van der Wielen PW, Biersterveld S, Notermans S, Hofstra H, Urlings BA, van Knapen F. Role
of volatile fatty acids in development of the cecal microflora in broiler chickens during
growth. Appl Environ Microb 2000; 66:2536-2540.
28. Salanitro JP, Blake IG, Muirhead PA, Maglio M, Goodman JR. Bacteria isolated from
duodenum, ileum and cecum of young chicks. Appl Environ Microb 1978; 35:782-790.
29. Adami A, Cavazzoni V. An experimental standard pattern of assessing the cecal microflora of
chicken. Ann Microb Enzimol 1993; 43:329-336.
30. Tannock GW. Molecular assesment of intestinal microflora. Am J Clin Nutr 2001;
73:410-414.
31. Apajalahti JH, Kettunen A, Bedford MR, Holben WE. Percent G + C profiling accurately
reveals diet-related differences in the gastrointestinal microbial community of broiler
chickens. Appl Environ Microb 2001; 67:5656-5667.
32. Julliand V. Microbiology of the equine hindgut. 1 . European conference on the nutrition of the
horse. Pferdeheilkunde: Sonderausgabe, 1992:42-47.
33. Frey K, Sasse HHL. Zur darmflora des pferdes-eine literaturstudie. Pferdeheilkunde 1996;
6:855-863.
34. Mackie RI, Wilkins CA. Enumeration of anaerobic bacterial microflora of the equine
gastrointestinal tract. Appl Environ Microb 1988; 54:2155-2160.
35. Holdeman LV, Cato EP, Moore WEC. 4th ed. Anaerobe laboratory manual. Blacksburg:
Virginia Polytechnic Institute and State University, 1977.
36. Collinder E, Lindholm A, Midtvedt T, Norin E. Six intestinal microflora-associated
characteristics in sport horses. Equine Vet J 2000; 32:222-227.
37. Cuddeford D, Pearson RA, Archibald RF, Miurhead RH. Digestibility and gastro-intestinal
transit time of diets containing different proportions of alfalfa and oat straw given to
Thoroughbreds, Shetland ponies, highland ponies and donkeys. Anim Sci 1995; 61:407-417.
The Gastrointestinal Microbiota of Farm Animals 397
38. Daly K, Shirazi-Beechey SP. Design and evaluation of group-specific oligonucleotide probes
for quantitative analysis of intestinal ecosystems: their application to assessment of equine
colonic microflora. FEMS Microb Ecol 2003; 44:243-252.
39. Roy JHB. The calf. London: Butterwors, 1980.
40. Russell JB, Hespell RB. Microbial rumen fermentation. J Dairy Sci 1981; 64:1153-1169.
41. Gall LS. Significance of microbial interaction in control of microbial ecosystem. Biotech
Bioeng 1970; 12:333-340.
42. Bauchop T. The anaerobic fungi in rumen fiber digestion. Agri Environ 1981; 6:339-348.
43. Cheng KJ, McCowan RP, Costerton JW. Adherent epithelial bacteria in ruminants and their
roles in digestive tract function. Amer J Clin Nutr 1979; 32:139-148.
44. Cheng KJ, Stewart CS, Dinsdale D, Costerton JW. Electron microscopy of bacteria involved
in the digestion of plant cell walls. Anim Feed Sci Tech 1984; 10:93-120.
45. Bartos S. Microbiology and biochemistry of digestion in rumen of ruminants. Praha:
Academia, 1987.
46. Baldwin RL, Allison MJ. Rumen metabolism. J Anim Sci 1983; 2:461-477.
47. Kmet V, Baran M, Kalacnjuk GI. Manipulation of rumen ecosystem in calves and lambs by
microbiological preparations. Bratislava: Veda, 1990.
48. Koike S, Kobayashi Y. Development and use of competitive PCR assays for the rumen
cellulolytic bacteria: Fibrobacter succinogenes, Ruminococcus albus and Ruminococcus
flavefaciens. FEMS Microb Lett 2001; 204:361-366.
49. Smith HW. The development of the bacterial flora of the faeces of animals and man: the
changes that occur during ageing. J Appl Bact 1961; 24:235-241.
50. Berger LL. Effects of diet composition on rumen fermentation. ISI Atl Sci Anim Plant Sci
1988; 1:178-182.
51. Lynch GP, Bond J. Relationship of lactose to nitrogen matabolism of artificially reased beef
calves. J Dairy Sci 1983; 66:2544-2550.
52. Stewart GD, Schingoethe DJ. Evaluation of high starch and high fat rations for dairy calves.
J Dairy Sci 1984; 3:598-605.
53. Kertz AF, Reutzel LF, Mahoney JH. Ad libitum water intake by neonatal calves and its
relationship to calf starter intake, weight gain, feces score and season. J Dairy Sci 1984;
67:2964-2969.
54. Cruywagen CW, Horn JG. Pre-weaning growth and feed intake of dairy calves receiving
different combinations of soya bean flavour, whey powder and colostrum. S Afr J Anim Sci
1985; 15:11-14.
55. Bush RS, Nicholson JWG. Effect of two acids and formalin in calves milk on faed
consumption and performance. Can J Anim Sci 1987; 67: 1 129—1 131.
56. Klein RD, Kincaid RL, Hodgson AS, Harrison JH, Hillers JK, Cronrath JD. Dietary fiber and
early weaning on growth and rumen development of calves. J Dairy Sci 1987; 70:2095-2104.
57. Laksesvela B, Slagsvold P, Krogh A, Ommundsen A, LandsverkT. Indigestion in young calves.
II. The influence of ground barley, coarse and fine hay. Acta Veter Scand 1977; 18:416-425.
58. Jagos P, Dvorak R, Skrivanek M. The influence of early intake of concentrates and roughage
feeds on development of digestive processes of calves in high concentration calves house. Vet
Med (Praha) 1986; 31:257-264.
59. Bomba A, Laukova A, Reiffova K. The effect of starter diet formula on rumen metabolism in
calves. Ziv Vyr 1993; 38:1003-1114.
60. Flachowsky G, Matthey M, Ochrimenko WI, Schneider M. Profile of isoacids in rumen fluid
and influence of added isoacids on in sacco dry matter disappearance of untreated and
ammonia treated wheat straw. Arch Anim Nutr Berlin 1988; 38:431-439.
61. Risley CR, Kornegay ET, Lindermann HD, Wood CM, Eigel WN. Effects of feeding organic
acids on selected intestinal content measurements at varying times postweaning in pigs.
J Anim Sci 1992; 70:196-206.
62. Kik MJ, Huisman J, van der Poel AF, Mouwen MJ. Pathologic changes of the small intestine
mucosa of piglets after feeding of Phase olus vulgaris beans. Vet Pat 1990; 27:329-334.
398 Bomba et al.
63. Lecce JG, Balsbaugh RK, Clare DA, King MW. Rotavirus and hemolytic enterophatogenic
Escherichia coli in weanling diarrhoea of pigs. J Clin Microbiol 1982; 16:715-723.
64. Deprez P, Van den Hende C, Muylle E, Oyaert W. The influence of the administration of sows
milk on the post weaning excretion of the hemolytic, E. coli in the pig. Vet Res Com 1986;
10:469-478.
65. Deprez P, Deroose P, van den Hende C, Muylle E, Oyaert W. Liquid verces dry feeding in
weaned piglets: The influence on small intestine morphology. J Vet Med 1987; B34:254-259.
66. Partridge GG, Fischer J, Gregory H, Prior SG. Automated wet feeding of weaner pigs versus
conventional dry feeding effects on growth rate and food consumption. Anim Prod 1992;
54:484 (abstract).
67. Beers-Schreurs van, HMG, Nabuurs MJA, Vellenga L, Breukink HJ. The effect of weaning
and diets on vilous height and crypt depth in the small intestines of piglets. In: Proceedings of
the IX-th International conference on Production Diseases in farm animals. Berlin: Germany,
1995; 103.
68. McCracken KJ. Effect of diet compositions on digestive development of early weaned pigs.
Proc Nutr Soc 1984; 43:109.
69. Pluske JR. Psychological and nutritional stress in pigs at weaning: Production parameters,
the stress response and histology and biochemistry of the small intestine. Ph.D. Thesis, The
University of Western Australia, 1993.
70. Pluske JR, Williams IH. Reducing stress in piglets as a means of increasing production after
weaning: administration ton of amperozide or co-mingling of piglets during lactation? Anim
Sci 1996;62:121-130.
71. Fonty G, Gouet P, Jouany J, Senaud J. Ecological factors determing establishment of
cellulolytic bacteria and protozoa in the rumens of meroxenic lambs. J Gen Microb 1983;
129:213-223.
72. Kmet V, Bomba A. Control of rumen microflora development. Ann Rep Inst Anim Phys Slov
Acad Sci 1987; 7:44-52.
73. Kopecny J, Simunek J. Probiotics in calves based on rumen microorganisms. In: Proceeding
on new knowledge in using of additives in calves nutrition. Uhrineves: CSVTS, 1989:82-88.
74. Bomba A, Kravjansky I, Kastel R, et al. Inhibitory effects of Lactobacillus casei upon the
adhesion of enterotoxigenic Escherichia coli K99 to the intestinal mucosa in gnotobiotic
lambs. Small Ruminant Res 1996; 23:199-206.
75. Perdigon G, Alvarez S, Rachid M, Agnero G. Immune system stimulation by probiotics.
J Dairy Sci 1995; 78:1597-1606.
76. Bomba A, Gancarcikova S, Kastel R, Nemcova R, Herich R. Concentration of organic acids in
the digestive tract of gnotobiotic piglets after preventive application of lactobacilli. Slov Vet
Cas 1998; 23:321-326.
77. Thomke S, Elwinger K. Growth promotants in feeding pigs and poultry. III. Alternatives to
antibiotic growth promotants. Ann Zootech 1998; 47:245-271.
78. Mead GC. Prospects for "competitive exclusion" treatment to control salmonellas and other
feedborne pathogens in poultry. Vet J 2000; 159:111-123.
79. Kovacs- Zomborszky M, Kreinzinger F, Gombo S, Zomborszky Z. Data on the effects of the
probiotic "Lacto-Sacc". Acta Vet Hung 1994; 42:3.
80. Bomba A, Nemcova R, Gancarcikova S, Herich R, Kastel R. Potentiation of the effectiveness
of Lactobacillus casei in prevention of E. coli induced diarrhea in conventional and
gnotobiotic pigs. In: Paul PS, Francis DH, eds. Mechanisms in the Pathogenesis of Enteric
Diseases 2. New York: Kluwer Academic/Plenum Publishers, 1999:185-190.
81. Nemcova R, Bomba A, Gancarcikova S, Herich R, Guba P. Study of the effect of
Lactobacillus paracasei and FOS on the faecal microflora in weanling piglets. Berl Munch
Tieraztl Wschr 1999; 112:225-228.
82. Ring0 E, Bendiksen HR, Gausen SJ, Sundsfjord A, Olsen RE. The effect of dietary fatty acids
on lactic acid bacteria associated with the epithelial mucosa and from faecalia of Artie charr,
Salvelinus alpinus (L.). J Appl Microb 1998; 85:855-864.
The Gastrointestinal Microbiota of Farm Animals 399
83. Kankaanpaa PE, Salminen SJ, Isolauri E, Lee YK. The influence of polyunsaturated fatty
acids on probiotic growth and adhesion. FEMS Microb Lett 2001; 194:149-153.
84. Bomba A, Nemcova R, Gancarcikova S, et al. The influence of to- 3 polyunsaturated fatty
acids (to-3 pufa) on lactobacilli adhesion to the intestinal mucosa and on immunity in
gnotobiotic piglets. Berl Munch Tieraztl Wschr 2003; 116:312-316.
85. Soerjadi AS, Rufner R, Snoeyenbos GH, Weinack OM. Adherence of Salmonellae and native
gut microflora to the gastroinestinal mucosa of chicks. Avian Dis 1982; 26:576-584.
86. Mether U. Administration of autochthonus intestinal microflora — a method to prevent
Salmonella infections in poultry. Dtsch Tierarztl Wochenschr 2000; 107:402-408.
87. Nisbet DJ, Corrier DE, DeLoach JR. Effect of mixed cecal microflora maintained in
continuous culture and of dietary lactose on Salmonella typhimurium colonization in broiler
chicks. Avian Dis 1993; 37:528-535.
88. Corrier DE, Hinton A, Jr., Kubena LF, Ziprin RL, DeLoach JR. Decreased Salmonella
colonization in turkey poults inoculated with anaerobic cecal microflora and provided dietary
lactose. Poult Sci 1991; 70:1345-1350.
89. Corrier DE, Hargis B, Hinton A, Jr., et al. Effect of anaerobic cecal microflora and dietary
lactose on colonization resistance of layer chicks to invasive Salmonella enteritidis. Avian Dis
1991; 35:337-343.
90. Fonty G, Gouet P, Ratefiarivelo H, Jouany JP. Establishment of Bacteroides succinogenes and
measurement of the main digestive parameters in the rumen of gnotoxenic lambs. Can
J Microbiol 1988; 34:39-46.
91 . Fonty G, Jouany JP, Chavarot M, Bonnemoy F, Gouet P. Development of the rumen digestive
functions in lambs placed in a sterile isolator a few days after birth. Reprod Nutr Develop
1991; 31:521-528.
92. Fonty G, Gouet P, Jouany JP, Senaud J. Ecological factors determining the estabilishment of
cellulolytic bacteria and protozoa in the rumen of meroxenic lambs. J Gen Microbiol 1983;
129:213.
93. Bomba A, Zitrlan R, Koniarova I, et al. Rumen fermentation and metabolic profile in
conventional and gnotobiotic lambs. Arch Anim Nutr 1995; 48:231-243.
94. Lysons RJ, Alexander TJL, Wellstead D, Hobson PN, Mann SO, Stewart CS. Defined
bacterial populations in the rumens of gnotobiotic lambs. J Gen Microbiol 1976; 94:257-269.
95. Soares JH, Leffel EC, Larsen RK. Neonatal lambs in a gnotobiotic environment. J Anim Sci
1970; 31:733-740.
96. Lysons RJ, Alexander TJL, Wellstead D, Jennings W. Observations on the alimentary tract of
gnotobiotic lambs. Res Vet Sci 1976; 20:70-76.
97. Nemcova R, Bomba A, Herich R, Gancarcikova S. Colonization capability of orally
administered Lactobacillus strains in the gut of gnotobiotic piglets. Dtsch Tierarztl Wschr
1997; 105:199-200.
98. Bomba A, Gancarcikova S, Nemcova R, et al. The effect of lactic acid bacteria on intestine
metabolism and metabolic profile of gnotobiotic pigs. Dtsch Tieraztl Wschr 1998;
105:384-389.
99. Sarra PG, Cantalupo R, Massa S, Trovatelli LD. Colonization of the gastrointestinal tracts of
conventional piglets by Lactobacillus strains. J Gen Appl Microb 1991; 37:219-223.
100. Tortuero F, Rioperex J, Fernandez E, Rodriguez ML. Response of piglets to oral
administration of lactic acid bacteria. J Food Protect 1995; 58:1369-1374.
101. Bomba A, Kastel R, Gancarcikova S, Nemcova R, Herich R, Cizek M. The effect of
lactobacilli inoculation on organic acid levels in the mucosal film and the small intestine
contents in gnotobiotic pigs. Berl Munch Tieraztl Wschr 1996; 109:428-430.
102. Gordon HA, Pesti L. The gnotobiotic animal as a tool in the study of host parasite
relationships. Bacteriol Rev 1971; 35:390-429.
103. Yokota H, Coates ME. The uptake of nutrients from the small intestine of gnotobiotic and
conventional chicks. Br J Nutr 1982; 47:349-356.
104. Vanbelle M, Teller E, Focant M. Probiotics in animal nutrition: a review. Arch Anim Nutr
1990; 40:543-567.
Index
Abomasum, 386
Acetate, 53, 324, 386
Achlorhydria, 30, 226
ACNQ. See 2-amino-3-carboxy-l,
4-naphthoquinone
Acquired immunity, 96
Actinobacteria, gene analysis, 2
Actinomyces israellii, 30
Acute leukemia, 360
Adhesins, 130
Adhesion, 129-130, 276, 292, 297, 390
Aging, 77
Aglycones, 156
Allergies
diet, 198
infants, 189-199
pathogens, 197
Allochthonous microbes, 127
2- Amino-3-carboxy- 1 ,4-naphthoquinone
(ACNQ), 287
Amino acid homeostasis, 53
Amino acid metabolism, 139-140
Aminoglycosides, 355-356
Amoxicillin, 336
Ampicillin, 336
Androgens, 143
Angiogenins, 104
Animal models, 253-265
Anthocyanins, 162
Antibiotic-associated diarrhea, 296,
318,319
Antibiotics, 27, 94, 116, 189, 296,
335-363
Antibodies, 27
Antigen-presenting cells (APC), 96, 99, 112
Anti-rotavirus response, 107-108
Apoptosis, 226, 230, 264
Arachidonic acid, 391
Aromatization, 144
Asthma, 113, 190
Atopic diseases, 319
Atopy, 190, 194
Autochthonous microbes, 127
Autoimmune diseases, 115-116
Azalide, 354
Azithromycin, 354
Azlocillin, 340
Azoreductase, 146, 326
Aztreonam, 348
Azulfidine, 148
Bacampicillin, 340
Bacillus, 123
Bacterial adhesion, 129-130
Bacterial cholesterol metabolism, 142
Bacterial enzymes, 230-231
Bacterial nitrozation, 147
Bacteriocins, 323
Bacteroides
carbohydrate fermentation, 138-139
diet, 55
feces, 44
large intestine, 42
volatile fatty acids, 36
B. distasonis, 55
B. fragilis
diet, 55
gene analysis, 12
B. thetaiotaomicron
cytokine expression, 212
fucose, 123
genome sequencing, 178
host-microbe interactions, 53, 181
PCR analysis, 64
B. vulgatus, 3, 55, 64
Bacteroides, 52, 123, 208
Bacteroidetes , gene analysis, 2, 8
Batch-type simulators, 238
401
402
Index
Beta-aspartylglycine, 279
Bifidobacteria, 52, 76, 286, 315
adults, 292-294
aging, 77, 78, 79-88, 95
colonization, 54, 76
diet, 55
immune response, 107-108
infants, 107, 130, 291
large intestine, 42
mucus adhesion, 80-81
PCR techniques, 65
pets, 372
prebiotics, 295
probiotics, 317
taxonomy, 79
Bifidobacterium
B. adolescentis, 79, 87
IL-12 production, 82
PCR analysis, 64
B. angulatum, 79
B. bifidum, 79
B. breve, 79
B. catenulateum, 79
B. dentium, 79
B. infantis, 212
B. lactis, 159, 319
B. longum
genome sequencing, 178
PCR analysis, 64
B. parvulorum, 79
B. pseudocatenulateum, 79
Bifidogenic factors, 286
Bile acid metabolism, 27, 277, 279
Bile acids, 143,231-232
Bile acid test, 39-40
Bile pigments, 143, 276
Biomarkers, 230
Biopsy
esophagus, 29
large intestine, 43-44
small intestine, 34-35
stomach, 30-31
Biotin, 141
Birth control, 150
Bottle feeding. See formula- fed babies
Breast feeding, 54, 76, 94, 107
Breath tests, 39-42
Butyrate, 53, 229, 232, 297, 324
Bystander suppression, 101
Caecum, 254, 263, 275, 382
Caesarian section delivery, 54, 94, 198
Calcium, 232, 298
Calves, 388, 390
Campylobacter, 43, 374
C. jejuni, 128, 393
C. upsaliensis, 374
Cancer, 225-233, 263-264
Candida
allergies, 191
C. albicans, 28, 299
Candidiasis, 296
Cannulation, 263
Capsule biopsies, 36
Carbapenems, 348
Carbohydrates, 52, 301
fermentation, 138-139
Carbon-carbon bond cleavage, 144
Carcinogens, 145
Carnivorous animals, 381
Catechin, 162
Cats, 371-376
CD14, 102
CD. See Crohn's disease
CD AD. See Clostridium dijficile-associated
diarrhea
14 C-D-xylose breath test, 40
Cefaclor, 344-345
Cefadroxil, 347
Cefazolin, 343
Cefbuperazone, 343
Cefepime, 343
Cefetamet, 347
Cefexime, 347
Cefmenoxime, 343
Cefoperazone, 343
Cefotaxime, 343
Cefotiam, 343
Cefoxitin, 343
Cefozopran, 344
Cefpirome, 344
Cefpodoxime proxetil, 347
Cefprozil, 347
Ceftazidime, 344
Ceftibuten, 347
Ceftizoxime, 344
Ceftriaxone, 344
Cefuroxime/axetil, 347
Cell-mediated immunity (CMI), 8 1
Cell signaling, 209
Cellular fatty acid (CFA) analysis, 78
Cellulose, 387
Cephalosporins, 340-348
Cephradine, 348
CFA. See cellular fatty acid
14 C-glycocholate breath test, 39-40
Chemokines, 95
Index
403
Chlorogenic acid, 157
Cholera, 44
Cholesterol, 142, 277-278, 298
Cigarette smoking, 227
Ciprofloxacin, 360-361
Cirrhosis, 343, 360
Clarithromycin, 350, 354
Clindamycin, 27, 355
Clonal libraries, 59
Clostridia, 52, 208
gene analysis, 2
large intestine, 42
volatile fatty acids, 36
Clostridium
C. coccoides
fecal samples, 44
gene analysis, 8, 10
C. difficile, 128, 296
associated diarrhea (CDAD), 78, 294
large intestine, 43
pets, 373
C. herbivorans, 384
C. histolyticum, allergies, 192
C. innocum, 191
C. leptum, gene analysis, 8, 10
C. orbiscindens, 161
C. ramosum, 276
Clostrium
C. clostridioform, PCR analysis, 64
C. perfringens, 11
enterotoxin (CPE), 373
CMI. See cell-mediated immunity
Colitis, 210
Collinsella serogaciens, 55
Colon cancer, 55, 297, 319
Colonization
elderly, 75-79
farm animals, 381, 390
infants, 94, 128-129, 208
pets, 372
Colonization resistance, 53, 299, 335
Colorectal cancer (CRC), 225, 228-229
Colorectal surgery, 343, 360
Community profiling assays, 59
Constipation, 302, 315, 318
Coprophagy, 255
Coprostanol, 277
Corticosteroids, 143
Co-trimoxazole, 356
Cow milk allergy, 192
COX-2. See cyclooxygenase, 2
CPE. See Clostrium perfringens
enterotoxin
CRC. See colorectal cancer
Crohn's disease (CD), 208
molecular ecology, 3
probiotics, 217-218
susceptibility gene, 209
Crosby capsule, 36
Cross-talk, 53, 130-131
Cryptosporidium, 28
Cycasin, 145
Cyclamate, 149
Cyclooxygenase-2 (COX-2), 227
Cytokines, 95, 190, 196, 212, 321
Cytomegalovirus, 28
DC. See dendritic cells
Decarboxylation, 140
Dendritic cells (DC), 95, 99, 100, 106-107,
196, 212
Denaturing gradient gel electrophoresis
(DGGE), 59
Desulfovibrio, 144
DGGE. See denaturing gradient gel
electrophoresis
Diarrhea, 43, 300, 315, 374, 390
Diet
allergies, 198
cancer, 225
farm animals, 388-389
fecal microbiota, 55
Dietary fibers, 290, 301, 384
Diethylstilbesterol, 149
Digoxin, 149
3,4-Dihydroxyphenylalanine (DOPA),
147-148
Dipstick analysis, 44
Dirithromycin, 354
DNA microarrays, 12
DNA synthesis, 356-363
Dogs, 371-376
DOPA. See 3,4-dihydroxyphenylalanine
Dot-blot hybridization, 8, 66
Doxycycline, 355
Drug metabolism, 147-150
Duodenal string test, 37-38
Ecology, 1
Eczema, 114, 190, 194,292
EHEC. See enterohemorragic
Escherichia coli
Elderly, 75-88, 294-295
Endoscopy, 34
Enoxacin, 361
Enteric infections, infants, 107
404
Index
Enterobacteriaceae
allergies, 191
elderly, 77
large intestine, 42
poultry, 385
Enterococcus, 29, 52, 55, 208
E.fecalis, 82, 170
Enterocytes, 124
Enterohemorragic Escherichia coli (EHEC),
43, 128, 373
Enteropathogenic Escherichia coli (EPEC),
43, 128, 132
Enterotest, 37-38
Enterotoxic Escherichia coli (ETEC), 33
Enterotoxin, 319
Enzymes, 26
EPEC. See enteropathogenic Escherichia coli
Epifluorescence microscopy, 9
Epithelium-bacterial cross talk, 111
Erythromycin, 354
Escherichia coli, 123, 208
colonization, 76
diet, 55
gene analysis, 12
host-microbe interactions, 170
hydroxycinnamates, 159
infants, 94
PCR analysis, 64
pets, 373
pigs, 384
Escherichia coli, 157, 392-393
Esophagus, 28-29
Estrogens, 143, 150
ETEC. See enterotoxic Escherichia coli
Eubacterium, 42, 52, 123
E. biforme, PCR analysis, 64
E. hallii, gene analysis, 10
E. lentum, 149
E. limosum, PCR analysis, 64
E. ramulus, 161
E. rectale
fecal samples, 44
gene analysis, 10
FAE. See follicle-associated epithelium
Faecalibacterium prausnitzii, 2
Farm animals, 381-395
FCM. See flow-cytometry
Fecal biomarkers, 230
Fecal bulking, 287, 299
Fecal enzymes, 324, 326
Fecal samples, 44, 55
Fecal water, 232-233
Fermentative activity, 297
Fermentor-type simulators, 238-241
Ferrulic acid, 157
Fetus, 76
FISH. See fluorescent in situ hybridization
Flavan-3-ols, 161-162
Flavonoids, 159-162
Flavonols, 159-161
Flomoxef, 344
Flow-cytometry (FCM), 14-15
Fluorescent in situ hybridization (FISH), 8-11,
66, 106
Folic acid, 141
Folic acid antagonists, 356
Follicle-associated epithelium (FAE), 98
Food allergies, 94, 110, 191
Food dyes, 146
Formula-fed babies, 54, 76, 94, 107, 292
FOS. See fructo-oligosaccharides
Fructans, 290
Fructo-oligosaccharides (FOS), 300, 375, 391
Fucose, 123
Fucosylated glycoconjugates, 103
Full thickness biopsy, 35
Fusobacterium, 52, 123
F. prausnitzii, 64
GAC. See germ-free associated characteristics
Galacto-oligosaccharides, 290, 298
GALT. See gut-associated lymphoid tissue
Garenoxacin, 361
Gas chromatography, 36
Gastric Helicobacter-Yike organisms (GHLO),
374-375
Gastroenteritis, 318
Gatifloxacin, 361
Gemifloxacin, 361
Gene analysis, 2-4, 173-177
Gene deficient animals, 263
Gene expression, 14, 230
Genistein, 142
Genome sequencing, 177-180
Germ-free animals, 260-261, 274
Germ-free associated characteristics (GAC),
261, 274
Germ-free life, 273-281
GFP. See green fluorescent protein
GHLO. See gastric Helicobacter-like
organisms
Giardia lamblia, Enterotest, 38
Glucose hydrogen breath test, 41-42
Beta-glucuronidase, 145-146, 230-231, 326
Glycopeptides, 350
Glycoproteins, 126, 287
Glycosidase, 145
Index
405
Gnotobiotic mice, 104, 181
Gnotobiotic ruminants, 393-394
Goblet cells, 124
Gram-negative bacteria
immunosenescence, 82
phase variation, 130
sulphate metabolism, 143
Gram-positive bacteria
immunosenescence, 82
pets, 372
small intestine, 5 1
Green fluorescent protein (GFP), 14
Group-specific PCR-DGGE, 5-6
Growth rates, 13
Gut-associated lymphoid tissue (GALT), 53,
98, 256, 280
Gut epithelium, 212
Haemophilus influenzae, genome sequencing,
177
Hay fever, 113
Helicobacter, 374-375
H. pylori, 30, 5 1
antibiotics, 360
cancer, 226-227
cross talk, 131
sampling, 28, 30-31
urea breath test, 31-32
Hepatic encephalopathy, 299, 302
Herbivorous animals, 381
Herpes simplex virus, 28
HFA. See human flora-associated animals
Hippuric acid, 158
Histoplasma capsulatum, 28
HMOs. See human milk oligosaccharides
Hormone replacement therapy, 150
Horses, 382, 386
Host-microbe interactions, 53, 169-183
Human flora-associated animals (HFA),
261-262
Human milk oligosaccharides (HMOs),
287, 291
Hybridization techniques, 7-8
Hydrogen breath test, 39
Hydroxybenzoates, 159
Hydroxycinnamates, 157-159
Hygiene hypothesis, 113, 189
Hypersensitivity, 100
Hypochlorhydria, 226
Hypocholesterolemea, 318
IgA-secreting cells, 105
IIS. See intestinal immune system
IL. See interleukin
Imipenem, 348
Immune modulation, 93-117, 287, 301
Immune response
maturation, 292
probiotics, 319
regulation, 112-116
Immunosenescence, 81, 87
Infants
allergies, 189-199
bifidobacteria, 107, 130, 291
colonization, 54-55, 76, 94, 112, 208
eczema, 114
enteric infections, 107
fecal ecosystem, 5
feeding, 63, 76
Thl/Th2 balance, 113
Infectious gastritis, 30
Inflammation
chronic, 225
esophagus, 28
Inflammatory bowel disease (IBD), 93,
209-211,285
molecular ecology, 3
prebiotics, 293-294
probiotics, 207-219, 319
tolerance, 102
Innate immunity, 95-96, 112
Interferon- y, 190
Interleukin (IL-10), 196, 211, 213
Interleukin (IL-12), 82, 196
Intestinal immune system (IIS), 93, 97-103
Intestinal intubation, 37
Intestinal microbiota, 76
Intestinal motility, 52
Intestinal permeability, 103, 213
Intra-epithelial lymphocytes (IEL), 98
Inulin, 213, 289, 298, 300
In vitro models, 237-250
In vivo expression technology (IVET), 173,
174-177
Isoflavones, 141-142
IVET. See in vivo expression technology
Kaempferol, 159
Kantvik colon simulator (KCS), 240-241
Ketolide, 354
Klebsiella pneumoniae, 174
IBD. See inflammatory bowel disease
IEL. See intra-epithelial lymphocytes
LAB. See lactic acid bacteria
Lactate, 324
406
Index
Lactic acid bacteria (LAB), 230, 372
Lactobacillus, 76, 123, 286
cytokine production, 197
diet, 55
elderly, 78
gene analysis, 8
gnotobiotic piglets, 394
L. acidophilus
elderly, 78
gene analysis, 12
PCR analysis, 64
L. bulgaricus, 212
L. casei
community profiling, 63
probiotics, 212
L. gasseri, 159
L. plantarum, 319
gene analysis, 13, 177
host-microbe interactions, 171
IL-12 production, 82
L. re uteri, 319
L. rhamnosus, 63, 319
L. salivarius UCC, 118, 212
poultry, 385
probiotics, 315, 317
Lactococcus lactis, 214
Lactoferrin, 287
Lactose intolerance, 315
Lactulose, 40, 290, 298, 299, 302
Lactulose hydrogen breath test, 40-41
Lambs, 390
Lamina propria, 125
Large intestine, A2-AA
cancer, 228-230
function, 125
Lectins, 130
Lenapenem, 350
Levofloxacin, 361
Lignans, 142
Lincosamide, 355
Linezolid, 356
y-Linolenic acid, 391
Lipid metabolism, 140, 298
Lipopoly saccharides, 173
Listeria monocytogenes, 170, 174, 299
Lomefloxacin, 361
Loracarbef, 344, 348
Luminal washes, esophagus, 29
MAC. See microflora associated
characteristics
Macrolides, 350, 354
Macrophages, 95
Magnesium, 298
MALT. See mucosa-associated lymphoid
tissue
Maltodextrin, 391
Mannanoligosaccharides, 375
Maternal antibiotics, 94
M cells, 125
ME. See Milieu exterieur
Membrane- array technique, 68
Meropenem, 348-349
Mesenteric lymph nodes (MLN), 256
Metabolic activity, 13-15
Metronidazole, 148, 360
MI. See Milieu interieur
Microflora associated characteristics (MAC),
261, 274
Migrating motor complex (MMC), 27
Milieu exterieur (ME), 274
Milieu interieur (MI), 274
Milk, 287, 315
Mineral absorption, 287, 298
MLN. See mesenteric lymph nodes
MMC. See migrating motor complex
Molecular ecology, 1-16
Molecular fingerprinting, 4-6, 68, 296
Monobactams, 348-350
Moxalactam, 344
Moxifloxacin, 362
Mucin, 278, 321
Mucosa-associated lymphoid tissue (MALT), 99
Mucosal brushings, 35
Mucosal interactions, 123-132
Mucus, 125-127
Mucus adhesion, 80-81
Mutagens, 144-147
Mycobacterium
M. avium, 28, 30
M. paratuberculosis, 210
M. tuberculosis, 30
Natural immunoglobulins, 114-115
Natural killer cells (NK), 82, 95
NDOs. See non-digestible oligosaccharides
Neutrophils, 95
Nitrate, 231
Nitrate reductase, 326
Nitric oxide (NO), 95, 321
Nitrites, 147
Nitrofurantoin, 356
Nitrogen metabolism, 139-140
Nitroimidazoles, 356, 360
Nitroreductase, 146-147, 326
NK. See natural killer cells
NF-kB. See nuclear factor kB
NO. See nitric oxide
Index
407
Non-digestible oligosaccharides (NDOs), 287,
294, 301
Non-fermentor models, 241-242
Nonsteroidal anti-inflammatory drug (NSAID),
227
Norfloxacin, 362
Normal microbiota, 51-69
NSAID. See nonsteroidal anti-inflammatory
drug
Nuclear factor kB (NF-kB) pathway, 111, 211,
212-213
Nutritional stress, 389
Ofloxacin, 362
Oligosaccharides, 286
Omnivorous animals, 381
Oral tolerance, 100-101, 109-110, 209
Orocecal transit time, 40
Oxazolidinone, 356
p53 role, 227
PAMPs. See pathogen-associated molecular
patterns
Paneth cells, 125
Pantethine, 287
Parkinson's disease, 147
Pathogen-associated molecular patterns
(PAMPs), 131
Pathogens, 26, 256
adhesion, 297
allergies, 197
enteric, 128
esophagus, 28-29
large intestine, 43, 128
pets, 372-374
probiotics, 323
small intestine, 33-34
translocation, 300
PCR-cloning, 64-66
PCR-denaturing gradient gel electrophoresis
4-5, 64, 296
Pediatrics, Enterotest, 38
Pefloxacin, 362
Penicillins, 336-340
Peptic ulcers, 51, 227
Peptide nucleic acid (PNA), 9
Peptidoglycan, 196
Peptococcus, 52
Peptostreptococcus, 52, 123
P. productus, 55
Peristalsis, 25
Preoperative needle aspiration, 35-36
Peroral intubation, 38
Peroxisome proliferator-activated receptor
(PPARy), 111
Pets, 371-376
Peyer's patches (PPs), 98, 101
Pharmabiotics, 211
Phase variation, 130
Phenolic acids, 157-159
Phenoxymethylpenicillin, 336
Phylochips, 12
Physiology, 26-28
Pigs, 383-385
Piperacillin, 340
Pivampicillin, 340
Pivmecillinam, 340
PNA. See peptide nucleic acid
Polyphenols, 155-164
Polyunsaturated fatty acids, 392
Postnatal development, 27
Pouchitis, 210, 216-217
Poultry, 382, 385-386
PPARy. See peroxisome proliferator-activated
receptor
PPs. See Peyer's patches
Prebiotics, 285-302, 375, 391
Proanthocyanidins, 163
ProbeBase, 7
Probiotics, 1, 296-297, 315-327
diarrhea, 319-320
farm animals, 390
immune response, 114
immunosenescence, 87
inflammatory bowel disease, 207-219
pets, 375-376
pouchitis, 216-217
Procyanidins, 163
Progesterone, 143
Propionate, 324
Propionibacteriumfreudenreichii, 170, 287
Prostaglandin, 321
Protein, 52
Proteus, 17, 123
Pseudomembranous colitis, 296
Pseudomonas, 29
Pyxigraphy, 44
Quantitative reverse transcriptase PCR, 180
Quercetin, 159
Quinic acid, 144
Quinolones, 360-363
Quinupristin/dalfopristin, 355
Raffinose, 292
Rapid urease test, 3 1
Reading simulator, 239
408
Index
Real time PCR, 12
Rectum, 125
Regulatory T cells, 190
Resistance, 335
Rhinoconjunctivitis, 190
Rodents, 254, 255
Rotavirus, 108, 319
Rothia, 29
Roxithromycin, 354
Rufloxacin, 362
Rumen, 382, 386-387
Rumen simulators, 244-249
Ruminants, 381-382, 386-387
Ruminococcus, 52
gene analysis, 12
R. obeum, 67
R. productus, diet, 55
Saccharomyces boulardii, 217 ', 319
Salicylazosulfapyridine, 148
Salmonella, 43, 128
Enterotest, 38
host-microbe interactions, 170
pets, 373
poultry, 392-393
S. enterica, 174
S. enteritidis, 299
Sampling, 28-46
SBBO. See small bowel bacterial overgrowth
SCFAs. See short-chain fatty acids
SCOTS. See selective capture of transcribed
sequences
SCW. See streptococcal cell wall
Secretory IgA antibodies, 102
Selective capture of transcribed sequences
(SCOTS), 173
Self- antigens, 211
Shigella, 43, 128
SHIME model, 239-240
Short-chain fatty acids (SCFAs), 52, 53, 140,
229, 232, 279, 287, 324
Signature tagged mutagenesis (STM), 172
SIP. See stable isotope probing
Sitafloxacin, 362
Skin diseases, 319
Small bowel aspiration, 36-38
Small bowel bacterial overgrowth (SBBO),
27, 34, 36
Small intestine, 32-42, 124-125
Soybean oligosaccharides, 289
Sparfloxacin, 362
16S rRNA gene analysis, 2-4, 66, 169, 385
Stable isotope probing (SIP), 13
Staphylococcus, 29, 55, 123
STM. See signature tagged mutagenesis
Stomach, 29-32, 76
cancer, 226-227
Streptococcal cell wall (SCW)-induced
arthritis, 115
Streptococci, diet, 55
Streptococcus, 29, 77, 94
S. alactolyticus, 372
S. bovis, 229, 390
S. mitis, 82
S. parasanguinis, 59
S. salivarius, 59
Streptogramin, 355
Strickland reaction, 139
Subspecies differentiation, 68
Succession, elderly, 75-79
Sulphate metabolism, 143-144
Surgically modified animals, 262-263
Synbiotics, 289, 294-295
Talampicillin, 340
Taxonomy, Bifidobacteria, 79
Tazobactam, 340
Teicoplanin, 350
Telithromycin, 354
Terminal-restriction fragment length
polymorphism (T-RFLP), 6
Tetracycline, 355
Thl/Th2 balance, 96-97, 112-113, 256
Thiamine, 141
Ticcarcillin, 340
Tinidazole, 360
TLRs. See Toll-like receptors
Tobramycin, 355-356
Tolerance, 27
Toll-like receptors (TLRs), 95, 131
Transit time, 52
Traveler's diarrhea, 318, 360
Treponema pallidum, 30
T-RFLP. See terminal-restriction fragment
length polymorphism
Tropheryma whipplei, 33
Trovafloxacin, 363
Trypsin, 276
Tryptophan, 147
Type B gastritis, 51
Tyrosine, 147
UC. See ulcerative colitis
Ulcerative colitis (UC), 148, 208
probiotics, 215-216
Ulcer bleeding, 227
Urea breath test, 31-32
Index
409
Urinary excretion tests, 38
Urobilins, 276
Urogenital tract infection, 319
Water retention, 299
Weaning, 63, 76, 292, 384, 389
Whipple's disease, 33
Vancomycin, 350
Veillonella, 123
Vibrio cholerae, 33, 44
Vitamin B 12 , 141
Vitamin C, 227
Vitamin K, 141, 274-275
Vitamins, 26
Volatile fatty acids, 36
Yeasts
antibiotics, 336
diet, 55
Yersinia
Y. enter ocolitica, 43, 128
Y '. pseudotuberculosis, 131
Yogurt, 315
Live Music Archive
Librivox Free Audio
Metropolitan Museum
Cleveland Museum of Art
Internet Arcade
Console Living Room
Books to Borrow
Open Library
TV News
Understanding 9/11