METHODS IN BIOTECHNOLOGY™ 14
idiicd b v
HUMANA PRESS
Food Microbiology Protocols
METHODS IN BIOTECHNOLOGY
1 ,M
John M Walker, Series Editor
15, Enzymes in Nonaqueous Solvents: Methods and Protocols, edited by Evgeny N.
Vulfson, Peter J, Hailing, and Herbert L. Holland, 2001
1 4. Food Microbiology Protocols, edited by John F T Spencer and Alicia Leonor Ragout
de Spencer, 2001
13. Supercritical Fluid Methods and Protocols, edited by John R. Williams and Anthony A,
Clifford, 2000
12. Environmental Monitoring of Bacteria, edited by Ctive Edwards, 1999
11. Aqueous Two-Phase Systems, edited by Rajni Hatti-Kaul, 2000
10. Carbohydrate Biotechnology Protocols, edited by Christopher Bucke, 1999
9. Downstream Processing Methods, edited by Mohamed A. Desai, 2000
8. Animal Cell Biotechnology, edited by Nigel Jenkins, 1999
7. Affinity Biosensors: Techniques and Protocols, edited by Kim R. Rogers
and Ashok Mukhandani, 1998
6. Enzyme and Microbial Biosensors: Techniques and Protocols, edited by
Ashok Mulchandani and Kim R, Rogers, 1998
5. Biopest aides; Use and Delivery, edited by Franklin R. Hall and Julius J. Menu, 1999
4. Natural Products Isolation, edited by Richard J. P. Cannell, 1998
3. Recombinant Proteins from Plants: Production and Isolation of Clinically Useful
Compounds, edited by Charles Cunningham and Andrew J, R. Porter, 1998
2. Bioremediation Protocols, edited by David Sheehan, 1997
I. Immobilization of Enzvmes and Cells, edited by Gordon E Bickerstaff, 199?
METHODS IN BIOTECHNOLOGY
Food Microbiology
Protocols
Edited by
John F. T. Spencer
and
Alicia L. Ragout de Spencer
Planta Piloto de Procesos Industriales Microbiologicos,
San Miguel Tucumdn, Argentina
Humana Press ^^ Totowa, New Jersey
© 2001 Humana Press Inc.
999 Riverview Drive, Suite 208
Totowa, New Jersey 07512
All rights reserved. No part of this book may be reproduced, stored in a retrieval system, or transmitted in
any form or by any means, electronic, mechanical, photocopying, microfilming, recording, or otherwise
without written permission from the Publisher. Methods in Biotechnology™ is a trademark of The Humana
Press Inc.
All authored papers, comments, opinions, conclusions, or recommendations are those of the author(s),
and do not necessarily reflect the views of the publisher.
This publication is printed on acid-free paper. Cjx^
ANSI Z39.48-1984 (American Standards Institute) Permanence of Paper for Printed Library Materials.
Cover design by Patricia F. Cleary.
For additional copies, pricing for bulk purchases, and/or information about other Humana titles, contact
Humana at the above address or at any of the following numbers: Tel: 973-256-1699; Fax: 973-256-8341;
E-mail: humana@humanapr.com, or visit our Website at www.humanapress.com
Photocopy Authorization Policy:
Authorization to photocopy items for internal or personal use, or the internal or personal use of specific
clients, is granted by Humana Press Inc., provided that the base fee of US $10.00 per copy, plus US $00.25
per page, is paid directly to the Copyright Clearance Center at 222 Rosewood Drive, Danvers, MA 01923.
For those organizations that have been granted a photocopy license from the CCC, a separate system of
payment has been arranged and is acceptable to Humana Press Inc. The fee code for users of the Transactional
Reporting Service is: [0-89603-867-X/01 $10.00 + $00.25].
Printed in the United States of America. 1098765432 1
Library of Congress Cataloging in Publication Data
Main entry under title: Food microbiology protocols.
Methods in molecular biology™.
Food microbiology protocols./edited by John F. T. Spencer and Alicia L. Ragout de Spencer,
p. cm. — (Methods in biotechnology; 14)
Includes bibliographical references and index.
ISBN 0-89603-867-X (alk. paper)
l.Food — Microbiology. I. Spencer, John F. T. II. Ragout de Spencer, Alicia L. III. Series.
QR115.F658 2001
664'.00 1 '579— dc2 1 00-02 1718
Preface
Two of the recent books in the Methods in Molecular Biology series,
Yeast Protocols and Pichia Protocols, have been narrowly focused on yeasts
and, in the latter case, particular species of yeasts. Food Microbiology Proto-
cols, of necessity, covers a very wide range of microorganisms. Our book treats
four categories of microorganisms affecting foods: (1) Spoilage organisms; (2)
pathogens; (3) microorganisms in fermented foods; and (4) microorganisms pro-
ducing metabolites that affect the flavor or nutritive value of foods. Detailed
information is given on each of these categories.
There are several chapters devoted to the microorganisms associated
with fermented foods: these are of increasing importance in food microbiology,
and include one bacteriophage that kills the lactic acid bacteria involved in the
manufacture of different foods — cottage cheese, yogurt, sauerkraut, and many
others. The other nine chapters give procedures for the maintenance of lactic
acid bacteria, the isolation of plasmid and genomic DNA from species of Lacto-
bacillus, determination of the proteolytic activity of lactic acid bacteria, deter-
mination of bacteriocins, and other important topics.
A substantial number of the chapters deal with yeasts, microorganisms
which, after all, have also been associated with human foods and beverages for
many thousands of years. The emphasis in Food Microbiology Protocols is on
techniques for the improvement of methods for yeast hybridization and isola-
tion, and for improvement of strains of industrially important yeasts, to be used
in food and beverage production. For instance, the chapters by Katsuragi
describe techniques for isolation of hybrids obtained by protoplast fusion and
conventional mating, by the use of fluorescent staining, and by separation using
flow cytometry. Other chapters discuss the identification of strains by analysis
of mitochondrial DNA and other techniques. There are chapters on the isolation
of strains of starches used in the production of human foods, and an important
chapter on obtaining and isolating thermotolerant strains for the high tempera-
ture production of beverage and industrial alcohol. Finally, there are methods for
the production of polyhydroxy alcohols for low-calorie sweeteners. The
material on yeasts overlaps only slightly with that in the excellent book, Yeast
Protocols, edited by Ivor H. Evans, so investigators interested in industrial yeasts
should avail themselves of both volumes.
v
vi Preface
The chapters on spoilage organisms and pathogens include valuable
information on the isolation and identification of most important species in these
areas. Several of these are concerned with bacteria, yeasts, and molds, causing
spoilage of poultry products, as well as causing disease in humans. Methods for
identification by molecular biology techniques and by conventional plate counts
are given. There are two reviews on topics of immediate interest.
Finally, the editors and the publishers would like to thank all those
authors who gave so freely of their time and energy in preparing these chapters.
The editors wish especially to thank Dr. Faustino Sineriz, Director of
PROIMI, for allowing us to use the facilities at PROIMI in the preparation of
this book, and for his kind encouragement in the work at all times. We also thank
Dr. Maria E. Lucca for her able assistance in correcting the final version.
John F. T. Spencer
Alicia L. Ragout de Spencer
Contents
Preface v
Contributors ix
Part I Spoilage Organisms
1 Psychrotrophic Microorganisms: Agar Plate Methods,
Homogenization, and Dilutions
Anavella Gaitan Herrera 3
2 Biochemical Identification of Most Frequently Encountered Bacteria
That Cause Food Spoilage
Maria Luisa Genta and Humberto Heluane 1 1
3 Mesophilic Aerobic Microorganisms
Anavella Gaitan Herrera 25
4 Yeasts and Molds
Anavella Gaitan Herrera 27
5 Conforms
Anavella Gaitan Herrera 29
6 Genetic Analysis of Food Spoilage Yeasts
Stephen A. James, Matthew D. Collins, and Ian N. Roberts 37
Part II Pathogens
7 Conductimetric Method for Evaluating Inhibition of Listeria
monocytogenes
Graciela Font de Valdez, Graciela Lorca, and
Maria Pia de Taranto 55
8 Molecular Detection of Enterohemorrhagic Escherichia coli 01 57:H7
and Its Toxins in Beef
Kasthuri J. Venkateswaran 61
9 Detection of Listeria monocytogenes by the Nucleic Acid Sequence-
Based AmplificationTechnique
Burton W. Blais and Geoff Turner 67
10 Detection of Escherichia coli 01 57:H7 by Immunomagnetic
Separation and Multiplex Polymerase Chain Reaction
Ian G. Wilson 85
VII
vlii Contents
1 1 Detection of Campylobacter jejuni and Thermophilic
Campylobacter spp. from Foods by Polymerase Chain Reaction
Haiyan Wang, Lai-King Ng, and Jeff M. Farber 95
12 Magnetic Capture Hybridization Polymerase Chain Reaction
Jinru Chen and Mansel W. Griffiths 107
13 Enterococci
Anavella Gaitan Herrera 11 1
14 Salmonella
Anavella Gaitan Herrera 1 13
15 Campylobacter
Anavella Gaitan Herrera 119
1 6 Listeria monocytogenes
Anavella Gaitan Herrera 125
Part III Fermented Foods
17 Methods for Plasmid and Genomic DNA Isolation from Lactobacilli
M. Andrea Azcarate-Peril and Raul R. Raya 135
18 Methods for the Detection and Concentration of Bacteriocins
Produced by Lactic Acid Bacteria
Sergio A. Cuozzo, Fernando J. M. Sesma,
Aida A. Pesce de R. Holgado, and Raul R. Raya 141
19 Meat Protein Degradation by Tissue and Lactic Acid Bacteria
Enzymes
Si I vina Fadda, Grade la Vignolo, and Guillermo Oliver 147
20 Maintenance of Lactic Acid Bacteria
Graciela Font de Valdez 163
21 Probiotic Properties of Lactobacilli: Cholesterol Reduction and
Bile Salt Hydrolase Activity
Graciela Font de Valdez and Maria Pia de Taranto 173
22 Identification of Exopolysaccharide-Producing Lactic Acid Bacteria:
A Method for the Isolation of Polysaccharides in Milk Cultures
Fernanda Mozzi, Maria Ines Torino, and
Graciela Font de Valdez 183
23 Differentiation of Lactobacilli Strains by Electrophoretic
Protein Profiles
Graciela Savoy de Giori, Elvira Maria Hebert, and
Raul R. Raya 191
Contents ix
24 Methods to Determine Proteolytic Activity of Lactic Acid Bacteria
Graciela Savoy de Giori and Elvira Maria Hebert 197
25 Methods for Isolation and Titration of Bacteriophages
from Lactobacillus
Lucia Auad and Raul R. Raya 203
26 Identification of Yeasts Present in Sour Fermented Foods
and Fodders
WouterJ. Middelhoven 209
Part IV Organisms in the Manufacture of Other Foods and Beverages
27 Protein Hydrolysis: Isolation and Characterization of
Microbial Proteases
Marcela A. Ferrero 227
28 Production of Polyols by Osmotolerant Yeasts
Lucia L C. de Figueroa and Maria £. Lucca 233
29 Identification of Yeasts from the Grape/Must/Wine System
Peter Raspor, Sonja Smole Mozina, and Neza Cadez 243
30 Carotenogenic Microorganisms: A Product-Based Biochemical
Characterization
Jose Domingos Fontana 259
31 Genetic and Chromosomal Stability of Wine Yeasts
Matthias Sipiczki, Ida Miklos, Leonora Leveleki, and
Zsuzsa Antunovics 273
32 Prediction of Prefermentation Nutritional Status of Grape Juice:
The Formol Method
Barry H. Gump, Bruce W. Zoecklein, and
Kenneth C. Fugelsang 283
33 Enological Characteristics of Yeasts
Fabio Vasquez, Lucia I. C. de Figueroa, and
Maria Eugenia Toro 297
34 Utilization of Native Cassava Starch by Yeasts
Lucia /. C. de Figueroa, Laura Rubenstein, and
Claudio Gonzalez 307
Part V Methods and Equipment
35 Reactor Configuration for Continuous Fermentation in Immobilized
Systems: Application to Lactate Production
Jose Manuel Bruno-Barcena, Alicia L. Ragout de Spencer,
Pedro R. Cordoba, and Faustino Siheriz 321
x Contents
36 Molecular Characterization of Yeast Strains by Mitochondrial DNA
Restriction Analysis
Maria Teresa Fernandez-Espinar, Amparo Querol, and
Daniel Ramon 329
37 Selection of Yeast Hybrids Obtained by Protoplast Fusion and
Mating, by Differential Staining, and by Flow Cytometry
Tohoru Katsuragi 335
38 Selection of Hybrids by Differential Staining and Micromanipulation
Tohoru Katsuragi 341
39 Flotation Assay in Small Volumes of Yeast Cultures
Sandro Rogerio de Sousa, Maristela Freitas Sanches Peres,
and Cecilia Laluce 349
40 Obtaining Strains of Saccharomyces Tolerant to High Temperatures
and Ethanol
Maristela Freitas Sanches Peres, Sandro Rogerio de Sousa,
and Cecilia Laluce 355
41 Multilocus Enzyme Electrophoresis
Timothy Stanley and Ian G. Wilson 369
42 Bacteriocin Production Process by a Mixed Culture System
Suteaki Shioya and Hiroshi Shimizu 395
Part VI Reviews
43 Nutritional Status of Grape Juice
Bruce W. Zoecklein, Barry H. Gump, and
Kenneth C. Fugelsang 415
44 Problems with the Polymerase Chain Reaction: Inhibition,
Facilitation, and Potential Errors in Molecular Methods
Ian G. Wilson 427
45 Problems with Genetically Modified Foods
Jose Manuel Bruno-Barcena, M. Andrea Azcarate-Peril, and
Faustino Siheriz 481
ndex 485
Contributors
Zsuzsa Antunovics • Department of Genetics, University of Debrecen,
Debrecen, Hungary
Lucia Auad • Centro de Referenda para Lactobacilos (CERELA), San Miguel
Tucumdn, Argentina
M. Andrea Azcarate-Peril • Centro de Referenda para Lactobacilos
(CERELA), San Miguel Tucumdn , Argentina
Burton W. Blais • Laboratory Services Division, Canadian Food Inspection
Agency, Ottawa, Ontario, Canada
Jose Manuel Bruno-Barcena • Departamento de Biotecnologia, Instituto
Agrochimica y Tecnologia de Alimentos, Valencia, Spain
Neza Cadez • Food Science and Technology Department, University of
Ljubljana, Ljubljana, Slovenia
Jinru Chen • Department of Food Science and Technology, University of
Guelph, Guelph, Ontario, Canada
Matthew D. Collins • Institute of Food Research, Norwich, UK
Pedro R. Cordoba • Planta Piloto de Procesos Industrials Microbiologicos
(PROIMI), San Miguel Tucumdn, Argentina
Sergio A. Cuozzo • Centro de Referenda para Lactobacilos (CERELA), San
Miguel Tucumdn, Argentina
Silvina Fadda • Centro de Referenda para Lactobacilos (CERELA), San
Miguel Tucumdn, Argentina
Jeff M. Farber • Microbiology Research Division, Bureau of Microbial
Hazards, Food Directorate, Health Canada, Ottawa, Ontario, Canada
Maria Teresa Fernandez -Espinar • Departamento de Biotecnologia, Instituto
Agroquimia y Tecnologia de Alimentos, Valencia, Spain
Marcela A. Ferrero • Microbiology Laboratory, Universitat de Lies Illes
Balears, Illes Balears, Spain
Lucia I. C. de Figueroa • Planta Piloto de Procesos Industriales
Microbiologicos (PROIMI), San Miguel Tucumdn, Argentina
Jose Domingos Fontana • Biomass Chemol Biotechnology Laboratory,
Curitiba, Pr., Brazil
Kennth C. Fugelsang • Department of Viticulture and Enology, California
State University-Fresno , Fresno, CA
Maria Luisa Genta • PROIMI-MIRCEN , San Miguel Tucumdn, Argentina
xi
xii Contributors
Graciela Savoy de Giori • Centro de Referenda para Lactobacilos
(CERELA), San Miguel Tucumdn, Argentina
Claudio Gonzalez • PROIMI-MIRCEN , San Miguel de Tucumdn, Argentina
Barry F. Gump • Department of Viticulture and Enology, California State
University-Fresno, Fresno, CA
Elvira M. Hebert • Centro de Referenda para Lactobacilos (CERELA),
San Miguel Tucumdn, Argentina
Humberto Heluane • PROIMI-MIRCEN , San Miguel Tucumdn, Argentina
Anavella Gaitan Herrera • Pontificia Universidad Javeriana, Bogota,
Colombia
Aida A. de R. Pesce Holgado • Centro de Referenda para Lactobacilos
(CERELA), San Miguel Tucumdn, Argentina
Stephen A. James • Institute of Food Research, Norwich, UK
Tohoru Katsuragi • Nara Institute of Science and Technology, Graduate
School of Biological Sciences, Ikoma, Nara, Japan
Cecilia Laluce • Instituto Quimica de Universidade EstadualPaulista "Julio
de Mesquita Filho" (UNESP), Araquara, SP, Brazil
Leonora Leveleki • Department of Genetics, University of Debrecen,
Debrecen, Hungary
Graciela Lorca • Centro de Referenda para Lactobacilos (CERELA),
San Miguel Tucumdn, Argentina
Maria E. Lucca • Planta Piloto de Procesos Industriales Microbiologicos
(PROIMI), San Miguel Tucumdn, Argentina
Wouter J. Middelhoven • Laboratorium voor Microbiologic, Department
Biomoleculaire Wetenschappen, Universiteit Wageningen, Wageningen,
The Netherlands
Ida Miklos • Department of Genetics, University of Debrecen, Debrecen,
Hungary
Sonja Smole Mozina • Food Science and Technology Department, University
of Ljubljana, Ljubljana, Slovenia
Fernanda Mozzi • Centro de Referenda para Lactobacilos (CERELA),
San Miguel Tucumdn, Argentina
Lai-King Ng • Bureau of Microbiology , Laboratory Centre for Disease
Control, Health Canada, Winnipeg, Manitoba, Canada
Guillermo Oliver • Centro de Referenda para Lactobacilos (CERELA),
San Miguel Tucumdn, Argentina
Maristela Freitas Sanches Peres • Programa de Pos Graduaqao da Faculdade
de Ciencias e Letras de Ribeirao Preto USP, SP, Brazil
Amparo Querol • Departamento de Biotecnologia, Instituto Agrochimica y
Tecnologia de Alimeiitos , Valencia, Spain
Contributors xiii
Daniel Ramon • Departamento de Biotecnologia, Instituto Agrochimica y
Tecnologia de Alimentos, Valencia, Spain
Peter Raspor • Food Science and Technology Department, University of
Ljubljana, Ljubljana, Slovenia
Raul R. Raya • Centro de Referenda para Lactobacilos (CERELA), San Miguel
Tucumdn, Argentina
Ian N. Roberts • Institute of Food Research, Norwich, UK
Laura Rubenstein • Plant a Piloto de Procesos Industrials Microbiologicos
(PROIMI), San Miguel Tucumdn, Argentina
Fernando J. M. Sesma • Centro de Referenda para Lactobacilos (CERELA),
San Miguel Tucumdn, Argentina
Hiroshi Shimizu • Department of Biotechnology, Graduate School of
Engineering, Osaka University, Osaka, Japan
Suteaki Shioya • Department of Biotechnology, Graduate School of
Engineering, Osaka University, Osaka, Japan
Faustino Sineriz • Planta Piloto de Procesos Industrials Microbiologicos
(PROIMI), San Miguel Tucumdn, Argentina
Matthias Sipiczki • Department of Genetics, University of Debrecen,
Debrecen, Hungary
Sandro Rogerio de Sousa • Instituto Quimica de UNES, Araquara, SP,
Brazil
Alicia L. Ragout de Spencer • Planta Piloto de Procesos Industrials
Microbiologicos (PROIMI), San Miguel Tucumdn, Argentina
John F. T. Spencer • Planta Piloto de Procesos Industrials
Microbiologicos (PROIMI), San Miguel Tucumdn, Argentina
Timothy Stanley • Bacteriology Department, Belfast City Hospital,
Belfast, Northern Ireland
Maria Pia de Taranto • Centro de Referenda para Lactobacilos (CERELA),
San Miguel Tucumdn, Argentina
Maria Ines Torino • Centro de Referenda para Lactobacilos (CERELA),
San Miguel Tucumdn, Argentina
Maria Eugenia Toro • Planta Piloto de Procesos Industrials Microbiologicos
(PROIMI), San Miguel Tucumdn, Argentina
Geoff Turner • Laboratory Services Division, Canadian Food Inspection
Agency, Ottawa, Ontario, Canada
Graciela Font de Valdez • Centro de Referenda para Lactobacilos (CERELA),
San Miguel Tucumdn , Argentina
Fabio Vazquez • Planta Piloto de Procesos Industrials Microbiologicos
(PROIMI), San Miguel Tucumdn, Argentina
xiv Contributors
Kasthuri J. Venkateswaran • Planetary Protection Sciences, Jet Propulsion
Laboratory, NASA, Pasadena, CA
Graciela Vignolo • Centro de Referenda para Lactobacilos (CERELA), San
Miguel Tucumdn, Argentina
Haiyan Wang • Microbiology Research Division, Bureau of Microbial
Hazards, Food Directorate, Health Canada, Ottawa, Ontario, Canada
Ian G. Wilson • Bacteriology Department, Belfast City Hospital,
Belfast, Northern Ireland
Bruce W. Zoecklein • Department of Food Science and Technology, Virginia
Tech, Blacksburg, VA
I
Spoilage Organisms
1
Psychrotrophic Microorganisms
Agar Plate Methods, Homogenization, and Dilutions
Anavella Gaitan Herrera
1. Introduction
Isolation and enumeration of the microorganisms present in foods usually
demands preliminary treatment of samples to release into a liquid medium those
microorganisms present that may be included within the food. In a mixing
procedure known as "stomaching," the food sample (see Note 1) and diluent
are put into a sterile plastic bag that is vigorously struck on its outer surfaces
by paddles inside a stomacher, the compression and shearing forces break up
solid pieces of food. After samples are removed for analysis, the bag and its
remaining contents can be discarded and the equipment is ready for use. If a
stomacher is not available, an electric blender with cutting blades revolving at
high speed can be used (see Note 2).
The nature of the diluent used is another highly important factor. Diluents
such as tap or distilled water, saline solutions, phosphate buffers, and Ringer's
solution are toxic to microorganisms, especially if the time of contact is unduly
prolonged. For that reason, we suggest that using 0.1% peptone solution, physi-
ological saline solution with 0.1% peptone added, is the most reliable source.
Peptone 0.1% in saline solution in 0.85% NaCl is recommended by the Inter-
national Standards Organization (see Notes 3 and 4).
The number of microorganisms by plate count has been one of the more
commonly used microbiological methods for determination food quality. This
method indicates the adequacy of sanitation and formation of an opinion on
incipient spoilage (see Note 5). The plate count has a special application to
imported foods for control of the standard of sanitation practiced in the manu-
facturing establishments (1).
From: Methods in Biotechnology, Vol, 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
4 Herrera
The three methods in common use for enumerating microorganisms are the
standard-plate count, also called the aerobic plate count or pour plate, the "surface
plate," or "spread-drop" method and the drop-plate method (see Note 6). None of
these procedures can be depended on to list all types of organisms present within
the test specimens. Many cells may not grow because of specifically unfavorable
conditions of nutrition, aeration, temperature, or duration of incubation (1).
The temperature chosen depends on the purpose of the examination. The
incubation temperature of microorganisms have different growth temperature
ranges such as 0-7°C for psychrotrophs, 30-35°C for mesophiles, and 55°C for
thermophiles. No single incubation temperature will absolutely exclude all
organisms from another group (see Notes 7 and 8). Incubators are required
with minimal fluctuation or variation of temperature throughout the incubation
chamber. All incubators should be checked and calibrated frequently (2).
The psychrotrophic or psychrophilic microorganisms are able to grow for
7-10 d (see Note 9) at commercial refrigeration temperatures (0-7°C). Species
of Achromobacter, Acinetobacter, Alcaligenes, Bacillus, Flavobacterium,
Streptococcus, and Pseudomonas are included among the psychrotrophic bac-
teria. Furthermore, some yeasts and molds, including Penicillium, Aspergillus,
Geotrichum, and Botrytis, are able to grow well in refrigerated foods (see
Note 10) in large numbers. These microorganisms can cause off flavors amd
physical defects in foods. Their growth rates are highly temperature dependent
(see Note 11). Their presence indicates a high potential for spoilage during
extended storage. Most of these microorganisms are destroyed by mild heat
treatment, but some heat-resistant types such as some species of Bacillus and
Clostridium may survive. The presence of psychrotrophic microorganisms in
heat-processed foods implies post-processing contamination. They are sources
of heat-resistant proteolytic and lipolytic enzymes (3) that affect adversely the
quality of the food during storage after heat treatment (see Note 12). The pres-
ence of psychrotropic microorganisms is also important in such foods as fro-
zen turkey or chicken when they are thawed.
2. Homogenization and Dilution: Method 1
2. 7. Materials
1. Mechanical blender, two-speed model or single speed with rheostat control.
2. Glass or metal blending jars of 1 L capacity, with covers, resistant to auto-
clave temperatures. One sterile jar (autoclaved at 121°C) for 15 min) is required
for each sample to be analyzed.
3. Balance with weights. Capacity at least 2500 g, sensitivity 0.1 g.
4. Instruments for preparing samples: knives, forks, forceps, scissors, spoons, spatu-
las, and tongue depressors, all sterilized for use by autoclaving or by hot air.
5. Pipets: 1, 5, and 10 mL.
Psychrotrophic Microorganisms 5
6. Refrigerator cooled to 2-5°C.
7. Peptone dilution fluid or peptone salt dilution fluid, sterilized in the autoclave for
each sample 450 mL in flask or bottle, 90 or 99 mL blanks in dilution bottles or
similar containers.
8. Mechanical mincer, mechanical blender, operating at not less than 8000 rpm and
not more than 45,000 rpm.
9. For Method 1, items 2-4, and 6:
a. Pipets, bacteriological
b. Sterile culture tubes for dilution fluid, 15-20 mL capacity
c. Peptone salt dilution fluid
3. Microogranisms: Agar Plate Method
1. Petri dishes, glass (100 x 15 mm) or plastic (90 x 15 mm) (see Note 7).
2. Pipets, bacteriological, 1, 5, and 10 mL sterile.
3. Water bath or incubator for tempering agar, 44-46°C.
4. Incubator, 29-31 °C.
5. Colony counter.
6. Tally register.
7. Plate count agar (standard-methods agar) (see Notes 5 and 6).
8. Drying cabinet or incubator for drying the surface of agar plates, preferably at
50°C.
9. Glass spreaders (Drigalski spatulas; hockey-stick-shaped glass rods).
10. Pipets, bacteriological, sterile, with divisions of 0.1 mL or less.
3. 7. Materials
1. Low-temperature incubator capable of maintaining a temperature of 1-7°C.
2. Nonselective agar media such as standard or trypticase soy broth.
3. Selective agar, crystal violet, or tetrazolium agar.
4. Pipets, bacteriological, 0.1 mL sterile
5. Materials for preparation and dilution of the food homogenate, as listed in Sub-
heading 2.1.
6. Petri dishes, as described previously.
7. Colony counter.
4. Methods
4. 7. Homogenization and Dilutions: Method 1
1. Begin the examination as soon as possible after the sample is taken. Refrigerate
the sample at 0-5°C if the examination cannot be started immediately after it
reaches the laboratory. If the sample is frozen, thaw it in its original container (or
in the container in which it was received at the laboratory) for a maximum of 18 h
in a refrigerator at 2-5°C. If the sample can be easily comminuted (as in ice
cream), proceed without thawing.
2. Tare the empty sterile blender jar, then weigh into it, 50 g representative of the
food sample. If the contents of the package are obviously not homogenous
6 Herrera
(frozen dinner), take a 50-g sample from a macerate of the whole dinner, or
analyze each different food portion separately, depending on the purpose of
the test.
3. Add to the blender jar, 450 mL of the peptone dilution fluid or peptone salt dilu-
tion fluid. This provides a dilution of 10 (+/-) 1.
4. Blend the food and dilute promptly. Start at low speed and then switch to high
speed within a few seconds. Time the blending carefully to permit 2 min at high
speed. Wait 2 or 3 min for foam to disperse.
5. Measure 1 mL of the 10 _1 dilution of the blended material, avoiding foam, into a
99-mL dilution blank. Shake this and all subsequent dilutions vigorously 25 times
in a 30-cm arc. Repeat this process using the progressively increasing dilutions
10~ 2 , 10" 3 , lO^ 4 , and 10~ 5 , or dilutions that experience indicates are desirable for
the food being tested.
4.2. Homogenization and Dilutions: Method 2
1. Begin the examination as soon as possible after the sample is taken. Preferably,
start analysis of unfrozen samples within 1 h after receipt. If the sample is frozen,
thaw in the original container (or in the container in which it was received in the
laboratory) in the refrigerator at 2.5°C and examine as soon as possible after
thawing is complete or at least sufficient to permit suitable subsamples to be
taken (maximum thawing time 18 h).
2. Proceed to step 3 if the sample is difficult to blend, grind, and mix twice in the
mechanical mincer.
3. Weigh into a tared blended jar at least 10 g of sample, representative of the
food. Add nine times as much dilution fluid as sample. This provides a dilution
of 10:1.
4. Time of grinding must not exceed 2.5 min.
5. Mix the contents of the jar by shaking and pipet duplicate portions of 1 mL each
into separate tubes containing 9 mL of dilution fluid. Carry out steps 7 and 8 on
each of the diluted portions.
6. Mix the liquids carefully by aspirating 10 times with a sterile pipet.
7. Transfer with the same pipet, 1.0 mL to another dilution tube containing 9 mL of
dilution fluid and mix with a fresh pipet.
8. Repeat steps 7 and 8 until the required number of dilutions are made. Each suc-
cessive dilution will decrease the concentration 10-fold.
4.2.1. Example 1
Dilution 10" 1 , 350, and 330: (350 + 330)/2 x 10 = 3400
Dilution 10~ 2 , 26, and 28: (26 + 28) 2 x 100 = 2700
X = (3400 + 2700)2 = 3050
30 x 10 2 CFU/g
Psychrotrophic Microorganisms 7
4.2.2. Example 2
90 colonies on dilution 10 -1 = 2900
40 colonies on dilution 10~ 2 = 4000
4000/2900 = <2. Report the average of the two counts: 35 x 10 2
170 colonies on dilution 10" 1 = 1700
35 colonies on dilution 10" 2 = 3500
3500/1700 = >2 Report the lower count 17 x 10' 2
4.2.3. Computing the Estimated Standard Plate Count (ESPC)
1 . If counts on individual plates do not fall within the range 30-300 colonies, report
the calculated count as ESPC. Calculate the count as directed in steps 2-4.
2. If plates of all dilutions show more than 300 colonies, divide each of the dupli-
cate plates for the highest dilution into convenient radial sections (e.g., 2, 4, 8)
and count all of the colonies in one or more sections. Multiply the total in each
case by the appropriate factor to obtain an estimate of the total number of col-
onies for the entire plate. Average the estimates for the two plates, multiply the
dilution, and report the resulting count as the ESPC.
3. If the three are more than 200 colonies per one-eighth section of the plates made
from the most dilute suspension, multiply 1600 (i.e., 200 X 8) by that dilution,
and express ESPC as more than (>) the resulting number. In all such cases, it is
advisable to report the dilution used in parentheses.
The Standard Plate Count
5. 7. Methods
1. Prepare the sample.
2. To duplicate sets of Petri dishes, pipet 1 mL aliquots from 10 _1 , 10~ 2 , 10~ 3 , 10 -4 ,
and 10~ 5 dilutions, and a 0.1 -mL aliquot from the 10~ 5 dilution to give 10 _1 to 10 -6 g
of food per Petri dish.
3. Promptly pour into Petri dishes 10-15 mL of melted and tempered agar. Immedi-
ately mix the aliquots with the agar medium by tilting and rotating the Petri
dishes. The sequence of steps is:
a. Tilt dish to and fro five times, in one direction.
b. Rotate it clockwise five times.
c. Tilt it to and fro again five times in a direction at right angles to that used the
first time.
d. Rotate it counterclockwise five times.
4. When the agar is solidified, invert the Petri dishes and incubate at 29-3 1°C for
48 +/- 3 h.
5.2. The Surface-Spread Plate
1. Add 15 mL of melted, cooled (45-60°C Plate count agar to each Petri dish used
and allow to solidify.
8 Herrera
2. Transfer 0.1 mL of each of the dilutions to the agar surface. Using the same pipet
for each dilution. Test at least three dilutions, even if the approximate range of
numbers of microorganisms in the food is known. Start with the highest dilutions
and proceed to the lowest, filling and emptying the pipet three times before trans-
ferring the 0.1 -mL portion to the plate.
3. Promptly spread the 0.1 -mL portions on the surface of the agar plates using glass
spreaders (Drigalsky spatulas). Use a separate spreader for each plate. Allow the
surfaces of the plates to dry for 15 min.
4. Incubate the plates in an inverted position, for 3 d.
5.2. 1. Computing the Standard Plate Count
and the Estimated Plate Count
5.2.1 .1 . The Standard Plate Count (SPC)
1. Select two plates corresponding to one dilution and showing between 30 and 300
colonies per plate. Count all colonies on each plate, using the colony counter and
tally register. Take the average of the two counts and multiply by the dilution
factor. Report the resulting number as the SPC.
2. Two plates should be counted even if one of them should give a count of fewer
than 30 or more than 300 colonies. Again, take the average of the two counts and
multiply by the dilution factor and report the resulting number as the SPC.
3. If the plates from two consecutive decimal dilutions fall into the countable range
of 30-300 colonies compute the SPC for each of the dilutions as directed above,
and report the average of the two values obtained, unless the higher computed
count is more than twice the lower one, in which case report the lower computed
count as the SPC.
4. Report only two significant digits as the colony-forming unit per gram or milliliter.
5.2.1.2. Example 1
1600 x 10 3 = >1600 000 > 16 x 10 3
Dilution 10 _1 : No colonies: in cases when there are no
colonies in the plates made from the most concentrated suspension,
report the ESPC as less than (<) 1 times the dilution.
For instance, if dilution 10 4 = no colonies, report ESPC < 10/g if sampling 0.1 < 100/g.
1. Reporting and interpreting:
a. Report the counts as SPC or ESPC per gram or milliliter of food.
b. Only the SPC should be considered in determining the acceptance or rejection
of a batch of food, never the ESPC. This is used only as a first approximation
in the assessment of the bacteriological quality of a food.
2. Repeating: A second count on a given plate should be within 5% of the first when
done by the same person., or within 10% of the first, when done by another per-
Psychrotrophic Microorganisms 9
son. If counts differ by more than these limits, the cause is sometimes poor eye-
sight, failure to recognize minute colonies as such, or failure to differentiate them
from food particles.
3. Computing: Only two significant digits should be used in reporting the SPC or
the ESPC. These are the first and second digits (starting from the left) of the
average of the counts. The other digits should be replaced by zeros.
5.2.1.3. Example 2
1. If the actual count were 143,000, report the count as 140,000 (14 x 10 4 ). If the
third digit from the left is 5 or greater, add one unit to the second digit (rounding
off). If the actual count were 53,000, report 54,000 (54 x 10 3 )
2. Spreading colonies:
a. If spreading colonies are present on a plate, count the colonies lying outside the
area of spreading, providing that the total of the repressed area does no exceed
one-half the area of the plate. Correct the count to allow for the area not counted.
b. Report the presence of the spreaders (spr) whenever the area affected exceeds
one-quarter of the area of the plate. When more than 1 plate out of every 20
shows spreading colonies, take measures to reduce the occurrence, such as
reducing the amount of moisture in the incubator and ensuring a thorough
mixing of the dilution fluid and tempered agar.
3. Inhibitors: When counts for the lower dilutions are markedly lower than they nor-
mally should be, inhibitors may be present. Use tests to detect possible inhibitors.
4. Methods: Plate count methods using selective media.
a. The agar plate method using nonselective media such as standard-methods
agar or trypticase soy agar (1).
b. Prepare dilutions, pour plates ,or spread plates as described previously.
c. Incubate plates at 7 ±1°C for 10 d.
d. Count the colonies and compute the counts.
e. Report the counts as psychotrophic place counts per milliliter, gram, or square
centimeter, as applicable.
5.2.1 .4. Plate-Count Method Using Selective Media
1 . Prepare dilutions and plates as described for the agar plate count except that crys-
tal violet tetrazolium (CVT) agar is used.
2. Incubate plates as 22°C for 5 d or at 30°C for 48 h.
3. Count red colonies and compute as for plates with nonselective media (4).
6. Notes
1 . When the Colworth stomacher is used, a supply of thin-walled (about 200 gauge)
polyethylene bags, about 18 x 30 cm, are required.
2. Weigh into a tared bag at least 10 g of sample and operate for 60 s.
3. If pathogenic microorganisms are known or suspected to be present in the food,
place the bag inside another as a precaution against breakage. Work in laborato-
ries having the required grade of containment.
10 Herrera
4. For high-fat foods (over 20%), such as smoked meats, add 1% Tween-80 or some
other nontoxic surfactant.
5. It is not essential that the medium be translucent, as all colonies grow and develop
on the surface of the agar.
6. Melt plate-count agar in flowing steam or boiling water, but do not expose it to
great heat for a prolonged period. Temper the agar to 44-46 Q C and control its
temperature carefully to avoid killing bacteria in the diluted medium.
7. Promptly pour into the Petri dishes 10-15 mL of melted and tempered agar. Fewer
than 20 min should elapse between making the dilution and pouring the agar.
8. One of several plates with inoculated agar medium and with inoculated dilution
fluid should be made as a control.
9. In some refrigerated foods, a majority of the psychrotrophic bacteria responsible
for quality loss and subsequent spoilage are Gram-negative rods.
10. A keeping-quality test, in which the agar plate count is determined prior to, and
following, preliminary incubation of the food (5-7 d at commercial refrigeration
temperature), can provide important information about the potential for the devel-
opment of flora in a refrigerated food.
1 1 . Samples should not be frozen because of possible death or injury to microorgan-
isms during freezing. This may extend the lag phase of growth and the time of
incubation is insufficient to detect them.
12. The incubation temperature used for counting may be different from that at which
the food is actually stored.
References
1. Speck, M. L. (1984) Compendium of Methods for the Microbiological Examina-
tion of Foods. Compiled by the APHA Technical Committee on Microbiological
Methods for Foods, 2nd ed. (Speck, M. L., ed.), American Public Health Associa-
tion, Washington, DC.
2. Elliot, R .P., Clark, D. S., and Michener, H. D. (1978) Microorganisms in Food 1.
Significance and Methods of Enumeration, 2nd ed., a publication of the Interna-
tional Commission on Microbiological Specifications for Foods (ICMSF) of the
International Association of Microbiological Societies, University of Toronto
Press, Toronto, Ontario, Canada.
3. Griffiths, M. W., Phillips, J. D., and Muir, D. D. (1981) Thermostability of pro-
teases and lipases from a number of species of psychrophilic bacteria of dairy
origin. /. Appl. Bacteriol. 50, 289-303.
4. American Public Health Association (1972) Standard Methods for the Examina-
tion of Dairy Products, 13th ed., American Public Health Association, New York.
2
Biochemical Identification of Most Frequently
Encountered Bacteria That Cause Food Spoilage
Maria Luisa Genta and Humberto Heluane
1. Introduction
When the microbial flora invades food, two major problems arise. First is
the pathogenicity of several microbes, and second are the changes on the food
characteristics, such as contents of nutrients (hydrocarbons, vitamins,
aminoacids, metals, etc.), bad smell, color and flavor, texture modification, etc.
This chapter presents the identification techniques to the most usually
encountered bacteria that could be present on food.
Salmonella may be present on raw or non-heat-treated food. Eggs, milk,
mayonnaise, chicken, hamburger, and creams are the most frequent vehicles
for this bacteria. Salmonella is sensitive to high temperatures and can survive
at very low temperatures. It is a Gram negative, mobile, nonsporulated, and
facultative anerobic bacteria. Only total absence of this bacteria on food is
normally accepted by legal regulations.
As a consequence of the nature of the contamination, salmonellas are usually
present together with large numbers of other enterobacteria. Therefore the use
of enrichment and selective media is required.
Bacillus cereus is a gram positive, aerobic, and catalase-positive bacteria. The
optimal growth for this microorganism is obtained at temperatures oscillating
between 25 and 75°C and pHs between 6 and 7, even though this microorganism
survives temperatures as low as -5°C. The spores are very resistant to heat. At pHs
lower than 4 the growth of B. cereus is inhibited. This species is highly lipolytic,
saccharolytic and proteolytic and it is pathogenic for humans. It may be present on
flour, milk, dairy products, rice, chicken, spices, and herbs. Only total absence of
this species is normally accepted by legal regulations.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
11
12 Genta and Heluane
Coliform is the name given to those microorganisms that have the following
characteristics: rod shaped, gram negative, mobile or nonmobile, aerobic or
facultative anerobic nonsporulating. They ferment lactose, producing acid and
gas in presence of bile salts, at 30-38°C. Coliforms are usually found in the
intestine of humans and animals.
The Escherichia coli genus belongs to the enterobacteracea family and it is
usually a sign of fecal contamination. E. coli is a bacillus with the following
characteristics: Gram negative, mobile or nonmobile, oxidase negative, catalase
positive, and glucose and lactose fermentation positive. E. coli is found in the
human intestine, synthesizes vitamin K, and is involved in the production of
vitamin B. Humans eliminate E. coli through fecal residues. Some strains are
enterohemorrhagic pathogens.
Staphylococci are Gram positive, nonmobile, nonsporulated,
noncapsulated, catalase positive, oxidase negative and most of the strains
grow in media containing 10% NaCl. They are anaerobically facultative, but
they grow better in aerobiosis. Staphylococci are capable of growing at tem-
peratures oscillating between 8 and 45 °C, although the optimum growth tem-
perature is 37°C and pHs oscillating between 4 and 9.3, but the optimum
growth pHs are 7.0-7.5.
Staphylococci produce heat-resistant toxins that act at the digestive level.
There are seven kinds of enterotoxins, A, B, C l9 C 2 , C 3 , D, and E. Toxins A and
D are more frequently present in food intoxication. Staphylococcus aureus may
cause skin infection (acne). Staphylococci could be present in, e.g., dairy, meat,
sausages, fish, and eggs (1-6).
2. Materials
2.7. Method 1: Salmonellas
1 . 500 mL and 250 mL sterile Erlenmeyer flasks.
2. Sterile Petri dishes.
3. 10 mL sterile pipets.
4. Loop.
5. Sterile blender ("Minipimer" type).
6. Buffered peptone water: Ingredients per liter: peptone 10 g, sodium chloride 5 g,
sodium phosphate dibasic 9 g, potassium phosphate monobasic 1.5 g, pH 7.0.
7. Tetrathionate broth: Ingredients per liter: proteose peptone 5 g, bacto bile salts 1 g,
sodium thiosulfate 30 g, calcium carbonate 10 g.
2.1.1. Method of Preparation
a. Prepare 100 mL of tetrathionate broth with distilled or deionized water and
heat to boiling. Cool below 60°C.
Biochemical Identification 13
b. Add 2 rtiL iodine solution (prepared by dissolving 6 g iodine crystals and 5 g
potassium iodide in 20 mL distilled or deionized water) to medium. Do not
heat after adding iodine.
c. Dispense 10-12 mL quantities into sterile test tubes. Use medium the same
day it is prepared.
8. Selenite broth: Ingredients per liter: bacto tryptone 5 g, bacto lactose 4 g, sodium
selenite 4 g, sodium phosphate 10 g, pH 7.0.
Dissolve the ingredients 1 L distilled or deionized water and heat to boiling to
pasteurize. Avoid excessive heating. Do not sterilize in the autoclave.
9. Wilson-Blair medium: Medium A: Ingredients per liter: bacto beef extract 5 g, pro-
teose peptone 10 g, bacto dextrose 10 g, sodium chloride 5 g, bacto agar 30 g, pH 7.3.
Solution 1: 40 g sodium sulfite anhydrous in 100 mL distilled water.
Solution 2: 21 g sodium phosphate dibasic anhydrous in 100 mL distilled
water.
Solution 3: 12.5 g bismuth ammonium citrate granular in 100 mL distilled
water.
Solution 4: 0.96 g ferrous sulfate dried in 20 mL distilled water with two
drops of hydrochloric acid.
2.1 .1 .1 . Selective Reagent
The selective reagent consists of a combination of solutions 1-4. Each solution
is made up separately, dissolved, then combined. Heat combined solution to boil-
ing until a slate-gray color develops. Allow to cool and store at room temperature
in a closed rubber-stoppered container. It is stable for up to 1 mo.
2.1.1.2. Basal Medium
a. Prepare 1 L of medium A with distilled or deionized water and heat to boiling
to dissolve completely.
b. Sterilize in autoclave for 15 minutes at 121°C.
c. To prepare the complete medium, aseptically add 70 mL of selective reagent
and 4 mL of a 1% titrate solution of Brillant Green. Mix thoroughly.
d. Dispense as desired.
10. Salmonella-Shi gella agar (SS agar): Ingredients per liter: bacto beef extract 5 g,
proteose peptone 5 g, bacto lactose 10 g, bacto bile salts 8.5 g, sodium citrate 8.5
g, sodium thiosulfate 8.5 g, ferric citrate 1 g, bacto agar 13.5 g, bacto Brillant
Green 0.33 mg, bacto Neutral Green 0.025 g, pH 7.0.
a. Prepare 1 L of SS agar in distilled or deionized water and heat to boiling.
b. Boil for 2-3 min with frequent and careful swirling to dissolve completely.
Avoid overheating. Do not autoclave. Cool to 55-60°C.
c. Dispense into sterile Petri dishes. Allow the surface of the medium to become
quite dry by partially removing the covers while the medium solidifies (about
2 h) (3,7,8).
14 Genta and Heluane
2.2. Method 2: Salmonellas
1. 500 mL and 250 mL sterile Erlenmeyer flasks.
2. Sterile Petri dishes.
3. 10 mL sterile pipets.
4. Loop.
5. Sterile blender ("Minipimer" type).
6. Test tubes.
7. Buffered peptone water: Ingredients per liter: peptone 10 g, sodium chloride 5 g,
sodium phosphate dibasic 9 g, potassium phosphate monobasic 1.5 g, pH 7.
8. Chromogenic Salmonella esterease agar (CSE)
a. Basal medium: Ingredients per liter: peptone 4 g, Lab-Lemco powder (Oxoid
Ltd.) 3 g, tryptone 4 g, lactose 14.65 g, L-cisteine 0.128 g, trisodium citrate
dihydrate 0.5 g, Tris base 0.06 g, Tween-20.3 g, Roko agar (Industrias Roko
S.A., La Coruna, Spain) 12 g, pH basal medium 7.
b. Chromogenic substrate: SLPA-octanoate [bromide form], 0.3223 g per liter
in the final medium formulation (see Note 1).
c. UV-absorbing compound: ethyl 4-dimethylamilobenzoate (0.035%, wt/vol)
dissolved in 8 mL of methanol per liter of medium.
d. Novobiocin: 70 mg per liter (Sigma-Aldrich Co., Ltd.) (see Note 2).
2.2. 1. Preparation
a. Prepare required volume of basal medium.
b. Sterilize in autoclave for 15 minutes at 121°C.
c. Cool down to about 55°C.
d. Add other compounds (e.g., chromogenic substrate, UV-absorbing compound,
and Novobiocin).
e. Pour complete agar medium into Petri dishes.
f. After setting, let plates to be surface dried. Use immediately or store in dark
at room temperature for up to 2 wk.
9. Saline solution: Sterile solution: 0.85% NaCl in distilled water (8,9).
2.3. Bacillus cereus
1. 1 mL sterile pipets.
2. Drigalski spatula.
3. Loop.
4. 500 mL and 250 mL Erlenmeyer flasks.
5. Sterile Petri dishes.
6. Mossel agar: Ingredients per liter: bacto beef extract 1 g, peptone 10 g, D-mannitol
10 g, sodium chloride 10 g, phenol red 0.025 g, bacto agar 12 g, pH 7.0
a. Make up 90 mL of the medium and dispense into a flask. Autoclave 15 min at
121°C. Cool to 50-55°C.
b. Add 10 \xL of a suspension 1:1 of egg yolk in physiological solution. This
suspension must be maintained at 50°C.
Biochemical Identification 15
c. Add 100 \xg of polymixin B sulfate per milliliter of medium.
d. Use immediately.
7. Gelatinase reaction medium: Ingredients per liter: bacto beef extract 3 g, peptone
5 g, gelatin 120 g, pH 7.0. Make up the desired volume of medium and autoclave
15minat 121°C.
8. Clark-Lubs medium (peptone broth): Ingredients per liter: peptone 7 g, glucose
5 g, dibasic potassium 5 g, pH 7.5.
a. Dissolve ingredients in distilled or deionized water.
b. Adjust pH to 7.5.
c. Sterilize in the autoclave for 15 min at 121° Gay Lussac.
9. Methyl red: Make up a 0.5% solution in 60°C ethanol.
10. Diluted acetic acid.
1 1 . Malachite green.
12. Sudan black: Make up a 0.3% solution in 70% ethanol.
13. Xylol.
14. Safranin(3,7,#,/0).
2 A. Conforms
1. 1 mL Sterile pipets.
2. Loop.
3. Fermentation vials (Durham tubes).
4. Brilliant Green lactose bile broth media: Ingredients per liter: bacto peptone 10
g, bacto lactose 10 g, bile salts 20 g, Brillant Green 0.0133 g, pH 6.9.
2.4.1. Preparation
a. Suspend ingredients in distilled or deionized water and warm slightly to
dissolve completely.
b. Dispense required amount in test tubes.
c. Place an inverted fermentation vial (Durham tube) in each tube.
d. Place caps on tubes and sterilize in the autoclave for 15 min at 121°C.
e. Before opening the autoclave, allow the temperature to drop below 75°C to
avoid entrapment of air bubbles in the inverted vials.
5. Tryptone water: Ingredients per liter: tryptone 10 g, sodium chloride 5 g.
6. Levine agar: Ingredients per liter: bacto peptone 10 g, bacto lactose 10 g,
dipotassium phosphate 2 g, bacto agar 15 g, bacto eosin Y 0.4 g, bacto methylene
blue 0.065 g,pH 6.8-7.0.
a. Suspend the ingredients in distilled or deionized water and heat to boiling to
dissolve completely.
b. Sterilize in the autoclave for 15 min at 121°C.
7. Simmons citrate agar: Ingredients per liter: magnesium sulfate 0.2 g, ammonium
dihydrogen phosphate 1 g, dipotassium phosphate 1 g, sodium citrate 2 g, sodium
chloride 5 g, bacto agar 15 g, bacto brom thymol blue 0.08 g.
16 Genta and Heluane
a. Suspend the ingredients in distilled or deionized water and heat to boiling to
dissolve completely.
b. Sterilize in the autoclave for 15 min at 121°C.
8. Clark-Lubs medium (peptone broth): Ingredients per liter: peptone 7 g, glucose 5 g,
phosphate bipotasic 5 g, pH 7.5.
a. Dissolve ingredients in distilled or deionized water.
b. Adjust pH to 7.5.
c. Sterilize in the autoclave for 15 min at 121°C.
9. Kovacs reagent: Ingredients per liter: paradimethyl-aminobenzaldehyde 5 g, amyl
alcohol 75 mL, hydrohydrochloric acid 25 mL.
Dissolve the aldehyde in the amyl alcohol heating in a water bath at 50°C. Let it
cool down. Add the hydrochloric acid very slowly (in drops). The yellow-golden
solution obtained must be stored in a dark bottle with a ground glass stopper.
1 . Methyl red solution: Prepare a 0.5% solution of methyl red in 60° Gay Lussac ethanol.
11. Creatinine.
12. Potassium hydroxide: 40% Solution in water (3,7,8,13).
2.5. Staphylococcus aureus
1. 1 mL sterile pipets.
2. Drigalsky spatula.
3. Sterile Petri dishes.
4. Test tubes.
5. Hemolysis tubes.
6. Loop.
7. Hydrochloric acid 1 N.
8. Rabbit citratade plasma.
9. Baird-Parker agar: Ingredients per liter: bacto tryptone 10 g, bacto beef extract 5 g,
bacto yeast extract 1 g, glycine 12 g, sodium pyruvate 10 g, lithium chloride 5 g,
bacto agar 20 g, pH 6.8-7.0.
2.5.1. Preparation
a. Suspend the ingredients in distilled or deionized water.
b. Heat to melt agar and adjust pH.
c. Autoclave for 15 min at 121°C.
d. Cool down to 45-50°C.
e. Add 50 mL of a suspension 1:1 of egg yolk in physiological solution. This
suspension must be maintained at 45-50°C.
f. Add 3 mL of a 3.5% potassium tellurite solution sterilized by filtration. The
solution must be warmed up to 45-50°C.
10. DNase test agar: Ingredients per liter: bacto tryptose 20 g, deoxyribonucleic acid
(DNA) 2 g, sodium chloride 5 g, bacto agar 15 g, pH 7.3.
a. Suspend compounds in distilled or deionized water. Heat to boiling to dissolve
completely.
b. Sterilize in the autoclave for 15 min at 121°C.
Biochemical Identification 1 7
11. Brain-heart infusion: Ingredients per liter: Infusion from calf brains 200 g,
infusion from beef heart 250 g, proteose peptone 10 g, bacto dextrose 2 g, sodium
chloride 5 g, disodium phosphate 2.5 g, pH 7.4.
a. Suspend the ingredients in distilled or deionized water.
b. Dispense as desired.
c. Sterilize in the autoclave for 15 min at 121°C (3,7,8,10).
3. Methods
3. 7. Salmonellas: Method 1
1 . The sample of the solid or liquid food must be representative and weight not less
than 25 g.
2. Mix 225 mL of the buffered peptone water with 25 g of the food sample. Blend
the mixture with a Minipimer-type blender during 2 min. Afterward, the pH of
the mixture must be adjusted to 6-7 with a buffer solution.
3. Transfer aseptically the mixture obtained in step 2 to a 500-mL sterile Erlen-
meyer flask. Incubate at 37°C for 16-20 h.
4. After incubation, transfer 10 mL of the culture to a flask containing 100 mL of
tetrathionate broth (culture A). Incubate at 42-43 °C for 48 h.
5. Transfer 10 mL of the culture obtained in step 3 to a flask containing 100 mL of
selenite broth (culture B). Incubate at 37°C for 48 h.
6. After 24 h incubation in both tetrathionate broth (culture A) and selenite broth
(culture B), samples of each culture must be plated on to Wilson-Blair medium
and SS agar to obtain isolated colonies. Petri dishes must be incubated at 37°C
for 48 h (see Note 3).
7. The same plating procedure indicated in step 6 must be followed after 48 h of
cultivation in both cultures (tetrathionate broth and selenite broth), but this time
Petri dishes are incubated for 24 h.
8. Salmonella colonies on Wilson-Blair agar will appear as brown or black with
shiny colonies surrounded by a dark halo. Some strains develop green colonies
and do not darken the medium.
Salmonella colonies on SS agar appear as colorless or pinkish colonies at 18 h
of incubation. Afterward, they become bigger and opaque and they can develop
a gray or black central spot (1,3,5,10,11) (see Note 4).
3.2. Salmonellas: Method 2
1. Follow steps 1-3 of Subheading 3.1.
2. Transfer a sample of the culture into test tubes containing buffered peptone water.
3. Incubate for 4-6 h at 37 °C.
4. In order to obtain plates showing well-isolated colonies, the cultures must be
serially diluted in saline solution.
5. Spread 100 \xL of appropriate dilutions onto chromogenic medium.
6. Incubate plates at 37 or 42°C.
7. Observe for colony coloration for up to 48 h.
18 Genta and Heluane
8. Salmonella spp. could be differentiated from nonsalmonellae by the production
of burgundy-colored colonies. Nonsalmonellae appeared as white or colorless
colonies (3,9).
3.3. Bacillus cereus
1. Take 25 g of the sample and add 225 mL of peptone broth. Mix thoroughly for
1-2 min. The solution thus obtained is a 10" 1 dilution of the original sample. The
amount of peptone broth to add to the sample depends on the product to test. In case
of flour it is convenient to predetermine the volume of medium to use.
2. Add 1 mL of the 10 _1 dilution to 9 mL of sterile peptone broth to obtain 10~ 2
dilution. Make up a 10~ 3 and 10" 4 dilutions following the same procedure.
3. Plate 0.1 mL of the dilutions on Mossel agar. Spread the inocula using a Drigalski
spatula. The plates must be completely dry.
4. Incubate for 24-48 h at 30°C. Examine plates to find colonies that have grown
(see Note 5).
3.3.1. Biochemical Confirmation
The colonies must be transferred to plates containing gelatinase reaction
medium. Incubate for 2-3 d at 30°C. Cover the plates with diluted acetic acid.
Colonies that are gelatinase positive will show a halo.
The doubtful colonies must also be transferred to test tubes containing 5 mL of
Clark-Lubs medium (peptone broth). Incubate for 3 d at 30°C and then add to the
cultures 4-5 drops of methyl red indicator, mix to homogenize, and check color. If
the colonies are methyl red positives the culture color will turn to red, otherwise
the culture color will remain yellow. B. cereus is methyl red (+), gelatinase (+),
and lecitinase (++) (see Note 6).
The number of cells per gram of product is obtained multiplying the number
of colonies developed on Mossel agar by the dilution factor used for the sus-
pension plated on the Petri dishes (3,4,10-12).
3 A. Conforms
1. Add 225 mL peptone water to 25 g of the sample. Shake during 1-2 min. The
final suspension is a 1:10 dilution of the sample.
2. Prepare 9 sterile test tubes containing 9 mL each one of BGBL medium and the
inverted fermentation tubes (see BGBL culture medium, Subheading 2.4., item 4).
3. Add with sterile pipet 1 mL of the 1:10 dilution of the sample to each of three of
the test tubes mentioned earlier. The suspension obtained will be a 1:100 dilution
of the original sample. Follow the same procedure to obtain a 1:1000 and a
1:10000 dilutions of the original sample. Note that three test tubes containing
each dilution will be obtained.
4. Incubate the test tubes for 48 h at 30°C.
Biochemical Identification 19
5. After the incubation period, observe the test tubes. Tubes where 10% of the total
volume of the inverted vial is occupied by gas are considered as coliform positive.
The results of these test tubes are useful to determine the more probable number of
microorganisms per gram or milliliter in the original sample. For each dilution (1 : 100,
1:1000, and, 1:10000) the tubes with positive gas production are counted. The num-
ber of positive tubes are used to obtain the more probable number from Table 1
(12,4,10,12,13). The positive tubes will also allow the identification of E. coli.
3.5. E. Coli
3.5.1. General Procedure
E. coli must be investigated in all test tubes where gas is present when the
coliform identification technique was followed (see Subheading 3.4.). E. coli
has the following biochemical characteristics: gas production when incubated
in BGBL broth for 48 h at 44°C and indole production when incubated in
tryptone water during 48 h at 44°C.
1 . Mix each test tube where gas is observed when the coliform identification technique
was followed. Transfer a loopful of the suspension from each tube to a new sterile
tube containing 10 mL of BGBL medium and an inverted vial.
2. Repeat the foregoing procedure with test tubes containing 10 mL of tryptone water.
3. Incubate for 48 h at 44°C.
4. After the incubation period check the gas production. Write down the number of
positive tubes.
5 . Investigate indole presence in the tubes containing tryptone water with the following
technique:
a. Add 1 mL of Kovacs reagent.
b. An indole positive reaction will develop a red ring on the surface of the medium
after 5 min.
6. Consider E. coli positive subcultures that, having produced gas during the 30°C
incubation, give an indole-positive reaction in tryptone water and gas production
in BGBL at 44°C.
3.5.2. Specific Media for Confirmation of E. coli
In order to reinforce the identification of E. coli, use the following procedures:
1. Take samples with a loop from the E. coli positive test tubes containing BGBL
medium. Plate the samples onto Levine agar.
2. Incubate plates for 48 h at 37°C.
3. Observe colonies. Different characteristics between E. coli and Enterobacter
aero genes are given in Table 2. Colonies of Salmonella and Shigella are trans-
parent, amber colored.
4. Confirm the presence of E. coli by the IMVIC (test using the following tech-
niques: indole, methyl red, Voges-Proskauer, and sodium citrate).
a. Indole: Proceed as indicated in step 5 of protocol for E. coli identification.
20
Genta and Heluane
Table 1
More Probable Number of Microorganisms per Gram
or Milliliter (see Note 7)
Number per gram
Positive tubes
milliliter
io- 2
10" 3
10" 4
1
3
1
2
4
1
7
1
7
1
1
11
2
11
2
9
2
1
14
2
1
15
2
1
1
20
2
2
21
2
2
1
28
3
23
3
1
39
3
2
64
3
1
43
3
1
1
75
3
1
2
120
3
2
93
3
2
1
150
3
2
2
210
3
3
240
3
3
1
460
3
3
2
1,100
b. Methyl red:
(1) Prepare a pure culture from the doubtful colonies using peptone water as
the culture medium. This culture must be incubated for 6-8 h. Use a loopful
of the latter culture as the inoculum to a test tube containing 10 mL of Clark-
Lubs medium.
(2) Incubate for 72 h at 30°C.
(3) Divide culture in two identical volumes, one of which will be used in the
methyl red test and the other one in the Voges-Proskauer test.
(4) Add to one of them five drops of methyl red solution.
(5) Observe results: Red color: methyl red +; Yellow color: methyl red -.
Biochemical Identification
21
Table 2
Different Characteristics between Colonies of E. coli and A aerogenes
E. coli
A. aerogenes
Size
Elevation
Well-isolated colonies
are 2-3 mm in diameter
Colonies are slightly raised;
surface flat or slightly
Appearance by Colonies dark, buttonlike,
reflected light often concentrically ringed
with a greenish metallic sheen
Well-isolated colonies
are usually larger than E. coli
Colonies considerably raised
and markedly convex concave
Much lighter than E. coli,
centers are deep brown
Metallic sheen is not observed
c. Voges-Proskauer test: This test is also known as of acethyl-methyl-carbinol
production.
(1) Add to the other portion of the culture in the Clark-Lubs medium a small
amount of creatinine and 5 mL of the solution 40% of KOH.
(2) Mix during 2 min.
(3) Observe results: Pink Color: Voges-Proskauer +; no color change: Voges-
Proskauer -.
d. Sodium citrate test: Some microorganisms are able to grow with citrate as the sole
carbon source. This characteristic is used to differentiate the Enterobacteriaceae.
(1) Inoculate the doubtful culture with a loop in the middle of the plate.
(2) Incubate for 48 h at 37°C.
(3) Observe results. Blue color: citrate +. No color change: citrate -
(3,4,6,8,13-15).
The results of the IMVIC tests for different bacteria genus are given in Table 3.
3.6. Staphylococcus
1. Add 225 mL of sterile water to 25 g of the sample. Shake during 1-2 min. The
final suspension is a 1:10 dilution of the sample.
2. Prepare 1:100, 1:1000, and 1:10000 dilutions of the sample.
3. Spread 0.1 mL of each dilution onto Petri dishes containing Baird-Parker agar.
Use a Drigalski spatula to spread properly. Make duplicates of the plates.
4. Incubate for 24-48 h at 37°C.
5. Coagulase-positive colonies of staphylococci are black with a sheen surrounded
by a clear zone due to the action of the enzymes on the egg yolk.
6. Investigate the presence of enzymes in the doubtful colonies using the following
techniques.
a. DNase test: S. aureus is DNase positive.
(1) Plates containing DNase test agar are inoculated by streaking or spotting with
the material or culture being tested. Make only three streaks or spots per plate.
22 Genta and Heluane
Table 3
IMVIC Test Results for Different Bacteria
Indole Methyl red Voges-Proskauer Citrate
Shigella
±
+
Escherichia
±
+
Salmonella
—
+
Arizona
—
+
Citrobacter
—
+
Klebsiella
±
—
Enter obacter
—
—
Hafnia
—
—
Proteus
+
+
Providencia
+
+
+
- +
+
+ +
+ +
+ +
+
+
(2) Incubate for 18-24 h at 37°C.
(3) Flood plates with 1 N hydrochloric acid and observe for clearing around
the streak or spot indicating DNase activity.
b. Coagulase test: Most of the S. aureus strains are coagulase positive, although
in very few cases it could be coagulase negative.
(1) Test tubes containing 5 mL of brain-heart infusion are inoculated with the
material being tested.
(2) Incubate for 24 h at 37°C.
(3) Add 2-3 drops of the culture to a hemolysis tube containing 0.5 mL rabbit
plasma.
(4) Incubate at 37°C, periodically observing coagulation. Coagulation usu-
ally takes place before 4 h of inoculation.
c. Thermonuclease test: S. aureus DNase is thermoresistant.
(1) Plates containing Baird-Parker agar are inoculated by streaking or spot-
ting with the material or culture being tested.
(2) Incubate at 37°C for 24 h.
(3) The dishes that show colony development are then incubated at 65°C for
150 min. After this treatment the cells become inviable.
(4) Add to the plates DNase test agar containing toluidine blue. Incubate at
37°C for 4 h.
(5) DNase hydrolysis is shown by the presence of pinkish brilliant halos. The
clearing is due to the action of S. aureus DNase that is thermoresistant.
Although S. aureus cells could have been destroyed in the sample by any
reason, some toxins could remain active. Therefore, even though S. aureus
cells are not detectable, it is important to investigate the presence of toxins.
Specific kits are the more usual way to detect these toxins.
To isolate a toxin from the food sample, proceed as follows.
Biochemical Identification 23
(1) Take 10 g of the food and add to it 10 mL of sterile 0.85% NaCl solution.
Cool to 4°C.
(2) Centrifuge at 2000g for 30 min at 4°C.
(3) The supernatant is then filtered through a 0.2-\im filter.
(4) The filtrate is used to detect the presence of the toxin using adequate kits
(2,4,5,11,13-15).
4. Notes
1. Chromogenic Salmonella esterase agar is based on the detection of C 8 -esterase
activity in salmonellae.
2. Alternatively, the chromogenic substrate and UV-absorbing compound could be
added directly to the basal medium if this is heated only to the boiling point. UV-
absorbing compound is added to protect the substrate against photochemical
degradation. The use of novobiocin reduce the growth of nonsalmonella strains
in the chromogenic medium.
3. Salmonella: following the procedure four plates will be obtained:
a. Culture A on Wilson-Blair medium.
b. Culture A on SS agar.
c. Culture B on Wilson-Blair medium.
d. Culture B on SS agar.
4. Salmonella: It is recommended to confirm the presence of Salmonella that either
the colonies are typical or they are doubtful. The appearance of the colonies var-
ies not only for the different species but also with different batches of culture
media. An API-20E kit could be used as a method to confirm Salmonella.
5. B. cereus: the polymixin added to the Mossel agar allows the growth of B. cereus but
inhibits the growth of the secondary flora. The lecithin of the egg yolk will precipitate
by the action of the lecithinase of B. cereus. B. cereus does not produce an acid from
mannitol, therefore its presence does not turn the phenol red to yellow. The colonies
of B. cereus are pink surrounded by an opaque zone due to the action of the lecithi-
nase on the egg yolk. The colonies are invasive, irregular, and rough.
6. B. cereus: the other test to confirm the presence of B. cereus consists of transferring
the doubtful colonies onto any nutrient agar for bacteria and incubating them for 24 h.
The cells are then fixed by heat on a slide. The spore staining is done by adding the
malachite green solution to the slide and heating with direct flame until vapor emis-
sion. Keep heating for 5-10 min. Wash the sample with water, dry it, and add the
Sudan Black solution for lipid staining. Keep the Sudan Black solution in contact
with the preparation for 15 min, wash it with xylitol for 5 s, and let dry. Add safranin
and keep in contact for 1 min. Afterward, wash with water, dry, and observe. Spores
show green, lipid compounds black, and the cytoplasm will show red.
7. Coliforms: use Table 1, e.g.,
a. Dilution 1:100 positive tubes 1.
b. Dilution 1:1000 positive tubes 2.
c. Dilution 1:10000 positive tubes 0.
Then the more probable number of microorganisms is 1 1 per gram or millili-
ters of the original sample.
24 Genta and Heluane
References
1. Banwart, G. J. (1981) Microbiologic! Bdsica de los Alimentos, Ediciones
Bellatterra S.A. Anthropos, Barcelona, Spain.
2. Cliver, D. O. (1990) Foodborne Diseases, Academic Press, San Diego, CA.
3. International Commission on Microbiological Specifications for Foods (ICMSF).
Microorganismos de los Alimentos. Vol. 1 . Tecnicas de Andlisis Microbiologicos,
Editorial Acribia S.A., Zaragoza, Spain.
4. Sharf, J. M. (1965) Recomended methods for the microbiological examination of
foods. American Public Health Association Inc. Washington, DC.
5. Vila Aguilar, R. (1994) Instituto de Agroquimica y Tecnologia de Alimentos
(IATA), Valencia, Spain.
6. Martialay Valle, F. (1989) Prontuario de Tecnicas en Microbiologia de
Alimentos, Ministerio de Defensa, Sec. Gral. Tecnica, Madrid, Spain.
7. Marchal, N., Bourdon, J. L., and Richard, C. L. (1982) Les milieux de culture
pour l'isolement et 1' identification biochimique des bacteries. Doin editeurs. Paris.
8. Difco Manual, Difco Laboratories, USA (1995).
9. Cooke, V. M., Miles, R. J., Price, R. G., and Richardson, A.C. (1999) A novel
chromogenic ester agar medium for detection of Salmonellae. Appl. Environ.
Microbiol. 65, 2.
10. Pascual Anderson, M. R. (1982) Tecnicas para el Andlisis Microbiol 6 gico de
Alimentos y Bebidas, Ministerio de Sanidad y Consumo, Madrid, Spain.
11. Larpent, J. P. and Larpent Gourgaud, M. (1975) Memento. Techniques de
microbiologic, Technique et Documentation, Paris.
12. Fung, D. Y. C. and Matthews, R. F. (1991) Instrumental Methods for Quality
Assurance in Foods, Marcel Dekker, ASQC Quality Press, New York.
13. Collins, C. H. and Lyne, P. M. (1989) Metodos Microbiologicos, Editorial Acribia
S.A., Zaragoza, Spain.
14. Speck, M. L. (1976) Compendium of Methods for the Microbial Examination of
Foods, American Public Health Association, Inc., Washington, DC.
15. Thatcher, F. S. and Clark, D. S. (1973) Andlisis Microbiologico de los Alimentos,
Editorial Acribia S.A., Zaragoza, Spain.
3
Mesophilic Aerobic Microorganisms
Annavella Gaitan Herrera
1. Introduction
The mesophilic microorganism is ones of the more general and extensively
microbiological indicators of food quality, (1) indicating the adequacy of tem-
perature and sanitation control during processing, transport, and storage, and
revealing sources of contamination during manufacture (2).
2. Materials
1. Mechanical blender, two-speed model or single speed with rheostat control.
2. Glass or metal blending jars of 1 L capacity, with covers, that are resistant to
autoclave temperatures. One sterile jar (autoclaved at 121°C for 15 min) for each
sample to be analyzed.
3. Balance with weights. Capacity should be at least 2500 g, sensitivity 0.1 g.
4. Instruments for preparing samples: knives, forks, forceps, scissors, spoons, spatulas,
or tongue depressors, sterilized previous to use by autoclaving or by hot air.
5. A supply of 1, 10, and 1 1 mL pipet(s).
6. Refrigerator, at 2-5 °C.
7. Peptone dilution fluid or peptone salt dilution fluid sterilized in autoclave for
each sample, 450 mL in flask or bottle, 90 or 99 mL blanks in dilution bottles or
similar containers.
3. Methods
1. Begin the examination as soon as possible after the sample is taken. Refrigerate
the sample at 0-5°C whenever the examination cannot be started immediately
after it reaches the laboratory. If the sample is frozen, thaw it in its original
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
25
26 Herrera
container (or on the container in which it was received at the laboratory) for a
maximum of 18 h in a refrigerator at 2-5°C. If the frozen sample can be easily
comminuted (ice cream), proceed without thawing.
2. Tare the empty sterile blender jar, the weigh into it 50 ± 0.1 g representative of the
food sample. If the contents of the package are obviously not homogeneous (frozen
dinner), take a 50-g sample from a macerate of the whole dinner, or analyze each
different food portion separately, depending on the purpose of the test.
3. Add to the blender jar 450 mL of peptone dilution fluid or peptone salt dilution
fluid. This provides a dilution of 10 _1 .
4. Blend the food and dilute promptly. Start at low speed, then switch to high speed
within a few seconds; Time the blending carefully to permit 2 min at high speed.
Wait 2 or 3 min for foam to disperse.
5. Measure 1 mL of the 10 _1 dilution of the blended material, avoiding foam, into a
99-mL dilution blank, or 10 mL into a 90-mL blank. Shake this and all subsequent
dilutions vigorously 25 times in a 30-cm arc. Repeat this process using the
progressively increasing dilutions to prepare dilutions of 10~ 2 , 10~ 3 , 10" 4 , and 10~ 5 , or
dilutions that are desirable for the food under test (3).
4. References
1 . Elliot, R. P., Clark, D. S., et al. (1978) Microorganisms in Foods 1 . Significance and
Methods of Enumeration, 2nd ed. A publication of the International Commission on
Microbiological Specifications for Foods (ICMSF) of the International Association of
Microbiological Societies. University of Toronto Press, Canada.
2. Speck M. L. (1984) Compendium of Methods for the Microbiological Examination
of Foods, 2nd ed. Compiled by the APHA Technical Commitee on Microbiological
Methods for Foods, American Public Health Association, Washington, DC.
3. Marth, E. H., ed (1978) Standard Methods for the Examination of Dairy Products,
14th ed., American Public Health Association, Washington, DC.
4
Yeasts and Molds
Anavella Gaitan Herrera
1. Introduction
Yeast and molds (nonfilament and filament molds) may be found as part of
the normal flora of a food product on inadequately sanitized equipment or as
airborne contaminants. They can produce toxic metabolites, resistance to freez-
ing environments, and cause off odors and off flavors of foods. Media for the
enumeration of molds use antibiotics, e.g., penicillin + streptomycin, chloram-
phenicol, chlortetracycline, oxy tetracycline, and gentamicin; oxytetracycline
has been useful. The incubation temperature is 22°C over 5-8 d (1).
2. Materials
1. Petri dishes.
2. Bacteriological pipets 1, 5, and 10 mL.
3. Incubator 20-24°C. Water bath at 44-46°C for temperating agar.
4. Oxytetracycline gentamicin yeast extract glucose (OGY) agar.
5. Diluent, buffered peptone water.
6. Potato dextrose agor (PDA), Difco.
3. Methods
3. 1. Antibiotic Method
Use plate count agar, temper the medium to 45 °C and aseptically add 2 mL
of antibiotic solution (add 500 mg each of chlortetracycline HC1 and chloram-
phenicol [U.S. Biochemical Corp., Cleveland, OH] to 100 mL sterile
phosphate-buffered distilled water and mix) per 100 mL medium.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
27
28 Herrera
1. Pipet 1 mL aliquots from 10" 1 to 10" 5 dilutions. Promptly put into Petri dishes 10-15
mL of OGY agar, melted and tempered to 45°C.
2. Incubate the Petri dishes at 22°C for 5-8 d.
3. Count all colonies on plates containing 30-300 colonies, compute the number of
yeast and molds per gram or milliliter of food. Report as colony-forming units
(CFU) per g or mL of sample (2).
3.2. Acidified Method
Acidify PDA or malt agar with sterile 10% tartaric acid to pH 3.5 ± 0.1.
Acidify the sterile and temperated medium with a quantity of acid solution
immediately before pouring the agar onto plates. Do not reheat medium once
acid has been added.
References
1 . Speck, M. L. ( 1 984) Compendium of Methods for the Microbiological Examination
of Foods. 2nd ed. Compiled by the APHA Technical Commitee on Microbiological
Methods for Foods. American Public Health Association, Washington, DC.
2. Elliot, R. P., Clark, D. S. et al (1978) Microorganisms in Foods 1 . Significance
and Methods of Enumeration. 2nd ed. A publication of the International Commis-
sion on Microbiological Specifications for Foods (ICMSF) of the International
Association of Microbiological Societies. University of Toronto Press, Canada.
5
Coliforms
Anavella Gaitan Herrera
1. Introduction
The coliform group of indicator organisms includes some members of this
family that are capable of fermenting lactose with the production of acid and
gas within 48 h at 35°C. The family Enterobacteriaceae are Gram-negative
oxigenic and facultatively anoxigenic rods, nonspore forming, that produce
acid from glucose and other carbohydrates.
The fecal coliform group is restricted to organisms that grow in the gas-
trointestinal tract of humans and warm-blooded animals and includes members
of at least three genera Escherichia, Klebsiella, and Enter obacter. Elevated tem-
peratures tests for the differentation of organisms of the coliform group into
those fecal origin and those of nonfecal origin have been used {see Table 1).
The presence of Escherichia coli may be attributed to contamination from envi-
ronmental sources and subsequent growth in the product (1,2).
Standard methods for the examination of water and wastewater describes
two approaches to fecal coliform determinations:
1. Subculture from positive presumptive lauryl sulfate tryptose (LST) broth to
E. coli broth with incubation at 45.5 ± 0.2°C for 24 ± 2 h.
2. A membrane filter procedure using medium-fecal coliform broth with incubation
at 44.5 ± 0.2°C for 24 ± 2 h. Foods authorities specify incudation specify incuba-
tion E. coli broth 44.5 ± 0.2°C for 24 h for fecal coliform counts of fish, fish
products, and shellfish, but 44.5 ± 0.2°C for other foods.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
29
30 Herrera
1. 7. Enterobactehacae Group
A brilliant green-Oxgall broth with glucose substituted for the lactose is
used for enrichment. Cultures are recovered from violet red bile agar (VRB A)
fortified with 1% glucose.
7.2. Escherichia coli
The detection and enumeration of E. coli of sanitary significant isolates must
conform to the coliform and fecal coliform group determinations. The isolates
were identified by indol, motility, Voges-Proskauer, citrate (IMViV):
1 . IMViC pattern: ++ - - Type I.
2. IMViC pattern: -+-- Type II.
It is important considering that this profile is inadequate for the idenification
of the species. The relatively high incidence of type II in some specimens is
explained by the fact that cultures require 48 h to produce a detectable amount
of indole and need additional tests for speciation.
7.3. Enteropathogenic E. coli (EEC)
Enteropathogenic E. coli is an etiological agent of gastroenteritis in humans
and domestic animals. Identifications of these cultures requires serological,
pathological, and biochemical tests. Some cultures are unable to ferment lac-
tose within 48 h or do not produce gas. Tests for enteropathogenicity include:
production of one or more enterotoxins, colonization of epithelial cells, or inva-
siveness, and possession of somatic, capsular, and flagellar antigens.
2. Materials
1. Water baths capable of maintaining temperatures of 44 ± 0.2, 44.5 ± 0.2, and
49 ± 1°C.
2. Thermometer approx 45-55 cm long, with a range of 1.0-55°C.
3. Circulating air incubator, maintaining a temperature of 44 ± 0.3°C.
4. Ultraviolet lamp filtered with a Woods filter, emitting rays of 365 nm wavelength.
5. Glass spreader.
6. 5% C0 2 incubator, maintained at 36 ± 1°C, moisture saturated.
7. Serological racks.
8. Glass Petri dishes and pipets (0.1 mL, 0.025 mL, and Pasteur).
9 . Vertical laminar flow hood, biological contaminant hood equipped with HEP A™ filter.
1 1 . McFarland nephelometer.
2. 7. Media
l
2
. Lauryl sulfate tryptose (LST) broth.
. Brilliant green bile (BGB) broth.
Coliform Bacteria 3 1
3. E. coll broth.
4. Levine eosin methylene blue (EMB) agar.
5. Tryptone (trypticase) broth.
6. Buffered glucose broth (MR-VP) medium.
7. Koser citrate medium.
8. Violet red-bile agar (VRBA).
9. Phosphate-buffered dilution water.
10. A-l broth.
11. Tryptone bile agar.
12. Peptone water.
13. Minerals-modifed glutamate agar.
14. Brain-heart infusion (BHI).
15. Tryptone phosphate (TP) broth.
16. MacConkey agar.
17. Veal infusion agar.
18. Malonate broth.
19. Bromocresol purple carbohydrate broth supplemented with the following carbo-
hydrates: 0.5% glucose, 0.5% sorbitol, 0.5% cellobiose, 0.5% mannitol, 0.5%
lactose, and 0.5% adonitol.
20. KCN broth.
21. Blood agar base.
22. Urea agar.
23. Motility agar.
24. Plate count agar (PCA).
2.2. Reagents
1. Kovacs indole reagent.
2. Methyl red indicator.
3. Voges-Proskauer reagents.
4. Gram-stain reagents.
5. NaCl 0.5%, sterile.
6. pH test paper, range 5.0-8.0.
7. E. coll antisera.
8. Shigella antisera.
9. Pathogenic biotypes of E. coli: enteroinvasive, enterotoxigenic (producing heat-
labile toxin), enterotoxigenic (producing heat-stable toxin), and classical (infan-
tile enteropathogenic).
10. Cytochrome oxidase reagent.
3. Methods
3. 1. Preparation of Sample
1. Hold in the refrigerator at 2-5 °C for 18 h before analysis.
2. Weigh 25 g of regular or thawed food sample aseptically into a sterile blender jar.
32 Herrera
3. Add 225 mL of diluent (buffered peptone water) and blend for 2 min.
4. Prepare decimal dilutions in the range 1:10, 1 : 100 by adding 10 mL of the previ-
ous dilution to 90 mL of the sterile diluent, shake all dilutions for 7 s.
3.2. Presumptive Test for Coliform Group Most Probable
Number (MPN)
1. Inoculate three replicate tubes of LST broth per dilution with 1 mL of the previ-
ously prepared 1:10, 1:100, and 1:1000 dilutions.
2. Incubated tubes for 24 and 48 ± 2 h at 35 ± 0. 5°C.
3. Observe all tubes for gas production either in the inverted vial (Durham) or by
effervescence produced. Read tubes for gas production after 24 h. Reincubate
negative tubes for an additional 24 h.
4. Record LST tubes showing gas within 48 h, refer to Table 2 (three-tube dilutions)
and report as the presumptive MPN of coliform bacteria per gram or milliter of food.
5. To obtain the MPN, determine from each of the three selected dilutions the num-
ber of tubes that provided a confirmed coliform result. Refer to Table 2 and note
the MPN based on the levels of sample dilution and the number of confirmed
postive tubes of each dilution selected.
6. Refer results to Table 2 calculated from the data of the Man (1975).
3.3. Confirmed Test for Coliform Group
1. Subculture positive LST tubes (gas production) into BGB broth, incubate at
35±0.5°Cfor48±2h.
2. Record LST tubes showing gas within 48 h, refer to Table 1 (three- or five-tube
dilutions) and report as confirmed MPN of coliform bacteria per g or mL of food.
3.3. 1. Coliform Group (VRBA)
1. Homogenize 25 g or mL sample for 2 min in 225 mL phosphate buffer.
2. Prepare serial tenfold dilutions.
3. Transfer two 1 mL aliquots of each solution to Petri dishes. Pour 1 mL of VRBA
mix; overlay with 5 mL VRBA. Incubate 24 h at 35°C.
4. Count purple-red colonies surrounded by zone of precipitated bile acids.
5. Confirmation: select colonies and transfer each to a tube of BGB broth, incubate
at 35°C for 24 or 48 h. Colonies producing gas are confirmed as coliform organ-
isms. Multiply the number of coliform organisms per gram of sample.
3.3.2. Fecal Coliform: The Mackenzie Test
This procedure should differentiate between coliforms of fecal origin (intes-
tines) and coliforms from other sources.
Table 1
Differentiation of £. co// from Related Enterobacteriaceae
Culture
IMViC
Motility
37°C
Cytochrome
oxidase
Glucose
gas
KCN
Lactose
Typical E. coli
++ —
+
Inactive E. coli
++ —
—
Plesiomonas
++ —
+
Klebsiella
-±±-
—
CO
Hafnia
-±±-
+
Co
Aeromonas
++++
+
Culture
Mannitol
S<
Typical E. coli
+
Inactive E. coli
+
Plesiomonas
+
Klebsiella
+
Hafnia
+
Aeromonas
+
+
+
+
+
+
+
+
Sorbitol
Cellobiose
Malonate
+
Adonitol
Urease
34
Herrera
Table 2
Most Probable Number of Bacteria (MPN)
Number of
positive
tubes
at each dilution level
Confidence limits
10-
1 (g) io- 2
io- 3
MPN (g)
99%
MPN (g)
95%
MPN
1
3
<1
23
<1
17
1
4
<1
28
1
21
1
1
7
1
35
2
27
1
1
7
1
36
2
28
1
2
11
2
44
4
35
2
9
1
50
2
38
2
1
14
3
62
5
48
2
1
15
3
65
5
50
2
1
1
20
5
77
8
61
2
2
21
5
80
8
63
3
23
4
177
7
129
3
1
40
10
230
10
180
3
1
40
10
290
20
210
3
1
1
70
20
370
20
280
3
2
90
20
520
30
390
3
2
1
150
30
660
50
510
3
2
2
210
50
820
80
640
3
3
200
<100
1900
100
1400
3
3
1
500
100
3200
200
2400
3
3
2
1100
200
6400
300
4800
Inoculate 1 mL into each of three tubes of media. Multiply the MPN by the appropriate factor of
10,100, or 1000.
Example: tubes selected come from IO -2 , IO -3 , and IO -4 multiply by 10, IO -3 , IO -4 and 10~ 5
multiply by 100.
1. Subculture positive LST tubes showing gas within 48 h to E. coli broth.
2. Incubate 24 ± 2 h at 4.5 ± 0.2°C.
3. Examine tubes for gas.
4. Calculate MPN values according to Table 2. Report results as MPN of fecal
coliforms per gram or milliliter.
3A. Enumeration o/E. coli
1. Subculture positive LST tubes showing gas within 48 ± 2 h into E. coli broth by
means of the 30-mm loop.
2. Incubate all E. coli tubes in a water bath for 48 ± 2 h at 45 ± 0.2°C.
3. Subculture all E. coli tubes showing gas on EMB plates and incubate 24 ± 2 h at
35°C.
Coliform Bacteria 35
4. If typical colonies are present (nucleated, dark-centered, with or without sheen)
pick two colonies from EMB plate and transfer each to a PCA slant. Incubate
slants at 35°C from 18-24 h.
3.4.1. Test for Indentification
1 . Tryptone broth incubate 24 ± 2 h at 35°C and test for indole. Add 0.3 mL Kovacs
reagent. The test is positive if the upper layer becomes red.
2. Incubate MR-VP medium for 48 ± 2 h at 35°C, transfer 1 mL of culture to tube to
test for acetylmethylcarbinol. Add 0.6 mL alcoholic alpha-naphthol and 0.2 mL
40% KOH. Mix and add a few crystals of. Incubate at room temperature for 2 h.
Test is positive if eosin pink develops. Incubate the remainer of MR-VP culture
for 48 h and test for methyl red reaction by adding five drops of methyl red solu-
tion to the culture. Test is positive if the culture turns red, negative if yellow or
orange.
3. Citrate broth. Incubate 48 h at 35°C and record growth as + or - .
4. LST broth: Incubate 48 ± 2 h at 35°C. Examine tubes for gas and formation
from lactose.
5. IMViC reaction: ++ — or - + — .
6. Compute MPN of E. coli per gram or milliliter.
3.5. Rapid Method for Enumeration of E. coli Biotype I
This method is modified by Anderson and Parker (3).
1. Prepare serial tenfold dilutions in peptone water of food.
2. Aseptically transfer sterile cellulose acetate membranes to the surface or dried
glutamate agar.
3. Transfer duplicate 1.0 mL aliquots of each dilution to cellulose acetate
membranes, using a sterile glass Drigalski spreader, distribute the fluid over the
entire membrane (except the periphery).
4. Incubate plates 4 h at 35°C (facilitate resuscitation). Transfer each membrane to
tryptone bile agar plate and incubate for 18 h at 44°C.
5. Remove lids of plates. Add 3 mL Kovacs reagent into each lid. Remove mem-
brane from agar and immerse in reagent for 5 min. Remove membrane and drain
excess reagent. Dry the membranes under a UV lamp.
6. Count pink-stained colonies within 30 min.
7. Calculate the number of type I E. coli by selecting the dilution giving an average of
20-50 pink colonies and both membranes and multiply total by the dilution factor.
References
1 . Speck, M. L. ( 1 984) Compendium of Methods for the Microbiological Examination
of Foods, 2nd ed. Compiled by the APHA Technical Committee on Microbiological
Methods for Foods. American Public Health Association, Washington, DC.
36 Herrera
2. Elliot, R. P., Clark, D. S., et al. (1978) Microorganisms in Foods. Significance and
Methods of Enumeration, 2nd. ed. A publication of International Commission on
Microbiological Specifications for Foods (ICMSF) of the International Association
of Microbiological Societies, University of Toronto Press, Canada.
3. Anderson, J. M. and Baird Parker, A. C. (1975) A rapid and direct plate method for
enumerating Escherichia coli biotype I in food. /. Appl. Bacteriol. 39, 1 1 1-1 17.
6
Genetic Analysis of Food Spoilage Yeasts
Stephen A. James, Matthew D. Collins, and Ian N. Roberts
1. Introduction
Yeasts have been associated with foods since earliest times, both as beneficial
agents and as major causes of spoilage and economic loss. Current losses to the
food industry caused by yeast spoilage are estimated at several million pounds
annually in the UK alone. As new food ingredients and new food manufacturing
technologies are introduced, novel food spoilage yeasts are emerging to present
additional problems. Consumer demand for milder food preservation regimes
and tougher regulatory constraints on hygiene in the production environment all
serve to increase the economic severity of problems caused by yeasts.
In order to better understand the processes by which yeast species (including
novel preservative-resistant strains) emerge to cause spoilage, more information is
needed concerning their biological diversity, natural habitats, and genetic interre-
latedness. This information can be used to predict the potential for yeast spoilage in
any particular food environment and to provide methods for rapid identification of
the species involved. To date, over 700 biological species of yeasts have been
described and thousands of different varieties have been shown to exist in all kinds
of natural and artificial habitats. Rapid identification is therefore essential in order
to establish at an early stage which species is involved and thus to predict the likely
severity of the problem and sensible course of action.
The methods presented here are based on DNA sequence analysis of the
ribosomal RNA (rRNA) genes. The small subunit rRNA gene (also referred to
as 18S rDNA) has proved to be an excellent evolutionary chronometer for
establishing species interrelationships (1). The neighboring internal transcribed
spacer (ITS) regions have been shown to be far more variable and have proved
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
37
38 James, Collins, and Roberts
valuable for designing polymerase chain reaction (PCR) primers for rapid
species identification (2). These methods are extremely rapid and can take less
than 24 h in contrast with conventional methods that may take 3—4 wk. Detailed
protocols associated with both methodologies are provided as follows.
2. Materials
Caution: the procedures described here involve the use of potentially
hazardous materials. The relevant safety regulations (e.g., Control of
Substances Hazardous to Health [COSHH] regulations [3]) should be consulted
prior to the use of these procedures.
1 . Difco yeast malt ( YM) broth: Difco dehydrated YM broth (ref . no . 07 1 1 -0 1 , Difco
Inc., Detroit, MI), 21 g/L. Alternatively, use YM medium: 3 g yeast extract, 3 g
malt extract, 5 g peptone, and 1 g glucose, made up to 1 L. After mixing, the pH
should be between 5 and 6. Sterilize by autoclaving for 15 min at 15-lb pressure
(121°C).
2. YM agar: Add 2% (w/v) agar to Difco YM broth or YM media before steriliza-
tion. After mixing, the pH should be between 5 and 6. Sterilize by autoclaving for
15 min at 15-lb pressure (121°C). Dispense in 20 mL aliquots into sterile Petri
dishes and leave to cool.
3. AmpliTaq DNA polymerase and 10X buffer (Perkin-Elmer, PE Biosystems,
Warrington, UK).
4. Deoxynucleotide triphospate (dNTP) stock mix (40 \iM each dNTP: ref. no.
U1240, Promega UK Ltd., Southampton, UK). For a working stock solution, mix
10 ^L of each dNTP (dATP, dCTP, dGTP, dTTP) with 60 jaL sterile distilled
water (SDW), to give a final concentration of 10 mM.
5. Thermocycler: Omnigene thermocycler (Hybaid Ltd., Ashford, Middlesex, UK).
6. Oligonucleotide primers: the sequences of the 18S rDNA and ITS amplification
and sequencing primers are listed in Tables 1 and 2. All oligonucleotide primers
were synthesized using a model 394A DNA synthesizer (PE Biosystems) and
phosphoramidite chemistry. For DNA amplification, dilute primers to a final
working stock concentration of 20 pmol/fiL. For sequencing, dilute primers to a
final working stock concentration of 4 pmol/jaL.
7. Mineral oil (ref. no. M5904, Sigma Chemical Co. Ltd., Dorset, UK).
8. Taq DyeDeoxy terminator cycle sequencing kit (PE Biosystems).
9. PE Biosystems model 373A DNA sequencer (PE Biosystems).
10. QIAquick PCR purification kit (ref. no. 28104, QIAGEN Ltd., Crawley, West
Sussex, UK).
11. Agarose (ref. no. A-0169, Sigma Chemical Co. Ltd., Poole, Dorset, UK).
12. 10X TBE: 121 g Tris Base, 55 g boric acid, and 7.4 g EDTA, made up to 1 L
with SDW.
13. Benchtop microcentrifuge (e.g., Eppendorf centrifuge model 5415C).
14. Minigel apparatus (e.g., GNA-100 "mini-submarine" gel apparatus: ref. no.
18-2400-02, Pharmacia Biotech, St. Albans, Herts, UK).
Food Spoilage Yeasts 39
Table 1
Oligonucleotide Primers Used for DNA Amplification and Sequencing of
Yeast 18SrDNA
Approx position
Primer Primer sequence 5'- 3' (S. cerevisiae numbering)
PI 08 ACCTGGTTGATCCTGCCAGT 2-21
PI 30 GTCTCAAAGATTAAGCCATG 34-53
WIL1 ATTTCTGCCCTATCAACT 301-318
PI 190 CAATTGGAGGGCAAGTCTGG 543-562
P2 1 30 GGTG A A ATTCTTGG ATTTATTG 900-92 1
P2540 GGAGTATGGTCGCAAGGCTG 1 108-1 127
P3490 CCGCACGCGCGCTACACTGA 1454-1473
WIL2 AGTTGATAGGGCAGAAAT 318-301
M 1 1 90 CC AG ACTTGCCCTCC A ATTG 562-543
M2 1 30 CAATAAATCCAAGAATTTCACC 92 1-900
M2540 CAGCCTTGCGACCATACTCC 1121-1 108
M3490 TCAGTGTAGCGCGCGTGCGG 1473-1454
M3989 CTACGGAAACCTTGTTACGACT 1775-1754
Table 2
Oligonucleotide Primers used for DNA Amplification and Sequencing
of the Yeast Internal Transcribed Spacer (ITS) Region
Approx position
Primer Primer sequence 5—3' (S. cerevisiae numbering)
pITS 1 TCCGTAGGTG A ACCTGCGG 1 769-1787 a
p5.8Sr ATGACRCTCAAACAGGCAT 156-138 b
pITS3 GCATCGATGAAGAACGCAG 31-49^
pITS4 TCCTCCGCTTATTGATATG 68-50 c
a 18S rRNA gene, b 5.8S rRNA gene, c 26S rRNA gene.
R = A/G.
15. Gilson micropipetters (Anachem Ltd., Luton, Beds, UK).
16. Power pack (e.g., EPS 200: ref. no. 19-0200-00, Pharmacia Biotech).
17. Transilluminator (Anachem Ltd.).
18. Multiple-sequence alignment program (e.g., PILEUP [4], contained in the
Genetics Computer Group software package [5]).
19. Phylogeny inference software (e.g., PHYLIP [6]).
3. Procedures
Caution: follow good laboratory practice throughout.
40 James, Collins, and Roberts
3. 7. Strain Cultivation
Streak out yeast isolates on YM agar plates, and grow at 24°C for 2-3 d to
produce well-separated colonies. Authenticated yeast strains can be obtained from
a number of culture collections, and their addresses are detailed in the Appendix.
3.2. DNA Amplification of Yeast 18S rDNA
1 . Yeast 1 8S rDNA is amplified as two overlapping fragments by using the PCR (7)
and the oligonucleotide primer combinations PI 08 :M3490 and PI 190:M3989 (for
primer sequences refer to Table 1).
2. Carry out DNA amplification directly on yeast cell suspensions. Resuspend cells
from a well-isolated single yeast colony in 50 fiL SDW. Dilute 5 \xL of this cell
suspension in a further 45 ^JL SDW. Boil the diluted cell suspension for 5 min
and place on ice. To the cooled "heat-treated" cell suspension add 1 \iL of each
amplification primer (20 pmol/f^L), 2 \xh of dNTP working solution, 10 f^L Taq
polymerase buffer (10X), and 1.5 U of AmpliTaq DNA polymerase. Make up the
reaction mix to a final volume of 100 \kL with SDW, and overlay the reaction mix
with two to three drops (approx 50 \xL) of sterile mineral oil.
3. Carry out DNA amplification in an appropriate thermocycler. When using the
Hybaid Omnigene thermocycler the following cycling parameters should be used:
a. 1 cycle of 94°C for 2 min (initial denaturation)
b. 2 cycles of 94°C for 2 min (denaturation), 54°C for 1 min (primer annealing),
and 72°C for 2 min (primer extension)
c. 33 cycles of 92°C for 2 min, 54°C for 1 min, and 72°C for 2 min
d. 1 cycle of 72°C for 5 min
4. Following DNA amplification, analyze 5 \iL aliquots of each PCR sample by
1.0% agarose-TBE gel electrophoresis (125 V for 30-40 min), using a minigel
apparatus (e.g., GNA-100 "minisubmarine" gel apparatus). Stain the agarose gel
in ethidium bromide (0.5 f^g/mL) for approx 20 min and visualize using a UV
transilluminator.
5 . Caution: ethidium bromide is a powerful mutagen and gloves should be worn when
handling gels in the staining solution, and eyes should be protected (with suitable
mask or goggles) at all times when analysing stained gels under UY light.
3.3. DNA Amplification of the ITS Region from Yeasts
The general protocol used to amplify the ITS region from yeast cells is iden-
tical to that detailed in Subheading 3.2. (DNA amplification of yeast 18S
rDNA), with the exception that the ITS region is amplified as a single PCR
fragment using the primer combination pITS 1 :pITS4 (for primer sequences
refer to Table 2 and ref. [8]).
Food Spoilage Yeasts 4 1
3.4. Purification of PCR-Amplified DNA Fragments
Purify PCR-amplified DNA fragments using a QIAquick PCR purification
kit following the manufacturer's protocol and resuspend DNA in 50 [aL SDW.
Analyze 1 to 2 \xL of each purified PCR-amplified fragment by agarose gel
electrophoresis (refer to Subheading 3.2.) and quantify against a known
amount of DNA standard (e.g. uncut X DNA).
3.5. Direct Sequencing of PCR-Amplified Fragments
1. The purified PCR-amplified fragments are sequenced directly using a Taq Dye-
Deoxy terminator cycle sequencing kit. For each sequencing reaction use 1-2 \kL
(approx 50 to 100 ng) of purified PCR-amplified fragment and add 8 \iL
DyeDeoxy terminator ready-reaction mix, 1 \xL sequencing primer (4 pmol/jaL),
and make up to a final volume of 20 ^JL with SDW. Overlay each sequencing
reaction mix with one drop of sterile mineral oil.
2. Carry out cycle sequencing in an appropriate thermocycler such as the Hybaid
Omnigene thermocycler, using the following thermal cycling parameters: 1 cycle
of 96°C for 2 min, followed by 25 cycles of 96°C for 30 s, 50°C for 15 s, and
60°C for 4 min.
3. To purify, transfer each completed sequencing reaction to a 0.5 mL Eppendorf
microcentrifuge tube containing 50 fiL 95% ethanol and 2 \xL 3 M sodium acetate
(pH 4.6). Vortex briefly and store samples on ice for 10 min. Centrifuge samples in
a benchtop microcentrifuge (e.g., Eppendorf centrifuge model 5415 C) for 20 min.
Carefully remove ethanol solution using a Gilson micropipetter. Rinse pellet by
adding 200 j^L ice-cold 70% ethanol. Carefully remove ethanol solution with a
micropipetter and dry pellet under vacuum (e.g., using a Speedivac centrifuge).
4. Following the manufacturer's instructions, electrophorese purified extension
products using an PE Biosystems model 373A DNA sequencer.
3.6. Analysis of 18S rDNA Sequences
1 . Using the complete set of primers listed in Table 1, approx 95% of the 1 8S rDNA
from an individual yeast isolate can be double-strand sequenced.
2. Once determined, the 18S rDNA sequence of the yeast isolate can either be aligned
with known yeast 18S rDNA sequences or used in a similarity search (e.g., perform-
ing a FASTA search [9]) to match with 18S rDNA sequences from a databank such
as EMBL or GENBANK. In the latter case, the best matching sequences can then be
extracted from the databank and included in the phylogenetic analysis.
3. To align the resulting set of 18S rDNA sequences, use a multiple sequence align-
ment program such as GCG PILEUP (4) to generate a multiple sequence format
(MSF) file. Depending on how closely related the set of 18S rDNA sequences
are, manual editing of the resulting sequence alignment may be required to
accommodate for sequence insertions and deletions.
42 James, Collins, and Roberts
4. In order for a multiple sequence alignment produced using the PILEUP program to
be compatible for use with the PHYLIP software package, two alterations need to be
made to it.
5. First, the MSF file needs to be reformatted into PHYLIP interleaved format. To
do this, the standalone program READSEQ (included in the PHYLIP software
package) is used.
6. To reformat, the following command line is used:
readseq -a yeast.msf -format=phylip -output=yeast.phy
where, "yeast.msf" refers to the name given to the multiple sequence alignment
file, and "yeast.phy" to the name assigned to the PHYLIP reformatted file.
7. Second, once reformatted all "periods" within the alignment need to be recoded
as either "unknown" bases (i.e., using the letter N), or as "deletions" (i.e., using
the symbol -). This manual editing of the reformatted sequence alignment is
essential, as the PHYLIP software package is not compatible with all of the
sequence symbols used by the GCG software package.
3.7. Phylogenetic Tree Construction Using the Neighbor-Joining
Distance-Based Method
For generating phylogenetic trees from closely related organisms, the Neigh-
bor-joining (NJ) method (10) is used, as recommended by Murray and co-work-
ers (11). This is a distance-based method that generates a phylogenetic tree
using a distance matrix calculated from the sequence data.
1. To generate the distance matrix, use the DNADIST program contained in the
PHYLIP software package, with the reformatted sequence alignment as the input
file (e.g., "yeast.phy"). The DNADIST program offers a choice of four models
for calculating pairwise distances between DNA sequences. The two models most
commonly used with 18S rDNA sequences are the Jukes-Cantor and Kimura
2-parameter models. For short sequences, the Jukes-Cantor model is recom-
mended (which assumes that all nucleotide positions along a DNA sequence dis-
play the same rate of base substitution).
2. The appropriate model for calculating pairwise distance is selected by typing in
"d" until the model of choice is displayed in the program settings. Once the selec-
tion is made and an output file name is assigned for the resulting distance matrix
(e.g., "yeast.dist"), the program can be run by typing "y" (i.e., "yes") to the ques-
tion "are these settings correct?".
3. From the resulting DNA distance matrix file (e.g., "yeast.dist"), a phylogenetic
tree can be constructed by using the Neighbor-joining method (10).
4. The Neighbor-joining method is run by selecting the "Neighbor joining" option
(N) of the NEIGHBOR program. To root the tree, select the outgroup option (O)
and specify the species (by number) to be used as the outgroup. (N.B. Species are
numbered depending on where their sequences are located in the original
sequence alignment, with the uppermost sequence being assigned as species 1.) In
Food Spoilage Yeasts 43
the phylogenetic tree shown in Fig. 1, Kluyveromyces lactis was used as the
outgroup. As with the DNADIST program, the NEIGHBOR program is run by
typing "y" to the question "are these settings correct?" and hitting the return key.
5. Once the program has run (and this takes a matter of seconds), two files are
created. These are the output and tree files (e.g., "yeast.out" and "yeast. tree,"
respectively). To visualize the results, type in the output file name, and the tree
topology and branch lengths will be displayed. This data combined can then be
used to draw the phylogenetic tree generated from the 18S rDNA sequence align-
ment (e.g., such as is shown in Fig. 1).
3.8. Statistical Analysis of the Phylogenetic Tree
Once the phylogenetic tree has been generated, the next step is to statisti-
cally test its topology. One method that is commonly used to test phylogenetic
tree topologies is the statistical method of bootstrapping (12). This method
calculates the variability of the tree topology by resampling (with replacement)
the original multiple sequence alignment a set number of times (i.e., a number
between 100 and 2000) to generate a new set of artificial multiple alignments.
This new data set is in turn used to generate a set of trees, from which a
"consensus" tree is produced. In the resulting consensus tree, at each branch
node on the tree, the fraction of bootstrap trials (referred to as the bootstrap
value) that confirmed that node is shown. For example in Fig. 1, 96 of 100
bootstrap trials found that the asexual yeast species (referred to as the
anamorph) Candida holmii and its sexual form (referred to as the teleomorph)
Saccharomyces exiguus were distinct from all other species examined in the
study. Consequently, the higher the bootstrap value, the greater the statistical
support for an individual branch within a phylogenetic tree. The PHYLIP
programs used to calculate the bootstrap values for a phylogenetic tree are
SEQBOOT, DNADIST, NEIGHBOR, and CONSENSE (used in the order shown).
1. To generate the multiple dataset of artificial sequence alignments, select the
SEQBOOT program and use the original multiple sequence alignment
("yeast.phy") as the input file (N.B. choose an appropriate output file name such
as "yeast. seqs"). In the program settings, use option (J) to designate the number
of multiple datasets (referred to in SEQBOOT as replicates) to be generated. In
the bootstrapped tree shown in Fig. 1, 100 datasets were used.
2. Once the number of datasets has been selected, run the program by typing "y" to
the question "are these settings correct?" and hitting the return key.
3. The output file "yeast. seqs" can now be used to generate a set of trees by using
the programs DNADIST and NEIGHBOR as described in Subheading 3.7. The
only difference that needs to be made is to alter option (M) in the settings of both
programs so that they will analyze multiple datasets (N.B.: it is also necessary to
indicate how many datasets are to be analyzed).
44
James, Collins, and Roberts
Fig. 1. Dendrogram showing the phylogenetic relationship between species of the
yeast genera Kluyveromyces , Saccharomyces , Torulaspora, and Zygosaccharomyces,
based on 18S rDNA sequences. The tree was constructed by using the neighbor-join-
ing method (10). Bootstrap values, expressed as percentages of 100 replications, are
given at branch points (only values >50% are shown).
Food Spoilage Yeasts 45
4. To generate the consensus tree, run the CONSENSE program, using the tree file
generated by the NEIGHBOR program as the input file. As with the NEIGHBOR
program, the resulting consensus tree can be rooted by using option (O) to select
the species to be used as the outgroup, and option (R) to root the tree based on
this selection. Once these settings are changed, run the program.
5. CONSENSE generates two files, an output file and a tree file. The output file is the
file to view, as this will show the calculated bootstrap values for all branch nodes of
the consensus tree. The bootstrap data can then be combined with the originally gen-
erated phylogenetic tree to produce a bootstrapped tree, such as is shown in Fig. 1.
For further detailed reading on all aspects of phylogenetic analysis, we recommend
the reader refers to the chapter entitled "phylogenetic inference" of ref. (13).
4. Notes
4. 7. Species Identification and Differentiation Based on Partial
rDNA Sequencing
As well as being invaluable for investigating the phylogenetic relationships
between yeast species and genera, 18S rDNA sequence analysis is also proving
to be extremely useful for both species identification and differentiation. For
these purposes it is not necessary to analyse the entire 18S rDNA sequence, as
it has been found to be comprised of conserved, semiconserved, and variable
regions of sequence (1,14). The best regions of the gene to analyze for identifi-
cation purposes are the variable regions. The region most suitable for such
purposes is the V4 region (where "V" stands for variable [14]), which has been
found to display the greatest level of sequence variation between different yeast
species (15). This region is located between nucleotide positions 635 and 860
in the gene (S. cerevisiae numbering [16]).
To use this region for species differentiation and identification the 1 8S rDNA can
be amplified from different yeast isolates as described in Subheading 3.2., using the
primer combination P108:M3490. Following the protocols as detailed in Subhead-
ing 3.4. and 3.5., the V4 region of the 18S rDNA can be completely double-strand
sequenced using the primers PI 190 and M2130 (see Table 1 for primer sequences).
In our experience the majority of yeast species can be differentiated based on their
V4 region sequences (15,17-19). In most cases, strains of the same species possess
identical V4 sequences, whereas strains of even closely related species (e.g.,Z. bailii
and Z. bisporus; see Fig. 1) tend to differ by at least one nucleotide in this region.
Notable exceptions to this are the species pairs of S. bayanus/S. pastor ianus and S.
cerevisiae IS. paradoxus. In the case of these yeasts, which cannot be reliably distin-
guished apart using conventional physiological testing (20), the V4 region cannot be
used as each pair of species has identical V4 sequences. In fact, sequence analysis of
the entire 18S rDNA molecule has revealed that each pair of species have identical
sequences along the entire length (17).
46 James, Collins, and Roberts
A second rDNA region routinely used for species differentiation is the 5' D2
domain (21) of the 25S rDNA (22,23). In comparison to the V4 region of the 18S
rDNA, the D2 domain appears to display a greater level of interspecies sequence
variation (23), permitting better resolution of closely related species, including
some species that cannot be differentiated based on V4 18S rDNA sequences (e.g.,
S. cerevisiae and S. paradoxus [22,23]). In practice, strains established as being
conspecific (i.e., belonging to the same species) by both physiological testing and
nuclear (n) DNA/nDNA hybridization studies (see ref. [24]) have been found to
exhibit less than 1% sequence variation within this region (23). Whereas strains
belonging to distantly related species have been found to differ by as much as 47%
in this region (e.g., Pichia bimundalis and Schizosaccharomyces japonicus var
versatilis [23]). For a detailed discussion of using this region of rDNA for species
differentiation, we recommend the reader refers to refs. (22,23,25).
To illustrate the value of these two rDNA regions for species differentiation,
Table 3 shows the nucleotide differences observed between the 18S rDNA and
25S rDNA sequences of the recently described species Z. lentus (26), and its
two closest relatives, Z. bailii and Z. bisporus (see Fig. 1). All three species are
commonly associated with food spoilage (20,26), but are frequently difficult to
distinguish from one another using conventional physiological testing [15, 26].
Indeed until recently, strains of Z. lentus were routinely misidentified as
Z. bailii (26). However despite possessing very similar physiological profiles,
as can be seen from Table 3, all three species can be readily differentiated
from one another based on their partial sequences from the V4 region of the
18S rDNA and the D2 domain of the 25S rDNA.
4.2. Use of the Internal Transcribed Spacer (ITS) Region
for Rapid Species Identification
An alternative for species identification to the two rDNA regions discussed in
Subheading 4 is the Internal Transcribed Spacer (ITS) region. In yeast, as with
other eukaryotes, this spacer region separates the 5.8S rDNA from the 18S and 25S
rDNA, with the ITS1 region located between the 18S rDNA and the 5.8S rDNA,
and the ITS2 region between the 5.8S rDNA and the 25S rDNA (see Fig. 2). In a
number of recent studies conducted on a variety of different yeasts, the ITS region
was found to exhibit far greater levels of sequence between species than either the
18S rDNA or the 25S rDNA (18,27,28). Indeed the level of sequence variation is
such that in a study of the genus Williopsis, ITS1 and ITS2 sequences were found
to provide resolution to the subspecies level (differentiating between the five
varieties of W. saturnus), which could not be fully achieved using either 1 8S rDNA
(same study) or 25S rDNA sequences (29).
In contrast to the 18S and 25S rDNA, which in yeast are approx 1800 base
pairs (bp) and 3000 bp, respectively, in size, the entire ITS region (including
Food Spoilage Yeasts
47
Table 3
A Comparison of Nucleotide differences in the V4 region of the 18S
rDNA (upper right) and D2 Domain of the 25S rDNA (lower left) Between
the Food Spoilage Yeasts Z bailii, Z. bisporus, and Z lentus
Strain"
1
l.Z. bailii NCYC 1416*
2. Z. bisporus NCYC 1495 b
3. Z. lentus NCYC D2627 b
18
23
22
3
5
a National Collection of Yeast Cultures, Norwich, UK.
b Type strain.
plTS1
:18SrDNA
25S rDNA
plTS4
500 - 800 bp
Fig. 2. Diagram showing the location of the ITS region. Arrows indicate the
approximate positions of the DNA amplification primers pITSl and pITS4 (8).
the 5.8S rDNA) is far smaller, typically ranging from 500-800 bp. Conse-
quently, this DNA spacer region is easy to both PCR amplify, using the primer
combination pITSl:pITS4 (8) and the protocols as detailed in Subheadings
3.2. and 3.3. and double-strand sequence (using the primers listed in Table 2).
Hence, as with the 18S and 25S rDNA, ITS sequences (ITS1 and/or ITS2)
represent a valuable means both for rapid species identification, and for
possible differentiation at the subspecies level (18,26,27).
Due to the high levels of sequence variation observed between ITS sequences of
closely related species (26-28), not only can species identification be achieved by
direct sequence analysis of this region, but specific PCR primers can also be
designed for rapidly screening for yeast species of particular interest (e.g., those
most commonly associated with food spoilage). Such an approach was developed
48 James, Collins, and Roberts
Fig. 3. Agarose gel showing the results of a PCR-based method for the rapid
identification of Z. lentus. The species specific primers (pLENTl and pLENT2) were
designed from the ITS1 and ITS2 sequences of Z. lentus.
Lane order of gel: lane 1 DNA size marker; lanes 2 and 3, Z. lentus NCYC D2627 T ,
primers pITSl/pITS4 and pLENTl/pLENT2; lanes 4 and 5, Z. lentus NCYC 2406,
primers pITSl/pITS4 and pLENTl/pLENT2; lanes 6 and 7, Z. bailii NCYC 1416 T ,
primers pITSl/pITS4 and pLENTl/pLENT2; lanes 8 and 9, Z. bisporus NCYC 1495 T ,
primers pITSl/pITS4 and pLENTl/pLENT2; lane 10, DNA size marker. N.B. All four
strains shown generate a PCR fragment with the conserved primers pITSl/pITS4 (8).
to identify the food spoilage yeast Z. lentus, with species-specific primers designed
from its ITS1 and ITS2 sequences. As Fig. 3 shows, these primers were used in
conjunction with the PCR, and Z. lentus was readily distinguished from its close
relatives Z. bailii and Z. bisporus, with only Z. lentus generating a PCR fragment
with the Z. /<?/zto-specific primers (all three species generated PCR fragments as
expected with the pITSl:pITS4 primer combination). This test has important
commercial implications as Z. lentus has exceptional preservative resistance and a
slow rate of growth that can hinder its early detection using conventional methods.
Although direct sequence analysis of 18S rDNA, 25S rDNA, or the ITS
region can take 2-3 d on average to identify a yeast isolate (compared to 3-4
wk using conventional physiological testing), PCR methods using ITS-derived
primers offer the possibility of identifying specific yeast species of interest
(e.g., potent food spoilage yeasts) within a single working day.
Food Spoilage Yeasts 49
Appendix
Authenticated yeast strains can be obtained from the following culture
collections:
1. National Collection of Yeast Cultures (NCYC), Dept. of Food Safety Science
Genetics & Microbiology, Institute of Food Research, Norwich Research Park,
Colney, Norwich NR4 7UA, UK. Tel: (0)1603-255274. Fax: (0)1603-458414.
E-mail: NCYC@bbsrc.ac.uk. Web site: http://www.ifrn.bbsrc.ac.uk/ncyc/
2. Centraalbureau voor Schimmelcultures (CBS), Yeast Division, Julianalaan 67,
2628 BC Delft, The Netherlands. Tel: (0)15-2783214. Fax: (0)15-2782355.
E-mail: SALES@cbs.knaw.nl. Web site: http://www.cbs.knaw.nl
3. American Type Culture Collection (ATCC), 10801 University Boulevard,
Manassas, VA 20110-2209, USA. Tel: 703-365-2700. Fax: 703-365-2701. Web
site: http://www.atcc.org/
References
1. Woese, C. R. (1987) Bacterial evolution. Microbiol. Rev. 51, 221-271.
2. James, S. A., Collins, M. D. and Roberts, I. N. (1996) Use of an rRNA internal tran-
scribed spacer region to distinguish phylogenetically closely related species of the
genera Zygosaccharoniyces and Torulaspora. Int. J. Syst. Bacteriol. 46, 189-194.
3. Control of Substances Hazardous to Health Regulations (1988) Approved code of
practice, Her Majesty's Stationery Office, London.
4. Feng, D. F. and Doolittle, R. F. (1987) Progressive sequence alignment as a pre-
requisite to correct phylogenetic trees. /. Mol. Evol. 35, 351-360.
5. Genetics Computer Group (1991) Program manual for the GCG package, version
7. Genetics Computer Group, Madison, WI.
6. Felsenstein, J. (1993) PHYLIP: Phylogenetic Inference Package, version 3.5.
University of Washington, Seattle.
7. Saiki, R. K., Gelfand, D. H., Stoffel, S., et al. (1988) Primer-directed enzymatic
amplification of DNA with a thermostable DNA polymerase. Science 239, 487^-91.
8. White, T. J., Bruns, T. D., Lee, S., and Taylor, J. W. (1990) Amplification and
direct sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR
Protocols (Innis, M., Gelfand, D. H., Sninsky, J. J., and White, T. J., eds.),
Academic Press, San Diego, CA, pp. 315-322.
9. Pearson, W. R. and Lipman, D. J. (1988) Improved tools for biological sequence
comparison. Proc. Natl. Acad. Sci. USA 85, 2444-2448.
10. Saitou, N. and Nei, M. (1987) The neighbor-joining method: a new method for
reconstructing phylogenetic trees. Mol. Biol. Evol. 4, 406-425.
11. Murray, R. G. E., Brenner, D. J., Colwell, R. R., et al. (1990) Report of the ad hoc
committee on approaches to taxonomy within the Proteobacteria. Int. J. Syst.
Bacteriol. 40, 213-215.
12. Felsenstein, J. (1985) Confidence limits on phylogenies: an approach using the
bootstrap. Evolution 39, 783-791.
50 James, Collins, and Roberts
13. Swofford, D. L., Olsen, G. J., Waddell, P. J. and Hillis, D. M. (1996) Phylogenetic
inference, in Molecular Systematics, 2nd ed. (Hillis, D. M., Moritz, C, and Mable,
B. K., eds.), Sinauer Associates Inc., Sunderland, MA, pp. 407-514.
14. De Rijk, P., Neefs, J-M., Van de Peer, Y. and De Wachter, R. (1992) Compilation
of small ribosomal subunit RNA sequences. Nucleic Acid Res. 20, 2075-2089.
15. James, S. A., Collins, M. D., and Roberts, I. N. (1994) Genetic interrelationship
among species of the genus Zygosaccharomyces as revealed by small-subunit
rRNA gene sequences. Yeast 10, 871-881.
16. Mankin, A. S., Skryabin, K. G., and Rubstov, P. M. (1986) Identification often addi-
tional nucleotides in the primary structure of yeast 18S rRNA. Gene 44, 143-145.
17. James, S. A., Cai, J., Roberts, I. N., and Collins, M. D. (1997) A phylogenetic
analysis of the genus Saccharomyces based on 18S rRNA gene sequences:
description of Saccharomyces kunashirensis sp. no v. and Saccharomyces
martiniae sp. nov. Int. J. Syst. Bacteriol. 47, 453-460.
18. James, S. A., Roberts, I. N., and Collins, M. D. (1998) Phylogenetic heterogeneity
of the genus Williopsis as revealed by 18S rRNA gene sequences. Int. J. Syst.
Bacteriol .48, 591-596.
19. Cai, J., Roberts, I. N., and Collins, M. D. (1996) Phylogenetic relationships among
members of the ascomycetous yeast genera Brettanomyces, Debaryomyces,
Dekkera, and Kluyveromyces deduced by small-subunit rRNA gene sequences.
Int. J. Syst. Bacteriol. 46, 542-549.
20. Barnett, J. A., Payne, R. W., and Yarrow, D. (1990) Yeasts: Characteristics and
Identification, 2nd ed., Cambridge University Press, UK.
21. Guadet, J., Julien, J., Lafey, J. F., and Brygoo, Y. (1989) Phylogeny of some
Fusarium species, as determined by large subunit rRNA sequence comparison.
Mol. Biol. Evol. 6, 227-242.
22. Kurtzman, C. P. and Robnett, C. J. (1991) Phylogenetic relationships among species
of Saccharomyces, Schizosaccharomyces, Debaryomyces and Schwanniomyces
determined from partial ribosomal RNA sequences. Yeast 7, 61-72.
23. Peterson, S. W. and Kurtzman, C. P. (1991) Ribosomal RNA sequence diver-
gence among sibling species of yeasts. Syst. Appl. Microbiol. 14, 124-129.
24. Kurtzman, C. P. and Phaff, H. J. (1987) Molecular taxonomy, in The Yeasts, 2nd
ed. (Rose, A. H. and Harrison, J. S., eds.), Academic Press, London, pp. 63-94.
25. Kurtzman, C. P. and Blanz, P. A. (1998) Ribosomal RNA/DNA sequence
comparisons for assessing phylogenetic relationships, in The Yeasts: a taxonomic
study, 4th ed. (Kurtzman, C. P. and Fell, J. W., eds.), Elsevier Science B.V.,
Amsterdam, pp. 69-74.
26. Steels, H., Bond, C. J., Collins, M. D., Roberts, I. N., Stratford, M., and James, S.
A. (1999) Zygosaccharomyces lentus sp. nov., a new member of the yeast genus
Zygosaccharomyces Barker. Int. J. Syst. Bacteriol. 49, 319-327.
27. James, S. A., Collins, M. D., and Roberts, I. N. (1996) Use of an rRNA Internal
Transcribed Spacer region to distinguish closely related species of the genera
Zygosaccharomyces and Torulaspora. Int. J. Syst. Bacteriol. 46, 189-194.
Food Spoilage Yeasts 51
28. Lott, T. J., Kuykendall, R. J., and Reiss, E. (1993) Nucleotide sequence analysis
of the 5.8S rDNA and adjacent ITS 2 region of Candida albicans and related
species. Yeast % 1199-1206.
29. Liu, Z. and Kurtzman, C. P. (1991) Phylogenetic relationships among species of
Williopsis and Saturnus gen. nov. as determined from partial rRNA sequences.
Antonie Leeuwenhoek 60, 21-30.
II
Pathogens
7
Conductimetric Method for Evaluating Inhibition
of Listeria monocytogenes
Graciela Font de Valdez, Graciela Lorca, and Maria Pia Taranto
1. Introduction
One of the major problems in the food industry, particulary in dairy
products, is the occasional presence of the pathogen Listeria monocytogenes,
which has been associated with food-borne disease outbreaks (1). The
association of listeriosis with the consumption of processed foods has
prompted a number of studies to determine the impact of food processing
and preservation procedures on the survival of L. monocytogenes. The
preservation methods include the addition of antimicrobial products (weak
acids [2], bacteriocin, etc.), the decrease in water activity, or high-temperature
short time pateurization (73.9°C for 16.4 s) (3).
The microbial growth can be determined by traditional methods (optical
density, end-product formation, pH) or by conductimetric methods, which
measure changes in the electrochemical characteristics of the culture medium
(see Note 1).
The conductance of growth media depends on the number and nature of
charge carriers and is changed by microbial metabolism, which converts poorly
charged carriers such as carbohydrates, proteins, and lipids into more effective
charged carriers, such as ionized acids and amines.
Automatic monitoring changes in the metabolic activity of microorganisms may
be a useful method for quality control of dairy products, cosmetics, meat, poultry,
frozen foods, pharmaceutical products, fermentation, and growth inhibitors.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
55
56 Font de Valdez, Lorca, and Taranto
2. Materials
2. 1. Growth Media
Brain-heart infusion (BHI) broth (4): This medium is used extensively for
maintaining and culture of Listeria, and it is commercially available from
different manufacturers (e.g., Difco, Oxoid). It contains infusion from calf
brains (200 g/L), infusion from beef heart (250 g/L), proteose peptone
(10 g/L), dextrose (2 g/L), sodium chloride (5 g/L), and disodium phos-
phate (2.5 g/L). Final pH is 7.4-0.2. Sterilize at 121 °C for 15 min.
2.2. Media for Determining the Effect of Antimicrobial Compounds
Different chemical or biological compounds may be used. As example we
have considered the antimicrobial effect of bile acids.
BHIB broth (see Note 4): BHI broth supplemented with the sodium salts of the
conjugated bile acids, taurocholic (TCA), glycocholic (GCA), tauro-
deoxycholic (TDCA), glycodeoxycholic (GDCA), taurochenodeoxycholic
(TCDCA), glycochenocodeoxycholic (GCDCA), and the unconjugated bile
acids, cholic (CA), deoxycholic (DCA), and chenodeoxycholic (CDCA)
(Sigma, St. Louis, MO). Add bile acids to a final concentration of 1 , 2, 4, and 6
milf. Sterilize at 121°C for 20 min.
2.3. Materials for Determination the Effect of Bile Acids
1. An active culture grown in BHI broth for about 16 h at 37°C (overnight culture).
2. Phosphate buffer: Solution A (NaH 2 PO 4 0.2 M): Weigh 27.6 g NaH 2 P0 4 -H 2
and make up to 100 mL with distilled water (dH 2 0). Solution B (Na 2 HP0 4 , 0.2 M):
weigh 53.05 g Na 2 HP0 4 -7 H 2 and make to 100 mL with dH 2 0. To prepare
1 L of sodium phosphate buffer 0.1 M pH 7.0, mixture 195 mL of solution A
and 305 mL of solution B, and bring to 1000 mL with dH 2 0. Sterilize at 121°C
for 20 min.
3. BHI broth: used as control.
4. BHIB broth: BHI broth supplemented with different concentrations of bile acids,
as mentionated in Subheading 2.2.
2.4. Materials for the Conductimetric Method
1. Items 1-3 and 4 from Subheading 2.3.
2. Bactometer™ Microbial Monitoring System (BioMerieux) with BPS R03-1
software, or similar.
3. 2 mL-Capacity sterile conductance cells.
Cytoductimetric Evaluation of L monocytogenes 57
3. Methods
3. 7. Optical Density Measurement
1. Grow the strain of Listeria under study in BHI broth at 37 °C for 16 h.
2. Harvest the cells by centrifugation at 5000g for 10 min.
3. Wash twice the pellet obtained with 0.1 M phosphate buffer, pH 7.0.
4. Resuspend the cells to the original volume with the buffer by vortexing.
5. Inoculate (0.5%) (see Note 3) BHI and BHIB broth with the bacterial suspension.
6. Incubate at 37°C in a water bath.
7. Read the optical density at 560 nm (OD 560 ) against blank of medium (uninoc-
ulated broth) every hour for the first 8 h and after 24 h of incubation.
8. Plot OD values against incubation time.
3.2. Conductimetric Method
1. Prepare the culture inoculum as described in Subheading 2.3. (see Note 2).
2. Dispense the culture medium into the conductance cells.
3. Insert the module into the incubator. The modules can be inserted at any moment
one by one or in runs, without interfering with the ongoing analyses.
4. Identify the modules (e.g., test type, product, sample number).
5. Detection times appear automatically on the computer screen. Every well in each
of the module placed in the incubator is electrically measured every 6 min,
enabling a growth curve to be established according to the time and percentage of
electrical variation.
6. Results can be edited in report form illustrated with growth curves.
4. Notes
1. Changes in the electrical properties of culture media are related to the number of
microrganisms in a sample and to the metabolic activity of those microorganisms
(4). These changes induce at a given moment a significant variation leading to a
sudden inflection in the curve. This inflection point is known as the detection
time (see Fig. 1).
2. Make 1/10 and 1/100 dilutions in the detection medium before placing the
samples into the equipment for reading conductance. As the Bactometer produces
detection times that are comparable to plate counts, it is possible to perform
calibration curves that relate the detection time to colony-forming units. Data
points must be evenly distributed over a 4-5 log range (see Fig. 2).
3. For determining the effect of bile acids (or other antimicrobial compound) on the
cells, it is important to use a low inoculum (0.5%, v/v) in order to have a low initial
OD 560 value and to ensure that the culture is at an early exponential phase of growth.
58
Font de Valdez, Lorca, and Taranto
5/1
00
-5
<L>
Q
!
10
Time (h)
15
20
Fig. 1. Changes in the conductance of L. monocytogenes at 37°C in BHIB broth at
different concentrations of bile acids. (•) control, (■) 1 mM, (A) 2mM, (▼) 4 mM.
4. The chemical composition of the culture medium should be perfectly adapted to the
conductimetric method. This fact enables the global detection of microorganisms in
a product or a particular microbiota (e.g., coliforms, lactic acid bacteria, listeria).
Detection media (g/L):
LM broth: This medium is used for detection and enumeration of lactic
acid bacteria in fruit juice, dairy products, and foods. It contains Bacto
peptone (10 g/L), tryptone (5 g/L), peptonized milk (10 g/L), dextrose
(4 g/L), and yeast extract (7.5 g/L) at a final pH of 6.5. Sterilize at 121°C
for 15 min.
MPCA broth: This medium is used for detection and enumeration of total
aerobic flora in milk and foods. It contains yeast extract (20 g/L), dex-
trose (4 g/L ), and tryptone (20 g/L) at a final pH 6.5-0.1. Sterilize at
121°C for 15 min.
CM broth: This medium is used for detection of coliforms in food. It contains
proteose peptone (10 g/L), yeast extract (6 g/L), lactose (20 g/L), sodium lau-
ryl sulphate (1 g/L), sodium deoxycholate (0.1 g/L), bile salts (Oxgall,
Difco) (1 g/L), and bromcresol purple solution (10 ml/L). To prepare the
bromcresol purple, add 0.35 g of bromcresol purple to 2 mL of 0.1 N
NaOH. Bring to a final volume of 100 mL, mix, and sterilize by filtra-
tion. For enterobacteria add dextrose (20 g/L) for a final pH 6.8-0.1.
Sterilize at 121°C for 15 min.
Cytoductimetric Evaluation of L. monocytogenes
59
3
o
o
§>
H-3
Time (h)
Fig. 2. Coliform calibration curve in yogurt.
The conductimetric method may also be used for monitoring changes in
activity of cheese starter cultures stored at refrigeration temperature (5) as well
as the activity of those frozen or freeze-dried (6) cultures in milk fermentation.
References
1. Farber, J. M. and Peternkin, P. I. (1991) Listeria monocytogenes, a foodborne
pathogen. Microbiol. Rev. 55, 476-5 11.
2. Eklund, T. (1983) The antimicrobial effect of dissociated and undissociated sorbic
acid at different pH levels. /. Appl. Bacteriol. 54, 383-389.
3. Lin, J., Smith, M. P., Chapin, K. C, et al. (1996) Mechanism of acid resistance in
enterohemorragic Escherichia coli. Appl. Environ. Microbiol. 62, 3094-3100.
4. Neviani, E., Muchetti, G., and Lanzanova, M. (1993) Analysis of conductance changes
as the growth index of lactic acid bacteria in Milk. /. Dairy Sci. 76, 2543-2548.
5. Tsai, K. and Luedecke, L. O. (1989) Impedance measurement of changes in activity
of lactic cheese starter culture after storage at 4°C. /. Dairy Sci. 72, 2239-2241.
6. Martos, G., Pesce de Ruiz Holgado, A., Oliver, G., and Font de Valdez, G. (1999)
Use of conductimetri to evaluate Lactobacillus delbruekii ssp. bulgaricus sub-
jected to freeze-drying. Milchwissenschaft 54(3), 128-130.
8
Molecular Detection of Enterohemorrhagic
Escherichia coli 01 57:H7 and Its Toxins in Beef
Kasthuri J. Venkateswaran
1. Introduction
Most Escherichia coli strains are harmless commensals in the human gut, but
some strains are known to cause disease. The enterohemorrhagic E. coli (EHEC)
strains of serotype 0157:H7 causes hemorrhagic colitis, which may develop into
life-threatening hemolytic uremic syndrome. Polymerase chain reaction (PCR)
is a powerful tool to multiply a target molecule to detectable quantities. In the
multiplex PCR method, two or more primer sets are used to simultaneously
amplify multiple target sequences. Many researchers developed multiplex PCR
for the detection of the LT (heat-labile toxin), SLT-I (Shiga-like toxin) and SLT-II
producing E. coli. Antibody- or DNA-based assays for identifying SLTs or bac-
teria-carrying SLT genes will not discriminate 0157:H7 isolates from the
numerous other serotypes that also produce SLTs entero toxins.
Bioassays and conventional methods are used to differentiate toxigenic
E. coli from nontoxic strains (see Notes 1-3). In order to overcome the limita-
tions of these existing methods, a multiplex PCR assay would be useful that
simultaneously identifies isolates of 0157:H7 and the types of SLT it encodes
(see Notes 4-7). The first set of primers is directed to the uid A gene, which
encodes for ^-glucuronidase in E. coli. Although 0157:H7 isolates do not
exhibit ^-glucuronidase activity, they carry the uid A gene. Exploiting the
uniqueness of a 92 base change in uid A gene, a second set of primers is designed
in a mismatch amplification mutation assay format to preferentially amplify
the uidA allele in 0157:H7 strains. The third and fourth sets of primers are
directed to the conserved regions within the genes encoding for SLT-I and
SLT-II genes, respectively.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
61
62 Venkateswaran
The development of molecular methodologies to detect pathogenic
microorganisms in food and clinical and environmental samples has led to
improved patient diagnosis and more precise determination of the public health
risk associated with food consumption and environmental exposures. Studies
with the PCR have largely concentrated on the identification of bacterial strains
or toxin genes with DNA extracted from pure cultures, but PCR methods for
detection of bacteria in food samples have not been adequately explored. The food
particles pose a major problem in the amplification of desired PCR amplicons.
Here, we have overcome with a protocol that would eliminate PCR inhibitory
substances originated from food.
The multiplex PCR method described here is a highly effective means for
specifically detecting and characterizing EHEC organisms directly from food. The
major advantage of this protocol over existing assays is that it can identify the types
of SLT encoded by the strain and simultaneously discriminate other SLT -produc-
ing E. coli strains from 0157:H7, the predominant serotype implicated in disease.
2. Materials
1 . Phosphate buffered-saline (PBS) : 0.2 M NaH 2 P0 4 , 0.2 M Na 2 HP0 4 , 0.9 % NaCl; pH 7.0.
2. Microbiological media: trypticase soy broth (TSB), Trypticase soy agar, eosin
methylene blue (EMB) agar, brilliant green lactose bile (BGLB) broth and£. coli
(EC) broth are commercially available. We purchased from Nissui Pharmaceuti-
cals, Tokyo, Japan.
3. Suitable oligonucleotide synthesizer should be used to synthesize primers. We
used a Beckman oligonucleotide synthesizer (Fullerton, CA).
4. Any available DNA thermal cycler will be used for PCR amplification. We
used the Perkin-Elmer system (Foster City, CA).
3. Methods
3. 7. Food Homogenization
1. Weigh 25 g of beef aseptically into a sterile stomacher bag that contain 100-mm
filters (Gunze, Tokyo, Japan) and add 225 mL of TSB.
2. Using a sterile food homogenizer (SH-001, Elmex, Tokyo, Japan), blend the
sample for about 1-2 min. Care should be taken to avoid generation of heat in the
process.
3. Aseptically siphon a out 100-fim filtered homogenized food sample and use
as the inoculum.
3.2. Conventional Identification of E. coli
1. Grow the test organism in trypticase soy agar at 37°C for 18-24 h.
2. Pick a well-isolated colony and inoculate into BGLB broth and incubate at 37°C
for 48 h. A gas-positive tube is considered for total coliforms.
Enterohemorrhagic E. coli 63
3. Transfer a portion of BGLB-gas-positive tube into EC broth and incubate at 44.5 °C
for 48 h. A gas-positive EC broth tube is considered positive for fecal coliforms.
4. The gas-positive EC tube is then streaked onto EMB agar. Metallic sheen colonies
on EMB agar plates are presumptively identified as E. coli.
3.3. Molecular Identification ofE. coli
3.3.1. Bacteria and Food Sample Preparation for PCR
1. Grow the bacterial strain in trypticase soy agar plates for 18 h at 37°C.
2. Pick a well-isolated colony and resuspend the bacterial cells in sterile PBS to a
concentration of 10 5 colony-forming units (CFU)/ml and use as a DNA template
for PCR.
3. To identify E. coli from food samples, inoculate the homogenized food samples
as detailed in Subheading 3.1. in TSB and incubate at 37°C for 6 h (see
Notes 8-10).
4. Remove 1 mL/of the enriched food homogenate and wash once with sterile PBS
and resuspend in 1 mL/of PBS.
5. Filter 400 fiL of the PBS -washed sample through 5-fim ultrafree tubes (cat. no.
UFC3 OGV; Millipore, Bedford, Mass.) and centrifuge. This step will eliminate
any particulate matter that might inhibit PCR reaction (see Notes 11 and 12).
6. The 5-jam filtrate should then pass through 0.2 jam ultrafree tubes (cat. no.
SE3P009E4; Millipore) and centrifuge to remove bacteria only. This step will
eliminate any dissolved matter that might inhibit PCR reaction.
7. Resuspend the 0.2-fim trapped materials in 400 ^JL of sterile PBS. Use 10-}iL
volumes of samples as the template for a PCR assay without extracting DNA.
8. All centifugation conditions are: 10,000g, 4°C, for 10 min.
3.3.2. Multiplex PCR
1. Prepare DNA template as described in Subheading 3.3.1. and use 10-mL as the
template.
2. Add 1-mL (final concentration, 1 mM) of various synthesized oligonucleotide
primers specific for uidA (UAL-754 and UAR-900), 0157:H7-specific uidA
(PT-2 and PT-3), SLT-I (LP-30 and LP-31) and II (LP -43 and LP-44) genes into
the PCR reaction mixture.
3. 10X PCR buffer: Chemicals (Tris-HCl, 100 mM; MgCl 2 , 15 mM; KC1, 500 mM;
pH 8.3) dissolved in appropriate solution provided by the manufacturer will be used.
4. Deoxynucleotide triphosphates (dNTP): Make up a single solution containing
0.2 mM of dATP, dGTP, dCTP, and dTTP and use appropriate concentration as
described in Subheading 3.3.2., item 7.
5. Primer sets that are used to amplify uidA (UAL-754 and UAR-900), 0157:H7-
specific (PT-2 and PT-3), SLT-I (LP-30 and LP-31), and SLT-II (LP-43 and
LP-44) gene-specific fragments are as follows:
64 Venkateswaran
UAL-754 5' AAA ACG GCA AGA AAA AGC AG 3'
UAR-900 5' ACG CGT GGT TAC AGT CTT GCC 3'
PT-2 5' GCG AAA ACT GTG GAA TTG GG 3'
PT-3 5' TGA TGC TCC ATC ACT TCC TG 3'
LP-30 5' CAG TTA ATG TGG TGG CGA AGG 3'
LP-31 5' CAC CAG ACA ATG TAA CCG CTC 3'
LP-43 5' ATC CTA TTC CCG GGA GTT TAC G 3'
LP-44 5' GCG TCA TCG TAT ACA CAG GAG C 3'
6. Taq DNA polymerase: Supplied by the manufacturer at a concentration of 5 U/f^L
is used.
7. IX Reaction mix: Forty-nine microliters of the reaction mix is required for each
sample. To make 49 f^L of this mix, combine 5.0 \xL of 10X PCR buffer, 4.0 f^L of
0.2 mM dNTP, 1 j^L each of various primers (1.0 \xM), 0.125 f^L of Taq DNA
polymerase (5 U/f^L) with 38.875 mL of DNAse- and RNAse-free distilled water.
8. Mineral oil: Molecular biology grade mineral oil purchased from any manufac-
turer can be used. Recent advancements are made in various thermal cyclers
where mineral oil is not necessary.
3.3.3. PCR and Electrophoresis Conditions
1. Amplification: Using a DNA thermal cycler, program for 30 cycles consisting of
30 s at 94°C, 1.5 min at 58°C, and 2.5 min at 72°C, with a final extension step at
72°C for 7 min.
2. Electrophoresis: Remove 15-fiL aliquots of each PCR mix and analyze for various
amplification products by submarine gel electrophoresis on 2% agarose gels.
3. Run the electrophoresis for 50 min at 100 V.
4. Stain the gel with ethidium bromide for 15 min.
5. Visualize the stained bands by UV transillumination and photograph.
6. Include a suitable molecular size marker (100 bp ladder; Gibco-BRL) in each gel.
4. Notes
1. The majority of E. coli isolates shows typical metallic sheen colonies on EMB
agar plates. However, S. dysenteriae mimics E. coli on EMB agar plates.
Similarly, gas may be produced from lactose at 44.5°C by E. coli 0157:H7.
E. coli 0157:H7 did not exhibit ^-glucuronidase activity. However, some heat
labile-toxin producing E. coli (ATCC 43886) strains may not produce fluores-
cence on 4-methylumbelliferyl-(3-D-glucuronide-supplemented commercial agar
that contains lactose. The absence of sorbitol fermentation by 0157:H7 is a
characteristic phenotype used to isolate E. coli 0157:H7 from clinical and food
specimens. Although useful, confirmation with 0157 and H7 antisera is required,
as since other bacteria share this serotype and because there are strains of
0157:H7 that can ferment sorbitol. As both S. dysenteriae and S. sonneii do not
utilize sorbitol, they show green coloration and mimic E. coli 0157:H7 in these
agars. Therefore, biochemical characteristics alone will not differentiate E. coli
0157:H7 from other toxigenic and nontoxigenic strains.
Enterohemorrhagic E. coli 65
2. Antibodies to the 0157 antigen are used in many assays to detect 0157:H7 in
clinical and food samples. Cross-reaction of somatic antigen 0157 and flagellar
antigen H7 between 0157 and 025, 026, 078, 01 1 1 as well as between H7 and
HI 1, H~is established. These tests, however, provide no information on the toxin
types produced by the isolates and are not specific, as the 0157 antigen is present
in other E. coli species. Also, anti-0157 sera often cross-reacts with Citrobacter
freundii, E. hermanii and other bacteria. Analyses of food products with anti-0157
serum have recognized 1 57 isolates that neither produced SLT nor were of the H7
serotype. Furthermore, production of SLT toxins is not confined to E. coliO\51:Hl
strains and these toxins are produced in other serogroups of E. coli.
3. The standard bioassays used for identification of pathogenic E. coli, such as
cytopathic effects on Y-l adrenal cells and rabbit ileal loop, are not readily adapt-
able for screening large numbers of E. coli isolates.
4. The uidA gene that is responsible for [3-glucuronidase activity is a good marker
for the differentiation of all types of E. coli strains from other group of coliforms,
but species of the genus Shigella also possesses this gene.
5. Analysis of amplification products showed that all reference strains of
0157:H7 serotype were correctly identified simultaneously with the SLT type
known to be produced by these strains {see Fig. 1, lanes 2-5). As anticipated,
no products were amplified from wild-type E. coli {see Fig. 1, lane 1),
whereas the expected toxin gene-specific products, but not 0157:H7-specific
products, were amplified from the SLT-producing non-0157: H7 serotypes
examined {see Fig. 1, lanes 6-14).
6. The type of SLT identified by the multiplex PCR assay correlated well with
the Vero cell toxicity data. Among non-£. coli strain, only S. dysenteriae
exhibits an SLT I amplicon. The Shiga toxin of S. dysenteriae type 1 is
almost identical to the SLT I of 0157:H7; therefore, this is not unexpected.
Although the multiplex PCR assay will not discriminate between
S. dysenteriae type 1 and non-0 157:H7 EHEC serotypes that produce only
SLT I, the 0157:H7-specific primers readily distinguish S. dysenteriae type
1 species from 0157: H7 isolates.
7. The major advantage of this method over existing assays is that it can identify the
types of SLT encoded by the strain and at the same time discriminate other SLT-
producing E. coli from 0157:H7, predominant serotype implicated in disease.
8. When whole bacterial cells are used, 10 2 CFU E. coli in 10-jaL PCR mixture is
necessary to amplify the PCR bands. However, a minimum of 10 6 CFU/g is needed
to amplify specific PCR products from food.
9. A 6-h incubation of contaminated food in a normal bacteriological medium would
allow proliferation of 10 2 CFU E. coli/g initial inoculum to a detectable level.
Similarly, if the food homogenate is incubated overnight (16 h) at 37°C in shaking
condition, a initial inoculum of 1 CFU E. coli/g slurry would attain a requisite
density (>10 9 CFU/g), thus producing all PCR amplicons.
10. PCR amplification is possible, even when E. coli and other coliforms are in a
ratio of 10 9 :1.
66
Venkateswaran
12 3 456 789 1011121314
584
348
252
147
I
•
1
-
Fig. 1. Agarose gel electrophoresis of amplicons generated by multiplex PCR from
E. coli strains isolated from various outbreaks. Lane 1, typical E. coli ATCC 25922;
lane 2, 0157:H7 strain producing SLT-I, lane 3, 0157:H7 strain producing SLT-I and
SLT-II; lane 4 and 5, 0157:H7 strains producing SLT-II; lane 6, virulent strain not
producing SLT-I or SLT-II; lanes 7-9, strains other than 0157 serovar producing
SLT-I; lanes 10-14, strains isolated from urinary tract and veterinary infections;
lane M, 100-bp marker. Number to the left of the gel are molecular sizes (base pairs).
11. Food particles and other unknown metabolic by-products may be inhibitory for
PCR reaction. Hence, a two-step filtration procedure is necessary to remove any
PCR inhibitory substances (see Subheading 3.3.1., steps 5-7).
12. The two-step filtration procedure is successful for identifying appropriate PCR
amplification products in various other food-borne pathogens directly from food
enrichment culture without extracting DNA. Some examples are Salmonella, Vibrio
cholerae, V . parahaemolyticus , Bacillus cereus groups, C amply obacter spp. etc.
9
Detection of Listeria monocytogenes by the Nucleic
Acid Sequence-Based Amplification Technique
Burton W. Blais and Geoff Turner
1. Introduction
The rapid detection of foodborne pathogens such as Listeria monocytogenes
requires ultrasensitive techniques that give measurable responses with low
numbers of the target bacteria in food samples or enrichment cultures. Although
a number of approaches are possible for detection of low levels of target
bacteria, including enzyme immunoassay (EIA) and nucleic acid probe hybrid-
ization, perhaps the most efficient approach from the viewpoint of detectability
and specificity are the nucleic acid amplification techniques. Nucleic acid amplifi-
cation targets specific nucleotide sequences within the bacterial genome and raises
the number of copies of the region of interest to levels that are detectable by
conventional means (e.g., agarose gel electrophoresis, DNA probes). A well-known
example is the polymerase chain reaction (PCR) technique, which amplifies target
DNA sequences by a mechanism involving hybridization of two oligonucleotide
primers to opposite strands flanking the target region, followed by a repetitive
series of cycles involving template denaturation, primer annealing, and the
extension of primers by a DNA polymerase, typically the thermostable Taq
polymerase, which enables the use of an automated thermal cycling device in this
process. The amplification in a typical PCR process can result in a million-fold
increase in the number of target sequence copies after 20 cycles (1).
As an alternative to the PCR technique, Nucleic Acid Sequence-Based
Amplification (NASBA™) was developed for the ultrasensitive detection of
specific nucleotide sequences, such as viruses and pathogenic foodborne
bacteria (2,3). NASBA is a homogeneous, isothermal, in vitro amplification
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
67
68 Blais and Turner
process involving the actions of three enzymes, reverse transcriptase (RT),
ribonuclease H (RNase H), and bacteriophage T7 RNA polymerase (T7 RNA
pol), as well as two target sequence-specific oligonucleotide primers (one of
which bears a bacteriophage T7 RNA pol binding and preferred transcriptonal
initiation sequence at its 5' end), acting in concert to amplify target sequences
more than 10 8 -fold within 90 min.
The scheme for the NASBA reaction is illustrated in Fig. 1. A NASBA
reaction system can be designed to target either RNA or DNA in a sample. For
amplification of RNA targets, the process begins when one primer (PI),
containing a 3' terminal sequence complementary to the target nucleic acid,
and a 5' terminal sequence corresponding to the T7 RNA polymerase promoter,
anneals with the target RNA [RNA(+)], followed by extension of the annealed
primer with RT. The RNA strand of the resulting RNA:DNA hybrid is then
digested by RNase H, and the second primer (P2), which is complementary to
the remaining DNA strand [DNA(-)], then anneals to the latter and is extended
by RT to form a double-stranded DNA template with a transcriptionally active
T7 promoter. This template is acted on by T7 RNA pol, which generates
multiple transcripts [RNA(-)]. P2 then anneals to each transcript and is
extended by RT, followed by digestion of the RNA strand by Rnase H to yield
a single-stranded DNA intermediate [DNA(+)]. After annealing of PI to this
strand and extension by RT, a transcriptionally active double-stranded DNA
template is created that results in the synthesis of yet more transcripts [RNA (-)]
as before. This is the basis for the exponential amplification that is achieved by
the NASBA system. For amplification of a sequence on a double-stranded DNA
target, the process is similar to the foregoing, with the exception that the two
strands must first be separated by heat denaturation in order to allow PI to
anneal to the complementary DNA strand [DNA(+)]. The annealed primer is
then extended by RT, followed by a second round of denaturation, yielding the
single-stranded DNA intermediate [DNA(-)] which anneals with P2 and
continues in the NASBA reaction scheme as described. It should be noted that,
as none of the enzymes used in the NASBA process are thermally stable, the
denaturation and priming of the DNA template are carried out separately from
the rest of the NASBA reaction.
The main advantages of NASBA over other amplification techniques such
as PCR are (1) rapid accumulation of amplicons (predominantly RNA), (2) no
need for specialized equipment (e.g., thermal cycling device), and (3) amplifi-
cation of either RNA or DNA targets depending on experimental design. It will
be evident from the description of the process that NASBA is particularly well
suited for the amplification of RNA targets, such as rRNA and mRNA, and this
is especially advantageous for food safety testing applications, where it is
important to distinguish between viable and nonviable pathogenic bacteria in a
Detecting L monocytogenes with NASBA
69
RNA Target
ss RNA 5' /N/N/S/3*
Primer 1
r/N/S/S/r
RT 5*
5*
3"
/S/S/S/
3"
5'
RNascH
Primer 2
5!,
5* 3*
3'
3'
RT
5'
5'.
3'
T7RNApol
\ 3'
5*
3AAAA/5
3/WVVs'
Primcr2
DNA Target
5'
3*
3'
.. dsDNA
Denature
Primer 1
5'
3'
3*
5'
3'
5'
RT
5'
3'
y
5'
Denature
Primer 2
3*
5"
5» 3"
3*
5'
RT
5'.
3*
3AAAA/5
sAAAA/s
3AAAA/5
3'
5'
T7 RNA pol
T7RNApol
Amplification
5*_ 3'
lAAAA/s
5*.
3'
3'
5'
RT
5'_ 3'
3AAAA/5
RNaseH
5".
3'
Primer 1
5*
RT
3*
3'
5'
Fig. 1. Schene for the NASBA reaction.
food sample. Because RNAs are generally unstable in the environment, only
viable bacterial cells would be expected to contain significant amounts of
70 Blais and Turner
RNA, whether in the form of rRNA or, if gene expression systems are active,
mRNA. The following sections describe two different NASBA systems
developed in our laboratory for the detection of the well-known pathogen
L. monocytogenes in foods (3,4). The basis for the specificity of these sys-
tems is the amplification of hemolysin gene (lily A) sequences unique to
L. monocytogenes. In one approach, we describe a method for amplifying
lily A sequences in the genomic DNA of L. monocytogenes with incorporation
of digoxigenin as a marker, followed by a simple microtiter plate-based
colorimetric assay of the amplicons. The other system, which targets an hlyA
mRNA sequence expressed in live L. monocytogenes cells, uses a simple dot-blot
assay system for the detection of amplicons incorporating biotin as a marker. The
major steps involved in the operation of a NASBA detection system comprise the
following: (1) induction of mRNA synthesis (if detecting RNA targets); (2) extrac-
tion of nucleic acids from the test sample; (3) performance of the NASBA reaction;
and (4) detection of amplicons using a simple colorimetric assay system (microtiter
plate or dot blot format).
2. Materials
2. 1. Bacterial Strains and Media
The L. monocytogenes American Type Culture Collection (ATCC) strain
no. 43256 may be utilized as a positive control for the NASBA experiments.
Alternatively, any other typical L. monocytogenes isolate may serve. Note that
some strains of L. monocytogenes do not express the hlyA gene, and should
therefore not be utilized as positive controls. The bacteria are routinely grown
by inoculation into trypticase soy broth (TSB) (Difco, Detroit, MI) and shak-
ing for 16 h at 30°C.
2.2. Chemicals, Reagents, and Supplies
2.2.1. Chemicals and Biologicals
The following is a list of chemicals and biologicals that will be required during
the course of a NASBA experiment (chemicals can be purchased from any
reputable supplier. However, wherever a specific supplier is indicated, it is highly
recommended that the item be purchased from that source. In any case, it is
advisable to purchase molecular biology grade chemicals wherever possible).
1. Ammonium acetate.
2. Antidigoxigenin antibody-peroxidase conjugate (Boehringer Mannheim, Quebec,
Canada).
3. Avian myeloblastosis virus reverse transcriptase (AMV-RT) (Seikagaku
America, Falmouth, MA).
4. Biotin- 1 1-UTP (Sigma Chemical Co., St. Louis, MO).
Detecting L monocytogenes with NASBA 71
5. Boiled Rnase.
6. Blocking reagent (Boehringer Mannheim).
7. Bovine serum albumin.
8. Chloroform.
9. Deoxyribonucleotide triphosphates: dATP, dGTP, dCTP, and dTTP.
10. Digoxigenin-11-UTP (Boehringer Mannheim).
11. Dimethylsulfoxide.
12. Dithiothreitol.
13. Ethanol.
14. Ethylenediamine tetraacetic acid (EDTA).
15. Formamide.
16. Isoamyl alcohol.
17. N-lauroylsarcosine.
18. Lysozyme.
19. Mineral oil.
20. Nuclease-free, deionized distilled water (e.g., diethyl pyrocarbonate treated).
21. Phenol (Tris saturated).
22. Proteinase K.
23. Ribonucleotide triphosphates: ATP, GTP, CTP, and UTP.
24. RNase H (Pharmacia, Quebec, Canada).
25. RNasin™ (Promega Corp., Madison, WI).
26. RNeasy Total RNA Kit (QIAGEN, Valencia, CA).
27. Sodium chloride.
28. Sodium citrate.
29. Sodium dodecyl sulfate.
30. Sodium phosphate, mono- and dibasic salts.
31. Sodium sarcosinate.
32. Streptavidin-peroxidase conjugate (Sigma).
33. Sucrose.
34. Taq DNA polymerase (Boehringer Mannheim).
35. Tetramethylbenzidine (TMB) membrane peroxidase substrate (Kirkegaard and
Perry Laboratories, Gaithersburg, MD).
36. Tetramethylbenzidine (TMB) micro well peroxidase substrate (Kirkegaard and
Perry Laboratories).
37. Triton X-100.
38. Trizma base (Tris).
39. T7 RNA polymerase (Pharmacia).
40. Tween-20.
2.2.2. Supplies and Equipment
(Care should be taken to ensure that all glassware and disposable plasticware
are DNase- and Rnase-free.)
72 Blais and Turner
1. Hot plate or dry heating block.
2. Incubators.
3. Microcentrifuge.
4. 1.5 mL-capacity microcentrifuge tubes.
5. 0.6 mL-capacity microcentrifuge tubes.
6. Microtiter plates (Immunlon 1, Dynex Technologies, Chantilly, VA).
7. Microtiter plate reader (optional).
8. Nylon membrane (Boehringer Mannheim).
9. Pipetors covering volume range of 0.5-1000 f^L, with appropriate tips.
10. Quartz cuvetes.
11. Spectrophotometer.
12. Thermal cycler.
13. Ultraviolet light source (254 nm).
14. Vortex mixer.
15. Water bath (2).
2.3. Oligonucleotides
All oligonucleotides can be synthesized inexpensively by a contract
laboratory specializing in this field. For best results, it is recommended that
oligonucleotides be purified by gel electrophoresis or high-performance liquid
chromatography, a service that is usually provided at minimal additional cost
by the contract laboratory. See Subheading 4.1. for further notes on the
selection and preparation of oligonucleotides.
2.3. 1. Oligonucleotides for hlyA Genomic DNA Detection
2.3.1 .1 . Primers for Preparation of DNA Capture Probe
A DNA capture probe for detection of NASBA amplicons using a microtiter
plate format can be readily prepared by amplifying L. monocytogenes-specific
hlyA sequences using the PCR technique, as described in Subheading 3.3.1.1.
To amplify a 259-mer DNA capture probe spanning nucleotides 958-1217 of
the published hlyA sequence (5), the primer set 5'-GAGCAGTTGCAAGCG-
3', and 5'-AGGTTGCCGTCGAT-3' will be required.
2.3.1 .2. Primers for NASBA Reaction
The primers for the NASBA reaction are designed to amplify the region
spanning nucleotides 939-1234 of the published hlyA sequence, and consist of
the set PI, 5'- AATTCTAATACGACTCACTATAGGGAG CGGCAAAGC
TGTTAC-3' (the T7 RNA polymerase-binding and preferred transcriptional ini-
tiation sites are indicated by underscoring); and P2, 5'-TATCGCGTA
AGTCTCCG-3'.
Detecting L monocytogenes with NASBA 73
2.3.2. Oligonucleotides for hlyA mRNA Detection
2.3.2.1 . Oligonucleotide Capture Probe
A 56-mer oligonucleotide capture probe for detection of NASBA
amplicons can be prepared based on the hlyA sequence, 5'-CAAGGATTGGA
TTACAATAAAAACAATGTATTAGTATACCACGGAGATGCAGTGAC-3'.
2.3.2.2. Primers for NASBA Reaction
The primers for the NASBA reaction are designed to amplify a 133-mer
region of hlyA mRNA, and consist of the set PI, 5- AATTCTAAT
ACGACTCACTATAGGGAGA TAACCTTTTCTTGGCGGCACA-3' (the T7
RNA polymerase-binding and preferred transcriptional initiation sites are
underscored); and P2, 5'-GTCCTAAGACGCCAATCGAA-3'.
3. Methods
3. 7. Sample Preparation
3.1.1. Purification of Genomic DNA
The following procedure may be used to prepare a stock of purified L. mono-
cytogenes genomic DNA for amplification of DNA target sequences (see also
Subheading 4.2.1.):
1. Inoculate 5 mL of TSB with one loopful of L. monocytogenes, and grow at 30°C
to the midlog phase (approx 10 8 CFU/mL).
2. Transfer2X 1 mL portions of the cells to 1.5 mL-capacity microcentrifuge tubes.
Pellet the cells by centrifugation at 10,000g for 15 min.
3. Resuspend the cell pellets in 100 jliL each of 50 mM Tris HC1 (pH 8.0) containing
25% (w/v) sucrose, and combine into a single tube. Freeze the suspension by
placing in a -20°C freezer for 30 min.
4. Thaw the cell suspension at room temperature, and add 20 fiL of a freshly
prepared lysozyme solution (5 mg/mL in distilled H 2 0). Incubate for 5 min at
room temperature.
5. Add 40 \iL of 0.25 M EDTA (pH 8.0). Incubate for 5 min at room temperature.
6. Add 5 \xL of fresh diethyl pyrocarbonate (DEPC) solution (prepared by combining
6.5 [LiL of DEPC with 125 j^L 95% ethanol). Poke a hole in the lid of the
microcentrifuge tube, and incubate for 15 min in a water bath adjusted to 65°C.
7 . Add 1 f^L of a boiled Rnase solution ( 1 mg/mL in distilled H 2 0) . Incubate for 1 5 min
in a 65 °C water bath. Transfer to a new microcentrifuge tube with an intact lid.
8. Add 40 fiL of a proteinase K solution (2 mg/mL in distilled H 2 0), followed by 80 \xL
of 2% (w/v) Na sarcosinate in distilled H 2 0.
9. Incubate with gentle agitation overnight (approx 16 h) at 37°C.
10. Add 200 ^L of TE buffer (10 mM Tris/1 mM EDTA, pH 8.0).
11. Add 400 \xL chloroformrisoamyl alcohol (24:1). Gently agitate for 10 min at room
temperature.
74 Blais and Turner
12. Centrifuge at 10,000g for 20 min. Using a pipet, remove the aqueous (top)
layer, being careful not to disturb the white interface. Discard the lower layer
and the interface.
13. Add 200 fiL of Tris-saturated phenol and 200 ^iL chloroform:isoamyl alcohol
(24:1) to the aqueous layer. Gently agitate for 10 min at room temperature.
14. Centrifuge at 10,000g for 20 min, and collect the aqueous layer as in step 12.
15 Add 400 jaL of chloroform:isoamyl alcohol (24:1) to the aqueous layer. Gently
agitate for 10 min at room temperature.
16. Centrifuge at 10,000g for 20 min, and collect the aqueous layer as before.
17. Transfer 400 |iL of the aqueous layer to a clean microcentrifuge tube, and add
35 fiL of 3 M ammonium acetate (pH 5.2), followed by 1 mL of 95% ethanol.
Incubate at -20°C for at least 2 h.
18. Centrifuge at 10,000g (4°C) for 30 min. Discard the ethanol phase.
19. Rinse the pellet with ice-cold 70% ethanol, and centrifuge at 10,000g (4°C) for
20 min. Discard the ethanol phase and air dry the DNA pellet.
20. Add 20-100 |iL of TE buffer to resuspend the DNA pellet.
21. Determine DNA concentration by measuring A 260 of solution. Store at -20°C.
3. 1.2. Purification of m FIN A
3.1 .2.1 . Induction of hlyA mRNA Synthesis
For detection of mRNA targets in the NASBA reaction, it will first be
necessary to induce the bacterial cells to express the gene of interest (see
Subheading 4.2.2.). Transcription of the hlyA gene in L. monocytogenes can
generally be induced by exposure of a cell suspension to sodium azide at a
slightly elevated temperature. Mix 1 mL of a cell suspension (e.g., broth
culture) with 10 [iL of 10% (w/v) sodium azide and incubate at 37°C for
30 min. Proceed immediately to the RNA purification step.
3.1 .2.2. Purification of Total Bacterial RNA
In order to recover the induced hlyA mRNA for use in the NASBA reaction,
the total RNA in the cell suspension can be purified rapidly and conveniently
using a commercially available kit, the QIAGEN RNeasy Total RNA Kit. In
this kit, cell suspensions are first lysed and homogenized under conditions that
destroy RNases while maintaining the RNA intact. The sample is then adjusted
with a high-salt buffer to allow binding of the RNA to a silica gel-based
membrane, and, after washing, the bound RNA is eluted from the membrane.
Following the manufacturer's instructions, elute the total RNA from the
membrane with 50 |^L of Rnase-free distilled H 2 0. If not used immediately,
the RNA should be stored at -20°C.
3.2. NASBA Reactions
The following protocols outline the procedures for amplifying either DNA
(e.g., genomic DNA sequence) or RNA (e.g., mRNA) targets. For amplifica-
Detecting L monocytogenes with NASBA 75
tion of DNA targets, each set of reactions should include a positive control
sample in which 50 ng of purified L. monocytogenes genomic DNA is
introduced into the NASBA reaction. For amplification of RNA targets, a
sample prepared from a pure broth culture of L. monocytogenes (approx 10 8 — 10 9
CFU/mL) should be included as a positive control. In the interest of obtaining
reliable amplifications, the specified temperatures should be strictly adhered
to. Refer to Subheading 4.3. for further considerations on the operation of a
NASBA system.
3.2. 1. Amplification of DNA Targets
In this particular NASBA system, the amplicons incorporate a digoxigenin
label in order to facilitate the subsequent detection of the amplicons using a
microtiter plate hybridization assay. The sample may be either DNA purified
according to the scheme outlined in Subheading 3.1.1., or cell lysates prepared
by other means (see Notes). In any case, the procedure for DNA targets
proceeds in two phases, template priming and amplification.
3.2.1 .1 . Priming DNA Template
Prior to entering the NASBA cycle, the DNA template must be denatured
and "primed" by annealing with primer PI, as follows.
1. In a 1.5-mL-capacity microcentrifuge tube, combine 2 jaL of sample with 16 fiL
of NASBA reaction mixture (50 mM Tris-HCl (pH 8.5); 62.5 mM KC1; 15 mM
MgCl 2 ; 1.25 mM each of dATP, dGTP, dCTP, and dTTP; 2.5 mM each of ATP,
GTP, CTP and UTP) containing 1 pmol of primer PI (see Subheading 2.3.1.2.).
2. Heat at 100°C for 5 min in a dry heating block or boiling water bath, then transfer
to a water bath adjusted to 50°C and allow 2 min for the tube to equilibrate. Note
that it may be necessary to centrifuge the tube for a few seconds after the high
temperature heating step in order to spin down any condensation forming at the
top of the tube.
3. Add 2 ^L containing 10 mM dithiothreitol (DTT) and 10 U AMV-RT, and
incubate further at 50°C for 15 min. Heat the tube at 100°C for 5 min in order to
denature the newly synthesized complex, chill on ice, then proceed immediately
to the amplification phase.
3.2.1.2. Amplification Phase
After initial priming, the target is then subjected to the amplification cycle
as follows.
1. In a new 1.5-mL-capacity microcentrifuge tube, combine 5 fiL of the PI -primed
sample with 18 jaL of NASBA reaction mixture {see Subheading 3.2.1.1.)
containing 14 mM DTT, 1 pmol each of primers PI and P2 (see Subheading
76 Blais and Turner
2.3.1.2.) and 0.25 mM digoxigenin-1 1-UTP. Heat the mixture at 65°C for 5 min,
then transfer to a water bath adjusted to 41°C and allow 2 min to equilibrate.
2. Add 2 fxL of a mixture containing 8 U AMV-RT, 40 U T7 RNA polymerase, 0.1
U RNase H, 12.5 U RNasin, and 2.6 \ig bovine serum albumin. Return the tube to
the 41°C water bath and incubate for 90 min.
3. Centrifuge for a few seconds to spin down any condensation, and place on ice or
freeze at -20°C until ready for analysis of the amplicons.
3.2.2. Amplification of RNA Targets
The amplification of RNA targets proceeds in a manner that is similar to that
for DNA targets, with the exception that no initial priming step is required, as
the primer PI can anneal directly to the single-stranded target sequence. In this
particular NASBA system, the amplicons incorporate a biotin label to permit
their detection using a simple dot-blot assay on membrane discs. The samples
may be either total RNA purified according to Subheading 3.1.2., or cell
lysates prepared by other means {see Notes).
3.2.2.1. Amplification Phase
The sample is introduced directly into the amplification reaction as follows:
In a 1 .5-mL-capacity microcentrifuge tube, combine 5 |iL of sample with 18 \\L of
NASBA reaction mixture {see Subheading 3.2.1.) containing 14 mMof DTT,
1 pmol each of primers PI and P2 {see Subheading 2.3.2.2.) and 0.25 mM
biotin- 1 1-UTP. Heat the mixture at 65°C for 5 min, then transfer to a water
bath adjusted to 41 °C and allow 2 min to equilibrate. Proceed as for steps 2
and 3 in Subheading 3.2.1.2.
3.3. Detection of Amplicons
3.3.1. Detection of Amplicons from DNA Targets
In Subheading 3.2.1., target sequences originating from DNA molecules (e.g.,
genomic DNA) were amplified in the presence of digoxigenin-1 1-UTP, resulting
in the incorporation of this label in the amplicons (predominantly minus -strand
RNA). The procedure outlined in this section pertains to a microtiter plate-based
assay for the detection of the digoxigenin-labeled NASBA amplicons by hybrid-
ization with an immobilized DNA probe. The hybridized amplicons are then
detected by sequential reactions of the microtiter plate wells with anti-digoxigenin
antibody-peroxidase conjugate and tetramethylbenzidine substrate solution. The
intensity of the resulting color in the wells is proportional to the amount of amplicon
produced in the NASBA reaction.
The DNA probe-coated microtiter plates must be prepared in advance. In
the present NASBA system, the DNA probe is conveniently made by
amplification of a portion of the target sequence using the PCR technique.
Detecting L monocytogenes with NASBA 77
3.3.1 .1 . Preparation of DNA Probe
A capture DNA probe can be prepared using the PCR technique with purified
L. monocytogenes genomic DNA as template:
1. In a 0.6-mL-capacity microcentrifuge tube, combine 10 jaL of distilled H 2
containing 10 ng of L. monocytogenes genomic DNA {see Subheading 3.1.1.)
with 89.5 f^L of PCR reaction mixture (11 mM Tris-HCl (pH 8.3); 0.22 mMeach
of ATP, CTP, GTP, and TTP; 2.2 mM MgCl 2 ; 55 mM KC1; and 0.11% (v/v)
Triton X-100) containing 1.1 \kM each of primers PI and P2 {see Subheading
2.3.1.1.). Overlay the mixture with mineral oil, then place in a thermal cycler set
to hold the temperature at 80 °C for for 10 min.
2. Add 0.5 |iL containing 1 U Taq DNA polymerase to the tube, then subject the
sample to 35 cycles of the following sequence: denaturation at 94°C for 30 s,
primer annealing at 55°C for 30 s and primer extension at 72°C for 90 s. Allow an
additional 2 min at 72°C after the last cycle in order to ensure completion of
primer extension.
3. Gently insert a pipet tip under the mineral oil layer and remove all of the PCR
reaction mixture to a new 1.5-mL-capacity microcentrifuge tube. Add 0.1 vol of 3 M
ammonium acetate (pH 5.2), followed by 2.5 vol of ethanol, and place at -20°C for
at least 2 h.
4. Proceed as for steps 18-21 in Subheading 3.1.1.
3.3.1 .2. Immobilization of DNA Probe on a Microtiter Plate
1. Denature an aliquot of DNA probe stock by heating at 100°C for 10 min, then
immediately dilute to a final concentration of 2 f^g/mL in ice-cold coating buffer
(0.3 M Tris-HCl (ph 8.0); 0.5 M MgCl 2 ; 1.5 M NaCl).
2. Transfer 100 j^L of diluted, denatured DNA to each well of a microtiter plate,
then seal the wells (e.g., using adhesive tape or microtiter plate sealing film
pressed firmly over the wells), and incubate at 37°C for 16 h.
3. Empty the wells of their contents and allow to air dry. The DNA can be
crosslinked to the plastic by exposure to ultraviolet light (254 nm) for 3 min.
4. Wash the wells three times with approx 200 jliL wash buffer (0.1 M Tris-HCl (pH
8.0); 2 mM MgCl 2 ; 1 M NaCl; 0.1% (v/v) Tween-20). Note that the wells can be
washed by simply filling each with wash buffer using a squirt bottle, and empty-
ing by vigorously shaking the plate upside down. Ensure that no residual buffer
remains in the wells.
5. Block the wells by incubation at 37°C for 1 h with 100 \\L of hybridization solution
(5X SSC [IX SSC is 0.15 M NaCl plus 0.015 M sodium citrate]; 1 % (w/v) block-
ing reagent; 0.1 % (w/v) N-lauroylsarcosine; 0.02 % (w/v) sodium dodecyl sulfate;
50 % (v/v) formamide). Wash the wells three times with PBST (0.01 M phosphate
(ph 7.2), 0.15 M NaCl; and 0.05 % (v/v) Tween-20). At this point, the wells can be
emptied and air dried for storage at 4°C for a maximum of 4-6 wk.
78 Blais and Turner
3.3.1 .3. Assay of NASBA Amplicons
1. In a DNA probe-coated microtiter plate well, combine 25 \xL of hybridization
solution (see Subheading 3.3.1.2.) with 25 \xL of NASBA reaction product (see
Subheading 3.2.1.) , and incubate at 56°C for 90 min.
2. Wash the wells with PBST (see Subheading 3.3.1.2.), and incubate at room tem-
perature for 20 min with 100 u.L of anti-digoxigenin antibody-peroxidase conju-
gate diluted 1:2 000 in PBST containing 0.5 % (w/v) blocking reagent (PBST-B).
3. Wash the wells with PBST as before, and incubate at room temperature for 20 min
with 100 \xL of tetramethylbenzidine micro well substrate solution. A blue color
will develop in the wells in the presence of bound peroxidase (positive samples).
Stop the reaction by the addition of 50 \xh per well of 1 M H 2 S0 4 (this will
change the color from blue to yellow).
4. Using a microtiter plate reader, measure the absorbance in the wells at 450 nm
(A 450 ). Generally, negative control samples in which no template was added to
the NASBA reaction mixture should give A 450 values below 0.10, whereas any
absorbance value above this level should be considered as a positive result.
However, the cutoff absorbance values for different systems will have to be
determined empirically. Alternatively, if a microtiter plate reader is not avail-
able, reactions can be scored qualitatively by visual examination of the wells.
3.3.2. Detection of Amplicons from RNA Targets
In Subheading 3.2.2., target sequences originating from RNA molecules
(i.e., mRNA) were amplified in the presence of biotin-11-UTP, in order to
incorporate a biotin label in the amplicons. This section describes a simple
membrane dot-blot technique as an alternative to the microtiter plate-based
method for the detection of NASBA amplicons. In this approach, an
oligonucleotide probe complementary to a portion of the NASBA amplicon
(minus-strand RNA) is immobilized as a spot in the center of a small nylon
membrane disc. For the assay, the disc is incubated with NASBA reaction product,
and the amplicon is captured by hybridization with the immobilized probe at the
center of the disc. The bound amplicon is then detected by sequential reactions
with a streptavidin peroxidase conjugate and tetramethylbenzidine substrate solu-
tion. In this manner, positive results are visualized on the basis of color formation
(i.e., a blue spot) in the center of the disc.
3.3.2.1 . Preparation of Probe-Coated Discs
1. Dissolve the 56-mer oligonucleotide probe (see Subheading 2.3.2.1.) at a final
concentration of 30 ng/uL in 6 X SSC (see Subheading 3.3.1.2.), and apply 1 uL
to the center of an approx 8-mm nylon membrane disc (nylon membrane discs can
be punched from a sheet of membrane using a clean standard hole puncher). Allow
the disc to air dry, then expose to ultraviolet light (254 nm) for 5 min to crosslink
Detecting L monocytogenes with NASBA 79
the probe to the membrane. Mark the edge of the disc with a pencil to keep track of
the side receiving the DNA spot (you can also scribe a number or letter to permit
sample identification later).
2. Block the disc by incubation at 52°C for 1 h in hybridization solution (see
Subheading 3.3.1.2.) containing 25% (v/v) formamide instead of 50% (v/v). Note
that several discs can blocked together in a bulk volume of hybridization solution
(i.e., sufficient volume to submerge all of the discs).
3. Wash disc three times for 5 min at room temperature with PBST in a 250-mL-
capacity beaker (constant gentle agitation). Note that several discs can be washed
together in a bulk volume (e.g., 100 mL) of PBST. At this stage, discs can be
used immediately in the dot blot assay or stored dry at 4°C.
3.3.2.2. Dot-Blot Assay
1. Place a probe-coated disc in a 1.5-mL-capicity microcentrifuge tube containing
0.5 ml of hybridization solution, then add 25 fiL of NASBA reaction product (see
Subheading 3.2.2.1.) and mix well. Place the tube in a water bath adjusted to
52°C, and incubate for 30 min.
2. Drain the liquid (if necessary, touch lightly with the corner of a paper towel or
blotting paper to draw off residual liquid) and, leaving the disc in the tube, wash
three times for 5 min at room temperature with 1.5 mL of PBST (vortex briefly
after addition of PBST).
3. Leaving the disc in the tube, add 0.5 mL of streptavidin-peroxidase conjugate
diluted to 0.25 jug/mL in PBST containing 0.05% blocking reagent, and incubate
at room temperature for 15 min.
4. Wash disc with PBST as before, then remove from tube and place on the flat
surface of a Petri dish with the side bearing the DNA spot facing upward. Pipet
50 [iL of tetramethylbenzidine membrane peroxidase substrate solution on the
disc, and incubate at room temperature for 15 min. Reactions on the discs are
scored qualitatively as follows: positive, colored spot formation at center of disc;
negative, no colored spot formation.
4. Notes
4. 7. Selection of Oligonucleotides
4. 1. 1. Selection of NASBA Primers
Primer PI bears the T7 RNA polymerase-binding and preferred
transcriptional initiation sites (indicated by underscoring in the sequences
presented in Subheading 2.3.1.2. and 2.3.2.2.) appended at its 5'-end, followed
by a target-complementary sequence terminating at the 3'-end. The target-
complementary sequence on PI will vary depending on the target, and typically
has a length of about 20 nucleotides (nt) (although this can vary from 1 5-30 nt). In
selecting a target-complementary sequence, a G + C content of 45-60% is recom-
80 Blais and Turner
mended, and care should be taken to avoid tracts of the same nucleotides (L. Malek,
personal communication). Furthermore, as with PCR primers, it is important to avoid
3'-terminal complementarity between primers PI and P2, to reduce the formation of
primer dimers. With NASBA this issue is perhaps even more important than with
PCR, as typical NASBA reaction conditions are relatively less stringent.
4. 1.2. Selection of DNA Capture Probe
In selecting primers for synthesis of a DNA capture probe by PCR, it is
important to avoid sequences complementary to the NASBA primers PI and
P2. In this manner, any primer dimers produced in the NASBA reaction will
not hybridize with the immobilized DNA capture probe during the subsequent
amplicon assay procedure. Thus, in the present example, the primers used for
preparation of the DNA capture probe (see Subheading 2.3.1.1.) were designed
to amplify hlyA sequences internal to the region defined by the NASBA primers
PI and P2 (see Subheading 2.3.1.2.).
4. 1.3. Synthesis of Long Oligonucleotides
When synthesizing long oligonucleotides, such as the primer PI, it is
important to consider that, during the synthesis procedure, oligonucleotides
are synthesized one base at a time starting at the 3'-end. Unlike biological
systems, the chemical couplings are not 100% efficient (typical coupling
efficiencies using current synthesizer models are about 98-99.5% for each
step). This means that between 0.5-2% of the oligonucleotides are not extended
at each base addition. For a short oligonucleotide, the major product will still
be the full-length sequence. However, as longer oligonucleotides are made, the
proportion of full-length oligonucleotides in the product pool decreases
exponentially [e.g., for a 61-mer involving 60 couplings, the proportion of full-
length product resulting from a process having 98% coupling efficiency can be
calculated as: (0.98)E60 x 100% = 30%]. Therefore, in order to obtain a
homogeneous preparation of full-length primers necessary for efficient
NASBA reactions, it is highly recommended that any oligonucleotides exceed-
ing 30 nt in length be purified by gel electrophoresis or HPLC.
4.2. Target Nucleic Acid Preparation
4.2. 1. DNA Purification
A simpler, more rapid alternative would be to either lyse whole cells by boiling
for 10 min in the presence of 1% (v/v) Triton X-100, and then using this crude cell
lysate directly in the NASBA reaction. This approach has generally worked well
for sample preparation in PCR applications. However, in some instances, such as
when the sample consists of an enrichment culture, the sample matrix (e.g., food
Detecting L monocytogenes with NASBA 81
sample, enrichment broth components) may contain substances that inhibit the
NASBA reaction, necessitating the use of a DNA purification step. Another alter-
native to the DNA purification procedure detailed in this chapter would be to utilize
a genomic DNA extraction kit offered by manufacturers such as QIAGEN,
Promega, Life Technologies (Gibco-BRL; Gaithersburg, MD), and Amersham
Pharmacia Biotech (Uppsala, Sweden).
4.2.2. RNA Purification
Because the detection of mRNA targets depends on in vivo transcriptional
activity, it is essential to understand the regulatory mechanisms involved in the
expression of a gene of interest. In this manner, it may be posssible to manipu-
late the organism's environment in order to induce transcription of a particular
gene, as is done in the present example involving expression of the L. mono-
cytogenes hly A gene by addition of sodium azide and elevation of the tempera-
ture. It should be noted that some strains of L. monocytogenes carry the hly A
gene but have lost the ability to express it (especially after prolonged stor-
age on plating media at 4°C), in which case the NASBA approach targeting
genomic DNA may be more appropriate.
4.3. Amplification Reactions
4.3.1. NASBA Reaction Conditions
It is important to recognize that the NASBA reaction system involves the
concerted actions of three separate enzymes — RT, T7 RNA polymerase, and
Rnase H — each with its own optimal operating conditions of temperature, pH,
ionic strength, and so on. Therefore, combining the three activities in a single
reaction system (e.g., NASBA) represents a compromise in terms of tempera-
ture and buffer conditions, and presents a very narrow window in which to
operate the system. Any deviation from the recommended temperatures or
buffer conditions can significantly affect the efficiency of the amplification.
Therefore, great care must be taken in the preparation of all buffers and
reagents, and in regulating the temperatures at each stage of the procedure. A
properly adjusted water bath will provide better temperature control than a dry
incubator, such as a heating block.
4.3.2. RNase Contamination
RNases are ubiquitous in biological systems, and frequently contaminate
the laboratory environment (including glassware). These robust enzymes are
very difficult to eliminate, being capable of renaturation even after autoclav-
ing. Because RNA molecules are so central to the NASBA reaction, it is crucial
to take the necessary steps to minimize the introduction of RNases in the
system. The NASBA reaction mixtures described herein contain the RNase
82 Blais and Turner
inhibitor RNasin to minimize the effects of contamination by the sample
matrix. Nonetheless, certain precautions are warranted to prevent contamina-
tion from other sources. Care should be taken to avoid touching surfaces and
reagents that will come in direct contact with the NASBA system (it is essen-
tial to wear gloves at all times). All glassware and water used in the preparation
of buffers and reagents should be treated to eliminate RNase contamination.
Solutions and glassware can be decontaminated by treatment with DEPC, but
it should be borne in mind that residual DEPC can interfere with the NASBA
reaction. Glassware can also be decontaminated using RNase Away (Molecu-
lar Bio-Products, Inc., San Diego, CA). Molecular biology grade reagents
should be used wherever possible.
4.3.3. Contamination with Amplicons
Amplicons from previous amplifications can quickly contaminate the labo-
ratory environment and pose a very serious problem to laboratories routinely
carrying out reactions such as PCR and NASBA. NASBA is particularly prone
to this problem as the levels of amplification can exceed by several orders of
magnitude those achieved with PCR. It is essential that negative controls
devoid of target sequences or sample matrix be run with each set of NASBA
reactions in order to determine whether a contamination problem exists. If a
contamination problem does exist, it is likely to involve one or more of the
following laboratory items: bench and equipment surfaces, pipetters, stock
buffers and solutions, reaction mixtures, reagents, and glassware. To minimize
the risk of false-positive reactions due to contamination, the different stages
involved in preparing the NASBA reagents and carrying out the procedure
should be physically separated. For instance, NASBA reaction mixtures (which
may be prepared in bulk ahead of time, then aliquoted and stored at -20°C)
should not be prepared in the same physical environment where the amplifica-
tion reactions are carried out. Similarly, post-amplification tubes should never
be opened in the same area where samples are prepared and added to the
NASBA reaction mixtures.
References
1. Sooknanan, R., Malek, L., Wang, X. I., Siebert, T., and Keating, A. (1993)
Detection and direct sequence identification of BCR-ABL mRNA in Ph+ chronic
myeloid leukemia. Exp. Hematol. 21, 1719-1724.
2. Compton, J. (1991) Nucleic acid sequence-based amplification. Nature (London)
350,91-92.
3. Blais, B. W., Turner, G., Sooknanan, R., and Malek, L. (1997) A nucleic acid
sequence-based amplification system for detection of Listeria monocytogenes
hlyA sequences. Appl. Environ. Microbiol. 63, 310 — 313.
Detecting L monocytogenes with NASBA 83
4. Blais, B. W., Turner, G., Sooknanan, R., Malek, L., and Phillippe, L. M. (1996) A
nucleic acid sequence-based amplification (NASBA) system for Listeria
monocytogenes and simple method for detection of amplimers. Biotechnol. Tech.
10, 189-194.
5. Mengaud, J., Vicente, M., Chenevert, J., Pereira, J. M., Geoffroy, C., Gicquel-
Sanzey, B., Baquero, F., Perez-Diaz, J., and Cossart, P. (1988) Expression in
Escherichia coli and sequence analysis of the listeriolysin O determinant of List-
eria monocytogenes. Infect. Immun. 56, 766-772.
10
Detection of Escherichia coli 01 57:H7
by Immunomagnetic Separation
and Multiplex Polymerase Chain Reaction
Ian G. Wilson
1. Introduction
Since 1983, when Escherichia coli 0157:H7 was first recognised as a cause of
hemorrhagic colitis and hemolytic uremic syndrome (HUS), verotoxin-producing
strains of E. coli (VTEC) have been identified as the cause of increasing numbers
of cases of serious human illness (1,2). One of a number of large outbreaks in Scot-
land resulted in 20 deaths, and a massive outbreak in Japan affected more than 9000
people (3,4). In England and Wales, 90 % of VTEC cases are sporadic (5).
The serotype predominantly associated with serious illness is E. coli
0157:H7, but other serotypes and coliforms have been reported to cause similar
disease (6,7). The morbidity and mortality are markedly higher than for other
serotypes, and the sequelae of infection are both more serious and more
common than most food-borne pathogens. Young children and elderly people
are at particular risk of developing hemolytic uraemic syndrome or thrombotic
thrombocytopenic purpura (TTP). Up to 10% of patients may develop these
complications. Some die, and a small number may require hospital care for
many months afterward because of renal impairment or other sequelae (8).
The factors surrounding the emergence of this organism have been discussed
widely. E. coli 0157:H7 is most commonly associated with beef, in particular
undercooked hamburgers (5,9,10). It has also been the cause of outbreaks
associated with direct animal and human contact, apple juice (11 ,12), fermented
sausage (13), dairy products (14-16), water (17,18), plant products (19), and
other foods. The infectious dose is considered to be very low, perhaps less than
10 bacteria (10,20). Fecal contamination from infected cattle, sheep, and wild
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
85
86 Wilson
birds (21) appears to be the most common ultimate source of the organism, and
it can survive for long periods in feces (22).
Conventional tests for E. coli will not detect E. coli 0157:H7 because most
strains are unable to ferment sorbitol, produce glucuronidase, or grow at 44°C.
E. coli 0157 would be detected only as a coliform in many screening tests.
Given its increasing prevalence, this serotype should now be sought
specifically. Although non-0157 E. coli serotypes which produce verotoxins
and other VT-producing coliforms have been shown to cause illness, E. coli
0157:H7 is more virulent. Non-0157 organisms are responsible only for a
small number of verocytotoxin -mediated illnesses.
Immunomagnetic separation (IMS) uses a suspension of uniform polymer
spheres containing oxides of iron (23,24). These have superparamagnetic prop-
erties and possess no residual magnetism when removed from a magnetic field
(23). Conjugated with specific antisera, they provide a rapid and effective
alternative to other methods of concentrating specific bacterial cells (25,26).
Multiplex PCR offers a rapid and definitive test for the possession of
virulence genes which have been shown to be important in strains causing
illness. Both the chromosomally-encoded attaching and effacing gene (eae)
which codes for an outer membrane protein that mediates intimate attachment
to the mucosa, and the bacteriophage-encoded verocytotoxin (VT1 and VT2)/
shiga-like toxin genes (sltl or sltll) appear to be necessary to cause illness (27).
The possession of only one of these genes may indicate lower the likelihood of
causing illness. These genes are not exclusive to E. coli 0157:H7, but may
correlate with pathogenicity in other species and serotypes (6,7,28).
Confirmation by serological and biochemical methods is essential, as PCR
alone cannot determine genus and serotype identity.
The method described in Subheading 3. is useful for routine food
examination and for risk assessment because it enables the confirmation of
E. coli 0157:H7 culture from food and the testing of isolates for virulence
genes. The principle involves sample preparation and enrichment culture,
immunomagnetic separation, and detection and confirmation (selective plating,
serological and biochemical diagnostic tests, and multiplex PCR).
2. Materials
1. Modified tryptone soya broth (MTSB) (Oxoid, Basingstoke, Hampshire, UK).
Methods for preparing Oxoid media can be found in the Oxoid Manual. Store at 4°C.
2. Dynabeads anti-£. coli 0157 (Dynal, Wirral, UK, techserve@dynal.u-net.com).
Store at 4°C.
3. Cefixime tellurite sorbitol MacConkey (CT-SMAC) agar (Oxoid). Store at 4°C.
4. MacConkey agar (Oxoid). Store at 4°C.
5. Nutrient agar. Store at 4°C.
VTEC IMS and PCR 87
6. Phosphate-buffered saline (PBS) pH 7.4 with 0.05% Tween-20 (PBST) in 5-mL
aliquots. Store at 4°C.
7. Saline solution (0.85% NaCl). Store at 4 °C.
8. ^-Glucuronidase broth. Store at 4°C.
9. Latex agglutination test: E. coli 0157 (Oxoid).
10. API 20E biochemical test strips (Bio-Merieux, Marcy l'etoile, France). Store at 4°C.
11. Magnetic particle concentrator (MPC, Dynal, UK). Dynal MPC-M holds 10
Eppendorf tubes and allows working volumes of 1.5 mL.
12. Columbia blood agar (Oxoid). Store at 4°C.
13. Tris acetate EDT A buffer (TAE).
14. 5.0 mM MgCl 2 . Molecular biology grade.
15. 10 mM Tris hydrochloride (pH 8.3). Molecular biology grade.
16. 50 mM KC1. Molecular biology grade.
17. 0.2 mM (each) dATP, dGTP, dCTP, and dTTP (Pharmacia Biotech, St. Albans,
Hertfordshire, UK).
18. Primers: 0.15 M each primer. See Table 1 and Note 1.
19. Thermus aquaticus (Taq) DNA polymerase (Stoffel fragment) (Perkin-Elmer,
South Glamorgan, UK). Store frozen.
20. Thermal cycler.
21. Agarose gel electrophoresis equipment.
3. Method
The detection of E. coli 0157:H7 (29) requires four stages: selective
enrichment in liquid medium, immunomagnetic separation, selective plating
and colony recognition on solid media, and confirmation. PCR can be
conducted on confirmed colonies (see Note 2).
3. 7. Selective Enrichment Culture
1. Aseptically weigh out 25g of food into a stomacher bag with filter.
2. Add 225 mL of preincubated (42°C) modified tryptone soya broth (MTSB) to the
sample and homogenize in a stomacher. If less than 25 g is available, use a 1:10
dilution with MTSB and record the weight and volume used (e.g., if 10 g of
sample, add 90 mL MTSB) (see Note 3).
3. Strain through the filter and pour into a sterile screw-topped jar (see Note 4).
4. Perform enrichment culture by incubating at 42°C for 6 h to encourage the selec-
tive proliferation of E. coli 0157:H7 {see Note 5).
3.2. Immunomagnetic Separation
Use Dynabeads anti-£. coli 0157 (Dynal) according to the manufacturer's
instructions for the isolation of E. coli 0157:H7. The technique will vary slightly
depending on the size of tubes and magnetic particle concentrators used (see
Notes 6 and 7).
88
Wilson
Table 1
Oligonucleotide Primers
Primer Oligonucleotide sequence (5-3')
Location
within gene
Predicted size of
amplified product
(bp)
sltl-F ACA CTG GAT GAT CTC AGT GG
sltl-R CTG AAT CCC CCT CCA TTA TG
sltll-F CCA TGA CAA CGG ACA GCA GTT
sltll-R CCT GTC AAC TGA GCA CTT TG
eae-F TCG TCA CAG TTG CAG GCC TGG T
eae-R CGA AGT CTT ATC AGC CGT AAA GT
PI IP GAG GAA GGT GGG GAT GAC GT
P13P AGG CCC GGG AAC GTA TTC AC
938-957
1539-1520
601
624-644
1403-1384
780
2242-2263
3350-3328
1109
16S rRNA
1175-1390
216
1 . Add 20 ^iL of resuspended Dynabeads (Dynal) to an appropriate number of 1 .5- mL
Eppendorf tubes.
2. Add 1 mL of inoculated and incubated MTSB enrichment broth to the tubes (see
Note 8).
3. Vortex briefly and incubate at room temperature for 30 min on a 360° rotating
mixer (Dynal) at moderate speed. This enables the beads to encounter and
specifically bind bacteria within the liquid phase.
4. Concentrate the beads using the MPC. Tubes are held in place by a perspex cover
and the magnetic strip is slid into the device to begin concentration. Leave to
separate for 5 min (see Note 9).
5. With the magnetic strip still in place, slowly rotate and invert the MPC three
times to bring the beads to the back of the tube. Open the tubes carefully using an
Eppendorf tube opener to avoid dislodging beads or creating aerosols from liquid
trapped in the cap. Carefully remove the supernatant by pipetting from the side of
the tube not holding the rust-colored bead-bacteria complexes (see Note 10).
Discard supernatant as potentially infected waste (see Note 11).
6. Remove the magnetic strip, add 1 mL of PBS pH 7.4, containing 0.05% Tween-20
(PBST) to the tubes. Use one tube of PBST per sample to avoid cross-contamina-
tion. Close the lids and mix by inverting the MPC three times to resuspend the
beads. Replace the magnetic strip and repeat steps 4-6 three times.
7. Aspirate the supernatant, remove the magnetic strip, and add 30 fiL PBST to
each tube. Resuspend using a vortex mixer. High numbers of a virulent patho-
gen with a low infectious dose may be present. Use appropriate containment
and work carefully.
3.3. Selective Plating
1. Plate 50 fiL of Dynabeads onto cefixime tellurite sorbitol MacConkey
(CT-SMAC) agar.
2. Streak out for single colonies and incubate at 37°C for 24 h (see Notes 13-15).
VTEC IMS and PCR 89
3.4. Identification
Examine CT-SMAC plates for colorless non-sorbitol-fermenting colonies
(sorbitol-fermenting colonies are pink/red). If present, subculture five non-sor-
bitol-fermenting colonies onto MacConkey agar and incubate overnight at
37 °C. Serological and biochemical confirmation must be conducted.
1. Perform latex slide agglutination tests (Oxoid) on lactose-positive, Gram-nega-
tive bacilli. Prepare two saline suspensions on a glass slide using a loopful of
growth from the MacConkey agar. Add a loopful of E. coli 0157 antiserum to
one of the suspensions. Rock the slide for 30-60 s. If agglutination occurs with
the antiserum but not the saline, the test is positive. Lactose-fermenting cultures
which autoagglutinate must be subcultured to nutrient agar, incubated until
adequate growth is obtained, and retested.
2. Confirm tests that cause agglutination in this reaction biochemically using the API
20E system (bio-Merieux) according to the manufacturer's instructions. It is also
useful to inoculate a (3-glucuronidase broth using a colony from the MacConkey
purity culture. E. coli 0157:H7 is usually [3-glucuronidase negative and urease
positive, unlike most other E. coli serotypes. Record as E. coli 0157:H7 any colonies
with an acceptable API profile and positive somatic 0157 agglutination response.
3. Presence or absence of E. coli in 25g can then be reported.
3.5. DNA Extraction
1. Subculture confirmed E. coli 0157:H7 strains on to Columbia blood agar and
incubate at 37°C overnight.
2. Using a 2-mm loop, pick a colony off into 0.5 mL TAE buffer in an Eppendorf
tube and place it in a boiling waterbath for 10 min to lyse the cells. This crude
extraction method is satisfactory when the target organisms have been grown in
pure culture. For higher purity DNA, phenol-chloroform extraction or one of
many commercial systems can be used {see Note 16).
3.6. Multiplex PCR Assay
Oligonucleotide primers can be prepared by commercial companies based
on previously published sequences (30,31) that give amplification products of
sizes which could be satisfactorily separated and distinguished from each other
by agarose gel electrophoresis.
The nucleotide sequence of each primer and the corresponding locations
within the sit I, sltU, and eae genes are shown in Table 1. Conserved primers
PI IP and PI 3P amplify a 216-bp fragment of the V6 region of the 16S rRNA
gene (32). This amplification is included to verify the presence of target DNA
from the sample. Negative (lfiL pure H 2 0, Fig. 1, lane 8) and positive (1 \ih of
extracted genomic DNA from the 3 strains listed in Fig. 1, lanes 5-7) controls
should be included in each run. Three positive control strains of E. coli should
90 Wilson
be used that possess the sltl, sltll and eae genes. We chose an E. coli 128 that
has the sltl gene only, E. coli 0157:H7 with sltll and eae, and E. coli 0157:H7
NCTC 12079 with sltl, sltll, and eae (see Note 17).
1. Make a master mix containing 5.0 mM MgCl 2 , 10 mM Tris hydrochloride (pH
8.3); 50 mM KC1; 0.2 mM (each) dATP, dGTP, dCTP, and dTTP (Pharmacia
Biotech); 0.15 M each primer; and 2.5 U of Taq DNA polymerase (Stoffel
fragment) (Perkin-Elmer) (see Note 18).
2. Add 1 L template DNA and carry out the amplifications in 25 L vol using a DNA
thermal cycler (Bio-Rad) for 1 cycle of 3 min at 96°C followed by 35 cycles of 30 s
at 94°C, 30 s at 60°C, and 1 min at 72°C with a final extension at 72°C for 5 min.
3.7. Electrophoresis
1 . Following PCR, electrophorese 15 L vol with tracker dye in 1% agarose (Bio-Rad)
in IX TAE buffer containing 0.25 g ethidium bromide per mL. Include a 100-bp
ladder (Gibco-BRL) in each gel as a molecular-size marker. Perform electrophore-
sis for 40 min at 100 V; visualize by UV transillumination, and capture by photog-
raphy or an image grabber attached to a computer and print.
2. Examination of the gel image shows the possession of virulence genes in the
E. coli 0157:H7 isolates. The different sizes of amplicons (see Table 1) show
clearly which genes have been amplified, so the presence of virulence genes in
E. coli isolates can be readily identified (see Fig. 1).
4. Notes
1. Many authors have published methods for E. coli 0157:H7 using alternative
primers and other variations on the methods described here.
2. This method is for the detection of the organism, not its enumeration.
3. MTSB should be prewarmed to 42°C to prevent temperature shock to the
organisms which may have been damaged by environmental or processing
stresses. The 42°C temperature reduces competition from nontarget organisms
and ensures the highest recovery of viable E. coli 0157:H7 (33).
4. Substrates containing high proportions of fat may interfere with immunomagnetic
separation. The fatty matrix of cheeses may interfere with the settling of
immunomagnetic beads, allowing their aspiration during washing steps and false-
negative results. Other reported causes of reduced sensitivity include nonspecific
binding of non-target bacteria to beads (25) and reaction inhibition when PCR is
used (26,34). In general, IMS is very reliable and these sources of interference
should not present a great problem. Nevertheless, some samples may require
preparation to remove fats or particulates which reduce recovery of cells.
5. The method described above should be suitable for use with fecal samples with
little modification. IMS -PCR has been reported to overcome the PCR inhibition
caused by bilirubin and bile salts in feces. Normally, a 500-fold dilution is needed
VTEC IMS and PCR
91
Fig. 1. Multiplex PCR of DNA from E. coli strains for sltl, sltll (including variants),
and eae genes (1.0% agarose with ethidium bromide). Lanes: 1, molecular size marker
(lOObp ladder); 2, E.coli 0157 slt-II, eae + (Patient A); 3, E.coli 0157 slt-ll, eae + (Pa-
tient B [wife of A] ); 4, E.coli 0157 slt-I, slt-II, eae + (Patient C); 5, E.coli 0128 slt-I;
6, E.coli 0157 slt-II, eae + ; 7, E.coli 0157 NCTC 12079 slt-I, slt-II, eae + \ 8, blank
(H 2 0).
to overcome inhibition, but with IMS extraction only a 10-fold dilution and the
addition of T4 gene 32 protein were needed (36).
6. A range of magnetic separators is available to allow various numbers and sizes of
tubes from single tubes to 96-well plates to be used depending on the processing
needs of the lab. The beads are visible on the wall of the tube as a rusty smear.
Care should be taken not to disturb them. Pipetting should be performed slowly,
and the pipet tip should be placed in the supernatant opposite the beads to avoid
reducing recovery by accidental aspiration of bound cells. With the smaller volumes
involved in using the 96-well concentrator, the beads are not be visible and careful
pipetting is particularly important. Using a multichannel pipet and undamaged tips,
aspirate every second row along the side with no beads attached, twist the MPC
180° and aspirate the remaining rows along the side with no beads attached. With
this technique, the angle of the operator's hand does not need to change.
7. Nude paramagnetic beads are available and can be conjugated with specific anti-
bodies, or with lectins by the user. This can be useful for capturing specific or
92 Wilson
generic microorganisms or nucleic acids. Dynabeads DNA are also available for
the nonsequence-specific capture of DNA from lysed cells.
8. It has been demonstrated that enrichment and selective plating using 100 f^L but
not 10 f^L of broth is of similar sensitivity in recovering E. coli 0157 as IMS
methods, but is less selective.
9. A machine that automates the bead-washing process is expected to become avail-
able soon. This will allow larger numbers of samples to be processed easily in
busy laboratories.
10. Considerable care is needed when pipetting to ensure that immunomagnetic beads
are not aspirated accidentally (reducing recovery of the organism), or cross-con-
taminated.
11. A new pipet tip should be used for each tube to prevent cross-contamination.
12. The UK Health and Safety Executive requires that£. coli 0157 should be worked
with in Category 3 containment once identification is confirmed. Cultures which
may contain VTEC may be worked with using good laboratory practice until
identity is confirmed.
13. VT genes are lost from the bacterial genome very readily (35). After storage at
-70°C, isolates that were positive may be negative when retested. The most reli-
able results will be obtained if isolates are tested promptly after isolation, and
with as little storage and subculturing as possible.
14. Control organisms and control DNAs are neccessary to assure the quality of results.
15. Colonies scraped from plates will give better results than those centrifuged from
broths. Broth cultures tend not to amplify well.
16. Boiling to release DNA is quick and simple, but more highly purified DNA is
likely to give better results, if time to purify it is available. Rapid DNA purifica-
tion methods may improve the clarity and reproducibility of results.
17. The presence of VT genes does not necessarily mean that they are expressed. The
finding of VT genes is not positive confirmation that the isolate caused illness.
Confirmation using a serological test for verocytotoxins is advisable.
18. Titration of Mg 2+ will ensure that the most effective concentration is being used
to maximize DNA amplification. Suboptimal concentrations may give rise to
spurious bands or an absence of bands.
References
1. Ammon A. (1997) Surveillance of enterohaemorrhagic E. coli (EHEC) infections
and haemolytic uraemic syndrome (HUS) in Europe. Euro surveillance 2, 91-96.
2. Armstrong, G. L., Hollingsworth, J., and Morris, J .G. (1986) Emerging foodborne
pathogens: Escherichia coli 0157:H7 as a model of entry of a new pathogen into
the food supply of the developed world. Epidemiol. Rev. 18, 29-51.
3. Anonymous (1996) Enterohaemorrhagic Escherichia coli infection. Weekly
Epidemiol. Record 30, 229-230.
4. Gutierrez, E. and Netley, G. (1997) Japanese Escherichia coli outbreak is still
puzzling health officials. Lancet 348, 540.
VTEC IMS and PCR 93
5. Parry, S. M., Salmon, R. L., Willshaw, G. A. and Cheasty, T. (1998) Risk factors
for and prevention of sporadic infections with vero cytotoxin (shiga toxin)
producing Escherichia coli 0157. Lancet 351, 1019-1022.
6. Law, D. (1997) The significance of verocy to toxin-producing Escherichia coli
other than E. coli 0157. PHLS Microbiol. Dig. 14, 72-75.
7. Tarr, P. (1994) Escherichia coli 0157:H7: overview of clinical and epidemiologi-
cal issues. /. Food Prot. 57, 632-636.
8. MacDonald, I. A. R., Gould, I. M. and Curnow, J. (1996) Epidemiology of infec-
tion due to Escherichia coli 0157: a 3 -year prospective study. Epidemiol. Infect.
116, 279-284.
9. Gill, C. O., McGinnis, J. C., Rahn, K. and Houde, A. (1996) The hygienic condi-
tion of manufacturing beef destined for the manufacture of hamburger patties.
Food Microbiol. 13, 391-396.
10. Willshaw, G. A., Thirlwell, J., Jones, A. P., et al. (1994) Vero cytotoxin-produc-
ing Escherichia coli 0157 in beefburgers linked to an outbreak of diarrhoea,
haemorrhagic colitis and haemolytic uraemic syndrome in Britain. Lett. Appl.
Microbiol. 19, 304-307.
11. Besser, R. E, Lett, S. ML, Weber, J. T., Doyle, M. P., Barrett, T., Wells J G et al.
(1993) An outbreak of diarrhoea and haemolytic uremic syndrome from Escheri-
chia coli 0157 in fresh-pressed apple juice. JAMA 111, 2217-2220.
12. Anonymous (1997) Outbreaks of Escherichia coli 0157:H7 infection and
cryptosporidiosis associated with drinking unpasteurized apple cider-Connecti-
cut and New York, October 1996. JAMA 277, 781-782.
13. Anonymous (1995) Escherichia coli 0157:H7 outbreak linked to commercially
distributed dry-cure salami. M.M.W.R. 44(9), 157-160.
14. Sharp, J. C. M., Reilly, W. J., Coia, J. E., Curnow, J., and Synge, B. A. (1995)
Escherichia coli 0157 infection in Scotland: an epidemiological overview, 1984-
94 PHLS Microbiol. Dig. 12, 134-140.
15. Duncan, S. E. and Hackney, C. R. (1994) Relevance of Escherichia coliO\51:Hl
to the dairy industry. Dairy Food Environ. Sanit. 14, 656-660.
16. Morgan, D., Newman, C. P., Hutchinson, D. N., Walker, A. M., Rowe, B. and
Majid, F. (1993) Verocytotoxin producing Escherichia coli 0157 infections
associated with the consumption of yoghurt. Epidemiol . Infect. Ill, 181-187.
17. Ackman, D., Marks, S., Mack, P., Caldwell, M., Root, T., and Birkhead G. (1997)
Swimming-associated haemorrhagic colitis due to Escherichia coli 0157:H7
infection: evidence of prolonged contamination of a fresh water lake. Epidemiol.
Infect. 119, 1-8.
18. Keene, W. E., McAnulty, J. M., Hoesly, F. C, Williams, L. P., Hedberg, K., Oxman
G. L. et al. (1994) A swimming-associated outbreak of hemorrhagic colitis caused
by Escherichia coli 0157:H7 and Shigella sonnei. New Engl. J. Med. 331, 579-584.
19. Anonymous (1997) Outbreaks of Escherichia coliO\51:Hl infection associated with
eating alfalfa sprouts — Michigan and Virginia, June-July 1997. JAMA 278, 809-810.
20. Bolton, F. J., Crozier, L., and Williamson, J. K. (1996) Isolation of Escherichia
coli 0157 from raw meat products. Lett. Appl. Microbiol. 23, 317-321.
94 Wilson
21. Wallace, J. S., Cheasty, T. and Jones, K. (1997) Isolation of verocytotoxin-pro-
ducing Escherichia coli 0157 from wild birds. /. Appl. Microbiol. 82, 399-404.
22. Wang, G., Zhao, T., and Doyle, M. P. (1996) Fate of enterohaemorrhagic £sc//£n-
chia coli 0157:H7 in bovine feces. Appl. Environ. Microbiol. 62, 2567-2570.
23. Anonymous (1998) Biomagnetic Techniques in Molecular Biology , 3rd ed. Dynal,
Oslo, Norway.
24. Safarik, I., Safarkov, M., and Forsythe, S. J. (1995) The application of magnetic
separations in applied microbiology. /. Appl. Bacteriol. 78, 575-585.
25. Tomoyasu, T. (1998) Improvement of the immunomagnetic separation method
selective fox Escherichia coli 0157 strains. Appl. Environ. Microbiol. 64, 376-382.
26. Chen, J., Johnson, R., and Griffiths, M. (1998) Detection of verotoxigenic
Escherichia coli by magnetic capture-hybridization PCR. Appl. Environ.
Microbiol 64, 147-152.
27. Heuvelink, A. E., Van de Kar, N. C. A. J., Meis, J. F. G. M., Monnens, L. A. H.,
and Melchers, W. J. G. (1995) Characterization of verocytotoxin-producing
Escherichia coli 0157 isolated from patients with haemolytic uremic syndrome
in Western Europe. Epidemiol. Infect. 115, 1-14.
28. Meng, J., Zhao, S., Doyle, M. P., Mitchell, S. E., and Kresovich, S. (1997) A
multiplex PCR for identifying Shiga-like toxin-producing Escherichia coli
0157:H7. Lett. Appl. Microbiol. 24, 172-176.
29. Roberts, D., Hooper, W. L., and Greenwood, M. (1995) Section 6: Isolation and
enrichment of micro-organisms, in Practical Food Microbiology, Methods for the
Examination of Food for Organisms of Public Health Significance, PHLS, London.
30. Gannon, V., King, R., Kim, J., and Golsteyn Thomas, E. (1992) Rapid and sensitive
method for detection of Shiga-like toxin-producing Escherichia coli in ground beef
using the polymerase chain reaction. Appl. Environ. Microbiol. 58, 3809-3815.
31. Beebakhee, G., Louie, M., de Azavedo, J., and Brunton, J. (1992) Cloning and
nucleotide sequence of the eae gene homologue from enterohaemorrhagic
Escherichia coli serotype 0157:H7. FEMS Microbiol. Lett. 91, 63-68.
32. Widjojoatmodjo,M.,Fluit, A., and Verhoef, J. (1994) Rapid identification of bac-
teria by PCR-single-strand conformation polymorphism. /. Clin. Microbiol. 32,
3002-3007.
33. Bolton, E.J., Crozier, L., and Williamson, J. K. (1995) New technical approaches
to Escherichia coli 0157. PHLS Microbiol. Digest 12, 67-70.
34. Wilson, I. G. (1997) Inhibition and facilitation of nucleic acid amplification. Appl.
Environ. Microbiol. 63, 3741-3751.
35. Karch, H., Meyer, T., Riissmann, H., and Heeseman, J. (1992) Frequent loss of
shiga-like toxin genes in clinical isolates of Escherichia coli upon subcultivation.
Infect. Immunol. 60, 3464-3467.
36. Widjojoatmodjo, M. N., Fluit, A. C, Torensma, R., Verdonk, G. P. and Verhoef, J.
(1992) The magnetic immuno polymerase chain reaction for direct detection of
salmonella in fecal samples. /. Clin. Microbiol. 30, 3195-3199.
11
Detection of Campylobacter jejuni and Thermophilic
Campylobacter spp. from Foods by Polymerase
Chain Reaction
Haiyan Wang, Lai-King Ng, and Jeff M. Farber
1. Introduction
Campylobacter spp. is one of the most commonly reported bacterial causes of
acute diarrheal disease in humans throughout the world (1-3). The thermophilic
Campylobacter jejuni, C. coli, C. lari, and C. upsaliensis are the most important
species, with C. jejuni accounting for more than 95% of all the human
Campylobacter infections (4,5). Poultry, raw milk, and water have been
implicated as the major vehicles for Campylobacter infection (6,7), although
other foods may also become a source of infection through cross-contamination
from other food types, a food handler, or a work surface during food preparation
(3). Because Campylobacters have fastidious growth requirements and relatively
inert biochemical characteristics, identification of these organisms and differen-
tiation between species within the genus Campylobacter by cultural methods are
time consuming and difficult (8-10). The accuracy of some biochemical tests is
also affected by bacterial inoculum size (11), which can be difficult to control.
Additionally, Campylobacter cells are usually present in very low numbers and
may become injured in foods and environmental water, and therefore become
nonculturable (12-15). Because of the foregoing, nucleic acid-based detection
methods became alternatives for the detection of Campylobacters.
The polymerase chain reaction (PCR) is an in situ DNA replication
process that allows for the exponential amplification of target DNA in the
presence of synthetic oligonucleotide primers and a thermostable DNA
polymerase. PCR has found its applications in a wide range of disciplines
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
95
96 Wang, Ng, and Farber
such as medicine, plant pathology, evolutionary biology, molecular biology, and
clinical, food, and environmental microbiology. PCR-based methods have been
developed for quick identification of purified cultures of a number of foodborne
pathogens including Salmonella spp. (16), Listeria monocytogenes (17), E. coli
0157:H7 (18), and Campylobacter spp. (see Table 1) (2,19-30). PCR-based
methods have also been applied to detect bacteria directly from food or clinical
samples with or without pre-enrichment (4,31-36, and see Table 1).
PCR-based methods can be made very specific for certain species, and may
detect the target organisms in the presence of other organisms. Currently, a
number of PCR protocols targeting different genes within the genus
Campylobacter have been developed and applied for detection or identification
of these organisms in pure cultures or directly from foods, water, and clinical
samples (4,36, and see Table 1). C. jejuni- specific PCRs based on unknown
genes (4,21) have been applied to the detection of this species from poultry,
milk, and other foods (2,21,33 ,36), whereas the hip gene-based C. jejuni-spe-
cific PCR was used to identify this species directly from clinical samples (23).
Linton and colleagues (23) also used different sets of primers to identify C. coli,
or both C jejuni and C. coli from clinical samples. A multiplex PCR assay
combining one pair of C. jejuni-specific primers (21,22) with another pair of
C. jejuni and C. co/z'-specific primers (26) in the same PCR reaction, allowed
for the simultaneous detection and differentiation of C. jejuni and C. coli (37).
There are also PCR methods that can detect thermophilic C. lari and
C. upsaliensis, in addition to C. jejuni and C. coli (2,29,35,36).
PCR-based methods may not be suitable for processed foods, as amplifica-
tion can be obtained from DNA originating from both viable and nonviable
cells. This problem may be solved by applying a recently developed reverse
transcriptase PCR (RT-PCR) targeting mRNA, which will detect only viable
thermophilic Campylobacters (38).
Theoretically, PCR should be able to detect a single copy of a target gene in
a PCR tube provided enough amplification cycles are used. However,
pathogenic bacteria usually occur in food samples at very low concentrations,
i.e., < 1 cell in 5-10 [iL added in one PCR reaction, and therefore pre-enrich-
ment of the samples is usually necessary. Additionally, because the PCR may
be inhibited by components present in food samples, enrichment media, or
DNA extraction solutions (39), a sample preparation procedure is usually
required before the application of PCR. Several researchers have attempted to
detect Campylobacters directly from foods, either with (2) or without (21 ,22,27)
pre-enrichment. However, the sample preparation procedures used in these
studies involved several steps, such as a two-step PCR (nested PCR) (21,22,27),
and achieved limited sensitivity. We have successfully applied a simple sample
preparation procedure based on buoyant density centrifugation (BDC) (31) for
Table 1
Specificity and Primer Sequences of Campylobacter PCR
Specificity Primer sequence
Target gene Sample type
Reference
N
C. jejuni
C. jejuni
C. jejuni
C. jejuni
C. coli
C. coli
C. jejuni
C. coli
C. jejuni
C. coli
C. jejuni
C. coli
C. lari
C. jejuni
C. coli
C. lari
C. jejuni I
C. colil
C. I aril
C. upsaliensis
C. jejuni I
c. coin
C. I aril
C. upsaliensis
VS15 (5-GAATGAAATTTTAGAATGGGG-3) (L)
VS16 (5'-GATATGTATGATTTTATCCTGC-3) (R)
C-l (5-CAAATAAAGTTAGAGGTAGAATGT) (L) a
C-4 (5-GGATAAGCACTAGCTAGCTGAT) (R) b
HIP400F (5-GAAGAGGGTTTGGGTGGTG-3) (L)
HIP1134R (5'-AGCTAGCTTCGCATAATAACTTG-3*) (R)
(5'-GGATTTCGTATTAACACAAATGGTGC-3')(L)
(5'-CTGTAGTAATCTTAAAACATTTTG-3')(R)
CC18F (5-GGTATGATTTCTACAAAGCGAG-3) (L)
CC519R (5'-ATAAAAGACTATCGTCGCGTG-3) (R)
CSF (5-ATATTTCCAAGCGCTACTCCCC-3) (L)
CSR (5-CAGGCAGTGTGATAGTCATGGG-3') (R)
CCCJ609F (5-AATCTAATGGCTTAACCATTA-3') (L)
CCCJ1442R (5-GTAACTAGTTTAGTATTCCGG-3) (R)
pg50 (5-ATGGGATTTCGTATTAAC-3') (L)
pg3 (5'-GAACTTGAACCGATTTG-3) (R)
CF03 (5'-GCTCAAAGTGGTTCTTATGCNATGG-3) (L)
CF02 (5'-AAGCAAGAAGTGTTCCAAGTTT-3') (R)
CF04 (5'-GCTGCGGAGTTCATTCTAAGACC-3) (R)
C442 (5*-GGAGGATGACACTTTTCGGAGC-3) (L)
C490 (5'-ATTACTGAGATGACTAGCACCCC-3) (R)
GTP 1.1 (5-GCCAAATGTTGGiAARTC) (L) (
GTP 2.1 (ATCAAGCCCTCCiCTRTC) (R) d
GTP 2.2 (ATCiAGiCCTSSiCTRTC) (R)^
B04263 (5'-AGAACACGCGGACCTATATA-3' )
B04264(5'-CGATGCATCCAGGTAATGTAT-3')
Unknown
Pure culture
19,20
Unknown
hip
Directly from
raw/cooked poultry,
vegetables, fruits
Clinical
21,22
23
flaA
Clinical
24
(putative)
Aspartokinase
Unknown
Clinical
Pure culture
23
20
16SrRNA
Clinical
23
flaA
Water
25,26
flaA,flaB
16S rRNA
Directly from
milk, dairy products,
water
Directly from enriched
chicken products
27,28
2
(putative)
GTPase
Pure cultures
29
(putative)
Oxidase
Water, milk
30
a L- left primer (sense); b R- right primer (antisense); c i - inosine; d S, G, or C; R, G, or A.
98 Wang, Ng, and Farber
the PCR detection of less than 0.3 CFU/mL of C. jejuni from naturally
contaminated chicken rinses (<0.1 CFU/g of chicken) (33), and of around 16
CFU/mL inoculated into 2% milk. Another simple sample preparation
technique called immunomagnetic separation (IMS) was used for PCR
detection of thermophilic Campylobacters from spiked poultry and milk
samples (36). In this chapter, we describe a C. jejuni-specific PCR and a
thermophilic campylobacter-specific PCR, combined with BDC and IMS,
respectively, for sample preparation from chicken rinse and milk.
2. Materials and Equipment
2. 1. Primer Sequences
2. 1. 1. For PCR Specific for C. jejuni (4) (see Note 1)
CL2 (5'-TGACGCTAGTGTTGTAGGAG-3') (L)
CR3 (5'-CCATCATCGCTAAGTGCAAC-3) (R)
2. 1.2. For PCR Specific for Thermophilic Campylobacter spp. (35)
6-1 (5'-GTCGAACGATGAAGCTTCTA-3') (L)
18-1 (5'-TTCCTTAGGTACCGTCAGAA-3') (R)
2.2. Buffers and Reagents for PCR
1. PCR buffer (10X stock): 100 mM Tris-HCl, 15 mM MgCl 2 , 500 mM KC1, pH
8.3. Final concentration in mixture is IX (see Note 2).
2. Nucleotide stock: Solution of the sodium salts of dATP, dCTP, dGTP, and dTTP,
each at a concentration of 10 mM in water. Final concentration in reaction mixture
is 0.2 mM.
3. Primers: Can be synthesized in house or by commercial companies (e.g., Sigma-
Genosys, The Woodlands, TX) with cartridge (reverse-phase) or high perfor-
mance liquid chromatography (HPLC) purification. Stock is made in water at a
concentration of 0.1 mM. Final concentration in reaction mixture is 0.1-1.0 \\M.
4. Taq DNA polymerase: 5 U/f^L, available from Roche Diagnostics (Laval, Quebec,
Canada) or other suppliers (e.g., Perkin Elmer).
5. PCR-grade water (see Note 3).
6. DNA molecular marker VIII: From Roche Diagnostics in a concentration of
0.25 |ig/|j,L, or appropriate DNA markers for amplicon sizes around 400 bp.
7. TBE (5X stock): 0.45 M Tris-borate, 0.0 1 M EDTA. For 1 L of solution, add 54 g
Tris base, 27.5 g boric acid, and 3.72 g EDTA into water, pH 8.0. Use 0.5X TBE
to make agarose gel and run electrophoresis (40).
8. Gel-loading buffer: 0.25% Bromophenol blue, 0.25% xylene cyanol FF, and 15%
Ficoll in water (40).
9. Ethidium bromide: Stock solution at 10 mg/mL in water is commercially available
from Cedarlane Laboratories Ltd. (Hornby, Ontario, Canada): add 1 drop (2.5 \xL) to
Detecting Campylobacter jejuni with PCR 99
50 mL of water to make a final concentration of 0.5 |ag/mL. It can also be made from
powder (40). Store stock solutions in a light-tight container (e.g., a bottle completely
wrapped in aluminum foil). Caution: Always wear gloves when handling ethidium
bromide, as it is a powerful mutagen and a possible carcinogen.
2.3. Reagents and Materials for Sample Preparation
2.3. 1. For Buoyant Density Centrifugation (BDC)
1 . Preston broth: The powder for base medium and the supplement are commercially
available from Oxoid (Nepean, Ontario, Canada), and the broth can be made accord-
ing to the instructions on the bottle, or from the formula provided by Bolton and
Robertson (41) for enrichment of Campylobacters from chicken rinses and milk.
2. Standard isotonic medium (SIM): 0.1% Peptone and 0.85% NaCl in Percoll®
(Pharmacia Biotech, Uppsala, Sweden) (31).
3. Peptone water: 0.1 g Peptone in 100 mL water.
4. 40% SIM: Dilute SIM in peptone water.
2.3.2. For Immunomagnetic Separation (IMS)
1. Exeter enrichment broth (13) or modified Rosef broth (42) for enrichment of
Campylobacters from milk or chicken samples (see Note 4).
2. BHI-YE broth: BHI broth containing 1% yeast extract.
3. Biomag Protein G magnetic particles (Metachem Diagnostics, Northampton,
UK) (see Note 5): coated in antibody solution at either 1 x 10 8 or 5 x 10 8
particles/mL (see Subheading 3. for coating) and used at 10 6 particles/mL
sample for bacterial capturing.
4. Polyclonal anti-Campy I obacter antibody (Kirkegaard and Perry Labs, Inc.,
Gaithersburg, MD), diluted at 1:100 in PBS containing 0.5% Bovine Serum
Albumin (BSA) for coating of magnetic particles.
5. PBST: PBS containing 0.5% Tween-20.
6. PCR-grade water.
2.4. Equipment (4,36)
1. Microcentrifuge with speed up to 20,000g.
2. Shaking incubator.
3. Anaerobic jars.
4. Magnetic particle concentrator (Dynal UK, Ltd).
5. Spira-mixer (Denley, UK).
6. Multimixer.
7. Block heater, to heat samples before PCR.
8. PE 9600 or PE 2400 thermal cycler (PE Biosystems, Ltd., Mississauga,
Ontario, Canada), or Progene thermal cycler (Techne, Princeton, NJ) or
100 Wang, Ng, and Farber
other equivalent models made for small and thin-wall PCR tubes (200 \xL).
These models allow for rapid heating, have heated lids, and do not require oil
overlay in the tubes.
9. Water bath: to cool agarose solution and keep it at 60°C before casting gel.
10. Horizontal gel electrophoresis system for agarose gel electrophoresis of PCR
products.
11. Gel Print 2000i (Bio/Can Scientific, Missisauga, Ontario, Canada) or other gel
documentation systems with UV illumination for DNA visualization.
2.5. Disposables
1 . PCR tubes: In size of 200 \xL for PCR, available from DiaMed Lab Supplies Inc.
(Missisauga, Ontario, Canada) or other suppliers.
2. Graduated microcentrifuge tubes, in 1.5 mL sizes for BDC, available from
DiaMed or other suppliers.
3. Microcentrifuge tubes: With screw top, pretreated with PBS, pH 7.4, containing
5% BSA/PBS (pH 7.4) for IMS.
3. Methods
3. 7. Master Mixture Preparation
1. Prepare a master reaction mixture by adding the following reagents to a sterile
test tube as listed in Table 2.
2. Aliquot into 45 f^L/PCR tube, and keep them at -20°C until use.
3.2. Sample Preparation
3.2.1. Cell Lysis from Pure Cultures
1. Suspend bacterial growth from agar plate into PBS buffer or water to make a
cloudy solution (10 7 -10 8 CFU/mL), heat at 105°C for 10 min to release DNA
from bacterial cells (see Notes 6 and 7). It is ready for use after brief cooling
on ice.
2. For bacterial growth in broth, heat directly as above (see Notes 6 and 7).
3. Briefly spin down (2000g) the condensed liquid on the inside wall of the tube.
3.2.2. Whole-Chicken Rinse Preparation and Enrichment for BDC (33)
1 . Rinse the whole fresh chickens in 200 or 500 mL peptone water by shaking in an
automated paint shaker for 1 min.
2. Add 25 mL of chicken rinse in 100 mL of Preston broth in an Erlenmeyer flask
(250 mL) and place in an anaerobic jar.
3. Degas the jar, fill the jar with gas mixture (5% 2 , 10% C0 2 , 85% N 2 ), and
incubate at 37°C for 3-4 h, followed by 42°C for 16-20 h, with shaking at
60-80 rpm.
Detecting Campylobacter jejuni with PCR
Table 2
Preparing Master Reaction Mixture
101
Reagent
Per reaction
100 reactions
Final concentration
dH 2
37.7 fiL
3.8 mL
10X reaction buffer
5 f^L
0.5 mL
IX
dNTPs
1 \iL
100 \iL
0.2 mM
Primer (CL2)
0.5 ^L
50^L
1.0 \jlM
Primer (CR3)
0.5 ^iL
50jxL
1.0 \jlM
Taq polymerase
0.3 ^iL
30fxL
1.5 U/reaction
3.2.3. Milk Spiking and Enrichment for BDC
1. Make C. jejuni dilutions in PBS and inoculate into 25 mL of 2% milk.
2. Add the spiked milk into 100 mL of Preston broth and enrich as above (see Sub-
heading 3.2.2.).
3.2.4. PCR Sample Preparation by BDC from Enriched Chicken
Rinses and Milk (33)
1. Layer 0.9 mL of sample gently over the top of 0.6 mL of 40% SIM in a
microcentrifuge tube and centrifuge at 16,000g for 1 min in a microcentrifuge.
2. Remove supernatant carefully down to 0.1 mL, and resuspend in 1.0 mL of IX
PCR reaction buffer.
3. Centrifuge the suspension at 10,000g for 5 min.
4. Remove supernatant down to a final volume of 10-20 \xL and resuspend the pellet
in this small volume.
5. Heat in a block heater at 105°C for 10 min and cool on ice.
6. Briefly spin down (2000g) the liquid on the inside wall of the tube.
7 Add 5 fiL of cell lysate into 45 \xL of PCR master mix (see preparation in
Subheading 3.1.).
3.2.5. Milk Spiking and Enrichment for IMS (36)
1 . Make 10-fold serial dilutions of C. jejuni culture (from broth or plate) in 2% milk.
2. Add 1 mL of above dilutions to 9 mL of enrichment broth.
3. Incubate microareobically at 37°C for 3-4 h, then at 42°C for 24-48 h.
3.2.6. Chicken Rinse Preparation, Spiking, and Enrichment for IMS (36)
1. Add 9 mL of BHI-YE broth per gram of chicken skin and homogenize in a
stomacher for 3 min.
102 Wang, Ng, and Farber
2. Make 10-fold serial dilutions of C. jejuni culture (from broth or plate) as in
Subheading 3.2.5.
3. Add 1 mL of the foregoing dilutions to 9 mL of enrichment medium.
4. Incubate microareobically at 37°C for 3-4 h, then at 42°C for 24-48 h.
3.2.7. IMS of Campylobacter Cells from Enriched Milk and Chicken
Samples (36)
1. Coat Biomag Protein G magnetic particles with anti-Campy lobacter antibody by
incubating the particles at a concentration of 1 x 10 8 particles per mL of antibody
solution at 4°C for 3 h with gentle rotation on a Spira-mix.
2. Wash the particles twice for 5 min each time with PBST by gentle rotation as
above to remove any unbound antibody. Recover the particles using the magnetic
particle concentrator.
3. Add 10 jo-L of antibody-coated Biomag magnetic particles to 1 mL of enriched
milk or chicken samples and incubate at room temperature for 1 h with gentle
rotation on a multimixer (see Note 8).
4. Recover the bound bacterial cells using the magnetic particle concentrator (MPC).
5. Wash the particles once with PBST, and then once with PCR-grade water.
6. Resuspend the particles in 50 joL of PCR-grade water and lyse the bacteria cells
as above (see Subheadings 3.2.1. and 3.2.4.).
7. Add lysate directly to the PCR master reaction mix and start the PCR program.
3.3. Controls
Each PCR run should include positive and negative controls to ensure that
the PCR assay is working (positive control) and that DNA contamination is not
occurring (negative control). The positive control can be a pure culture of
C. jejuni at 10 7 — 10 8 CFU/mL in PBS. The negative control can be a negative
chicken rinse that has gone through all the enrichment, sample preparation,
and other steps the same way as the real samples.
3.4. PCR Cycle Programs
3.4. 1. C. jejuni Specific
Start the PCR by denaturation for 10 min at 95 °C, followed by 25 cycles of
denaturation at 95°C for 15 s, annealing at 48°C for 15 s, and extension at 72°C
for 30 s. Allow a final 10 min at 72°C for the completion of primer extension
after the last cycle. Hold the PCR products at 4°C or store at -20°C until the
amplicon is ready to be analyzed by electrophoresis.
3.4.2. Thermophilic Campylobacter Specific
Start the PCR by denaturation for 2-10 min at 94°C, then followed by 35
cycles of 94°C for 1 min, 65°C for 1 min, and 75°C for 0.5 min. Hold the PCR
products at 4°C or store at -20°C until ready to be analyzed by electrophoresis.
Detecting Campylobacter jejuni with PCR 103
3.5. Agarose Gel Electrophoresis
1. Prepare 1.5% agarose gel by adding 0.75 g agarose (Sigma) into 50 mL of 0.5X
TBE and 5 mL water (to make up the volume lost during microwaving), and
microwave for 2-3 min or until the agarose particles dissolve completely. Cool
the solution to 60°C in a water bath before casting the gel.
2. Mix 10 |^L of PCR product with 2 f^L of gel-loading buffer and load in well
carefully. Add 5 f^L of molecular weight marker III mixed with 1 [aL gel-loading
buffer to the first well.
3. Electrophorese at 10 V/cm for 1-1.5 h.
4. Stain the gel in 0.5 ^ig/mL of ethidium bromide for 30 min (see Note 9).
5. Destain the gel in water for 20 min to remove the ethidium bromide background
in agarose.
6. View and photograph the gel under UV light.
7. Determine the amplicon sizes based on molecular size marker.
3.6. Expected Sizes of Ampl icons
The C. jejuni- specific PCR should produce a single band of 402 bp for C. jejuni,
whereas the PCR specific for thermophilic Campylobacters will produce a single
band of 409 bp for C. jejuni, C. coli, C. lari, and some strains of C. upsaliensis. The
positive control should show the expected size(s), and the negative control should
not have any bands.
4. Notes
1 . Our primers cannot distinguish subspecies of C. jejuni (4).
2. The MgCl 2 concentration affects the specificity of PCR; gelatin or BS A or other
chemicals may be incorporated into the PCR mix to enhance PCR sensitivity. For
the thermophilic Campy lobacter-specific PCR, the MgCl 2 concentration in the
10X stock is 3.5 mM, and 0.1% gelatin is included in the 10X PCR buffer.
3. The impurities in some water supplies may affect PCR performance. In our lab,
we use autoclaved double-distilled water for PCR. Reverse osmosis purified
water can also be used for PCR (36).
4. Desirable features of an enrichment broth for use in IMS include (a) high
selectivity for Campylobacter, (b) capability of resuscitating injured Campy-
lobacter cells, and (c) noninterference with bacterial binding to the beads. Because
the components of Preston broth are very similar to that of Exeter broth, either
one could be used for the IMS or BDC method.
5. Because the magnetic beads (especially the antibody-coated ones) are very
expensive, the IMS procedure may not be cost effective (also see Note 8).
6. When performing PCR from isolated colonies, bacterial growth (not too heavy) can
also be picked up with the sharp end of a toothpick and added directly into the PCR
mix. Because too much DNA may deplete primers and thus affect the amplification,
104 Wang, Ng, and Farber
overloading with cells should be avoided. Sometimes, PCR inhibitors present in foods
or selective enrichment media may lead to false-negative reactions. Diluting such
samples may yield positive results.
7. Mohran and coworkers (43) found that some of the C. jejuni and C. coli strains that
they isolated in Egypt were resistant to boiling and did not release PCR-detectable
DNA. If this happens in your system, alternative DNA extraction methods should
be sought.
8. Sometimes, it is necessary to centrifuge the enriched samples before the addition
of magnetic beads to eliminate the inhibitors to immunobinding. This again adds
more steps and costs to the IMS method.
9. Ethidium bromide can be added to the agarose solution before casting, and therefore
staining would not be needed after electrophoresis (40).
References
1 . Altekruse, S. F., Stern, N. J., Fields, P. I., and Swerdlow, D. L. (1999) Campylobacter
jejuni — an emerging foodborne pathogen. Emerg. Infect. Dis. 5 (1), 28-35.
2. Giesendorf, B. A. J., Quint, W. G. V., Henkens, M. H. C, et al. (1992) Rapid and
sensitive detection of Campylobacter spp. in chicken products by using the polymerase
chain reaction. Appl. Environ. Microbiol. 58, 3804-3808.
3. Roels, T. H., Wickus, B., Bostrom, H. H., et al. (1998) A foodborne outbreak of
Campylobacter jejuni (0:33) infection associated with tuna salad: a rare strain in
an unusual vehicle. Epidemiol. Infect. 121, 281-287.
4. Ng, L.-K., Kingombe, C. I. B., Yan, W., et al. (1997) Specific detection and con-
firmation of Campylobacter jejuni by DNA hybridization and PCR. Appl.
Environ. Microbiol. 63, 4558-4563.
5. Van Doom, L.-J.,Verschuuren-van Haperen, A., van Belkum, A., et al. (1998) Rapid
identification of diverse Campylobacter lari strains isolated from mussels and oysters
using a reverse hybridization line probe assay. /. Appl. Microbiol. 84, 545-550.
6. Tauxe, R. V. (1992) Epidemiology of Campylobacter jejuni infections in the
United States and other industrialized nations, in Campylobacter jejuni: Current
Status and Future Trends (Nachamkin, I., Blaser, M.J., and Tompkins, L.S., eds.),
American Society for Microbiology, Washington, DC, pp. 9-19.
7. Tauxe, R. V., Hargrett-Bean, N., Patton, C. M., and Wachsmuth, I. K. (1988)
Campylobacter isolates in The United States, 1982-1986. M.M.W.R., CDC Surveil-
lance, 37 (No. SS-2), 1-13.
8. On, S. L. W. and Holmes, B. (1992) Assessment of enzyme detection tests useful
in identification of campylobacteria. /. Clin. Microbiol. 30, 746-749.
9. Penner, J. L. (1988) The genus Campylobacter: a decade of progress. Clin.
Microbiol. Rev. 1, 157-172.
10. Sanders, G. (1998) Isolation of Campylobacter from food, in Compendium of
Analytical Methods (Warburton, D., ed.), vol 3. HPB laboratory procedure MFLP-
46. Polyscience Publications, Laval, Quebec, Canada.
11. On, S. L. W. and Holmes, B. (1991) Effect of inoculum size on the phenotypic
characterization of Campylobacter species. /. Clin. Microbiol. 29, 923-926.
Detecting Campylobacter jejuni with PCR 105
12. Beumer, R. R., de Vries, J., and Rombouts, F. M. (1992) Campylobacter jejuni
non-culturable coccoid cells. Int. J. Food Microbiol. 15, 153-163.
13. Humphrey, T.J. (1986) Techniques for the optimum recovery of cold injured
Campylobacter jejuni from milk or water. /. Appl. Bacteriol. 61, 125-132.
14. Medema, G. J., Schets, F. M., van de Giessen, A. W., and Havelaar, A.H. (1992)
Lack of colonization of 1 day old chicks by viable, non-culturable Campylobacter
jejuni. J. Appl. Bact. 72, 512-516.
15. Rollins, D. M. and Colwell, R. R. (1986) Viable but nonculturable stage of
Campy lobe ter jejuni and its role in survival in the natural aquatic environment.
Appl. Environ. Microbiol. 52, 531-538.
16. Rahn, K., De Grandis, S. A., Clarke, R. C, et al. (1992) Amplification of an invA
gene sequence of Salmonella typhimurium by polymerase chain reaction as a
specific method of detection of Salmonella. Mol. Cell. Probes 6, 271-279.
17. Border, P. M., Howard, J. J., Plastow, G. S., and Siggens, K. W. (1990) Detection
of Listeria species and Listeria monocytogenes using polymerase chain reaction.
Lett. Appl. Microbiol. 11, 158-162.
18. Pollard, D. R., Johnson, M. W., Lior, H., et al. (1990) Differentiation of Shiga
toxin and verocytotoxin type I genes by the polymerase chain reation. /. Infect.
Dis. 162, 1195-1198.
19. Stonnet, V. and Guesdon, J.-L. (1993) Campylobacter jejuni', specific oligonucle-
otides and DNA probes for use in polymerase chain reaction-based diagnosis.
FEMS Immunol. Med. Microbiol. 7, 337-344.
20. Stonnet, V., Sicinschi, L., Megraud, F., and Guesdon, J. L. (1995) Rapid detection of
Campylobacter jejuni and Campylobacter coli isolated from clinical specimens using
the polymerase chain reaction. Eur. J. Clin. Microbiol. Infect. Dis. 14, 355-359.
21. Winters, D. K. and Slavik, M. F. (1995) Evaluation of a PCR based assay for specific
detection of Campylobacter jejuni in chicken washes. Mol. Cell. Probes 9, 307-310.
22. Winters, D. K., O'Leary, A. E., and Slavik, M. F. (1998) Polymerase chain
reaction for rapid detection of Campylobacter jejuni in artificially contaminated
foods. Lett. Appl. Microbiol. 27, 163-167.
23. Linton, D., Lawson, A. J., Owen, R. J., and Stanley J. (1997) PCR detection, identifi-
cation to species level, and fingerprinting of Campylobacter jejuni and Campylobacter
coli direct from diarrheic samples. /. Clin. Microbiol. 35, 2568-2572.
24. Nachamkin, I., Bohachick, K., and Patton, C. M. (1993) Flagellin gene typing of
Campylobacter jejuni by restriction fragment length polymorphism analysis. /.
Clin. Microbiol. 31, 1531-1536.
25. Oyofo, B. A. and Rollins, D. M. (1993) Efficacy of filter types for detecting
Campylobacter jejuni and Campylobacter coli in environmental water samples by
polymerase chain reaction. Appl. Environ. Microbiol. 59, 4090-4095.
26. Oyofo, B. A., Thornton, S. A., Burr, D. H., et al. (1992) Specific detection of
Campylobacter jejuni and Campylobacter coli by using polymerase chain
reaction. /. Clin. Microbiol. 30, 2613-2619.
27. Wegmiiller, B., Llithy, J., and Candrian, U. (1993) Direct polymerase chain
reaction of Campylobacter jejuni and Campylobacter coli in raw milk and dairy
products. Appl. Environ. Microbiol. 59, 2161-2165.
106 Wang, Ng, and Farber
28. Kirk, R. and Rowe, M. T. (1994) A PCR assay for the detection of Campylobacter
jejuni and Campylobacter coli in water. Lett. Appl. Microbiol. 19, 301-303.
29. Van Doom, L.-J., Giesendorf, B. A. J., Bax, R., et al. (1997) Molecular discrimi-
nation between Campylobacter jejuni, Campylobacter coli, Campylobacter lari
and Campylobacter upsaliensis by polymerase chain reaction based on a novel
putative GTPase gene. Mol. Cell. Probes 11, 177-185.
30. Jackson, C. J., Fox, A. J., and Jones, D. M. (1996) A novel polymerase chain
reaction assay for the detection and speciation of thermophilic Campylobacter
spp. /. Appl. Bacteriol. 81, 467-473.
3 1 . Lindqvist, R. (1997) Preparation of PCR samples from food by a rapid and simple
centrifugation technique evaluated by detection of Escherichia coliOl51:Hl. Int.
J. Food Microbiol. 37, 73-82.
32. Wang, H., Blais, B. W., and Yamazaki, H. (1995) Rapid confirmation of polymyxin-
cloth enzyme immunoassay for group D salmonellae including Salmonella enteriti-
dis in eggs by polymerase chain reaction. Food Control 6, 205-209.
33. Wang, H., Farber, J. M., Malik, N., and Sanders, G. (1999) Improved PCR detec-
tion of Campylobacter jejuni from chicken rinses by a simple sample preparation
procedure. Int. J. Food Microbiol. 52, 39-45.
34. Wernars, K., Heuvelman, C. J., Chakraborty, T., and Notermans, S. H. W. (1991)
Use of the polymerase chain reaction for direct detection of Listeria
monocytogenes in soft cheese. /. Appl. Bacteriol. 70, 121-126.
35. Van Camp, G., Fierens, H., Vandamme, P., et al. (1993) Identification of entero-
pathogenic Campylobacter species by oligonucleotide probes and polymerase
chain reaction based on 16s rRNA genes. Syst. Appl. Microbiol. 16, 30-36.
36. Docherty, L., Adams, M. R., Patel, P., and McFadden, J. (1996) The magnetic
immuno-polymerase chain reaction assay for the detection of Campylobacter in
milk and poultry. Lett. Appl. Microbiol. 22, 288-292.
37. Harmon, K. M., Ransom, G. M., and Wesley, I. V. (1997) Differentiation of
Campylobacter jejuni and Campylobacter coli by polymerase chain reaction. Mol.
Cell. Probes 11, 195-200.
38. Sails, A. D., Bolton, F. J., Fox, A. J., et al. (1998) A reverse transcriptase poly-
merase chain reaction assay for the detection of thermophilic Campylobacter spp.
Mol. Cell. Probes 12, 317-322.
39. Rossen, L., Norskov, P., Holmstrom, K. and Rasmussen, O. F. (1992) Inhibition
of PCR by components of food samples, microbial diagnostic assays and DNA-
extraction solutions. Int. J. Food Microbiol. 17, 37-45.
40. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning, A Laboratoiy
Manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, pp. 6. 15.
41. Bolton, F. J. and Robertson, L. (1982) A selective medium for isolating
Campylobacter jejuni/ 'coli. J. Clin. Pathol. 35, 462-467.
42. Lammerding, A. M., Garcia, M. M., Mann, E. D., et al. (1988) Prevalence of
Salmonella and thermophilic Campylobacter in fresh pork, beef, veal and poultry
in Canada. /. Food Proteins 51, 47-52.
43. Mohran, Z. S., Arthur, R. R., Oyofo, B. A., et al. (1998) Differentiation of
Campylobacter isolates on the basis of sensitivity to boiling in water as measured
by PCR-detectable DNA. Appl. Environ. Microbiol. 64, 363-365.
12
Magnetic Capture Hybridization Polymerase Chain
Reaction
Jinru Chen and Mansel W. Griffiths
1. Introduction
Polymerase chain reaction (PCR) is a novel DNA amplification technique
that has brought fundamental change to clinical diagnosis and rapid detection
of food-borne pathogens. The technique needs little technical time and has a
quick turnover. The results of PCR are accurate, sensitive, and specific.
However, the application of PCR for the detection of pathogens directly from
food is limited because natural food components often affect the activity of
Taq DNA polymerase, the enzyme catalyzing DNA amplification.
Magnetic capture hybridization polymerase chain reaction (MCH-PCR) uses
a capture probe to separate DNA template from food by DNA hybridization
and biotin-streptavidin based magnetic separation. Captured-template DNA is
used subsequently in PCR amplification. MCH-PCR was initially used to
overcome the inhibitory effect of humic acid present in soil samples during
PCR amplification (1). Chen and colleagues (2) adapted the technique for the
detection of verotoxigenic Escherichia coli (VTEC) from ground beef. The
technique has also been applied to the detection of Bacillus cereus and Bacil-
lus thuringiensis in soil samples (Damgaard and co-workers [3] ); Mycobacte-
rium paratuberculosis and Mycobacterium avium subsp. silvaticum in tissue
and fecal samples (4); and Staphylococcus spp. from clinical samples (5).
In MCH-PCR, bacterial cells are lysed by heat treatment. Template DNA present
in the supernatant of lysed bacterial suspension is separated from cell debris by
centrifugation, and captured by a DNA probe that is internal to the PCR product to
be amplified and has a biotin label on the 5' end. After hybridization, the DNA
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
107
108 Chen and Griffiths
hybrid of capture probe and template is isolated through chemical binding between
biotin on the hybrid and streptavidin on paramagnetic particles. The hybrid on
paramagnetic particles can be used directly in subsequent PCR amplification.
2. Materials and Equipment
2.1. Equipment
1. Hotplate.
2. Bench-top centrifuge.
3. Hybridization oven.
4. Magnetic separator.
5. Rotator.
6. DNA thermal cycler.
7. DNA gel electrophoresis apparatus.
8. Gel document system.
2.2. Reagents and Buffers
1. Sterile dH 2 0.
2. Streptavidin-coated paramagnetic particles (see Note 1).
10 mg/mL
3. Binding buffer.
a. lOmMTris-HCl
b. 1 mM EDTA
c. lOOmMNaCl
d. pH8.0
4. Hybridization buffer.
a. 50% (vol/vol) formamide
b. 5% standard saline citrate (SSC)
c. 2% (w/v) blocking agent
d. 0.1% (w/v) N-lauroylsarcosine
e. 0.02% (w/v) sodium dodecyl sulfate (SDS)
5. PCR reagents.
a. PCR reaction buffer (5%)
b. dNTP(lOmM)
c. Taq DNA polymerase (1 U/pA)
d. Oligonucletide primers (0.1 \ig/\iA)
6. TBE buffer.
a. 0.089 MTris-base
b. 0.089 M boric acid
c. 0.002MEDTA
d pH8.0
7. Ethidium bromide.
10 mg/mL
Magnetic Capture Hybridization 109
3. Procedures
3. 1. Synthesis of Capture Probe
A capture probe should be designed based on the internal sequence of MCH-
PCR product to be amplified. It can be synthesized in conventional PCR by the use
of biotin-labeled oligonucleotide primers. Consequently, biotin labels are located
on the 5' end after the probe is made. If a shorter probe is desired, a synthesized
oligonuceotide with a biotin label can be used directly as a capture probe.
Synthesized probe can be stored at refrigeration temperature for future use.
3.2. Preparation of DNA Template
Tested bacteria are grown in brain-heart infusion (BHI) agar at 37°C. Overnight
cultures are transferred into BHI broth and incubated at 37°C for about 6 h. If food
samples are tested, enrichment is sometimes required depending on initial load of
tested pathogen in a sample. One milliliter of enriched broth or liquid bacterial
culture is centrifuged at 12,000g for 2 min using a benchtop centrifuge. Bacterial
pellets are washed twice with 1 mL of sterile dH 2 and resuspended subsequently
in 100 [iL of dH 2 0. The bacterial suspensions are heated in a water bath for 10 min.
After heat treatment, the cultures are placed on ice immediately to prevent DNA
from annealing. Heat-treated cells are centrifuged at 12,000g for 2 min. Superna-
tants were taken and used in the hybridization assay.
3.3. Hybridization
Biotin-labeled DNA probe is heated at 100°C for 10 min and cooled down
rapidly on ice (see Note 1). Denatured probe is mixed with single-stranded DNA
template and hybridization buffer (300 ^iL). Hybridization is carried out at 42°C
for 4-16 h with rotating in a hybridization oven.
3.4. Magnetic Capture
Streptavidin-coated paramagnetic particles (30 [ig per sample) are taken
from storage and washed three times with, and subsequently resuspended in,
binding buffer (see Note 2). Washed paramagnetic particles are then added to
hybridization mix and incubated at room temperature for about 1 h on a rotator.
The particles are collected at the end of the incubation and washed three times
with sterile H 2 and used directly in PCR amplification. A magnetic separator
is used to collect paramagnetic particles between washing.
3.5. PCR Amplification
Fifty microliters of PCR mix contains the following.
1. X |^L of template DNA on paramagnetic particles.
2. 5 mL of buffer (10%).
3. 5 fiLofdNTP(lOmM).
110 Chen and Griffiths
4. 1 fiL of each of the two primers (0.1 |a,g/|iL).
5. 0.4 \xL of Taq DNA polymerase (1 U/fiL).
The total volume of the mix is adjusted to 50 \\L using dH 2 0.
The amplification conditions include one cycle at 94°C for 5 min, 58°C for
1 min and 72°C for 6 min, followed by 30-50 cycles of 94°C for 2 min, 60°C
for 1 min, and 72°C for 1 min. The amplification is followed by a holding
period at 72°C for 10 min.
Amplified products are analyzed using DNA electrophoresis. Alternatively,
the method can be automated by using an alkaline phosphatase-labeled DNA
probe and detecting hybridization by flow injection with a chemiluminescent
substrate (2). In this way the detection cycle was less than 30 min and the
sensitivity was at the femtomole level.
4. Notes
1 . Depending on individual pathogen, the ratio of DNA template and capture probe
in hybridization needs to be adjusted. Magnetic particles collected from hybrid-
ization mix should be washed properly with dH 2 to remove the residue of
hybridization buffer.
2. Commercial paramagnetic particles contain preservatives. Therefore, proper
washing is needed before use. The amount of paramagnetic particles used in PCR
amplification is critical. An excessive amount of particles present in PCR mix
during MCH-PCR could lead to the failure of DNA amplification.
References
1. Jacobsen,C. S. (1995) Microscale detection of specific bacterial DNA in soil with
magnetic capture — hybridization and PCR amplification assay. Appl. Environ.
Microbiol. 61, 3347-3352.
2. Chen, J., Johnson, R., and Griffiths, M. W. (1998) Detection of verotoxigenc
Escherichia coli by magnetic capture hybridization PCR. Appl. Environ.
Microbiol. 1, 147-152.
3. Damgaard, P. H., Jacobsen, C. S., and Sorenson, J. (1996) Development and
application of a primer set for specific detection of Bacillus thuringiensis and
Bacillus cereus in soil using magnetic capture hybridization and PCR amplifica-
tion. Syst. Appl. Microbiol. 19, 436^41.
4. Millar, D. S., Withey, S. J., Tizad, M. L. V., et al. (1995) Solid-phase hybridiza-
tion capture of low-abundance target DNA sequences: Application to the poly-
merase chain reaction detection of Mycobacterium paratuberculosis and
Mycobacterium avium subsp. silvaticum. Anal. Biochem. 226, 325-330.
5. Kolbert, C. P., Connolly, J. E., Lee, M. J., and Persing, D. H. (1995) Detection of
the Staphylococcal mecA gene by chemiluminescent DNA hybridization. /. Clin.
Microbiol. 33, 2179-2182.
6. Chen, X., Zhang, X. E., Chai,Y. Q., et al. (1998) DNA optical sensor: A rapid
method for the detection of DNA hybridization. Biosens. Bioelect. 13, 451-458.
13
Enterococci
Anavella Gaitan Herrera
1. Introduction
Lancefield's group D is composed of Streptococcus equinus, S. faecalis,
S. bovis, and S.faecium. S. avium (Q and D antigens). Group D is found in the
intestinal tract of warm-blooded animals. The term "enterococcus" refers only
to the species S. faecalis and S.faecium. The medium employed for enumera-
tion of coliforms in foods is KF agar.
2. Materials
2. 1. Presumptive Test
1. Glass Petri dishes.
2. 1 mL Bacteriological pipets.
3. Incubator at 35-37°C.
4. KF streptococcus agar.
5. 3% Hydrogen peroxide.
2.2. Confirmation Test
1. Brain-heart infusion broth and BHI with added 6.0% sodium chloride.
2. Hydrogen peroxide, 3% aqueous solution.
3. Methods
3. 1. Presumptive Test
1. Prepare samples by methods described in previous chapters.
2. To Petri dishes pipet 1 mL of each dilution of the food.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
m
1 12 Herrera
3. Add to each dish 15 mL of KF agar tempered at 45°C.
4. Mix the dishes by rotating and incubate at 35-37°C for 48-72 h.
5. Count all colonies on the KF agar deep red and light pink (5 .faecalis-S '. faecium)
on the plates containing 30-300 colonies and multiply by the dilution factor.
6. Compute the number of presumptive enterococci per gram of food.
3.2. Confirmation Test
1. Select 5-10 light pink colonies from KF plates, pick individually into tubes of
BHI, incubate at 35-37°C for 18-24 h, until turbidity appears.
2. Observe for typical Gram-positive oval cocci in short chains or pairs.
3. Mix 3 mL of each culture in another tube with about 0.5 mL of 3% hydrogen
peroxide. Failure of bubbles to appear indicates mixture is catalase negative.
Confirms that the culture is a Streptococcus.
4. Inoculate one tube each of BHI with the confirmed Streptococcus isolates.
Incubate at 44-46°C for 48 h. Look for growth.
5. Inoculate one tube each of BHI containing 6.5% NaCl with the confirmed Strep-
tococcus isolates, incubate at 35-37°C for 72 h and look for growth.
6. Catalase negative Streptococcus that grows at 44-46°C and in the BHI plus 6.5%
NaCl confirms that the culture is an enterococcus.
7. To identify the species, the cultures belonging to serological group D can be
obtained by testing with specific serum.
References
1 . Speck, M. L. ( 1 984) Compendium of Methods for the Microbiological Examination
of Foods, 2nd ed. Compiled by the APHA Technical Commitee on Microbiological
Methods for Foods, American Public Health Association, Washington, DC.
2. Elliot, R. P., Clark, D. S., et al. (1978) Microorganisms in Foods 1 . Significance
and Methods of Enumeration. 2nd ed. A publication of the International Comission
on Microbiological Specifications for Foods (ICMSF) of the International
Association of Microbiological Societies, University of Toronto Press, Canada.
14
Salmonella
Anavella Gaitan Herrera
1. Introduction
Salmonellosis is one of the most common, if not the most common infec-
tious diseases transmitted by contaminated poultry foods (1,2). A critical goal
in food processing plants and governmental control agencies is to prevent Sal-
monella contamination of food products and this prevention depends to a great
exent on an adequate quality control program. Salmonella detection is still
highly dependent on employing appropriate culture media. The cells may be
stressed during processing of the food. Standard bodies and media they specify
for Salmonella detection are named in Table 1 (3,4).
2. Methods
2. 1. Resuscitation and Preenrichment
Salmonella occurring in dried, processed foods are usually present in low
numbers and in injured cells are frequently accompanied by competing
organisms that are present in numbers thousands of times greater. Satisfactory
resuscitation and preenrichment generally requires a nutritious nonselective
medium. Buffered peptone water and lactose broth are commonly used, but other
nutrient media such as tryptone soya and nutrient broths may also be used (5).
The isolation procedure should provide the following: nutrients for multiplica-
tion to favor the ratio of Salmonella to non-Salmonella microoranisms, repair of
cell damage, rehydratation, and dilution of toxic or inhibitory substances (2,4).
2.2. Selective Enrichment
Selective enrichment broths are employed for the purpose of increasing the
Salmonella population while at the same time inhibiting multiplication of other
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
113
114
Herrera
Table 1
Regulatory Agencies That Specify Detection Procedures for Salmonella
and the Culture Media to Be Used
Agency
Culture media
Pre-enrichment
Enrichment
Plating
ISO
APHA
AOAC/FDA
IDF
BSI
Buffered peptone water
Lactose broth
Lactose broth, tryptone
soya broth, nutrient broth
Buffered peptone water,
distilled water plus,
brillant green 0.002%
Buffered peptone water
Rappaport-Vassiladis
(RV) broth
Selenite cysteine broth
Selenite cysteine broth,
tetrathionate broth
(USP)
Selenite cysteine broth,
tetrathionate broth
(USP)
Muller-Kauffman
tetrathionate broth,
Selenite cysteine broth
Rappaport-Vassiliadis
(RV) broth,
selenite cysteine broth
Brillant green agar
SS agar, bismuth
sulphite agar,
Hektoen agar
Brillant green agar,
Hektoen agar,
XLD agar,
bismuth sulphite
agar
Brillant green agar
Bismuth sulphite
agar
Brillant green agar,
any other solid
selective medium
organisms in the food sample. A variety of inhibitors is in use, the most widely
used of which are bile, tetrathionate, sodium selenite, and either brillant green
or malachite green dyes. Additionally, media may be supplemented with anti-
biotics, commonly novobiocin. Activity of inhibitory agents may be futher
enhanced by incubation of the enrichment culture at higher temperatures,
usually between 41 and 43°C.
2.3. Selective Plating Media
These are formulated so that Salmonella may appear in the form of discrete
colonies, whereas the growth of competing non-Salmonella microorganisms is
suppressed. Non-Salmonella colonies are generaly distinguished by their ability
to produce hydrogen sulfide, and to utilize one or more carbohydrates incorpo-
rated in the media. Selective media that have been used for the isolation of
Salmonella include brillant green (BG), bismuth sulfite (BS), Salmonella
shigella, MacConkey's, desoxycholate citrate, Hektoen enteric (HE), xylose
lysine desoxycholate (XLD), and xylose lysine brillant green.
Salmonella 115
PRE-ENRICHMENT
Sample 25 g + pre-enrichment medium, 225 mL
16-20 h, 37°C I
SELECTIVE ENRICMENT
Culture, 10 mL + Culture, 10 mL +
Tetrathionate broth, 100 mL Selenite cysteine broth, 100 mL
18-24 h,45°C 18-24 h,37°C
(2 periods of) (2 periods of)
SELECTIVE DIAGNOSTIC ISOLATION
Plate in bismuth sulphite agar plus brilliant green/phenol red agar
(or xilose lysine desoxycholate agar or Hektoen enteric agar
20-24 h, 37°C I
(40-48 h, if necessary) -A
Pick five colonies from each agar plate and inoculate on nutrient agar
18-24 h, 37°C I
BIOCHEMICAL CONFIRMATION
24 H, 37°C
I
SEROLOGICAL CONFIRMATION
Side agglutinations - O, Vi, H antisera
Fig. 1. Isolation procedure.
2.4. Differential Media
Differential media are ussually tubed. The more commonly used differential
agar are triple sugar iron (TSI) agar (production of hydrogen sulfide and
utilization of glucose, lactose, and sucrose) and lysine iron (LI) agar (produc-
tion of hydrogen sulfide and decarboxlilation of lysine).
2.5. Confirmatory Serological Tests
The genus Salmonella is characterized serologically by especific antigenic
components. The antigens are divided into somatic (O), flagelLar (H), and capsu-
lar (K). A tube of the antigen antiserum mixture is incubated for 1 h in a 50°C water
bath and the culture usually is tested with a polyvalent flagellar (H) antiserum.
Isolation procedures as typified by B SI/ISO and FDA/AOAC BAM are
shown in Figs. 1 and 2.
3. Notes
1. Selenite broth base (lactose): discard the prepared medium if large amounts of
reduced selenite can be seen as a red precipitate in the bottom of the bottles.
1 1 6 Herrera
PRE-ENRICHMENT
Test sample 25 g + pre - enrichment medium, 225 mL
24+-2 h, 35°C I
SELECTIVE ENRICHMENT
Culture, 1 mL+ Culture, 1 mL +
Tetrathionate broth, 10 mL Selenite cysteine broth, 10 mL
24-K2 h, 35°C
SELECTIVE DIAGNOSTIC ISOLATION
Plate on bismuth sulphite agar,
xylose lysine desoxycholate agar,
Hextoen enteric agar
24+-2h, 35°C
(48 h, if necessary)
i
BIOCHEMICAL CONFIRMATION
Pick two or more suspect colonies from each agar plate for biochemical tests
24-96 h, 35°C
I
SEROLOGICAL CONFIRMATION
Slide and tube agglutinations - O, H antigens
Fig. 2. Isolation procedure.
2. Do not incubate longer than 24 h because the inhibitory effect of selenite is
reduced after 6-12 h incubation. Mannitol fermentation by Salmonella helps
correct the alkaline pH swing, which can occur during incubation.
3. Take subcultures from the upper third of the broth column, which should be at
least 5 cm deep.
4. Occasionally Salmonella cultures showing atypical biochemical results (H 2 S
negative, lactose positive, or dulcitol-negative reactions) may be isolated. It
should be realized that the classification of an isolate as Salmonella depends ulti-
mately on the antigenic structure of the organism, and not unqualifiedly on its
biochemical characteristics.
5. Some foods contain microbial inhibitors that may affect the efficiency of the
analytical method.
6. Culture media and reagents, including antisera, should be subjected to quality
control procedures.
Salmonella 1 1 7
References
1. Post, D. E. (1997) Food-borne pathogens, in Monograph Number I: Salmonella.
Oxoid Setting Standards.
2. Unipath Ltd. (1990) The Oxoid Manual, 6th ed., Basingstoke, UK.
3. American Public Health Association (1976) Compendium of Methods for the
Microbiological Examination of Foods, APHA Inc., Washingon, DC.
4. Association of Official Analytical Chemists (1989) F.D.A. Bacteriological
Analytical Manual, 6th ed. AOAC, Arlington, VA.
5. American Public Health Association (1980) Standard Methods for the Examina-
tion of Water and Wastewater, 15th ed. APHA Inc., Washington, DC.
15
Campylobacter
Anavella Gaitan Herrera
1. Introduction
The association of infection with consumption of contaminated water and
foods, particularly poultry, is clearly established (1). Campylobacter food
poisoning outbreaks occur either sporadically, affecting individuals and small
groups suchs as families, or larger community outbreaks. Campylobacter jejuni
commonly occurs in undercooked chicken (2). Cross-contamination from raw
poultry to foods that are not cooked before eating is also a cause. Campylobacter
spp. are readily destroyed by temperatures used in Pasteurization and cooking
(3,4)> They may survive for several weeks in a moist environment but quickly
die in dry conditions, particularly at room temperature. Acidic conditions rapidly
destroy them and they show no unusual resistance to disinfectants. Table 1 pre-
sents characteristicsof catalase-positive Campylobacters.
2. Materials
1. Campylobacter enrichment broths: Hunt and Radle enrichment broth (BAM).
2. Campylobacter plating media: Campylobacter agar (CAT) and Campy-Cefex agar.
3. Antibiotic supplement Amphotericin B 10 mg/L, cefoperazone 8 mg/L,
teicoplanin 4 mg/L, vancomycin lOmg/L, trimethopim lactate 12.5 mg/L, sodium
cefoperazone 33 mg/L (15 mg/L) and cycloheximide 200 mg/L.
4. Campylobacter growth supplement (FBP) sodium pyruvate 0.125 g, sodium
metabisulfite 0.125 g, ferrous sulfate (hydrated salt) 0.125 g. Aseptically add
2 mL of sterile distilled water and add to 500 mL of culture medium.
5. Jar with Campylobacter gas-generating kits.
6. CampyGen creates a suitable atmosphere for growth of Campylobacter spp. by
decreasing the carbon dioxide content in the air.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
119
120 Herrera
Table 1
Characteristics of Catalase-Positive Campylobacters
Catalase-positive Campylobacter
C. jejuni
C. coli
C. fetus
C. fetus ss. venerealis
Oxidase
+
+
+
+
Ferment sugars
—
—
—
—
N0 3 reduction
+
+
+
+
N0 2 reduction
—
—
—
—
H 2 S (SIM)
—
—
—
—
H 2 s (Strip)
+
+
+
(V)
Hippurate hydrolysis
+
—
—
—
1% glycine
+
+
+
—
T
3.5% NaCl
—
—
—
—
25 °C
—
—
+
+
L
30.5°C
-(Vr)
+
+
+
E
37°C
+
+
+
+
R
42°C
+
+
-(V)
-(V)
A
Aerobic (plate)
—
—
—
—
N
5% 2 (plate)
+
+
+
+
C
Nalidixic acid a
S
S
R
R
E
Cephalotin^
R
R
S
S
Falta TTC r
S(V)
R(V)
S
S
Vr = results are variable;+ = positive; - = negative; S = sensible; R = resistant.
*High concentration nalidixic acid sensitivity disc (30 \ig). Any zone of inhibition on agar
plates is regarded as a positive or a sensitive strain.
^High concentration cephalothin sensitivity disc (30 u,g).
C TTC = 2,3,5-triphenyltetrazolium chloride. More than 6 mm zone of inhibition is regarded as
a positive or sensitive strain.
3. Methods
Cells of C. jejuni are sensitive to air and they usually survive for only 1-2 d
in solids, 2-4 d in liquids, and 10-20 d in semisolid media at room tempera-
ture. Their survival twofold when held under refrigeration al 4°C (see Note 1).
3.7. Campylobacter Enrichment Broths
A large size is desirable for isolation, to obtain a cell concentrate from
relatively large (1-2 kg) samples of poultry products, a rinse technique may be
used. However, the taking of swabs is recommended for sampling carcases of
large animals. When a large sample is not available, pieces of food (10-25 g)
can be added directly to an enrichment broth without the preparation of a cell
concentrate. In this case, the sample may be blended at low speed (see Note 2).
Campylobacter 121
1. Surface rinse technique: Rinse the surface of the sample (1-2 kg) by shaking
or massaging it with 250 mL of nutrient broth (without agar) in a sterile plastic
bag. Filter the washing through two layers of cheesecloth. Centrifuge the filtrate
at 16,000g for 20 min at 4°C. Discard the supernatant fluid and suspend the pellet
in a minimum (2-5 mL) volume of an enrichment broth.
2. Swab-sampling technique: Dip a sterile swab into an enrichment broth and
press the swab against the container wall to remove excess moisture. When swab
samples are to be transported, use a transport medium. Wipe the surface of the
sample (25-100 cm 2 ) with the moist swab.
Hunt and Radle Enrichment Broth (BAM/FDA)
Base
g/L
Nutrient broth
10.0
Yeast extract
6.0
Water distilled
950 mL
Supplement A
Ferrous sulfate
0.25 g
Sodium metabisulfite
0.25 g
Sodium pyruvate
0.25 g
Lysed horse blood
50.0 mL
Supplement B
Vancomycin
10.0 mg
Trimethoprim lactate
12.5 mg
Sodium cefoperazone
15.0 mg
Amphotericin B
2.0 mg
Supplement C
Sodium cefoperazone
15.0 mg
3.2. Campylobacter Plating Media Enrichment
1. Transfer the cell concentrate or food sample into the enrichment broth.
2. Place a weighted ring on the neck of the flask, and insert a sterile Teflon tube,
0.317 cm or 1/8 in. in diameter, from the gas cylinder between the cotton plug
and the neck of the flasks so that the tube is below the level of he broth. Allow the
gas mixture to flow at a rate of 5-10 mL/ min.
3. Wrap the cotton plug of the flask with two layers of parafilm and let stand at
room temperature for 30 min.
4. Incubate the flasks in a water bath, preset at 42°C for 48 h under a constant flow
of the gas mixture (5% 2 , 10%CO 2 , 85% N 2 ).
5. Filter the enrichment culture (5-7 mL) through a 4.7-cm-diameter membrane
filter (0.65 f^m pore size) in a sterile Millipore filter unit connected to a vacuum
pump, or filter through a Swinny adapter fitted to a 10-mL syringe. Use a low
vacuum, 12.7 cm or 5 in. of Mercury.
122 Herrera
Humphrey developed Exeter agar made by adding agar to Exeter broth.
C. jejuni strains produce gray/moist flat spreading colonies. Some strains may
have a green hue or a dry appearance with or without a metallic sheen. C. coli
strains tend to be creamy-gray color, moist, slightly raised, and often produc-
ing discrete colonies.
Prepare Campylobacter blood-free agar base, sterilize by autoclaving at
121 °C for 15 min. Cool to 50°C. Aseptically add one vial of CAT supplement
reconstituted with 4 mL of sterile distilled water. Mix well and pour into Petri
dishes. Store plates in the dark and preferably in wrapped or sealed containers.
3.2. 1. Campylobacter Agar (CAT)
Basal medium blood-free Campylobacter agar base: mg/L
Nutrient broth 25.0
Bacteriological charcoal 4.0
Casein hydrolysate 3.0
Sodium deoxycholate 1.0
Ferrous sulphate 0.25
Sodium pyruvate 0.25
Agar 12.0
pH 7.4 + -0.2
3.2.2. Campylobacter Selective Supplement (CAT)
Base rng/L
Cefoperazone 8.0
Teicoplanin 4.0
Amphotericin B 10.0
3.2.3. Campy-Cefex Agar
Campy-Cefex agar was formulated by Stern, Wojton and Kwiatek as a
selective-differential medium for the isolation of C. jejuni from chicken car-
casses. Campy-Cefex was found to be as productive and selective as the other
media. The high concentration of cycloheximide in Campy-Cefex medium
enables it more effectively inhibit the growth of molds and yeast, which is
frequently associated with poultry samples (see Note 3).
Base g/L
Brucella agar
44.0
Ferrous sulfate
0.5
Sodium bisulfite
0.2
Sodium pyruvate
0.5
Campylobacter 123
Distilled water 950 mL
Lysed horse blood 50 mL
3.2.4. Antibiotic Supplement
Base mg/L
Sodium cefoperazone 33.0
Cycloheximide 200
3.3. Test for Identification
Prepare a fresh culture in 5 mL of Brucella broth contained in a 25 -mL flask.
The culture is used for inoculation of the following tubes for biochemical and
grouth tests, and one agar plate for sensitivity to antimicrobial compounds.
Incubate all tubes aerobically or microaerobically at 42°C for 2-3 d (tubes for
25 and 30.5°C incubate for 5-7 d). Place a disc each of nalidixic acid (30 fig)
and cephalothin (30 [ig) on each plate. Incubate the plates at 42°C for 2-3 d
under a microaerobic atmosphere. After the incubation period, measure the
diameter of the transparent zone around the disc (5) .
4. Notes
1. Colonies tend to swarm when initially isolated. However, reduction in moisture
content of culture media can markedly alter the appearance to round, entire, some-
time butyrous, colonies. The extent of this change in colony appearance is vari-
able. The effect may explain differences seen in different laboratories and on
different culture media. It cannot be reversed by increasing the moisture in the
atmosphere during incubation.
2. If plates are first examined after 24 h incubation, read them immediately and
quickly return them to a microaerobic atmosphere to ensure continued viability.
3. Campylobacter-selective supplement contains cycloheximide and is toxic swal-
lowed, inhaled, or by skin contact. As a precaution when handling, wear gloves
and eyes/face protection.
References
1. Bryan, F. L. and Doyle, M. P. (1995) Health risks and consequences of Salmo-
nella and Campylobacter jejuni in raw poultry. /. Food Protein 58, 326-344.
2. Griffiths, P. L. and Park, R. W. A. (1990) Campylobacters associated with human
diarrhoeal disease. /. Appl. Bact. 69, 281-301.
3. Jones, R. G. and Skinner, F. A. (1992) Identification Methods in Applied and
Environmental Microbiology . Society for Applied Bacteriology Technical Series
No. 29, Board, Blackwell Scientific Publishers, Oxford, UK.
4. Vandrzant, C. and Splittstoesser, D. F. (1990) Compendium of Methods for the
Microbiological Examination of Foods, 3rd ed., American Public Health Asso-
ciation, Washington, DC.
5. Unipath Ltd. (1990) The Oxoid Manual, 6th ed., Basingstoke, UK.
16
Listeria monocytogenes
Anavella Gaitan Herrera
1. Introduction
Listeria monocytogenes was discovered as a pathogen of animals and
humans in the 1930s. As far as humans are concerned the organism was initially
identified as a cause of abortion in early pregnancy, stillbirth, or of septicemia
after an uneventful birth. Ecological surveys have demobstrated that Listeria
in general, and L. monocytogenes in particular, are naturally occurring in a
wide variety of domestic animals, particularly sheep and chickens. L. mono-
cytogenes has four attributes: the alleged elevated heat resistance, the ability
for relatively rapid growth at refrigeration temperatures, a marked tolerance of
reduced pH values, and growth in the presence of over 5% sodium chloride.
L. monocytogenes have been solated from raw staple foods including chicken,
red meat, seafood, and, of course, raw milk (see Note 1 and refs. / and 2).
2. Materials
1 . Cultures of Staphylococcus aureus NCTC 1 803 and Rhodococcus equi NCTC 162 1 .
2. Sheep blood agar plate.
3. Henry's oblique illumination.
4. Oxford and PALCAM agar.
5. FDA Listeria enrichment broth (LEB).
2. 7. Enrichment Media
Cold preenrichment cultures in which samples are added to a nonselective
nutritious medium and refrigerated was the standard procedure until recent
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
125
126 Herrera
years (see Note 2). Cold enrichment takes advantage of the psychrophilic prop-
erty of Listeria spp. Listeria will multiply at the low temperature, which inhib-
its multiplication of the accompanying medophilic flora (3). Detection of
Listeria colonies is generally assisted by viewing with a plate microscope with
the plate illuminated at an oblique angle as described by Henry (see Fig. 1).
Colonies of Listeria spp. are blue or blue/gray making them easily distinguish-
able to enable suitable colonies to be picked for futher testing (4). The explana-
tion of the phenomenon is that the cells in a Listeria colony tend to lie the same
plane, thus forming a crude diffraction grating, which changes the wave length
of light transmitted through the colony.
2. 1. 1. FDA Listeria Enrichment Broth (LEB)
Formula (g/L)
Tryptone soya 30.0
Yeast extract 6.0
pH 7.2 ±0.2
2. 1.2. Listeria Selective Enrichment Supplement
Formula* 7
Nalidixic acid 20.0 mg (equivalent to 40 mg/L)
Cycloheximide 25.0 mg (equivalent to 50 mg/L)
Acriflavine hydrochloride 7.5 mg (equivalent to 15 mg/L)
*Each vial is sufficient for 500 mL of medium.
Suspend the supplement in 2 mL of sterile distilled water. Sterilize by
autoclaving at 121 °C for 15 min. Cool to 50°C and aseptically add the Listeria-
selective enrichment supplement, mix well, and distribute into sterile containers.
2. 1.3. Listeria Selective Agar Base
Formula
(g/L)
Columbia blood agar base
39.0
Aesculin
1.0
Ferric ammonium citrate
0.5
Lithium chloride
15.0
pH 7.0 ± 0.2
Bring gently to boil to dissolve. Sterilize by autoclaving at 121 °C for 15 min.
Cool to 50°C and aseptically add the contents of one vial of Listeria-selQctive
supplement (Oxford formulation).
Listeria monocytogenes
127
24 h 48 h
ENRICHMENT
Test sample 1 : 25g + FDA Test sample 2: 25g + FDA
enrichment broth 225 mL enrichment broth without
Incubate up to 48 h 30°C selective agents 225 mL + 0. 1%
w/v sodium pryuvate.
Incubate 6 h 30°C.
Add selective agents.
Incubate up to 48 h 30°C.
24 h 48 h
SELECTIVE DIAGNOSTIC ISOLATION
Oxford Agar
Incubate 24-48 h 35°C.
LEB Agar
Incubate 24^48 h 30°C.
\ /
Examine for brownish-black
colonies with brown halos.
24 h 48 h
Examine by Henry
illumination.
24 h
48 h
\ /
Subculture to tryptone soya
agar + 0.6% yeast extract
\
CAMP test motility test and
biochemical test
Subculture to tryptone soya broth
+ 0.6% yeast extract
T
Subculture to tryptone broth
T
Serological tests
Fig. 1. Listeria monocytogenes flowsheet.
2. 1.4. Listeria Selective Supplement (Oxford Formulation)
Formula*
Cycloheximide
Colistin sulphate
200.0 mg (eqivalent to 400 mg/L)
10.0 mg (equivalent to 20 mg/L)
128 Herrera
Acriflavine 2.5 mg (equivalent to 5 mg/L)
Cefotetan 1.0 mg (equivalent to 2 mL/L)
Fosfomycin 5.0 mg (equivalent to 10 mg/L)
°Each vial is sufficient for 500 mL of medium.
Reconstituted with 5 mL of ethanol/sterile distilled water (1:1). Mix well
and pour into sterile Petri dishes.
2.1.5. PALCAM Agar
Selective and differential diagnostic medium for the detection of
L. monocytogenes.
Formula
(g/L)
Columbia blood agar base
39.0
Yeast extract
3.0
Glucose
0.5
Aesculin
0.8
Ferric ammonium citrate
0.5
Mannitol
10.0
Phenol red
0.08
Lithium chloride
15.0
pH 7.2 ±0.2
Suspend in 500 mL of distilled water. Bring gently to boil to dissolve completely.
Sterilize by autoclaving at 121 °C for 15 min. Cool to 50°C and aseptically add the
contents of one vial of PALCAM selective supplement, reconstituted.
2. 1.6. PALCAM Selective Supplement
Formula mg
Polymixin B 5.0
Acriflavine hydrochloride 2.5
Ceftazidime 10.0
*Each vial is sufficient for 500 mL of medium.
Vial is reconstituted with 2 mL of sterile distilled water. Mix and pour into
sterile Petri dishes. The addition of 2.5% (v/v) egg yolk emulsion to the medium
may aid the recovery of damaged Listeria spp.
L. monocytogenes hydrolyzes aesculin resulting in the formation of a black
halo around colonies, not fermented mannitol, thus easy differentiation from
contaminants such as enterococci and staphylococci can be made (these will
ferment mannitol and produce a change from red to yellow in the pH indicator
phenol red). Incubation under microaerophilic conditions serves to inhibit strict
Listeria monocytogenes 129
aerobes such as Bacillus spp. and Pseudomonas spp. that might otherwise
appear on the medium.
After 48 h incubation, typical Listeria spp. from colonies that are approxi-
mately 2 mm in diameter, gray-green in color with a black sunken center and a
black halo against a cherry-red medium background.
3. Methods
3. 7. Plating Media (see Note 3)
Oxford and PALC AM agars have employed as highly effective plating media that
are widely specified in official methodology (FDA/BAM) (see Fig. 2). The medium
utilizes the selective inhibitory components lithium chloride, acriflavine, colistin sul-
phate, cefotetan, cycloheximide, and fosfomycin and the indicator system aesculin
and ferrous iron for the isolation and differentiation of L. monocytogenes.
L. monocytogenes hydrolyzes aesculin, producing black zones around the colonies
due to the formation of black iron phenolic compounds derived from the aglucon.
Gram-negative bacteria are completely inhibited. Typical L. monocytogenes colonies
are almost always visible after 24 h, but incubation should be continued for a futher
24 h to detect slow-growing strains (see Note 4 and ref. 4).
3.2. Identification Tests
Colonies that appear to be Listeria spp. on plating media can be confirmed
using four simple tests (see Notes 5 and 6).
1 . Motility: Heavily inoculate brain-heart infusion or nutrient broth and incubate at
room temperature. Examine microscopically at 4-6 h. If tumbling, roating motil-
ity is not seen, reexamine at 18 h before discarding as negative. Listeria spp. do
not form flagellae above 30-33°C and motility may not occur if cultures are incu-
bated above 30°C.
2. Catalase: Emulsify a colony in a drop of hydrogen peroxide on a glass slide.
Immediate bubbling indicates a positive catalase test. Listeria spp. are catalase
positive. False positive catalase reactions may occur if a colony is taken from a
medium containing blood.
3. Microscopy: Examine a Gram-stain of growth from a suspected colony. Listeria cells
have a distinctive appearance and disposition. They are short Gram-positive rods that
ocur as straight pairs, pairs arranged in V formation and pairs adjacent to each other.
Most non-Listeria spp. can be eliminated by these three screaning tests.
4. The CAMP test (Christie-Atkins-Munch-Peterson): Prepare sheep blood agar
plates by pouring a thin layer of 5% v/v blood agar made with washed sheep
cells. Streak cultures of Staphylococcus aureus NCTC 1803 and Rhodococcus
equi NCTC 1621 across the sheep blood agar plate. Then streak the test strains at
right angles to the S. aureus and R. equi leaving a minimum of 12 mm between
cultures. Incubate at 37°C overnight {see Tables 1 and 2 and ref. 5).
130 Herrera
Microscope
Petri dish
%
45°
microscope plane or concave light
mirror source
Fig. 2. Plating methodology.
Table 1
CAMP Reactions for the Hemolytic Species of Listeria
Staphylococcus aureus Rhodococcus equi
L. monocytogenes + -
L. seeligeri + -
L. ianovii — +
Table 2
Tests to Be Done and the Results Shown
by L. monocytogenes
Test L. monocytogenes
Beta hemolysis (horse blood) +
Camp test
Staphylococcus aureus +
Rhodococcus equi -
Catalase +
Oxidase -
Nitrate reduction -
Methyl red (MR) +
Voges-Proskauer (VP) +
H 2 S
Urea -
Acid from:
Glucose +
Xylose -
Rhamnose +
Mannitol -
Aesculin +
Listeria monocytogenes 131
4. Notes
1. Do not use beyond the expiration date or if the product is caked, discolored, or
shows any signs of deterioration.
2. Listeria enrichment supplement medium contains cycloheximide and is toxic
if swallowed, inhaled, or skin contact. When handing, wear gloves and eye/
face protection.
3. Store the prepared medium at 2-8°C, tightly capped, in the dark, and use as soon
as possible.
4. Store prepared medium away from light. Acriflavine can photooxidize to form
compounds inhibitory to Listeria spp.
5. Broth cultures are more dangerous than colonies on agar plates.
6. Store the supplement at 2-8 °C away from light and use before the expiration date
on the label.
References
1. Dever, F. P., Shaffner, D. W., and Slade, P. J. (1993), Methods for the detection of
foodborne Listeria monocytogenes in the US. /. Food Safety 13, 263-292.
2. Post, D. E. (1989) The detection of Listeria, in Redacting the Risk of Listeria.
I. B.C. Technical Services Ltd. Symposium, London, UK.
3. Farber, J. M. (1993) Current research on Listeria monocytogenes in foods: an
overview. /. Food Protect. 56, 640-643.
4. Farber, J. M. and Peterkin, P. I. (1991) Listeria monocytogenes, a foodborne
pathogen. Microbiol. Rev. 55, 476-51 1.
5. Varnham, A. H. and Evans, M. G. (1991) Foodborne Pathogens: An Illustrated
Text. Wolfe Publishing Ltd., London.
6. British Standard (1993) Microbiological examination for dairy purposes, B5 4285,
Part 3. Methods for Detection and/ or Enumeration of Specific Groups of Microor-
ganisms. Section 3.15. Detection of Listeria monocytogenes, ISO 10560.
Ill
Fermented Foods
17
Methods for Plasmid and Genomic DNA Isolation
from Lactobacilli
M. Andrea Azcarate-Peril and Raul R. Raya
1. Introduction
Lactobacillus represents a major genus of the lactic acid bacteria that have
widespread use in fermented food production. They are also found in the mouth,
intestinal tract, and vagina of many animals. They produce bioantagonists
compounds such as lactic acid and bacteriocins and hence are used as probiotics
to treat gastroenteric disorders (1). In view of their commercial importance, a
complete characterization of their genome and further genetic manipulation
may have great potential for the improvement of these microorganisms.
However, compared with that of Lactococcus lactis, the genetic knowledge of
lactobacilli is sparse and the availability of genetic systems for its study is
limited. Natural plasmids of lactobacilli may play a significant role in vector
development techniques that are the basis for applied genetics. Resident
plasmids are abundant in Lactobacillus strains. Although some industrially
significant characteristics such as metabolic functions, restriction/modification
systems, and drug resistance are plasmid DNA encoded, most of these plasmids
remain cryptic (2). Several protocols have been described for plasmid DNA
isolation in this genus (3,4), mainly based in the Birnboim and Doly method
(5). In this chapter, we describe two methods used in our laboratory for the
isolation of plasmid and genomic DNA. They are based on standard protocols
developed for other lactic acid bacteria and render DNA suitable for
polymerase chain reaction (PCR) and restriction digestion experiments.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
135
136 Azcarate-Peril and Raya
2. Materials
2. 1. Culture Media
1. MRS broth (6): 10 g/L peptone, 10 g/L meat extract, 5 g/L yeast extract, 20 g/L
glucose, 5 g/L sodium acetate, 1 g/L Tween-80, 2 g/L ammonium citrate, 2 g/L
K 2 HP0 4 , 0.2 g/L MgS0 4 -7H 2 0, and 0.05 g/L MnS0 4 4H 2 0; pH 6.5.
2. MB broth (7): 10 g/L yeast extract, 10 g/L glucose, 1 g/L Tween-80, 0.05 g/L
(NH 4 ) 2 HP0 4 , and 0.005 g/L MgS0 4 -7H 2 0; pH 6.5.
Autoclave for 17 min at 121 °C. Media can be stored at room temperature for
months.
2.2. Total DNA Isolation
1. Lysis buffer: 75 mM sodium chloride, 25 mM EDTA, 20 mM Tris-HCl, pH 7.5,
containing 10 mg/mL of lysozyme. The solution should be prepared just prior to use.
2. 10% sodium dodecyl sulfate (SDS).
3. 25 mg/mL proteinase K, in distilled water.
4. 5 M sodium chloride.
5. A 24 : 1 (v/v) mixture of chloroform and isoamyl alcohol.
6. 100% isopropanol.
7. 70% ethanol chilled to -20°C.
8. TE buffer: Tris-HCl 10 mM, and EDTA 1 mM, pH 8.0. Autoclave for 20 min at
121°C.
9. TE-buffer-saturated phenol (8).
10. 3 M sodium acetate, adjusted to pH 5.2 with glacial acetic acid.
11. 37°C water bath.
12. 55°C water bath.
13. Refrigerated centrifuge.
14. pH Meter.
2.3. Plasm id DNA Isolation
1. Resuspension buffer: 6.5% sucrose, 50 mM Tris-HCl, and ImM EDTA; pH 8.0.
2. Lysozyme solution: 10 mg/mL lysozyme, dissolved in resuspension buffer. The
solution should be prepared fresh just prior to use.
3. Lysis solution: 3% SDS, 50 mM Tris-HCl, and 5 mM EDTA. Adjust the pH to
12.25-12.4 with 5 N sodium hidroxide just prior to use.
4. Fresh 5N sodium hidroxide.
5. 3N potassium acetate, adjusted to pH 4.8 with glacial acetic acid.
6. 100% isopropanol.
7. TE buffer.
8. 10 mg/mL DNase-free RNase (Sigma, St. Louis, MO) dissolved in sterile
distilled water.
Methods for DNA Isolation from Lactobacilli 137
9. TE-buffer-saturated phenol.
10. A 24:l(v/v) mixture of chloroform and isoamyl alcohol.
11. Optional: 8 N LiCl dissolved in sterile distilled water.
12. 37°C water bath.
13. Refrigerated microcentrifuge.
14. pH Meter.
2.4. Agarose Gel Electrophoresis
1. 0.8% agarose dissolved in TAE or TBE buffer (8).
2. TAE (IX: 0.04 M Tris-acetate, 0.001 MEDTA, pH 8.0) or TBE (0.5X: 0.045 M
Tris-borate, 0.001 M EDTA; pH 8.0) buffer (8).
3. 10 mg/mL ethidium bromide.
4. Power supply and accessories for electrophoresis.
3. Methods
3. 1. Total DNA Isolation (see Note 1)
1 . Inoculate 30 mL of MRS broth with 300 \xh of an overnight culture. Incubate 16 h
at 37 °C (see Note 2).
2. Centrifuge the culture at 7000g for 10 min and resuspend the cells in 5 mL of
lysis buffer. Incubate in a 37 °C water bath for 2 h.
3. Add 500 |LiL of 10% SDS and 100 f^L of 25 mg/mL proteinase K. Incubate in a
55°C water bath for 2 h. Shake occasionally.
4. Add 2 mL of 5 M sodium chloride and 6 mL of chloroform-isoamyl alcohol.
Incubate at room temperature for 30 min.
5. Centrifuge at 19,000g for 10 min to eliminate cellular debris. Transfer the upper
phase to fresh tube.
6. Precipitate the nucleic acids by adding 1 volume of 100% isopropanol. Take the
DNA filament with a glass stick and wash it with ice-cold 70% ethanol.
7. Air-dry the DNA and resuspend it in 600 jliL of TE buffer.
8. Extract the sample by adding 1 volume of TE-buffer-saturated phenol. Mix by
inverting the tube and centrifuge at 19,000g for 5 min. Transfer the aqueous
upper phase to a fresh tube and repeat this step.
9. Treat the upper phase with 1 volume of the chloroform-isoamyl alcohol mixture.
Centrifuge at maximum speed for 5 min and carefully transfer the upper phase to a
new tube.
10. Add 50 jj,L of 3M sodium acetate pH 5.2, and 2 volumes of chilled 100% etha-
nol. Incubate at -70°C for 1 h or at -20°C overnight. Centrifuge at 19,000g for
10 min.
11. Wash the pellet twice with 70% ethanol chilled at -20°C and air-dry the pellet.
12. Resuspend de DNA in 50-100 \xL of TE buffer and store at 4°C (see Notes 3
and 4).
138 Azcarate-Peril and Raya
3.2. Plasmid DNA Isolation (see Note 1)
1 . Inoculate 10 mL of broth with a single colony. Incubate the culture for 16 h at 37°C.
2. Centrifuge 2-10 mL of the culture at 16,000g for 2 min.
3. Wash the cells with 1 mL of resuspension buffer and resuspend the pellet in 200
jj,L of lysozyme solution (see Notes 5 and 7).
4. Incubate on ice for 1 h.
5 . Add 400 \xL of the lysis solution (pH 1 2.25-1 2.4; see Note 6) and incubate on ice
5 min to allow a complete cell lysis.
6. Neutralize with 400 j^L of 3M potassium acetate and mix by inverting the
Eppendorf tube several times (see Note 7). Do not vortex.
7. Keep the sample on ice (at least 10 min), mix by invertion, and centrifuge at
16,000s ^ 10 min.
8. Carefully transfer the supernatant to a fresh tube and recentrifuge if necessary.
9. Precipitate the clear supernatant with 1 volume of isopropyl alcohol. Incubate on
ice for 30 min.
10. Centrifuge at room temperature at 16,000g for 20 min.
1 1 . Carefully pour off the supernatants and allow pellet to drain completely (see Note 8).
12. Resuspend the pellet in 500 f^L of TE-buffer and add 50 U of DNase-free RNase.
Incubate at 37°C for 45 min.
13. Add 500 ^iL of TE-buffer-saturated phenol and invert several times to mix. Centri-
fuge at 16,000g for 5 min and transfer the upper phase to a fresh tube (see Note 9).
14. Treat the upper phase with 500 fiL of chloroform-isoamyl alcohol. Invert several
times to ensure the complete elimination of any trace of phenol and centrifuge at
16,000s for 5 min.
15. Precipitate the upper phase by adding 1 mL of ice-cold ethanol and incubate at
-70°C for at least 30 min. Centrifuge at 16,000# for 15 min at 4°C.
16. Wash the pellet twice with ice-cold 70% ethanol, air-dry, and resuspend the pellet
in 20 f^L of TE buffer.
17. Examine 10 fiL in an 0.8-0.9% agarose gel and stain with ethidium bromide (see
Note 4).
4. Notes
1. Wear gloves all the time to minimize the risk of contamination with DNases.
Other sources of DNases are water and solutions, so use sterilized water and do
not store solutions for more than 30 d. Use disposable gloves when handling
dangerous solutions like sodium hydroxide, TE-buffer-saturated phenol, chloro-
form-isoamyl alcohol and ethidium bromide. Fresh-prepared solutions, espe-
cially sodium hydroxide and lysozyme, have to be used to optimize the procedure.
2. The conditions to achieve a complete cell lysis have to be optimized: Although
overnight cultures can be used for almost all lactobacilli, some strains might need
to be processed in the exponential growth phase. For exopolisaccharide-produc-
ing strains, the use of the low-salt-medium MB is recommended.
Methods for DNA Isolation from Lactobacilli 139
3. The pellet can also be resuspended in sterile distilled water instead TE if DNA
will be treated with restriction enzymes. If water is used instead, TE plasmid
DNA should be conserved at -20°C. Repeated thaw and freeze of the DNA can
cause damage in large genomic and plasmid DNA.
4. Measure the absorbance of the final solution at 260 and 280 nm to check DNA
concentration and purity (8).
5. In some cases, the incubation with lysozyme solution can be made at 37°C.
However, it should not be done for more than 30 min because plasmid DNA in
some strains can be damaged.
6. Carefully control the pH of the lysis solution during the plasmid isolation. A pH
of at least 12.25 is needed to denature chromosomal DNA, and a pH over 12.4
can cause damage to the plasmid DNA.
7. Sucrose can be replaced by 50 mM glucose in the resuspension buffer for plasmid
DNA isolation. Also, potassium acetate can be replaced by 3 M sodium acetate,
pH4.8.
8. After precipitation with isopropanol, do not overdry the pellet, it can make the
subsequent resuspension difficult and shear the DNA.
9. The TE-buffer-saturated phenol extraction can be avoided in plasmid DNA isola-
tion if there are problems with subsequent restriction enzymes treatments. Add
1 volume of SN lithium chloride and incubate at -20°C for 30 min. Centrifuge at
16,000g for 15 min and precipitate the supernatant with ice-cold ethanol.
References
1. Davidson, P. M. and Hoover, D. G. (1993) Antimicrobial components from lactic
acid bacteria, in Lactic Acid Bacteria (Salminen, S. and von Wright, A., eds.),
Marcel Dekker, New York, pp. 127-159.
2. Wang, T. and Lee, B. (1997) Plasmids in Lactobacillus . Crit. Rev. Biotechnol. 17,
227-272.
3. Klaenhammer, T. R. (1984) A general method for plasmid isolation in lactobacilli.
Curr. Microbiol. 10, 23-28.
4. Muriana, P. and Klaenhammer, T. (1991) Cloning, phenotypic expression, and
DNA sequence of the gene for lactacin F, an antimicrobial peptide produced by
Lactobacillus ssp./. Bacteriol. 173, 1779-1788.
5. Birnboim, H. and Doly, J. (1979) A rapid alkaline extraction procedure for screen-
ing recombinant plasmid DNA. Nucleic Acids Res. 7, 1513-1523.
6. De Man, J., Rogosa, M., and Sharpe, M. (1960) A medium for the cultivation of
lactobacilli. /. Appl. Bacteriol. 23, 130-135.
7. Bruno-Barcena, J. M., Azcarate-Peril, M. A., Ragout, A., Font de Valdez, G.,
Raya, R., and Sineriz, F. (1998) Fragile cells of Lactobacillus easel suitable for
plasmid DNA isolation. Biotechnol. Techniques 12, 97-99.
8. Sambrook, J., Fritsch, E. F., and Maniatis, T. (eds.) (1989) Molecular Cloning.
A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Har-
bor, NY.
18
Methods for the Detection and Concentration
of Bacteriocins Produced by Lactic Acid Bacteria
Sergio A. Cuozzo, Fernando J. M. Sesma,
Aida A. Pesce de R. Holgado, and Raul R. Raya
1. Introduction
Lactic acid bacteria (LAB), used for centuries by man to preserve food,
produce a wide variety of antagonistic compounds, including lactic acid,
hydrogen peroxide, and bacteriocins. Bacteriocins are antimicrobial peptides
that are bactericidal toward bacteria taxonomically close to the producer (1).
The bacteriocins produced by LAB have been extensively studied (2) and
classified into three main groups (3): (I) lantibiotics, small peptides (<5 kDa),
which are characterized by the presence of lanthionine and/or (3-methyl-
lanthionine residues in the polypeptide; (II) nonlantibiotic, low-molecular-
weight (<10 kDa), heat-stable peptides; and (IE) nonlantibiotic, large (>30 kDa),
heat-labile peptides. Class II bacteriocins can be subdivided into (IIA) Listeria-
active peptides, (IIB) two peptide bacteriocins, (IIC) Sec-dependent bacteriocins,
and (IID) class II bacteriocins that do not belong to the other subgroups.
Nisin, produced by Lactococcus lactis, is a well-characterized lantibiotic
extensively used as a food preservative, particulary in cheese and other milk
products. Furthermore, the specific actions of some bacteriocins toward
foodborne pathogenic bacteria and undesirable flora like Listeria spp. and
Clostridium spp. have increased the interest in these compounds. The search
for new bacteriocins is therefore of great significance because of their potential
use in fermented food and feed.
Several direct and deferred procedures to detect bacteriocin activity have been
described (4). In this chaper, we describe several methods used in our laboratory
for the detection, titration, and partial purification of bacteriocins produced by LAB .
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
141
142 Cuozzo et al.
2. Materials
2. 1. Culture Media
1. MRS broth (5): 10 g/L peptone, 10 g/L meat extract, 5 g/L yeast extract, 20 g/L
glucose, 5 g/L sodium acetate, 1 g/L Tween-80, 2 g/L ammonium citrate, 2 g/L
K 2 HP0 4 , 0.2 g/L MgS0 4 -7H 2 0, and 0.05 g/L MnS0 4 4H 2 0, pH 6.5.
2. MRS base agar: MRS with agar 1.5%.
3. MRS top agar: MRS with agar 0.7%.
2.2. Detection of Bacteriocin Activity In Situ
1. Tubes with 10 mL MRS base agar.
2. Tubes with 5 mL MRS top agar.
3. Petri dishes containing 10 mL MRS base agar.
4. Stove at 30°C.
5. Water bath at 45 °C.
2.3. Titration by Diffusion Zone
1. Tubes with 5 mL MRS top agar.
2. Petri dishes containing 10 mL MRS base agar.
3. MRS broth.
4. Membrane filter of 0.45 fim of pore size.
5. Sterile tubes.
6. Hollow punch, 0.5 cm in diameter.
7. Water bath at 45°C.
2.4. Microtiter Plate Assay
1 . Membrane filter of 0.45 ^im of pore size.
2. Microtiter plates.
3. Sterile tubes.
4. Microplate reader.
2.5. Bacteriocin Purification
1. (NH 4 ) 2 S0 4 powder.
2. Vacuum evaporator.
3. Membrane filter of 0.45 f^m of pore size.
4. Columns C18 or C8 from SUPELCO (Supelclean SPE).
5. Isopropanol.
6. Methanol.
7. Deionized water.
Detection and Concentration of Bacteriocins 143
8. 2-Propanol or acetonitrile.
9. Peristaltic pump.
10. Refrigerated centrifuge.
3. Methods
3. 1 Detection of Bacteriocin Activity In Situ
1. Add 100 \xL of a 1:100,000 dilution of an overnight culture of the bacteriocin
producer strain to a tube containing 10 mL of molten MRS base agar at 45 °C (see
Note 1).
2. Mix gently and pour the mixture into a Petri dish containing MRS base agar.
Let solidify.
3. Add 5 mL of molten MRS top agar (45°C) over the second layer. Slide the plate
in circles on the bench top immediately to spread the top agar over the plate.
Once the top agar has solidified (about 10 min), incubate overnight at 30°C (see
Note 2).
4. Mix gently 70 fiL of an overnight culture of the sensitive strain with 5 mL of
molten MRS top agar (45 °C) and pour onto the three-layer Petri dish. Slide the
plate in circles.
5. Incubate the plates (with the agar side up) overnight at 30°C.
6. Bacteriocin activity is detected by the presence of growth inhibition zones (halos)
of the indicator strain (see Note 3).
3.2 Diffusion Zone
1. Mix gently 70 \xL of an overnight culture of the sensitive strain with 5 mL of
molten MRS top agar (45 °C) and pour the content into a Petri dish containing
10 mL of solidified MRS base agar (1.5%).
2. Make wells 0.5 cm in diameter with a hollow punch.
3. In each well, add 30 f^L of undiluted and serial twofold ( 1/2, 1/4, 1/8, l/n) dilutions
of the membrane-filtered supernatant containing the bacteriocin (see Note 4). Use
sterile MRS broth to prepare the dilutions.
4. Incubate the plates overnight at 30°C.
5. Bacteriocin activity is expressed in arbitrary units (AU) per milliliter, as fol-
lows: AU/mL = 1/0.03 mL x maximal dilution, which inhibits growth of the
indicator strain (see Note 5).
3.3. Microti ter Plate Assay (7)
1. Add 100 \xL of the bacteriocin dilutions (twofold dilutions) into the wells of a
microtiter plate (96 wells).
2. Add 20 ^iL of an exponentially growing indicator culture (A 600 = 0. 1-0.4) and 80 fiL
of MRS broth to each well. Mix gently.
144 Cuozzo et al.
3 . After 3 h of incubation at 30°C , evaluate growth inhibition by spectrophotometrically
measuring the optical density at 600 nm with a MR 700 microplate reader.
4. One bacteriocin unit (B.U.) was defined as the amount of bacteriocin that inhibited
growth of the indicator microorganism by 50%, when comparing with control culture
without bacteriocin.
3 A. Concentration and Partial Purification of Bacteriocin
3.4.1. Precipitation by Ammonium Sulfate
1. Centrifuge the culture at 13,000g for 10 min and transfer the supernatant to a
separate vessel.
2. Precipitate the bacteriocin by adding (NH 4 ) 2 S0 4 slowly and mixing continuously
(most of the bacteriocins are precipitable with at concentration of 40-80%). This
step can be perfomed at room temperature.
3. Centrifuge at 10,000g and resuspend the pellet in deionized water or in 5%
isopropanol.
4. Apply the bacteriocin extract directly to a solid-phase extraction column (SPE).
Alternatively, the extract can be dialyzed in a benzoylated nitrocellulose sack
(which must retain proteins with molecular weights greater than 2000) against
deionized water at 4°C overnight, with gently stirring .
3.4.2. SPE Column
1. Apply the extract to a C18 or C8 solid-phase extraction column (see Note 6).
Depending on the supernatant volume, it is possible to use columns with different
sorbent capacities. SPE columns are previously washed with two volumes of
isopropanol or methanol and one volume of deionized water. Once applied, the
bacteriocin samples are applied to the top of the column and are drawn through
the packing bed (flow must be 1-5 mL/min). A syringe is used or, alternatively,
a peristaltic pump coupled with a fraction collector can also be used.
2. Columns are washed with deionized water (or other polar solvent) (see Note 7).
3. Bacteriocins are eluted with a nonpolar solvent (usually 2-propanol or
acetonitrile). Elution is more efficient using a gradient of the nonpolar solvent
(see Note 7).
4. Determine bacteriocin activity in the collected fractions by the diffusion zone
method (see Subheading 3.2.).
3.4.3. Adsorption and Desorption
Alternatively the bacteriocin can be concentrated by using the adsorption/
desorption properties at different pHs (6).
1. Grow the producer strain in 1 L of MRS broth at 30°C for 18-20 h (without
pH control).
Detection and Concentration of Bacteriocins 145
2. Heat the culture to 70°C for 30 min (to inactivate proteases and to kill cells).
3. Adjust the pH to 6.5 with 4 N NaOH (to adsorb bacteriocin to the cells).
4. Collect by centrifugation (15,000g, 15 min) and wash the pellet twice in 5 mM
sodium phosphate buffer (pH 6.5).
5. Resuspend in 10 mL of 100 mM NaCl at pH 2.0 (adjusted with 5% phosphoric
acid) and mix with a magnetic stirrer for 2 h at 4°C.
6. Centrifuge the cell suspension at 29,000g, 20 min at 4°C, and evaluate the
supernatant for inhibitory activity and stored at -20°C for future assays.
4. Notes
1 . The optimal dilution of the producer culture should permit the growth of 150-200
colonies by plate.
2. Addition of the third layer of top agar over the bacteriocin producer strain is very
important to avoid dissemination of colonies.
3. The colony size should be 0.5-1 mm in diameter. Larger colonies will produce a
spread of the halo of inhibition.
4. The supernatant containing the bacteriocin are obtained by centrifugation of the
culture at 13,000g for 10 min. They are sterilized by filtration through a
membrane of 0.45 [xm, without detectable loss of activity. If the bacteriocin is
sufficiently thermostable to withstand temperatures that kill the producer cells, it
can be sterilized by autoclaving.
5. A spot of undiluted supernatant might show a confluent clear area of inhibition
whether it contains a phage or a bacteriocin. In the case of a phage, the dilutions
would show a decreasing number of discrete phage plaques; a bacteriocin, on
the other hand, would show a diffuse thinning of growth getting less marked
with increasing dilution of the supernatant. In general, no bacteriocin activity
was detectable in dilutions beyond 1:1000, whereas phage activity was still
present at much higher dilutions.
6. Although C8 or C18 columns can be prepared in the lab, it is recommended to
use the ready-to-use commercial columns available from several suppliers.
7. The bacteriocin recovered from C8 or C18 columns can be further purified from
high-performance liquid chromatography or sodium dodecyl sulfate-polyacryla-
mide gel electrophoresis.
5. References
1. Tagg, J. R., Dajani, A. S., and Wannamaker, L. W. (1976) Bacteriocins of gram-
positive bacteria. Bacteriol. Rev. 40, 722-756.
2. De Vuyst, L. and Vandamme, E. J. (1994) Bacteriocins of lactic acid bacteria,
in Microbiology, Genetics and Applications (De Vuyst, L. and Vandamme, E. J.,
eds.), Blackie Academic & Professional, London.
3. 3. Nes, I. F., Diep, D. B., Haverstein, L. S., Brurberg, M. B., Eijsink, V., and
Holo, H (1996) Biosynthesis of bacteriocins in lactic acid bacteria. Antonie van
Leeuwenhoek 70, 113-128.
146 Cuozzo et al.
4. Klaenhammer, T. R. (1988). Bacteriocins of lactic acid bacteria. Biochimie 70,
337-349.
5. De Man, J., Rogosa, M. and Sharpe, M. (1960) A medium for the cultivation of
lactobacilli. /. Appl. Bacteriol. 23, 130-135.
6. Yang, R., Johnson, M. C, and Ray, B. (1992) Novel method to extract large amount
of bacteriocin from lactic acid bacteria. Appl. Environ. Microbiol. 58, 3355-3359.
7. Toba, T., Samant, S. K., and Itoh, T. (1991) Assay system for detecting bacterio-
cin in mucrodilution wells. Lett. Appl. Microbiol. 13, 102-104.
19
Meat Protein Degradation by Tissue and Lactic Acid
Bacteria Enzymes
Silvina Fadda, Graciela Vignolo, and Guillermo Oliver
1. Introduction
During the fermentation and ripening of dry fermented sausage, a large
number of biological reactions occur in the sausage mince. Proteolysis is
considered to be one of the major processes involved in texture and flavor
development. Moreover, small peptides and free amino acids, thus originated,
are essential constituents of the nonvolatile compounds with flavor properties
(1). Free amino acids are also the origin of other aroma volatile compounds
that are involved in further enzymatic and chemical reactions (2,3). This is the
result of the proteolytic activity of both endogenous and microbial enzymes. In
recent years, the proteolytic system of lactobacilli involved in meat fermenta-
tion is becoming the focus of an increasing number of studies because of the
technological roles of these organisms (5-7). The study of the enzymology of
dry fermented sausages is quite complex because of the coexistence of
endogenous and microbial enzymes, which prevent the determination of the
independent contribution of each enzymatic system in the whole proteolytic
event. For this reason, it was necesary to establish aseptic conditions to evaluate
the real function of endogenous enzymes and lactic acid bacteria (LAB).
The techniques used to analyze meat protein degradation will be considered
under the following headings:
1. Experimental meat systems: Aseptic meat system involving muscular protein
extraction: (sarcoplasmic and myofibrillar); modification of the experimental
meat system to optimize the growth of lactobacilli and beaker sausage to evaluate
proteolysis by approaching the real sausage conditions.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
147
148 Fadda, Vignolo, and Oliver
2. Meat protein degradation: The roles of endogenous enzymes and LAB were
determined by complementary methods: electrophoresis in denaturing conditions
(sodium dodecyl sulfate-polyacrylamide gel electrophoresis [SDS-PAGE]) to
evaluate the large protein degradation; fTuorometric method (orthophthalaldehyde)
and reverse phase high pressure liquid chromatography (rp-HPLC) to analyze the
peptidase activity and hydrolysis products (peptides and amino acids).
2. Materials
2. 1. Sarcoplasmic and Myofibrillar Systems
1. Stomacher 400 blender (London, UK),
2. Bovine Semimembranosus muscle and porcine Longissimus dorsi after 24 h of
exsanguinization.
3. Distilled water (dH 2 0).
4. Phosphate buffer 20 mM, pH 7.4.
5. Whatman paper No. 5; sterifilter system (Millipore); 0.22-f^m membrane filter.
6. Glucose.
7. Phosphate buffer 0.1 N with 0.7 M KI, pH 6.5, sodium azide (0.02%, w/v)
8. Plate count agar (PCA).
2.2. Proteolytic Activity in Aseptic Conditions; Effect
of Curing Additives
1. 250 mL of each experimental system (sarcoplasmic and myofibrillar).
2. Stock solution of NaN0 2 , 10,000 ppm. Weigh 1 mg of NaN0 2 and added dH 2 to
reach 100 mL in a volumetric flask. Sterilize by filtration.
3. Sodium chloride.
4. Stock solution of ascorbic acid 1 mg/mL (approx 50 mL). Weigh 10 mg of
ascorbic acid and adjust to 10 mL with dH 2 0. Sterilize by filtration.
5. Glucose and sucrose.
6. Lactic acid solution (20%, w/v).
2.3. Proteolytic Activity of Lactic Acid Bacteria on Muscle Proteins
2.3.1. Ability of Lactic Acid Bacteria to Growth in Sarcoplasmic System
1. LAB isolated from dry fermented sausages.
2. MRS broth.
3. An active lactobacilli culture grown in MRS broth for about 16 h at 30°C.
4. 20 mM phosphate buffer, pH 7.0.
5. 30 mL of the sarcoplasmic modified medium.
6. 0.1% Peptone for decimal dilutions.
7. MRS agar for bacterial enumeration.
Meat Protein Degradation 149
2.3.2. Proteolytic Activity of Different LAB Enzyme Sources
on Sarcoplasmic and Myofibrillar Proteins
1. 100-150 mL of an overnight culture.
2. 20 mM phosphate buffer, pH 7.0, as washing and resuspending solutions.
3. 100-150 mL of each muscle experimental system (sarcoplasmic and myofibrillar).
4. Sucrose solutions (0.4, 0.45, and 0.6 M).
5. 10 mM MgCl 2 stock solution.
6. Lysozyme.
2.3.3. Curing Conditions Effect on LAB Proteolytic Activity
1. 100-150 mL of an overnight culture.
2. 150 mL of muscle experimental systems (sarcoplasmic and myofibrillar).
3. Stock solution of NaN0 2 , 10,000 ppm (step 2 of Subheading 2.2.).
4. Sodium chloride.
5. 1 mg/mL stock solution of ascorbic acid (step 4 of item Subheading 2.2.).
2.3.4. Proteolytic Activity of LAB in a Sausage Experimental System
1. Porcine and bovine meat.
2. 10,000 ppm of a stock solution of NaN0 2 : Weigh 1 mg of NaN0 2 and add dH 2
to reach 100 mL in a volumetric flask. Sterilize by filtration.
3. Sodium chloride.
4. 1 mg/mL stock solution of ascorbic acid.
5. Glucose and sucrose.
6. Poly (vinyl chloride) (PVC) films.
7. Sodium azide.
8. 150 mL of an overnight culture of each microorganism.
2.4. To develop the Proteolytic Activity
2.4.1. SDS-PAGE
1. Resolving acrylamide stock solution 30% T-0.5% C. Weigh 29.85 g of
acrylamide and 0.15 gr of N-N,methylene to-acrylamide into a beaker, add about
50 mL of dH 2 0, stir until dissolved and dilute to 100 mL. Filter (0.45-^im filter)
and store in cold (4°C) and protected from light. Avoid skin contact.
2. Stacking acrylamide stock solution 10% T-15% C. Weight 4.25 g acrylamide and
0.75 g of to-acrylamide into a beaker, add 25 mL of dH 2 0, stir until dissolved and
dilute to 50 mL. Filter (0A5-\xm filter), store in brown bottle at 4°C.
3. 3MTris,pH 8.8. Dissolve 32,2 g of Trizma base (desiccated) and 5.4 g Tris-HCl
(desiccated) in dH 2 0; dilute to 100 mL. Store at 4°C (shelf life about 1 mo). If
desiccated solutions are used, no pH adjustment is necessary.
150 Fadda, Vignolo, and Oliver
4. 0.5 M Tris, pH 6.8. Dissolve 0.075 g Trizma base (desiccated) and 3.85 g Tris-
HC1 (desiccated) in water; dilute to 50 mL. Store at 4°C.
5. SDS (20% w/v). Dissolve and filter through 0.45-[im filter. Store at room
temperature.
6. Reservoir buffer concentrate (5X). 0.25 M Tris (Trizma base), 1.92 M glycine,
0.5% SDS. Store in cold and dilute to IX before use.
7. Amonium persulfate. Prepare a 100-mg/mL solution in water just before use.
8. A/WW,AMetramethylethylenediamine (TEMED) .
9. Sample buffer: 8 M urea, 2 M thiourea, 0.05M Tris (pH 6.8), 75 mM dithiothreitol
(DTT), 3% SDS, 0.05% bromophenol blue. For 100 mL 1: 1 weight: 48 g urea
(deionized), 15.2 g thiourea (deionized), 0.605 g Trizma base, 3 g SDS, 5 mg
bromophenol blue, and 1 . 1 55 g DTT. Transfer the solids to 1 50-mL glass beaker,
add a stir bar and 40 mL of water (Note 1) and stir gently until all the solids are
dissolved (Note 2). Adjust the pH to 7, adding 100 \\L of 12 M HC1. Now, add
1.155 g of solid DTT while stirring until dissolved; continue adjusting the pH
down to 6.8 using a 20-f^L aliquot of 2M HO {see Note 3). Finally, add water to
100 mL and mix. Aliquote and store at -75°C until used.
Note: For urea/thiourea deionization, proceed as follows:
• Prepare 200 mL of 6 M urea.
• Add 30 g of mixed-bed ion-exchange resin (i.e., AG = 501 x 8 [Bio-Rad,
Richmond, CA]) and stir for 1-2 h.
• Monitor the conductivity of the solution {see Note 4).
• Filter the urea.
• Prepare 150 mL of 2 M thiourea.
• Add 5 g of the resin; stir for 1-2 h.
• Check the conductivity.
• Filter the deionizated thiourea.
• Add the other reagent as stated in this step.
10. Glycerol (50% v/v). Stable at room temperature.
1 1 . Staining solution. Weigh out 0.5 g of Coomassie brillant blue R-250 and dissolve in
250 mL isopropanol and 100 mL of acetic acid and dilute to 1000 mL with dH 2 0.
12. Destaining solution. Measure 50 mL of acetic acid andl50 mL of ethanol; mix
both reagents and dilute to 500 mL with dH 2 0.
13. The proteins used as standards were myosin (200.0 kDa), (3-galactosidase (1 16.3
kDa), phosphorylase B (97.4 kDa), serum albumin (66.2 kDa), ovalbumin (45.0
kDa), carbonic anhydrase (31.0 kDa), trypsin inhibitor (21.5 kDa), lysozyme
(14.4 kDa), and aprotinin (6.5 kDa) from Bio-Rad.
2.4.2. Peptide Analyses
1. Ultraviolet (UV) detector (214 nm).
2. Waters Symmetry C18 (4.6 mm inside diameter by 250 mm) column (Waters
Corp. Milford, MA).
3. Eluent A: 0.1% (v/v) trifluoroacetic acid (TFA) in MilliQ water {see Note 5).
4. Eluent B: acetonitrile-water-TFA 60:40:0.085% (v/v).
Meat Protein Degradation 1 5 1
2.4.3. Ortho-Phthaldialdehyde method (OP A)
1. 0.1 M Phosphate buffer, pH 7.0. Solution A (0.2 M NaH 2 P0 4 ): Weigh 27.6 g
NaH 2 P0 4 H 2 and make to 100 mL with distilled water (dH 2 0). Solution B 0.2 M
Na 2 HP0 4 Weight 53.05 g of Na 2 HP0 4 .7H 2 and make to 100 mL with dH 2 0.
To prepare 1 L of 0.1 M phosphate buffer, pH 7.0, mix 195 mL solution A and
305 mL solution B and bring to 1000 mL with dH 2 0.
2. SDS (20% w/v). Dissolve 20 g SDS in 100 mL dH 2 with gentle stirring. Store at
room temperature. Solution may become cloudy at temperatures below 20°C but
may be restored by warming to 30°C and mixing.
3. 100 mM sodium tetraborate (borax). Weight 3.81 g of Na 2 B 4 O 7 -10H 2 O and make
up to 100 mL with dH 2 0. This solution is stable at least 1 mo at 4°C.
4. Working reagent (OPA solution). Mix 25 mL of 100 mM borax, 2.5 mL 20%
SDS, 40 mg OPA (dissolved in 1 mL methanol), and 100 ^iL (3-mercaptoethanol.
Dilute to a final 50 mL with dH 2 0. This reagent must be prepared daily.
5. 0.75 N trichloroacetic acid (TCA). This solution is prepared by weighting
61.24 g TCA and diluting to 500 mL with dH 2 0. The solution is stable for at
least 2 wk when stored at 4°C.
2.4.4. Amino Acid Analysis
1. Pico TagWork Station™.
2. 50 mm x 6 mm derivatization glass tubes.
3. Amino acids standards (Sigma).
4. Drying solution: methanol, sodium acetate trielthilamine TEA (2:2:1).
5 . Derivatization solution: prepare daily and consisted of methanol, H 2 0/TEA/phenyl
isothiocyanate (PICT) (7:1:1:1).
6. UV detector (240 nm).
7. A Waters Symmetry C18 (4.6 mm inside diameter by 250 mm) column.
8. Acetonitrile.
9. High-purity water (MilliQ).
10. Sample buffer: 0.005 M phosphate buffer, pH 7.4, containing 5% acetonitrile.
11. Eluent A: 70 mM acetate buffer, pH 6.55, containing 2.5% acetonitrile.
12. Eluent B: acetonitrile/H 2 0/metanol (45:40:15).
3. Methods
3. 7. Sarcoplasmic and Myofibrillar Experimental Systems
These systems consist of meat proteins extracted from bovine (Semimembrano-
sus) or porcine (Longissimus dor si) muscles. After removing fat and connective
tissue in aseptic conditions, cut the lean muscle into small cubes (3 cm) and keep at
-70°C until use.
152 Fadda, Vignolo, and Oliver
3.1.1. Sarcoplasmic System
1. Weigh 20 g of lean muscle in a stomacher bag.
2. Add 200 mL of 20 mM phosphate buffer, pH 7.4 (Note 6).
3. Homogenize this mix in a Stomacher 400 blender for 8 min.
4. Centrifuge the protein solution at 1 1,1 80g for 20 min at 4°C, to precipitate the
insolubilized protein and connective tissue.
5. Filter the supernatant containing the sarcoplasmic proteins through Whatman
paper.
6. Filter-sterilize this solution by using a 250-mL capacity filter (Bio-Rad). This
experimental system contain approximatly 1.95 mg/mL of protein.
3.1.2. Modified Sarcoplasmic System
To ensure the development of lactic acid bacteria in the sarcoplasmic system,
it is necesary to adjust the pH at 6.5 with 1 N NaOH in step 5; complement the
protein extract with 1 % glucose (w/v), as the carbon source, add it before filter-
sterilize (step 7) and just before use; supplement with 0.01% of Tween-80, as
the growth factor, previously sterilized.
3.1.3. Myofibrillar System (Note 7)
1. Weigh 10 g of the pellet resulting from the sarcoplasmic protein extraction
2. Add 100 mL of 20 mM phosphate buffer, pH 7.4, previously sterilized.
3. Process this mixture for 4 min in a Stomacher 400 blender.
4. Centrifuge for 20 min (1 1,1 80g at 4°C).
5. Repeat steps 2 and 3 twice (Note 8).
6. Weigh the resulting pellet and resuspend in 9 volumes of 0.1 N phosphate buffer
with 0.7 M KI, pH 6.5, containing 0.02 % sodium azide {see Note 9).
7. Homogenize for 8 min in the Stomacher.
8. After centrifugation (1 1,1 80g for 20 min at 4°C), dilute the supernatant 10 times
in the same buffer for enzymatic assays. The protein content of this myofibrillar
extract is 0.75 mg/mL {see Note 10).
3.1.4. Sterility Control
1. Inoculate two Petri dishes with 0.5 mL of each protein extract.
2. Add 30 mL of the melted plate count agar (PCA) {see Note 11) homogenizing prop-
erly.
3. Once the agar has solidified, invert the plates and incubate for 48 h at 37°C.
4. The growth of microorganisms must be negligible with colony-forming units
(CFU) below 1 x 10 2 CFU/mL.
Meat Protein Degradation 153
3.2. Proteolytic Activity in Aseptic Conditions; Effect of Curing
Conditions (see Note 12)
1. NaN0 2 : Add 200 \iL and 400 ^L of a 10,000-ppm stock solution of NaN0 2 to
20 mL of each experimental system (sarcoplasmic and myofibrillar) to evaluate
the effect of 100 ppm and 200 ppm of NaN0 2 on muscle proteolysis (tubes 1
and 2).
2. NaCl: Put 0.4 g and 1 g of NaCl, previously sterilized (15 min at 121 °C) in each
glass tube and add 20 mL of the experimental system to evaluate the effect of 3%
and 5% of NaCl on proteolysis (tubes 3 and 4).
3. Ascorbic acid: Add 2 mL of 1-mg/mL stock solution of ascorbic acid to 20 mL
of the sarcoplasmic or myofibrillar experimental system (final concentration
0.1 mg/mL) (tube 5).
4. Glucose+sucrose: Add 0.15 g of each sugar (0.75% w/v) to 20 mL of experimen-
tal medium and filter sterilize once more, to study the sugars effect on the muscle
proteolysis (tube 6).
5. Control: 20 mL of experimental muscle extract (tube 8).
6. pH: This variable is adjust with lactic acid (20% v/v solution) in aseptic
conditions to reach pH 4.2 and pH 5.0 (tubes 9 and 10).
7. To study the combination effect, all agents (3%NaCl, 200 ppm NaN0 2 . and
0.1 mg/mL ascorbic acid) were supplemented at the same time into 20 mL of the
sarcoplasmic and myofibrillar experimental systems (tube 11).
8. Incubate a set of tubes at the required temperature.
9. Take the samples (1 mL) at 0, 24, 48, 72, and 96 h stored at -70°C until proteolytic
analyses.
3.3. Proteolytic Activity of LAB on Muscle Proteins
3.3.1. Culture Conditions
Lactobacillus is routinely propagated in MRS broth and incubated at 30°C. They
were harvested at logarithmic phase (an overnight culture), washed twice with 20
mM phosphate buffer (pH 7.0), and inoculated in the required concentrations.
3.3.2. Ability of LAB to Grow in the Sarcoplasmic System
1 . Inoculate 30 mL of the sarcoplasmic modified medium with an overnight culture
grown in MRS broth to yield an initial number of 10 5 CFU/mL corresponding to
an optical density (680 nm) of 0.15 (see Note 13).
2. Incubate this culture for 96 h at 30°C.
3. Take samples every 24 h for pH, bacterial development, and proteolytic analysis.
Take 1 mL for each analysis.
4. The pH values are monitored potentiometrically using a pH meter. Take 2 mL of
the sample to carry out this measure.
5. Determine bacterial growth in MRS agar using 100 f^L of sample + 900 \xL of
peptone 0.1% to make decimal dilutions.
154 Fadda, Vignolo, and Oliver
• Inoculate 0.5 mL of each dilution in a Petri dish and add the melted MRS agar
by homogeneizing properly.
• Once solidified, add 10 mL more of MRS agar in a second layer (see Note 14).
• Once solidified, invert the plates an incubate 48 h at 30°C.
3.3.3. Proteolytic Activity of Different LAB Enzyme Sources on
Sarcoplasmic and Myofibrillar Proteins
To determine the role of intracellular enzymes (peptidases and aminopeptidases)
in muscle subtrates three independent assays are carried out for each type of protein
(sarcoplasmic and myofibrillar), using as enzymatic sources either whole cell
suspensions (WC), cell-free extracts (CFE), or a combination of WC+CFE (1:1).
3.3.3.1 . Obtention of Whole Cells
1. Harvest whole cells (WC) from of an overnight culture in MRS broth (30 mL)
by centrifugation (9060g, 4 Q C) and wash twice with phosphate buffer solution
(20 mM, pH 7.0).
2. Resuspend the washed cells in 6 mL of the same buffer solution (20% of
initial volume).
3. Aseptically add the 6 mL of WC to 30 mL of the sarcoplasmic or myofibrillar system.
3.3.3.2. Obtention of Cell-Free Extracts
1. Harvest cells from 30 mL of an overnight culture grown in MRS broth by
centrifugation and wash twice with phosphate buffer solution (20 mM; pH 7.0).
2. Resuspend the WC in the same buffer ( 1 0% of initial volume) supplemented with
sucrose and 1 mg/mL lysozyme (see Note 15).
3. After incubation at 30°C for 1 h, remove the cell-wall fraction by centrifugation
(25,160£for20minat4 Q C).
4. Wash the pellet in 20 mM phosphate buffer, pH 7.0, and resuspend in the same
buffer without sucrose (see Note 16).
5. Sonicate the cell suspension for 15 min in three cycles of 5 min each with inter-
mediate rest of 2 min (see Note 17).
6. Remove cell debris by centrifugation (44,740g for 20 min at 4°C). The
supernatant constitute the cell-free extract (CFE).
7. Aseptically add 6 mL of CFE to 30 mL of sarcoplasmic or myofibrillar extract.
3.3.3.3. Whole Cells+Cell-Free Extracts
1. In the case of the combination of the WC and CFE, combine 3 mL of each
enzymatic sample, twice concentrated (see Note 18).
2. Incubate each reaction mixture at 37°C for 96 h under shaking conditions (see
Note 19).
3. Take the samples at and 96 h for further analysis of pH, bacterial count, and
proteolytic events.
Meat Protein Degradation 155
3.3.4. Curing Conditions Effects on LAB Proteolytic Activity
1. Inoculate the sarcoplasmic and myofibrillar systems (30 mL) supplemented with
NaCl (3%), NaN0 2 (200 ppm), and ascorbic acid (0.1 mg/mL) with WC (6 mL)
as described in Subheading 3.3.2. with the selected Lactobacillus strain (see
Note 20).
2. Incubate the reaction mixture in shaking conditions for 96 h at the required
temperature.
3. Take the samples at and 96 h and analyze for protein degradation and peptide
and amino acid content.
3.3.5. Proteolytic Activity of LAB in a Sausage Experimental System
1 . Aseptically process 50 g of porcine and 50 g of bovine meat ( 1 : 1 ) in a home processor.
2. Supplement this mix with 3% of NaCl, 200 ppm NaN0 2 , 0.1 mg/mL of ascorbic
acid, and 1.5% (w/v) of glucose and sucrose (0.75% of each sugar); mix vigor-
ously. Divide the system into four batches.
3. This sausage-like system is divided in the number of batches according to the
LAB strains to be assayed. Cells are collected from a MRS broth overnight culture
and added to reach a final concentration of approx 2 x 10 8 CFU/mL. A mixed
culture of the strains and a control (without bacterial inocula) is also included
(see Note 21).
4. Properly homogenize each batch to ensure the efficient distribution of the micro-
organisms and additives.
5. Stuff into artificial casings of PVC (see Note 22). Heat seal properly.
6. Incubate at 25°C for 4 d.
7. Take the samples every 24 h and analyze for protein degradation, protein, peptide,
and free amino acids contents, pH, and bacterial development.
3.4. Methods Employed to Measure the Proteolytic Events
3.4.1. SDS-PAGE
The hydrolysis of muscle proteins is monitored by SDS-PAGE analysis (8)
using 12% and 10% polyacrylamide gels for sarcoplasmic and myofibrillar
proteins, respectively.
Table 1 lists the components necessary for making 10% and 12% polyacry-
lamide resolving gels and stacking 3% acrylamide gel. The quantities listed are
those necessary to prepare two Mighty Slab gels.
1 . Prepare the resolving gel mixture in 25 mL Erlenmeyer flasks containing everything
except the ammonium persulfate and the TEMED, which should be added immediatly
prior to pouring the gel. Homogenize gently, avoiding bubbles (see Note 23).
2. Pour the gel gently into the previously assemble slab gel casting unit, leaving
space for the sample well comb. Take care not to introduce any air bubbles. Over-
156 Fadda, Vignolo, and Oliver
Table 1
Composition of Polyacrylamide Resolving and Stacking Gels
Components
Final percentage (w/v)
acrylamide
Resoh
r ing gels 10%
12%
3% Stacking gel
Acrylamide stock + bis-aci
ylamide
4mL
4.8 mL
Stacking stock acrylamide
+ bis-acr
ylamide
1.5 mL
3MTrispH8.8
3mL
3mL
0.5MTris,pH6.8
1.25 mL
20% (w/v) SDS
60 |^L
120 \xL
25 fiL
H 2
2.46 mL
1.6 mL
1.17 mL
50% (v/v) Glycerol
2.4 mL
2.4 mL
1 mL
10% (w/v) Persulfate
75 fiL
75 ^L
30fxL
TEMED
10 ^L
10 \xL
10 fxL
lay the gel with isopropanol/H 2 solution (1:3) and allow to polymerize for
aproximately 20 min at room temperature (see Note 24).
3. After polymerization, rinse off the propanol solution and the unpolymerized
upper layer with water.
4. Prepare the stacking gel mixing the reagents as in the resolving gel preparation
and pour onto the top of the resolving gel. Use a sample well comb to form
wells for sample loading. Polymerization should be complete in 13-30 min at
room temperature.
5. Remove the sample well comb and wash the wells extensively with distilled water
to remove any unpolymerized acrylamide. Load the gel into the electrophoresis
tank and fill the lower and upper tanks with IX reservoir buffer. Gently remove the
gel combs after the upper reservoir is filled. You are now ready to load the samples.
6 . Mix samples with an equal volume of sample buffer: Boil in a water bath for 4-5 min
at 100°C to denature the sample (see Note 25).
7. Apply 20 \iL of sarcoplasmic or 25 \xL of myofibrillar proteins onto the gels
using a Hamilton syringe and store at -70°C until required (see Note 25).
8. Electrophorese at 50 mA at room temperature until the front marker reaches the
botom of the gel (approx 50 min).
9. Separate the gel plates, discard the stacking gel, and place the resolving gel gently
into staining solution. Stain the gel for 2 h with constant agitation and then trans-
fer to destain (see Note 26).
10. Destain for 2 h by replacing the destaining solution periodically (see Note 27).
3.4.2. rp-HPLC for Peptide Analyses
1. Deproteinize 2 mL of the sample with 5 mL of acetonitrile.
2. Vortex vigorously and allow to stand for 15 min at 4°C.
Meat Protein Degradation 157
3. Centrifuge the solution at ll,180g for 15 min and transfer the supernatant to a
clean 25-mL round-bottom flask.
4. Concentrate the supernatant to dryness by evaporation and resuspend in 200 fiL
of solvent A (see Note 28).
5. Apply 15 |^L of resuspended sample into a Waters Symmetry column previously
equilibrated under basal conditions.
6. Elute 1% solvent B in an isocratic phase for 5 min, followed by a linear gradient
from 1% to 100 % solvent B for 20 min, at a flow rate of 0.9 mL/min and at 40°C.
7. Peptides are detected at 214 nm.
8. Analyze the peptide peaks qualitatively by comparison between and 96 h and
with the control samples (see Note 29).
9. The chromatogram is concluded in 30 min.
3.4.3. OPA Method
The OPA reagent reacts with primary amines in the presence of a thiol group
(i.e., (3-mercaptoethanol) and is enhanced at basic pH. Under these conditions,
l-thioalkyl-2-alkylisoindoles are formed, which absorb strongly at 340 nm.
This method was developed to study milk protein hydrolysis (9). The modifi-
cation described here is to be used for meat proteins allowing the obtention of
satisfactory preliminary results:
1. Add 500 \xL of 0.75 N trichloride acetic acid (TCA) to 250 \xL of homogeinized
sample.
2. Vortex vigorously and allow to stand for 15 min at 4°C.
3. Centrifuge the solution at 13,000g for 15 min and transfer the supernatant to a
clean Eppendorf with a micropipet (see Note 30).
4. Add 1 mL of OPA reagent to 50 f^L supernatant in a 1-mL quartz cuvet.
5. Mix briefly by inversion and incubate 2 min at room temperature.
6. Measure the absorbance at 340 nm against the blank (sterile muscle protein extract).
7. Calculate the millimoles per liter of a-amino released (mM) from the following
relationship:
mM= 8AA 340 F
where AA 340 is the experimentally observed change of absorbance at 340 nm
using a 1-cm light path, F is the dilution factor corresponding to the assay
procedure, and 8 is the molar absorption coefficient (6000 Ml cm).
3.4.4. rp-HPLC for Amino Acid and Natural Dipeptide Analyses
The derivatized amino acids were analyzed by reverse-phase HPLC according
to the method of Aristoy and Toldra (10).
1. Deproteinize samples of 500 f^L plus 50 \xL of an internal standard (0.325 mg/mL
hydroxyproline) with 1375 \xL of acetonitrile.
158 Fadda, Vignolo, and Oliver
2. Vortex vigorously, allow to stand for 15 min at 4°C, and centrifuge at 1 1,1 80g.
3. The supernatant is derivatized to their phenylthiocarbamyl derivatives according
to the method of Bidlingmeyer et al. (11):
• Dry under vacuum 250 \xL of supernatant in the Pico Tag Work Station.
• Add 10 \xL of the drying solution (methanol/sodium acetate/TEA) and dry
under vacuum again.
• Add 20 f^L of the derivatization reagent (methanol/H 2 0/TEA/PICT).
• Vortex vigorously and incubate at room temperature for 20 min in darkness.
• Dry under vaccum.
• Resuspend the sample in 250 fiL of 0.005M phosphate buffer (pH 7.4)
containing 5% acetonitrile.
• Centrifuge at ll,180g at 4°C and the supernatant constitute the derivatized
amino acid sample.
4. Inject 15 f^L of each derivatized sample including the amino acid standard
mixture into the column previously equilibrated in basal conditions.
5. rp-HPLC is performed at 40°C during 72 min with a flow rate of 1 mL/min.
6. The separation gradient is as follows:
0-13 min: 100% of solution A
13-16.5 min: 3-31% solution B
16.5-30 min: 3.1-9% solution B
30-50 min 9-34% soultion B
50-60 min: 34% solution B
60-63 min: 34-56% solution B
65-70 min: 100% solution B
7. Calculate the amino acid concentration by the relationship of the peak area and
estandar amino acid concentration as follows:
Mg% A A = A A factor x Aa area x ProOH weight x 100
ProOH area (L5~~
4. Notes
1. When preparing the deionized urea for the sample buffer, do not add too much
water, the urea and thiourea takes up over half the final volume. Use latex gloves to
avoid contamination of the sample buffer with skin proteins.
2. Avoid temperatures above 40°C. Heated urea speeds cyanate formation.
3. The buffer capacity rapidly declines as the pH is lowered. Do not overshoot.
4. The conductivity should be less than 1 f^Q when the deonizaton is complete.
Another parameter to take in account when the deionization is finished is the change
of resin color. If not, more resin may need to be added.
5. Acetonitrile, methanol, and trifluoroacetic acid used for HPLC analysis must be
HPLC grade.
6. The sarcoplasmic proteins are soluble in low-ionic-strength solutions. Eight
minutes of stomacher process is sufficient to ensure the soluble protein
extraction.
Meat Protein Degradation 159
7 . Myofibrillar proteins are soluble only in high-ionic-strength solutions. It is
neccesary to increase the ionic strength by adding KI, but not higher than 0.7M to
protect microbial amino peptidases.
8. In the obtention the myofibrillar system, a complete elimination of sarcoplasmic
proteins must be done by properly washing the meat extract.
9. The myofibrillar extract cannot be filter sterilized because its gel nature. Sodium
azide is added to prevent bacterial development.
10. The myofibrillar extract must be diluted 10-fold just before use to avoid an
excessive inhibition of bacterial proteinases by KI.
11. PCA media is used to quantify the total aerobic organisms.
12. Curing additives concentrations are related to the technological parameters
used in industry. As regard as pH values, they are chosen to evaluate the
proteolytic phenomena in the midle (pH 5.0) and final (pH 4.2) stages of dry
sausage fermentation.
13. To avoid interference with the sarcoplasmic system, an optical density of 680 nm
was selected.
14. To ensure microaerophilic conditions, a second layer of MRS agar is applied.
15. It is necessary to supplement the buffer solution with sucrose and MgCl 2 at different
concentrations according to the strain to ensure cell integrity (i.e., 0.4 M sucrose
for L. plantctmm, 0.6 M sucrose and 5 mM MgCl 2 for L. curvatus and L. casei, and
0.45 M sucrose for L. sake). Lysozyme is used to digest the cellular wall.
16. To support osmotic shock, resuspension buffer (20 mM phosphate, pH 7.0) must
be free of sugars!
17. To prevent thermal enzyme inactivation, it is necessary to pause for 2 min
between each sonication cycle.
18. Whole cells and cell-free extract are concentrated when added together, to keep
the same enzyme content and to prevent dilution of the reaction mixture.
19. To ensure enzyme-substrate interaction of muscle proteins during the incubation
time at 30-37°C, shaking must be used.
20. The additive concentrations employed when combination effect were analyzed
are such that best proteolytic changes were observed. When BAL are added no
sugar were added to avoid a pH decrease.
21. The strains selected for use as mixed cultures must be compatible.
22. Avoid air bubbles when stuffing the meat mixture. It is known that the air bubbles
produce defects (i.e., mold contamination) in the final product
23. The dissolved oxygen in the gel solutions retards the acrylamide-bis polymeriza-
tion. Use disposable latex gloves and avoid polyacrylamide skin contact!
24. Optimal time to gel polymerization solution is 10-20 min. If the gel sets more
quickly, decrease the amount of ammonium persulfate; if the gel takes longer,
increase the ammonium persulfate. There is a considerable batch-to-batch
variation in the acrylamide and amonium persulfate so the levels need to be read-
justed with your own reagents. The acrylamide is gelled when a clear line can be
observed 1-2 mm below the isopropanol solution.
KDa
1
a
6 7
9
200
116
97.4
66
45
31
29
*»B W
Fig. 1. Proteoplytic activity of Lactobacillus on sarcoplasmic proteins after 96 h at
37°C, whole cells. 1. Molecular weight standards, 2. L. plantarum CRL681 h,
3. L. plantarum CRL681 96 h, 4. L. casei CRL705 h, 5. L. casei CRL705 96 h,
6. L. curvatus NCDO904 h, 7. L. curvatus NCDO904 96 h, 8. L. sake CECT4808 h,
9. L. sake CECT4808 96 h.
KDa
3
4
6
8
200 —
<«*
43.6
31
-
Fig. 2. Proteolytic activity of Lactobacillus on myofibrillar proteins after 96 h at
37°C, Whole cells + cell-free extracts. 1. Molecular weight standards, 2. L. plantarum
CRL68 1 h, 3. L. plantarum CRL68 1 96 h, 4. L. casei CRL705 h, 5. L. casei CRL705
96 h, 6. L. curvatus NCDO904 h, 7. L. curvatus NCDO904 96 h, 8. L. sake
CECT4808 96 h.
Meat Protein Degradation 1 6 1
25. Sample preparation: protein concentration can be readily determined by the
method of Bradford. Band resolution is improved if small volumes of sample
are applied to the gels. However, with all kinds of samples, avoid protein con-
centrations exceeding 5 mg/L. The sample volume applied onto the gel depends
on the protein concentration. It is necessary to have at least 20 fig of protein in
the total volume: sample + sample buffer. Do not boil more than 5 min
because the urea will form cyanate, which reacts with proteins and alters
the migration rates.
26. Staining should be done immediatly to avoid band broadening by diffusion. Alterna-
tively, soak gel in 50% methanol-10% acetic acid-40% dH 2 until ready to stain.
27. The most important proteolytic changes could be observed when lactic acid
bacteria WC and WC+CFE were present in the reaction mixture on both sarco-
plasmic and myofibrillar proteins, respectively (see Figs. 1 and 2).
28. The samples must be concentrated before HPLC analysis because of the low
concentration of free peptides in the muscle.
29. Hydrophilic peptides (desirable flavor products) are elueted first, whereas hydro-
phobic ones (bitter peptides) are eluted in the last 10 min.
30. The samples after the TCA treatment can be frozen at -20°C until further use.
References
1. Verplaetse, A. (1994) Influence of raw meat properties and processing technol-
ogy on aroma quality of raw fermented meat products in Proceedings of the 40th
International Congress on Meat and Technology, The Hague, pp. 45-65.
2. Flores, M., Aristoy, M. C, Spanier, A., and Toldra, F. (1997) Non-volatile
components effects on quality of Serrano dry cured ham as related to processing
time./. FoodSci. 62, 1235-1239.
3. Maga, J. A. (1982) Pirazines in foods: an update. Crit. Rev. FoodSci. Nutr. 16, 1-18.
4. Montel, M. C, Seronine, M. P., Talon, R., and Hebraud, M. (1995) Purification
and characterization of a dipeptidase from Lactobacillus sake. Appl. Environ.
Microbiol. 61, 837-839.
5. Sanz, Y. and Toldra, F. (1997) Purification and characterization of an aminopep-
tidase from Lactobacillus sake. /. Agric. Food Chem. 45, 1552-1558.
6. Sanz, Y., Mulholland, F., and Toldra, F. (1998) Purification and characterization
of a tripeptidase from Lactobacillus sake. /. Agric. Food Chem. 46, 349-353.
7. Sanz, Y. and Toldra, F. (1998) Aminopeptidases from Lactobacillus sake affected
by amines in dry sausages. /. Food Sci. 63, 894-896.
8. Fritz, J., Swartz, D. R., and Greaser, M. L. (1989) Factors affecting polyacrilamide
gel electrophoresis and electroblotting of high molecular weight myofibrillar
proteins. Anal. Bioc hem. 180, 205-209.
9. Church F. C, Swaisgood H. E., Porter H. D., and Catignani, G. L. (1983) Spectro-
photometry assay using o-phtaldialdehyde for determination of proteolysis in
milk and isolated milk proteins. /. Dairy Sci. 66, 1219-1227.
10. Aristoy, M. C. and Toldra, F. (1991) Deproteinization techniques for HPLC amino
acid analysis in J. Agric. Food Chem. 39, 1792-1795.
162 Fadda, Vignolo, and Oliver
11. Bidlingmeyer, B. A., Cohen, S. A., Tarvin, T. L., and Forst, B. A. (1987) A new,
rapid, high sensitivity analysis of amino acids in food type samples. /. Assoc. Off.
Anal.Chem. 70,241-247.
12. Bradford, M. M. (1976) A rapid and sensitive method for quantification of micro-
gram quantities of protein utilizing the principle of protein-dye binding. Anal.
Biochem. 72, 248-254.
20
Maintenance of Lactic Acid Bacteria
Graciela Font de Valdez
1. Introduction
Freeze-drying is commonly used for the long-term preservation and storage
of microorganisms in stock collections as well as for the production of starter
cultures for the food industry. The choice of an appropriate suspending medium
is of primary importance to increase the survival rate of the lactic acid bacteria
(LAB) during and after freeze-drying although the success of the process also
depends on several factors such as growth phase, extent of drying, rehydration,
suspension medium, cryoprotectors, and so forth (1-3). During freezing or freeze-
drying, cellular damage may occur, resulting in a mixed population containing
unharmed cells and dead cells as well as those sublethally injured. Damage may
not lead directly to death since in a suitable environment the injured cells may
repair and regain normal functions (4,5). Information on the requirements for
recovery from sublethal injury is important from the standpoint of food microbi-
ology and culture collections.
LAB can also be preserved for short-term storage. The techniques used will
be considered under the following headings:
1. Short-term maintenance for daily or weekly use. Rich, undefined media such as
MRS, LAPTg, M17, or Elliker broth are commonly used (see Subheading 2).
2. Long-term preservation, as in a culture collection, where immediate access is less
important, but maintenance of the characteristics of the species and strains is the
primary objective.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
163
164 FontdeValdez
2. Materials
2. 1. Growth Media
1. MRS broth (6). For 1 L:
a. Nitrogen source: polypeptone (10 g), meat extract (10 g), and yeast extract (5 g).
b. Carbon source: glucose (20 g).
c. Salts: K 2 HP0 4 (2 g), ammonium citrate (2 g), sodium acetate (5 g),
MgSO 4 -7H 2 (0.2 g), and MnS0 4 4H 2 (0.05 g).
d. Growth factor: Tween-80 (1 mL).
The pH is adjusted to 6.4 ± 0.2 before autoclaving at 121°C for 15 min.
2. LAPTg broth (7). For 1 L:
a. Nitrogen source: yeast extract (10 g), universal peptone (10 g), and tryptone (16 g).
b. Carbon source: glucose (10 g).
c. Growth factor: Tween-80 (1 mL).
The pH is adjusted to 6.6 before autoclaving at 121°C for 15 min.
3. Ml 7 medium for lactococci (8). For 1 L:
a. Nitrogen source: phytone peptone (5 g), polypeptone (5 g), yeast extract (5 g),
and beef extract (2.5 g).
b. Carbon source: lactose (5 g).
c. Ascorbic acid (0.5 g), (3-disodium glycerophosphate (19 g), 1.0 M
MgS0 4 -7H 2 0(l mL).
The pH is adjusted to 7.1 before autoclaving at 121°C for 15 min.
4. Elliker medium for lactococci (9). For 1 L:
a. Nitrogen source: tryptone (20 g), yeast extract (5 g), and gelatin (2.5 g).
b. Carbon source: dextrose (5 g), lactose (5 g), and sucrose (5 g).
c. Sodium chloride (4 g), sodium acetate (1.5 g), and ascorbic acid (0.5 g)
The pH is adjusted to 6.8 before autoclaving at 121°C for 15 min. All media
mentioned can be agarized by addition of 15 g/L agar (see Notes 1-5).
5. Nonfat milk powder (NFM) (100 g). Sterilize by autoclaving at 121°Cfor 15 min.
2.2. Short-Term Storage
1. Storage on liquid medium: tubes of any of the broth media, as described
previously; pipet with sterile tips.
2. Inoculum: bacterial cells, grown for 16 h in any of the media described to approx
10 8 — 10 9 colony-forming units (CFU)/mL.
2.3. Long-Term Storage
2.3.1. Lyophilization
1 . Cultures grown in any of the culture media described, for 16 h (overnight) at 37°C.
In the case of thermophilic species (e.g., Streptococcus salivarius ssp. thermo-
philus), the optimum incubation temperature may be in the range 39-4 1°C.
Maintenance of Lactic Acid Bacteria 1 65
2. Suspending media: NFM (20%), sodium glutamate (10%). For preparing NFM,
reconstituted skim milk powder may be used.
3. Freeze-drying apparatus, if available.
4. Acetone/dry-ice freezing bath, if a commercial freeze-drying apparatus is not
at hand.
5. Ampules, standard.
6. Labels, permanent markers.
7. Sterile Pasteur pipets.
8. Small cotton plugs for ampules.
9. Torch, for sealing ampules under vacuum.
10. When using double vials:
a. Tubes with flat bottom (outer vials).
b. Vials, 2 mL, flat bottom (inner vials).
c. Silica gel, to confirm the dryness of the lyophilized samples.
1 1 . When a commercial drier is not available:
a. Vacuum pump in good condition.
b. Acetone/dry-ice bath, for freezing.
c. Manifold for attaching ampules for vacuum-drying.
2.3.2. Freezing
1. Storage in liquid medium or in NFM; pipet with sterile tips.
2. Inoculum: washed bacterial cells obtained by centrifugation of cultures grown
for 16 h in any of the media described, and taken to half of the initial volume
(approx 10 8 — 10 9 CFU/mL) with sterile distilled water.
3. Cryoprotectant: glycerol, sterile.
4. Small cultures tubes or cryovials, 3—4 mm in diameter, sterile.
5. Freezer, capable of operation at -70°C.
6. Waterproof markers.
2.3.3. Storage Under Liquid Nitrogen
1. Plastic ampules, 2 mL; screw cap, sterile.
2. Inoculum: bacterial cells, grown at the selected temperature for 16 h in any of the
liquid media as described, to a cell density of 10 8 — 10 9 CFU/mL.
3. 10% or 20% cryoprotectant, sterile glycerol solution, 10% v/v dimethyl sulfoxide
(DMSO).
4. Liquid-nitrogen refrigerator, and also a domestic freezer (-30°C) if available, or
a cooling bath.
5. Dewar flask for transporting frozen ampules.
6. Racks for holding the ampules in the freezer, and other ancillary equipment.
7. Permanent markers for ultralow temperatures {see Note 6).
166 Fontde Valdez
3. Methods
3.7. Short-Term Storage
1 . Label the tubes containing 5-10 mL of the selected liquid medium carefully with
a waterproof marker (preferently black or blue).
2. Inoculate (4%, v/v) with an overnight active culture. Keep under refrigeration
(4-6°C) without previous incubation. Cells remain viable up to 10 d.
3. When needed, place the tubes at room temperatures for 15-20 min and incubate
at the proper temperature for 16 h. Make at least two or three transfers in fresh
medium before using.
3.2. Long-Term Storage
3.2. 7. Freezing
1. Carefully label 1 to 2-mL screwcap cryovials with a waterproof marker (black or
blue preferred).
2. Inoculation into NFM: Harvest and wash once by centrifugation the cells from a
10-mL overnight active culture. Resuspend the cell pellet into 1-2 mL 10% NFM
supplemented with 1% (w/v) glucose, 0.5% (w/v) yeast extract, and 10% (v/v)
glycerol (final concentration) and store in a domestic freezer (-20°C to -30°C) or
even better, at -60 to -70°C.
3. Inoculation into glycerol solution: Take an aliquot of the washed pellet and make
up to a glycerol concentration of 15-50%. Different workers prefer different
concentrations of glycerol in the final mixture.
a. Transfer the mixture to the sterile cryovials, freeze, and store as described in step 2.
b. Routine transfers are made by scraping a little of the culture from the surface
of the frozen medium and transferring to fresh medium.
4. If the freezer should fail, the culture can be transferred and a fresh subculture
frozen later.
5. Survival (shelf life) is for several years, cultures stored at -70°C surviving longer
than those kept at -20°C. Several tubes of each strain should be stored.
6. For thawing, place the cryovials at room temperature or in a water bath at 37°C
and inoculate tubes containing 5-10 mL of the proper liquid medium. Incubate
the tubes at the selected temperature for 16-18 h. Make at least two or three
transfers in fresh medium before using (see Note 7).
3.2.2. Storage Under Liquid Nitrogen
1. Mix equal quantities of inoculum (washed) and the glycerol solution (or other
cryoprotectant) in a sterile tube, so that the final concentration of glycerol is 10%
(v/v). Transfer 1 mL of the mixture to each of the ampules.
2. Freeze the preparations in a domestic freezer or cooling bath, to -30°C, at a rate
of about 5°C/min and allow to dehydrate for 2 h.
Maintenance of Lactic Acid Bacteria 167
3. Transfer the frozen ampules, without thawing, to the liquid-nitrogen refrigerator.
Use the chilled Dewar flask if necessary.
4. Maintain the level of liquid nitrogen to where the ampules are completely
submerged. Shelf life is for many years.
5. Cultures are revived by rapid thawing in a water bath at 37°C.
3.2.3. Lyophilization
3.2.3.1. Double-Vial System
1. Label the inner vials carefully. Labels may be printed by machine to reduce the
possibility of mislabeling or written with waterproof markers.
2. Prepare outer vials by placing a small amount of silica gel granules (6-16 mesh)
in the vial to cover about half of the bottom. Add a small cotton wad to cushion
the inner vial and heat at 100°C overnight. The silica gel should be dark blue
after heating; this serves as a moisture indicator during storage. Place vials in a
dry box (<10% relative humidity) to cool.
3. Aseptically, mix equal amounts of inoculum (washed) and suspending medium
in a sterile tube or bottle.
4. Inoculation of the inner vial: Six drops of the mixture (0.2 mL) are transferred to
the bottom of each vial with a sterile Pasteur pipet. Do not touch the side of the vial.
5. Replace the cotton plug and trim it so the cotton is even with the rim of the vial.
Place the inner vial in a pan, in racks, or in boxes in a freezer at -60 to -70°C
and let the samples freeze for 1-2 h. In the case of a domestic freezer (-20°C to
-30°C), let the samples freeze overnight.
6. Chamber-type freeze-dryer: The plates of the freeze dryer should be frozen as well.
Let the condenser cool at -60°C to -70°C (about 30 — 45 min) and then place the
frozen inner vials on the plates. Evacuate the system to below 30 ^imHg (4 Pa).
7. Start the process in the afternoon and allow to run about 18 h. The system is
monitored by a thermistor vacuum gage. When the vacuum sensor is placed
between the product and the condenser, it will show an increase in pressure as
drying occurs. However, when drying is complete, the pressure should return to
below 30 f^rnHg.
8 . When the cycle is complete, close the vacuum line between the chamber (containing
the plates with the dried samples) and the condenser. Open the valve on the inlet
port to admit air, allowing pressure in the cabinet to reach atmospheric.
9. Insert the inner vials into the outer vials. Tamp a 1/4-in. plug of glass fiber paper
above the cotton-plugged inner vial. Heat the outer vial in an air/gas torch, rotat-
ing the vial and keeping the flame just above the glass fiber paper until the glass
begins to constrict. Pull the top of the vial slowly with forceps until the constric-
tion is a narrow capillarly tube. Cool the vials in a dry cabinet.
10. Attach each vial to a port of a manifold. Each port has a single-holed rubber
stopper that fits the open end of the vial. Evacuate the system to less than
50 f^mHg (7 Pa). Seal the vials at the capillarly using a double-flame air/gas torch.
168 Fontde Valdez
1 1 . Store vials at 2-8°C. To open the vials, heat the tip of the outer vial in a flame, then
squirt a few drops of water on the hot tip to crack the glass. Strike with a file or pencil
to remove the tip. Remove the fiber paper insulation and the inner vial. Use forceps to
gently remove the cotton plug and rehydrate with 0.3-0.4 mL of appropriate broth
medium. When resuspended, transfer the content to 5-6 mL of broth and incubate at
the selected temperature for 16-18 h (see Notes 8-12).
3.2.3.2. Manifold System
1 . There are two types of ampules used in the manifold method. A 1-mL bulb-shaped
ampule (8.0 mm outside diameter) facilitates shell freezing and is generally used
when cryoprotectants are added. A 1-mL tubular ampule (8.0 mm outside
diameter) is used when the culture is suspended in skim milk without a cryo-
protector; the product will freeze as a pellet.
2. Plug the ampules lightly with cotton. Autoclave at 121°C for 60 min. Label the
ampules before or after sterilization as described in step 1 of Subheading 3.2.3.1.
3. Prepare the cell suspension as described in step 3 of Subheading 3.2.3.1.
4. Dispense 0.2 mL of the material into each of the sterile ampules. Depress the
cotton plug approximately 1/2 in. below the rim of the ampule using a sterile
probe and flame the rim to remove any residual cotton fibers that would interfere
with the integrity of the vacuum system.
5. Attach a 1-in. piece of nonpowdered amber Latex IV tubing to the rim of each
ampule using a tubing stretcher.
6. If tubular ampules are used, freeze the material by direct immersion in a dry ice/
ethylene glycol bath or by a controlled freezer (step 5 of Subheading 3.2.3.1.),
after which ampules are immersed in the bath for further processing.
7. For material in bulb-shaped ampules, immerse in a dry-ice/ethylene glycol bath
and rotate the ampule to effect shell freezing. Some lyophilizers contain an alcohol
bath that may be cooled to temperatures below -70°C, according to the equipment.
8. Let the condenser cool at -60°C to -70°C (about 30 min) and then attach ampules
to the ports on the manifold while they are immersed in the dry-ice slush. This is
particularly important when the material is frozen as a pellet.
9. In shell-frozen samples or when ampules cannot be maintained in the dry-ice
bath while drying, they can be attached one by one to the manifold port, turning
on the vacuum after each connection of the ampule.
10. Attach a thermistor vacuum gage between the condenser and the vacuum pump.
An additional gage may be placed between the manifold and the condenser.
1 1 . Start the cycle early in the afternoon and allow to run overnight. Ambient tempera-
ture (not over 25 °C) would be the heat source for drying. At the end of the drying
cycle, use a double-flame air/gas torch to seal the ampules, moving the flame up and
down the ampule within a 1-in. area below the cotton plug. After the ampules have
cooled, a cellulose sleeve may be applied to protect the label and the ampule tip.
12. Store the freeze-dried material at 2-8°C.
Maintenance of Lactic Acid Bacteria 1 69
13. To open single-vial preparations, first remove the cellulose film with a sharp
blade or by soaking briefly in water. Then, score the ampule once with a file 1 in.
from the tip. Desinfect the ampule with alcohol-dampened gauze. Wrap gauze
around the ampule and break at the scored area. Rehydrate in appropriate broth at
once (see Notes 13 and 14).
4. Notes
1. MRS broth has become the standard culture medium for lactobacilli. It is
available from Merck in the dehydrated form, but it can be made up in the
laboratory if desired. The reagents must be of very high quality. For some
purposes, such as in fermentation tests, the meat extract and glucose are omitted.
2. LAPTg broth is not as rich as MRS broth, but it can be used for both lactobacilli
and streptococci (including lactococci).
3. M 17 broth has become the standard for genetic investigations because lactococcal
bacteriophages can be efficiently demonstrated and distinguished on M17 agar.
Plaques larger than 6 mm in diameter could be observed as well as turbid plaques,
indicating lysogeny. Streptococcus salivarius ssp. thermophilics and enterococci
also grow well in this medium.
4. Elliker broth is probably the most cited for the isolation and growth of lactococci,
although it is unbuffered. This disadvantage can be overcome by the addition of
suitable buffer substances. Addition of 0.4% (w/v) of diammonium phosphate
improves the enumeration of lactic streptococci on Elliker agar.
5 . Maintenance of the cultures at refrigeration temperatures is useful for routine work
in the laboratory. However, it is not recommended as the conservation method
because subculturing is susceptible to contamination and errors during execution.
6. Freezing in liquid nitrogen is technically simple but requires preliminary
experimentation to establish the optimum freezing conditions, because strains vary
widely in their levels of survival at different freezing rates. On the whole, a two-
step system is employed, as microbial cells should not freeze directly to the
temperature of liquid nitrogen. The cells are first cooled to a temperature between
-20°C and -40°C and allowed to dehydrate at this temperature in order to remove
sufficient water from the cells to allow subsequent rapid cooling to -196°C.
7. Removal of too much water from the cells during freezing leads to a concentration
of solutes within the cells that may be harmful (osmotic stress). However, too much
water remaining inside the cell can result in intracellular damage from ice-crystal
formation (mechanical damage). The delicate balance between these two events is
maintained by carefully controlling the cooling rate when freezing cells, and warm-
ing the frozen product as quickly as possible during the thawing process.
8. The freeze-drying process consists of three steps: prefreezing of the sample to
ensure a solidly frozen starting structure, primary drying during which most of
the water is removed, and secondary drying to remove bound water. Prefrezing
of the cell suspension is a key step. Rapid cooling results in small ice crystals,
170 Fontde Valdez
useful in preserving the cell structures, but the product is more difficult to freeze-
dried. Slower cooling results in larger ice crystals and less restrictive channels in
the matrix during the drying process.
9. During the prefreezing process, most products form eutectics. Eutectics are solutes
that freeze at lower temperatures than the surrounding water. The higher the concen-
tration of solutes in the suspending medium, the lower the freezing temperature to
reach the eutetic temperature. For effective freeze-drying, the product must be cooled
until all of the eutetic mixtures are frozen (eutectic temperature). Small pockets of
unfrozen material remaining in the product may not be visible; however, under high
vacuum, the melted pockets will expand, causing the product to bubble. These facts
will affect the structural stability of the the freeze-dried product.
10. Sublimation of the frozen water requires very careful control of the two param-
eters involved in lyophilization, temperature and pressure. No matter what type
of freeze-drying system is used, conditions must be created to encourage the
free flow of water molecules from the sample, which depends on the vapor
pressure differential between the product and the condenser. Therefore, the
condenser temperature must be significantly lower than the product tempera-
ture. Sublimation of water is enhanced by heat, which can be applied by several
means: directly, through a thermal conductor shelf as is used in tray drying, or
by using ambient heat as in manifold drying.
11. After all ice crystals have been sublimed, bound moisture is still present in the
product, which appears dry but the residual mositure may be as high as 7-8%.
The further storage stability of the dried cells depends on the reduction of humid-
ity to optimal values (about 1-2%). In manifold systems and tray dryers with
external condensers, the drying end point can be determined by valving off the
path to the condenser and measuring the pressure above the product with a
vacuum gage. If drying is still occurring, the pressure in the system will increase.
1 2 . Two of the most important factors that can affect the stability of freeze-dried cells are
moisture and oxygen. The amount of moisture remaining in the material depends on
the nature of the product (suspending medium, cryoprotectants) and the length of
secondary drying. The freeze-dried samples should be stored at refrigeration
temperatures. The higher the storage temperature, the faster the product will degrade.
13. When opening single-vial preparations, care should be taken not to have the gauze
too wet, or alcohol could be sucked into the culture when the vacuum is broken.
14. After addition of the liquid for rehydration, let the sample settle for 5-10 min
before transferring to the appropriate culture medium for growing.
References
1. De Valdez, G. F., De Giori, G. S., Ruiz Holgado, A. P., and Oliver, G. (1985).
Effect of the drying medium on the residual moisture content and viability of
freeze-dried lactic acid bacteria. Appl. Environ. Microbiol. 49, 413-415.
2. De Valdez, G. F., De Giori, G. S., Ruiz Holgado, A. P., and Oliver, G. (1985).
Effect of the rehydration medium on the recovery of freeze-dried lactic acid
bacteria. Appl. Environ. Microbiol. 50(5), 1339-1341.
Maintenance of Lactic Acid Bacteria 1 71
3. De Valdez, G. F. and Diekmann, H. (1993). Freeze-drying conditions of starter
cultures for sourdoughs. Cryobiology 30, 185-190.
4. De Valdez, G. F. and de Giori, G.S. (1993). Effect of freezing and thawing on the
viability and amino acids uptake by L. delbrueckii ssp. bulgaricus. Cryobiology
30, 329-334.
5. Fernandez Murga, M. L., de Ruiz Holgado, A. P., and de Valdez, G.F. (1998).
Survival rate and enzyme activities of Lactobacillus acidophilus following frozen
storage. Cryobiology 36, 315-319.
6. De Man, J. C., Rogosa, M., and Sharpe, M. E. (1960). A medium for the cultiva-
tion of lactobacilli. /. Appl. Bacteriol. 23, 130-135.
7. Raibaud, P., Coulet, M., Galpin, J. V., and Mocquot, G. (1961). Studies on the
bacterial flora of the alimentary tract of pigs. II Streptococci: selective enumera-
tion and differentation of the dominant group. /. Appl. Bacteriol. 24, 285-291.
8. Terzaghi, B. E., and Sandine, W. E. (1981). Bacteriophage production follow-
ing exposure of lactic streptococci to ultraviolet radiation. /. Gen. Microbiol.
122,305-311.
9. Elliker, P. R., Anderson, A.W., and Hannesson, G. (1956). An agar medium for
lactic acid streptococci and lactobacilli. /. Dairy Sci. 39, 161 1-1612.
21
Probiotic Properties of Lactobacilli
Cholesterol Reduction and Bile Salt Hydrolase Activity
Graciela Font de Valdez and Maria Pia Taranto
1. Introduction
Among the probiotic effects attributed to lactic acid bacteria (LAB), the
assimilation of cholesterol (1) would be of particular interest for reducing the
absorption of dietary cholesterol from the digestive system into the blood. Several
studies have indicated that the cholesterol removal would be related to the ability
of the cultures to deconjugate bile salts (2).
Bile tolerance and gastric juice resistance (3) are another important
characteristics of probiotic lactic acid bacteria used as adjuncts because they
enable them to survive, to grow, and to perform their beneficial action in the
gastrointestinal tract (GIT). Although the degree of tolerance required for
maximum growth in the GIT is not known, it seems reasonable that the most
bile- and acid-resistant species should be selected.
The techniques used to selecting LAB for probiotic purposes will be considered
under the following headings:
1. Bile tolerance, using differents bile salts concentrations.
2. Resistance to gastric juice.
3. In vitro cholesterol reduction on the presence of bile salts.
4. Bile salt hydrolase activity, determined by three complementary methods: plate
assay, colorimetric method, and high-performance liquid chromatography (HPLC).
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
173
174 Font de Valdez and Taranto
2. Materials
2. 1. Growth Media for 1 L
MRS broth (4) is used extensively for maintaining and culturing lactobacilli.
1. Nitrogen source: polypeptone (10 g), meat extract (10 g), and yeast extract (5 g).
2. Carbon source: Glucose (20 g).
3. Salts: Sodium acetate (5 g), ammonium citrate (2 g), KH 2 P0 4 (2 g), MgS0 4 -7H 2
(0.25 g), MnS0 4 4H 2 (0.058 g).
4. Growth factor: Tween-80 (1.08 mL) (see Fig. 1).
5. Final pH 6.4 ± 0.2. Sterilize at 121°C for 20 min.
2.2. Media for Determination of Bile Tolerance for 1 L
MRSO broth: MRS broth supplemented with 0.5, 1, 1.5, and 3 g bile Oxgall
(Difco Laboratories) to obtain a final concentration of 0.05%, 0.1%, 0.15%,
and 0.3 %, respectively. (See Note 1). Sterilize at 121°C for 20 min.
2.3. Media for Determination of Acid Resistance for 1 L
Artificial gastric juice: NaCl (2 g), pepsine (3,2 g), adjusted at a final pH 2-2.3
with HC1 without dilution (approx 7 mL), and take to 1 L with distilled water. As a
control, artificial gastric juice adjusted at a final pH 6.5-7.0 with 5 N NaOH is
used. Sterilize by filtration (filter membrane 0.22 fim).
2.4. Media for Determination of Cholesterol Reduction for 1 L
MRSOCH broth: Add 3 g bile oxgall to MRS broth and sterilize at 121 °C
for 20 min. Supplement the culture medium with 1 % (v/v) of Lipids Cholesterol
Rich (Sigma, L-4646) stored at 4°C. The Lipids Cholesterol Rich is sterile and
must be added at the moment of using.
2.5. Media for Bile Salt Hydrolase Activity for 1 L
2.5.1. Plate Assay
1. MRS agar: Add 12 g granular agar to MRS broth and sterilize the medium at
121°Cfor20min.
2. MRSBA agar: Supplement MRS broth with 12 g granular agar, 5 g thyoglycholate
(see Note 2) and 5 g of the sodium salt of one of the following compounds:
taurocholic acid (TCA), glycocholic acid (GCA), taurodeoxycholic acid (TDCA),
or glycodeoxycholic acid (GDCA). In all cases, the final concentration of the
conjugated acid is approx 4 mM. Sterilize at 121°C for 20 min.
2.5.2. Colorimetric Method
MRSTT broth: MRS broth supplemented with 5 g thioglycholate and 5 g
TCA (final concentration, 4 mM). Sterilize at 121°C for 20 min.
Probiotic Properties of Lactobacilli
175
ti t 2
Time (min)
Fig. 1. Example for calculating growth delay. D = t 2 -t 1(
2.5.3. HPLC
MRSTC broth: MRS broth supplemented with 0.5 g cysteine chlorhydrate
(see Note 2) and 5 g TCA (final concentration, 4 mM). Sterilize at 121 °C for 20 min.
2.6. Materials for Bile Tolerance
1 . An active culture grown in MRS broth for about 16 h at 37°C (overnight culture).
2. Phosphate buffer: Solution A (0.2 M NaH 2 P0 4 ): Weigh 27.6 g NaH 2 P0 4 H 2
and make to 100 mL with distilled water (dH 2 0). Solution B (0.2 M
Na 2 HP0 4 ): Weigh 53.05 g Na 2 HP0 4 -7H 2 and make to 100 mL with dH 2 0.
To prepare 1 L of 0.1 M sodium phosphate buffer (pH 7.0), mix 195 mL of
solution A and 305 mL of solution B and bring to 1000 mL with dH 2 0. Ster-
ilize at 121°Cfor 20 min.
3. MRSO broth: MRS broth supplemented with different concentrations of bile salts,
as mentioned in Subheading 2.2.
2.7. Materials for Gastric Juice Resistance
1. An overnight culture in MRS broth.
2. 0.1 M phosphate buffer, pH 7.0, sterile.
3. Artificial gastric juice, pH 2-2.2 and pH 6.5-7.0.
4. 0.1% peptone water: To prepare 1 L, weigh 1 g peptone and bring it to 1000 mL
with dH 2 0. Sterilize at 121°C for 20 min.
5. MRS agar.
176 Font de Valdez and Taranto
2.8. Materials for Cholesterol Reduction
1. An overnight culture in MRSOCH broth.
2. Ethanol (95%), prepared at the moment of using or stored at 4°C.
3. Potassium hydroxide (50%), stable at room temperature.
4. Hexane pure, stored at 4°C.
5. Distilled water.
6. Nitrogen gas.
7. oPhthalaldehyde reagent. This reagent contains 0.5 mg ophthalaldehyde (Sigma)
per mL of glacial acetic acid. It is prepared at the moment of using.
8. Concentrated sulfuric acid.
2.9. Materials for Bile Salt Hydrolase Activity
2.9.1 Plate Assay
1. An overnight culture in MRS.
2. MRS agar.
3. MRSBA agar (see Fig. 2).
2.9.2. Colorimetric Assay
1. An overnight culture in MRSTT broth.
2. NaOH (1 N), stored at room temperature.
3. Distilled water.
4. HO (10 A0, stable at room temperature.
5. Ethyl acetate pure, stored at 4°C.
6. Nitrogen gas.
7. NaOH (0.01 A0, stable at room temperature.
8. Sulfuric acid (16 A0, stable at room temperature.
9. 1 % Furfuraldehyde. This reagent is particularly toxic and must be prepared at the
moment of using.
10. Glacial acetic acid.
2.9.3. HPLC Analysis
1. An overnight culture in MRSTC broth.
2. Membrane filter (0.22 fim).
3. C18 Spherisorb 5-fim column (250 x 4.6 mm).
4. Programmable solvent module (126 M).
5. 106 Dioxide array detector.
6. Ultraviolet detector (210 nm).
7. Eluent A: 65% methanol in 0.03 M sodium acetate, pH 4.3.
8. Eluent B: 90% methanol in 0.07 M sodium acetate, pH 4.3 (see Note 3).
Probiotic Properties of Lactobacilli
177
Fig. 2. Bile salt hydrolase activity in LAB on MRS agar: (A) plate with TDCA; (B)
plate with GDCA; (C) control.
178 Font de Valdez and Taranto
9. Standard solution of bile acids: taurocholic (0.2 mg/mL), glycocholic (0.2 mg/mL),
and cholic acids (0.4 mg/mL). Filter the solution before injection by using a 0.22-jim
filter membrane.
3. Methods
3. 1. Bile Tolerance
1. Grow the lactobacilli under study in MRS broth at 37°C for 16 h.
2. Harvest the cells by centrifugation at 5000g for 10 min.
3. Wash twice the pellet obtained with 0.1 M phosphate buffer, pH 7.0.
4. Resuspend the cells to the original volume with the buffer by vortexing.
5. Inoculate (0.5%) (see Note 4) MRS and MRSO broth with the bacterial suspension.
6. Incubate at 37°C in water bath.
7. Read the optical density at 560 nm (OD 560 ) against the blank (uninoculated broth)
every hour for the first 8 h and after 24 h of incubation.
8. Plot optical density values against incubation time (see Note 5).
3.2. Gastric Juice Resistance
1 . Repeat steps 1-4 of Subheading 3.1.
2. Inoculate (2%) the artificial gastric juice pH 2-2.3 and pH 6.5-7.0 with the
bacterial suspension.
3. Incubate both media at 37°C and take samples at 0, 1,2,3, and 4 h and after 24 h
for cell viability.
4. Plate in MRS agar (in mass) proper dilutions from 10-fold serial dilutions
prepared in 0.1% peptone water.
5 . Incubate the plates at 37°C for 24 h, and count the resulting colonies after that time.
Results are expressed as colony-forming units (CFU) per milliliter (CFU/mL).
3.3. Cholesterol Reduction (5)
1 . Inoculate ( 1 %) 20 mL of MRSCHO broth an overnight culture in MRS broth and
incubate at 37°C for 16 h. Uninoculated MRSCHO broth (control) is processed
in the same way.
2. Remove the cells by centrifugation at 8000g for 5 min. Place the sample (0.5 mL
supernatant) into a clean glass tube.
3. Add 3 mL of 95% ethanol to each tube, followed by 2 mL of 50% potassium
hydroxide. Mix after the addition of each component.
4. Heat the tubes in water bath at 60°C for 10 min. Cool at room temperature (20°C).
5. Carefully add 5 mL of hexane. Mix vigorously with a vortex for 20 s. Add 3 mL
dH 2 and repeat the mixing with the vortex.
6. Let the tubes settle at room temperature for 15 min or until complete phase
separation (aqueous and organic phase).
Probiotic Properties of Lactobacilli 1 79
7. Transfer 2.5 mL of the hexane layer (upper phase) into a clean tube. Evaporate
hexane to dryness at 60°C under nitrogen gas flow.
8. Resuspend the residue formed in 4 mL of ophthalaldehyde reagent. Keep the tubes
at room temperature for 10 min and then pipet 2 mL of concentrated sulfuric acid
slowly down the inside of each tube. Mix thoroughly as described previously.
9. After standing at room temperature for an additional 10 min, read the absorbance
at 550 nm (A 550 ) against the reagent blank (see Note 6).
10. The results are expressed as micrograms (\xg) of cholesterol per milliliter.
3 A. Bile Salt Hydrolase Activity
3.4.1. Plate Assay (6)
1. Melt the agar media: MRS agar and MRSBA agar (described in Subheading
2.5.1.) in boiling water. Pour each melted medium separately into sterile Petri
dishes (60 x 15 mm).
2. Once solidified, invert the plates and place in an anaerobic chamber for at least
48 h before using.
3. Inoculate each plate on surface with an overnight culture grown in MRS broth by
using a lO-pL loop.
4. Incubate the plates at 37°C in anaerobic jars (Systen Oxoid) for 72 h.
5. The bile salt hydrolase activity of the cultures is evidenced by the formation of a
white precipitate around the colonies grown in MRSBA agar. This precipitate is not
observed in MRS agar (control) without bile salts, where colonies are translucent
(see Note 7).
3.4.2. Colorimetric Assay (7)
1. Inoculate (1%) 20 mL of MRSTT broth with an overnight culture grown in MRS
broth and incubate at 37°C for 16 h.
2. Adjust the pH to 7.0 with 1 N NaOH and take to 25 mL with distilled water (see
Note 8).
3. Remove the cells by centrifugation at 12,000g at 4°C for 10 min.
4. Adjust 15 mL of the resulting supernatant fluid to pH 1.0 by using 1 N HC1 and
take to 24 mL with distilled water. (See Note 8).
5. Transfer 3 mL of each sample to glass test tubes and add 9 mL of ethyl acetate.
6. Mix the content of each tube and let settle to allow the complete phase separation.
7. Transfer 3 mL of the ethyl acetate layer (upper phase) to a clean test tube and
evaporate to dryness at 60°C under nitrogen gas flow.
8. Dissolve the residue formed with 1 mL of 0.01 N NaOH.
9. Carefully add 6 mL of 16Af H 2 S0 4 to each tube, followed by the addition of 1 mL
of 1% furfuraldehyde.
10. Mix the tubes, heat at 65 °C for 13 min in water bath, and cool at room temperature.
180 Font de Valdez and Taranto
11. Add 5 mL of glacial acetic acid to each tube, mix the content vigorously, and
read the absorbance at 660 nm (A 660 ) against the reagent blank (see Note 9).
12. The results are expressed as micromoles (jimol) cholic acid per milliliter.
3.4.3. HPLC Analysis (8)
1. Inoculate (1%) MRSTC broth with an overnight culture grown in MRS broth and
incubate at 37°C for 16 h.
2. Remove the cells by centrifugation at 8000g for 5 min and filter the supernatant
by using a of 0.22-jam filter membrane.
3. Inject 50 ^JL of each standard solution, previously filtrated and diluted (1:2).
4. Perform the analysis on a 250 x 4.6-mm C18 Spherisorb 5-|im column.
5. Use the following elution program: isocratic elution with 15% of eluent B, 85%
of eluent A for 10 min, then a 25-min linear gradient to 90% of solvent B.
6. Maintain the mobile-phase composition at 90% of solvent B. The flow rate is
1 mL/min.
7. Perform the detection at 210 nm, and process the data with System Gold™
software.
8. After running the standard, follow steps 3-7 for the samples obtained in step 2,
which are also filtered and diluted (1:2) (see Note 10).
4. Notes
1 . The range of bile salt concentration used (0.05-0.3%) corresponded to that found
in the human intestinal tract; 0.3% bile is the maximun concentration that is
present in healthy men.
2. Lactic acid bacteria are anaerobic or microaerophile. Culture growth in liquid
and agarized media for evaluation of both cholesterol reduction and bile salt
hydrolase activity were performed under anaerobiosis. Thioglycholate and cys-
teine chlorhydrate are used to mantain a low redox potential.
3. Methanol and sodium acetate used for HPLC analysis must be of HPLC grade.
4. For determing the bile tolerance of the cells, it is important to use a low inoculum
(0.5%, v/v) in order to have a low initial OD 560 value and to assure that the culture
is at an early exponential phase of growth.
5. The comparison of the cultures is based on the time required for each of them to
increase the OD 560 by 0.3 units (generally, this value is found in the early exponen-
tial phase of growth) in both MRS and MRSO broths; the difference in time (min)
between the culture media is considered as the growth delay (D) (see Fig. 1).
6. The A 550 is compared with a standard curve to determine the concentration of
cholesterol. The same procedure for the samples is used for the standard curve,
except that the following amounts of cholesterol (Sigma L-4646) are assayed in
place of the samples: 0, 10, 20, 30, 40, 50, 60, 70, 80, 90, and 100 f^g. The A 550
values are plotted against microgram of cholesterol.
Probiotic Properties of Lactobacilli 1 8 1
7. TDCA and GDCA produce the most sharply defined halos (white dense
precipitate and diffused halos around colonies, respectively {see Fig. 2), whereas
TCA and GCA are slightly less effective. Strains with a high bile salt hydrolase
activity for TDCA and GDCA will also release high concentrations of
deoxycholic acid, which may inhibit the growth in the plate. In this case, it is
suggested to use a lower TDCA or GDCA concentration (2 raM).
8. The pH must be carefully adjusted to 7.0 and 1.0 in each case. In this step, the
complete separation of the two forms of the bile acid (i.e., conjugated and
unconjugated taurocholic acid) as well as the further extraction of the cholic acid
released is performed.
9. The A 660 is compared with a standard curve to determine the concentration of
cholic acid. The same procedure used for the samples is applied for the standard
curve, except that the following amounts of cholic acid are assayed in place of
the samples: 0,0.5,0.7, 1.0, 1.5, 2.0, 2.5, 3.0, 3.5, and 4.0 jamol. The A 660 values
are plotted against micrograms of cholic acid per milliliter.
10. The early eluting peak (about 0.1 U absorbancy in the elution time 1 .6 — 4 min),
corresponds to residues of MRS broth. The elution time for taurocholic,
glycocholic, and cholic acids are 4.75, 6.22, and 17.11 min, respectively.
Therefore, the first peak does not interfere with the measurements of interest.
References
1. Hepner, G., Fried, R., Jeor, S., Fusetti, L., and Morin R. (1979)
Hypocholesterolemic effect of yogurt and milk. Am. J. Clin. Nutr. 32, 19-24.
2. Walker, D. K. and Gilliland, S. E. (1983) Relationship among bile tolerance, bile
salt deconjugation, and assimilation of cholesterol by Lactobacillus acidophilus .
J. Dairy Sci. 76,956-961.
3. Kilara, A. (1982) Influence of in vitro gastric digestion on survival of some lactic
cultures. Milchwissenschaft 37, 129-132.
4. De Man, J. C, Rogosa, M., and Sharpe, M. E. (1960) A medium for the cultiva-
tion of lactobacilli. /. Appl. Bacteriol. 23, 130-135.
5. Rudel, L. L. and Morris, M. D. (1973). Determination of cholesterol using
o-phthalaldehyde. /. Lipid Res. 14, 364.
6. Dashkevicz, M. P. and Feighner, S. D. (1988) Development of a differential medium
for bile salt hydrolase-active Lactobacillus sp. Appl. Environ. Microbiol. 55, 11-16.
7. Irvin, J. L., Johnson, C. G., andKopalo, J. (1944) A photometric method of deter-
mination of cholates in bile and blood. /. Biol. Chem. 439-457.
8. Scalia, S. (1988) Simultaneus determination of free and conjugated bile acids in
human gastric juice by high performance liquid chromatography. /. Chromatogr.
431, 259-269.
22
Identification of Exopolysaccharide-Producing
Lactic Acid Bacteria
A Method for the Isolation of Polysaccharides in Milk Cultures
Fernanda Mozzi, Maria Ines Torino, and Graciela Font de Valdez
1. Introduction
Exopolysaccharides (EPS) are exocellular polysaccharides that can be found
either attached to the cell wall in the form of capsules or secreted into the
extracellular environment in the form of slime.
Among the wide variety of EPS-producing microorganisms, lactic acid
bacteria (LAB) have gained a lot of attention because of the interesting proper-
ties of these polymers and the GRAS (Generally Recognized as Safe) status of
the group. LAB capable of synthesizing EPS are often used in the manufacture
of fermented milks (1) and more recently, EPS" 1 " starter cultures have been used
in the elaboration of low-fat cheeses (mozzarella) (2). The presence of these
kind of polymers improves the texture of the fermented milks, prevents the
syneresis, and can increase moisture retention in low-fat mozzarella.
Milk has been commonly used as a culture medium for EPS production by
LAB. The techniques for the identification of EPS -producing strains and for
the isolation of these polymers from milk cultures will be considered under the
following headings:
1. Mucoid colonies formation on agar medium.
2. Ropy appearance in milk cultures.
3. Capsular polysaccharides; India ink negative staining.
4. Isolation of EPS.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
183
184 Mozzi, Torino, and Font de Valdez
2. Materials
2. 1. Growth Media
Liquid Non-Fat Skim Milk (NFSM): NFSM (100 g/L). Sterilize at 115 Q C
for 20 min.
2.2. Media for Detecting Mucoid Colonies
Milk agar: Liquid NFSM with 1.5% agar (see Note 1). Sterilize at 1 15°C for
20 min.
2.3. Media for Determining Ropy Appearance in Milk Cultures and
for EPS Isolation
Liquid NFSM: NFSM (100 g/L). Sterilize at 115°C for 20 min.
2.4. Materials for Detecting Mucoid Colonies on Milk Agar
1. An active culture grown in liquid NFSM for about 16-24 h at the usual growth
temperature.
2. Plates of milk agar medium.
3. Peptone water 0.1% as dilution medium. To prepare 1 L, weigh 1 g peptone and
bring it to 1000 mL with distilled water. Sterilize at 121°C for 20 min.
4. Sterile toothpicks.
2.5. Materials for Observing Ropiness in Milk Culture
1. An active culture grown in liquid NFSM for about 16-24 h at the usual growth
temperature.
2. Pipets.
3. Meter scale.
2.6. Materials for Detecting Capsular EPS
1. An active culture grown in liquid NFSM for about 16-24 h at the usual growth
temperature.
2. India ink.
3. Distilled water
4. Very clean microscope slides
5. Cover slips
2. 7. Materials for Isolating EPS
1. An active culture grown in liquid NFSM for about 16-24 h at the usual growth
temperature.
2. Sterilized distilled water.
Identification of Exopolysaccharide-Producing LAB 185
3. Sterilized NaOH (2 N), stable at room temperature.
4. Pronase E Type XIV from Streptomyces griseus (Sigma Chemical Co.). Add
10 mg of the enzyme to 100 mL of milk culture (see Note 2). Employ sterile
material to weigh.
5. Merthiolate, add to reach 0.1% final concentration.
6. 95° Ethanol. Store at 4°C before use.
7. Distilled water.
8. Dialysis sacks that retain compounds with molecular weight greater than 12,000
(Sigma Diagnostics) (see Note 3).
2.8. Materials for the EPS Quantification
by the Phenol-Sulfuric Method
1. Very clean glass tubes (see Note 4).
2. Distilled water.
3. Phenol reagent (80% w/v). To prepare 10 mL, weigh 8 g phenol using a 10-mL
test tube, dissolve at 37°C, and then add distilled water to the final volume. Phenol
is toxic and must be carefully prepared.
4. Concentrated sulfuric acid (see Note 5).
3. Methods
3. 1. Detecting Mucoid Colonies on Milk Agar (3)
1 . Grow the LAB under study in liquid NFSM at the usual temperature for 16-24 h.
2. Melt the milk agar medium in boiling water and pour into sterile Petri dishes.
3. Prepare appropriate 10-fold dilutions of the NFSM culture using water peptone
as diluent.
4. Transfer and spread 0.5 mL of the desire dilution on surface of milk agar plates.
5. Allow the plates to set, then invert and incubate for about 48-72 h at the
appropriate temperature (see Note 6).
6 . Touch the colonies formed with sterile toothpicks, look for typical threadlike structure.
3.2. Determining Ropy Appearance in Milk Cultures (3)
1 . Grow the LAB under study in liquid NFSM at the usual temperature for 16-24 h.
2. Touch the milk cultures with sterile pipets and let the coagulated milk drop.
3. Measure the length of the string formed with a meter scale. Measurements between
and 5 mm are recorded as nonropy (-) and those higher than 6 mm as ropy (+).
3.3. Determination of Capsular EPS (4)
1 . Grow the LAB under study in liquid NFSM at the usual temperature for 16-24 h.
2. Prepare a dilution of the coagulated LAB culture with water peptone or
distilled water.
186 Mozzi, Torino, and Font de Valdez
3. Place a loop of India ink on a very clean, grease-free microscope slide.
4. Mix into the India ink a little of the bacterial suspension.
5. Place a cover slip on the mixture, avoiding air bubbles, and press firmly with
blotting paper until the film of liquid is very thin.
6. Place one drop of immersion oil on the microscope slide. Examine with the oil-im-
mersion objective. The capsule will be seen as a clear area around the bacterium.
3.4. Isolation of EPS from Milk Cultures (5)
1. Grow the LAB under study in 50-100 mL (see Note 7) liquid NFSM at the usual
temperature for 16-24 h. Perform the following steps in sterile conditions (see
Note 8).
2. Dilute the coagulated cultures twice with sterile distilled water. Mix with a sterile
pipet to break the coagulum.
3. Adjust the pH to 7.5 (see Note 9) with sterile NaOH (2 N). Mix with a sterile pipet.
4. Add the Pronase E and merthiolate (see Note 10). Mix with a sterile pipet.
5. Incubate at 37°C (see Note 11) for about 24 h.
6. Remove the cells by centrifugation (16,000g, 30 min at 4°C) (see Note 12).
The EPS are present in the supernatant. For the calculation of EPS production,
the volume of sterile water added in step 2 must be subtracted from the super-
natant volume obtained after centrifugation.
7. Concentrate the clarified supernatant five times by evaporation using a rotavap
evaporator (see Note 13).
8. Recover the EPS from the concentrated supernatant by precipitation at 4°C for
24 h with 3 vol of cold 95° ethanol.
9. Dissolve the precipitated EPS with 2-3 mL of distilled water.
10. Dialyze under stirring against distilled water at 4°C during 48-72 h (see Note 14).
The volume of liquid retained inside the sacks (containing the EPS) must be
considered for calculations.
1 1 . Store at -20°C or lyophilize and store at 4°C.
3.5. Quantification of EPS Production (8)
1. In very clean glass tubes, add the following:
a. 800 jliL of sample (dialyzed EPS solution) (see Note 15)
b. 40 \xL of phenol reagent; mix by vortexing.
c. 2 mL of sulfuric acid (see Note 16); mix by vortexing.
2. Prepare a reagent blank using 800 \xL of distilled water instead of sample.
3. Read the absorbance at 490 nm (A 490 ) against the reagent blank (see Note 17).
4. The determinations must be performed in triplicate (see Note 18).
5. The results are expressed as milligrams (mg) of EPS per liter (see Note 19).
4. Notes
1. LAB are very exacting microorganisms and usually it is necessary to add yeast
extract (5 g/L) and glucose (10 g/L) to enhance the growth on solid media.
Identification of Exopolysaccharide-Producing LAB 187
2. To simplify the procedure when many samples are manipulated, prepare a
solution of the enzyme to an appropriate concentration (i.e., for five samples of
100 mL each, prepare 5 mL of a 10-mg/mL solution and add 1 mL). The solution
must be freshly prepared with a sterile tube and sterile distilled water.
3. The cutoff of the dialysis sacks depends of the molecular weight of the EPS
isolated. LAB usually produce EPS of about 10 4 -10 6 .
4. The phenol sulfuric method is very sensitive and the employed materials must be
very clean. The new glass tubes must be carefully washed with acidulated water
and rinsed three times with distilled water. Once used, keep them with the reaction
mixture. When needed, discard the reaction mixture and rinse several times with
water and three times with distilled water.
5. Sulfuric acid used must be high quality.
6. LAB are anaerobic or microaerophile and many species do not grow well on
the surface of solid media incubated aerobically. When necessary, incubate the
Petri dishes in an oxygen-free atmosphere. The incubation period will be longer
than 48 h.
7. The amount of EPS produced by LAB is scarce (usually in the order of milli-
grams per liter) and the isolation from a small volume of culture is very erroneous.
8. The sterile conditions must be maintained because of the further incubation pe-
riod with the Pronase.
9. The pH 7.5 is the optimal one for the Pronase activity.
10. Pronase is added to digest the milk proteins and merthiolate to prevent further
cell growth during the additional incubation period.
11. The incubation temperature of 37°C is the optimal for the Pronase activity.
12. The presence of EPS as capsule usually decreases the adhesion of the cell pellet
and the centrifugation parameters must be extended. When a high amount of EPS
remains attached to the cell wall, it must be removed from the pellet to avoid
lower EPS values. In this cases, the pellet is washed with sterile 0.9% NaCl and
centrifuged again. The supernatant fluid is decanted with ethanol and the pellet
resuspended in 1 mL 5% trichloroacetic acid. It is then vortexed at maximum
velocity for 1 min and transferred to an Eppendorf tube. The debris are
centrifuged at lOOOg for 5 min at room temperature, washed twice in Pronase
buffer (7), and resuspended in 1 mL of Pronase buffer. Pronase (20 mg/mL) is
added and the mixture is incubated at 40°C for 20 h. The digest is dissolved in
5 mL of distilled water and dialyzed (8).
13. The temperature used during the concentration may be about 60-65°C.
14. Dialysis is one of the critical steps in the EPS isolation because the residual sugar
from culture medium is removed, avoiding inflated values of EPS quantification.
The water for dialysis must be changed twice each day.
15. The amount of sample added depends of the EPS concentration. Usually 50 fiL
(plus 750 \xL of distilled water to reach the final volume of 800 \xL) gives
appropriate A 490 values.
16. The sulfuric acid must be quickly added in the middle of the reaction mixture.
188
Mozzi, Torino, and Font de Valdez
2.0 i
E
c
o
o>
<*
1.5
1.0
0.5 -
0.0
^g of glucose
Fig. 1. Plot of A 490 values versus micrograms of glucose.
17. The A 490 of the blank reagent must be less than 0.1. The measured A 490 difference
(sample and blank) should be at least 0.2 absorbance units to achieve sufficiently
accurate results. If lower values are obtained, the amount of sample employed in
the reaction must be increased.
18. Because of the high sensitivity of the phenol sulfuric method, a single determina-
tion is unacceptable. Those A 490 values for each sample that differ in 0.1 or less
absorbance units are averaged.
19. The amount of EPS is calculated with the following formulas:
EPS (mL/mg) = A 490 x F
mL
where A 490 is the averaged absorbance values, F is the factor calculated from the
standard curve (see below), and mL is the amount of sample used in the phenol
sulfuric reaction.
EPS mg (in mL of dialyzed) = EPS (mg/mL) x mL of dialyzed
where mL of dialyzed is the amount of liquid retained into the dialysis sack.
EPS production (mg/L) = EPS (mL dialyzed) x 1000
mL of supernatant - mL of
sterile water (step 2)
Standard curve for calculating the factor F. The same procedure used for the
phenol sulfuric method in samples is applied for the standard curve, except that
glucose ( 1 g/L) is used as standard reagent in place of the samples. The amount of
Identification of Exopolysaccharide-Producing LAB 189
Table 1
Example of Calculating Factor Ffrom the Standard Curve
X t (\xg of standard glucose) F / (A 490 ) XjY t X t
2
(IXiY= 16,900 Total
0.04
5
0.2
1
25
10
0.4
4
100
20
0.8
16
400
25
0.9
22.5
625
30
1
30
900
40
1.6
64
1600
2130
4.94
137.5
3650
a = (7 x 137.5 -130 x 4.94)/(7 x 3650 x 16900)
a = 0.037
F=l/a = 27
glucose standard added are: 0, 5, 10, 20, 25, 30, and 40 mL (or micrograms
because the concentration of the standard is 1 g/L). The A 490 values are plotted
against \xg glucose in Fig. 1.
The mathematical expression of a line is: y = ax + b, where
a = tg a = A 490 ; |wg glucose = A 490 1; F = 1
\xg glucose (-) a a
In order to choose the best line, the principle of least squares is generally used.
By this method, the a value is obtained and F can be calculated:
a = nSXjYj - IX^Y;
nlX? - (ZX t )2
where n is the number of trials. In this case, n = 1 (0, 5, 10, 20, 25, 30, and 40).
See Table 1 for values used in the calculation.
References
1. Sutherland, I. W. (1990) Food usage of polysaccharides, in Biotechnology of
Microbial Polysaccharides (Sutherland, I. W., ed.,), Cambridge University Press,
Cambridge, pp. 117-125.
2. Perry, D. B., McMahon, D. J., and Oberg, C. J. (1997) Effect of exopolysaccharide
producing cultures on moisture retention in low-fat mozzarella cheese. /. Dairy
Sci. 80, 799-805.
3. Mozzi, F. (1995) Ph.D. thesis. Universidad Nacional de Tucuman, Argentina.
4. Harrigan, W. F. and McCance, M. E. (1976) Laboratory Methods in Food and
Dairy Microbiology, Academic, London.
5. Cerning, J., Bouillanne, C, and Desmazeaud, M. J. (1986) Isolation and charac-
terization of exocellular polysaccharide produced by Lactobacillus bulgaricus.
Biotechnol. Lett. 8(9), 625-628.
190 Mozzi, Torino, and Font de Valdez
6. Dubois, M., Gilles, K. A., Hamilton, J. K., Rebers, P. A. and Smith, F. (1956)
Colorimetric method for determination of sugars and related substances. Anal.
Chem. 28, 350-356.
7. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A
Laboratory Manual, 2nd ed., vol. 3, Cold Spring Harbor Laboratory Press, Cold
Spring Harbor, NY, p. B16.
8. Escalante, A., Wacher-Rodante, C, Garcfa-Garibay, M., and Farres, A. (1998)
Enzymes involved in carbohydrate metabolism and their role on exopolysaccharide
production in Streptococcus thermophilus. J. Appl. Microbiol. 84, 108-1 14.
23
Differentiation of Lactobacilli Strains by
Electrophoretic Protein Profiles
Graciela Savoy de Giori, Elvira Maria Hebert, and Raul R. Raya
1. Introduction
Lactic acid bacteria (LAB) comprise a diverse group of Gram -positive, non-
spore-forming microorganisms (1). Fermentable carbohydrates are used as
energy sources and are degraded to lactate (homofermentatives) or to lactate
and additional products such as acetate, ethanol, carbon dioxide, formate, or
succinate (heterofermentatives). Lactobacilli species are widely used in food
technology. The manufacture of high-quality products requieres close attention
to characterization, differentiation, and maintenance of lactobacilli starter
culture strains. The species identification of LAB depends mainly on
physiological and biochemical criteria. These conventional methods are time-
comsuming and difficult and the results are often ambiguous. Therefore, for
microbiological quality control, it is necessary to develop more reliable and
quicker identification methods. The electrophoretic separation of cellular
proteins is a sensitive technique, applied in bacterial systematics, that mainly
provides information on the similarity of strains within the same species or
subspecies. The present chapter deals with the most common technique of
polyacrylamide gel electrophoresis (PAGE) in the presence of denaturing
agents (sodium dodecyl sulfate [SDS]) of whole and wall-cell-associated
proteins extracts for strain typing of lactobacilli. These methods will be useful
for culture maintenance by giving each particular strain a fingerprint.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
191
192 Savoy de Giori, Hebert, and Ray a
2. Materials
1. MRS broth (2): polypeptone (10 g/L), meat extract (10 g/L), yeast extract (5 g/L),
glucose (20 g/L), sodium acetate (5 g/L), Tween-80 (1.08 g/L), ammonium citrate
(2 g/L), K 2 HP0 4 (2 g/L), MgS0 4 ■ 7H 2 (0.2 g/L), and MnS0 4 • 4H 2 (0.05 g/L),
pH 6.4 ± 0.2. Sterilize in an autoclave at 121°C for 15 min.
2. Phosphate buffer: Solution A (0.2 M NaH 2 P0 4 ): weigh 27.6 g NaH 2 P0 4 - H 2
and make to 100 mL with distilled water (dH 2 0). Solution B (0.2 M Na 2 HP0 4 ):
weigh 53.05 g of Na 2 HP0 4 • 7H 2 and make to 100 mL with dH 2 0. To prepare
1 L of 0.1 M phosphate buffer, (pH 7.0) mix 195 mL of solution A and 305 mL of
solution B and bring to 1000 mL with dH 2 0.
3. Acrylamide solution: Weigh 29.2 g acrylamide and 0.8 g iVyV'-methylene-to-
acrylamide, add about 50 mL of dH 2 0, stir until disolved, and dilute to 100 mL.
Remove insoluble material by filtration. Store at 4°C in a dark bottle (30 d maxi-
mum to avoid hydrolysis of acrylamide to acrylic acid). Caution: Acrylamide is
neurotoxic; repeated skin contact, inhalation, or swallowing may cause a nervous
system disorder.
4. Separation gel buffer: Dissolve 18.15 g Tris in 80 mL dH 2 0, adjust to pH 8.8
with HC1 and make up to 100 mL with dH 2 0. The solution is stable for at least 2 wk
when stored at 4°C.
5. Stacking gel buffer: Dissolve 6 g Tris in 80 mL dH 2 0, adjust to pH 6.8 with HC1
and make up to 100 mL with dH 2 0. The solution is stable for at least 2 wk when
stored at 4°C.
6. 10% (w/v) sodium dodecyl sulfate (SDS): Dissolve 10 g SDS in 100 mL dH 2
with gentle stirring. Store at room temperature. Solution may become cloudy
at temperatures below 20°C, but clarity may be restored by warming to 30°C
and mixing.
7. 10% (w/v) Ammonium persulfate (APS): Dissolve 100 mg APS in 1 mL dH 2 0.
Always use a freshly prepared solution.
8. Reservoir buffer: Prepare solution by combining 6.05 g Tris, 28.8 g glycine, and
2 g SDS. Dissolve with dH 2 to a final volume of 2 L. Final pH should be about
8.3. Store at 4°C; warm to 37°C before use if precipitation occurs.
9. Sample buffer: Prepare solution by combining dH 2 (4 mL), stacking gel buffer
(1 mL), glycerol (0.8 mL), 10% SDS (1.6 mL), |3-mercaptoethanol (0.4 mL), and
bromophenol blue (0.002%). Dilute the sample 1:1 with sample buffer and heat
at 100°Cfor5min.
10. Staining solution: Weigh 0.5 g of Coomassie brilliant blue R-250 and dissolve in
500 mL of methanol; add 400 mL dH 2 and 100 mL acetic acid. Store at room
temperature. This reagent is stable for several months.
11. Destaining solution: 25% (v/v) methanol and 10% (v/v) acetic acid.
12. A^A^^Tetramethylethylenediamine (TEMED).
13. Glass beads (0.1 mm in diameter, Sigma)
14. SDS molecular weight markers (Sigma).
15. Bio-Rad protein assay (Bio-Rad).
16. Vertical gel electrophoresis unit (Sigma).
Differentiation of Lactobaccili Strains 193
3. Methods
3. 7. Cultivation of Bacteria
1. Inoculate 1% of the microorganisms in 5 mL MRS broth (see Notes 1 and 2) and
incubate overnight at 30°C (mesophilic bacteria) or 37°C (thermophilic bacteria).
2. Collect cells by centrifugation at 10,000g.
3. Wash the pellet twice with 5 mL of 0.1 M sodium phosphate buffer pH 7.0.
4. Resuspend washed cells in 200 \xL of the above-mentioned buffer by vortexing.
Be sure that the pellet is completely resuspended before proceeding.
3.2. Preparation of Protein Samples
3.2. 1. Whole-Cell Protein Extract
1. Vortex the resuspended cells eight times for 1 min with 200 mg glass beads with
1-min intervals on ice (see Note 3).
2. Centrifuge the tubes at 12,000g for 7 min to remove glass beads and unbroken cells.
3. Transfer the supernatant to a clean tube by carefully decanting from the pellet. Store
at -20°C. For long term storage the samples should preferably be kept at -60°C.
3.2.2. Wall-Cell Associated Proteins Extract
1. Add 40 fiL of 10% SDS to 200 ^L of resuspended cells.
2. Heat the cell suspension at 100°C for 7 min.
3.3. Electrophoresis of Protein Samples
The SDS-PAGE procedure considered here is based on the technique
described by Laemmli (3). All percentages are expressed as weight per volume
(w/v), except when indicated otherwise.
3.3. 1. Preparation of Separation Gel (12% Acrylamide)
1. Place a comb into the assembled gel sandwich (see Note 4). With a pen, place a
mark on the glass plate at 2 cm below the teeth of the comb. This will be the level
to which the separating gel is poured.
2. To a clean flask, add 16.75 mL of dH 2 0, 12.5 mL separation gel buffer, 20 mL
acrylamide solution, 0.5 mL of 10% SDS, 0.25 mL of 10% APS, and 25 fiL
TEMED (see Notes 5 and 6).
3. Mix thoroughly by stirring. Holding the flask by the neck and swirl it 8-10 cycles.
Pour the solution smoothly to the mark and avoid the inclusion of air bubbles.
4. Immediately overlay the solution with 1.5 mL water-saturated isobutanol to
obtain a flat surface (see Note 7).
5. Allow the gel to polymerize for 45 min to 1 h at 20°C. The acrylamide is gelled
when a clear line can be observed 1-2 mm below the water-saturated-isobutanol
(see Note 8).
194 Savoy de Giori, Hebert, and Ray a
6. Rinse off the overlaying solution four times with dH 2 0. This is especially
important with alcohol overlays (see Note 9).
7. The gel can be used after 12 h or stored for 48 h at 4°C in a closed plastic bag (to
avoid evaporation; see Note 10).
3.3.2. Preparation of Stacking Gel (5% Acrylamide)
1. Dry the area above the separating gel with filter paper before pouring the
stacking gel.
2. Mix the following in a clean flask: 7.0 mL dH 2 0, 1.3 mL stacking gel buffer,
1.6 mL acrylamide solution, 0.05 mL of 10% SDS, 0.05 mL of 10% APS, and
10 jliL TEMED. Swirl the solution gently but thoroughly (see Note 5).
3. Rinse the top of the gel with approximately 1 mL of stacking gel solution, pour
off, and fill the cassettes inmediately with stacking gel solution.
4. Insert the comb into cassettes; avoid trapping air bubbles.
5. Allow the gel to polymerize at least 1 h at 20°C.
6. Remove the comb and rinse the wells with dH 2 0.
3.3.3. Loading the Samples
1. After polymerization, fill the upper and lower reservoirs with reservoir buffer.
Remove any air bubbles from the botton of the gel so that good electrical contact
is achieved. This can be done by swirling the lower buffer with a pipet until the
bubbles clear.
2. Insert the samples through the reservoir buffer and into the wells with a Hamilton
syringe or a GE Loader tip (Bio-Rad) attached to a 20-fiL pipetman. The volume
depends on the concentration of proteins in the extract (see Note 11). Apply
approximately 50 fig of protein (determined with Bio-Rad Protein Assay) from
each extract. Adjust the volume to 15 fiL with phosphate buffer and mix 1 with
sample buffer. Load 20 \xL of these samples in each well. Include one reference
pattern and a mixture of molecular-weight markers on each slab gel (see Note 12).
3.3.4. Running the Gel
1 . Attach the electrical leads to a suitable power supply with the proper polarity. Be
sure to connect the positive lead to the lower chamber.
2. Run the gel at constant current of 10 mA per gel until the tracking dye reaches 1 cm
of the botton of the gel.
3. Turn off the power supply and disassemble the glass plates.
3.3.5. Staining and Destaining
1. Immerse the gel in a container and cover it with staining solution (see Notes 13
and 14).
2. Shake gently for 1-2 h.
Differentiation of Lactobaccili Strains 195
3. Remove stain from the container.
4. Rinse the gel and the gel container with water to remove excess staining solution.
5. Gels may be destained by soaking in several changes of destaining solution until
the background is clear (see Note 15).
3.3.6. Storage
Stained gels may be stored between cellophane sheets or dried onto Mylar
Sheets using a gel dryer (Bio-Rad).
3.3.7. Interpretation of Bacterial Protein Electrophoretic Profiles
Visual comparison is the most frequently used method for the interpretation
of bacterial protein electrophoretic patterns (see Notes 16 and 17). However,
computer programs have been developed to allow the standarization,
normalization, and comparison of data (4,5). Pay special attention to the bands
present in the range 20-66 kDa.
4. Notes
1 . The cultivation medium chosen should support good growth of the microorganisms.
Rich media are recommended.
2. To identify the species it is necessary to include one reference pattern of a neo-
type strain and compare the electrophoretic profiles.
3. Other methods to lyse cells can be used, such as lysozyme treatment (6), sonica-
tion, or pressure techniques.
4. When assembling cassettes, always use clean glass plates and label the bottom
right corner of each gel cassette.
5. The electrophoretic reagents must be high quality.
6. The high-molecular-weight proteins (>100 kDa) are better resolved on 7-8%
acrylamide gels. Reduce the volume of acrylamide in the separating gel and
replace it with water. The stacking gel composition can remain the same.
7. Isobutanol chemically attack the acrylic plastic of the sandwich clamp.
8. If the gel sets more quickly than 1 h, decrease the amount of TEMED; if the gel
takes longer, increase the amount of TEMED.
9. Do not allow alcohols to remain on the gel more than 1 h because the top of the
gel will dehydrate.
10. It is sometimes convenient to cast the separating gel the day before running the
gel. If the stacking gel is to be cast the following day, place about 10 mL of a 1 :4
dilution of separating buffer on top of separating gel after rinsing with dH 2 0.
This will prevent dehydration of the separating gel during overnight storage.
11. Band resolution is improved if small volumes of sample are applied to the gels.
12. Molecular-weight markers or a reference bacterial protein extract must be used
as standards to evaluate the reproducibility of the electrophoretic system.
13. Use disposable plastic gloves to handle the gel.
196 Savoy de Giori, Hebert, and Ray a
14. Staining should be done inmediately to avoid band broadening by diffusion.
15. If a gel becomes overdestained or fades, the staining can be repeated.
16. One advantage of electrophoretic methods over conventional physiologic test is
that once the bacteria are isolated and identified to the genus level, the protein
can be prepared and SDS-PAGE results can be determined in 1 d. In contrast, the
physiologic tests required for species identification can require an additional
incubation of at least 7 d.
17. The electrophoretic protein patterns provide a reliable way to differentiate spe-
cies, whereas differentiation at the strain level is not always possible. We recom-
mend using both methods (whole cells and wall-cell-associated protein extracts)
to identify species.
References
1. Kandler, O. and Weiss, N. (1986) Regular, nonsporing Gram-positive rods, in
Bergey's Manual of Systematic Bacteriology (Sneath, P. H. A., Mair, N., Sharpe,
E., and Holt, J. G., eds.), Williams & Wilkins, Baltimore, pp. 1208-1260.
2. De Man, J. C., Rogosa, M., and Sharpe, M. E. (1960) A medium for the cultivation
of lactobacilli. /. Appl. Bacteriol. 23, 130-135.
3. Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the
head of bacteriophage T4. Nature 227, 680-685.
4. Pot, B., Gillis, M., Hoste, B., Van de Velde, A., Bekaert, F., Kersters, K. , et al.
(1989) Intra- and intergeneric relationships of the genus Oceanospir ilium. Int. J.
Syst. Bacteriol. 39, 23-34.
5. Vauterin, L. and Vauterin, P. (1992) Computer-aided objective comparison of
electrophoresis patterns for grouping and identification of microorganisms. Eur.
Microbiol. 1,37-41.
6. Pot, B., Vandamme,P. and Kersters, K. (1994) Analysis of electrophoretic whole-
organism protein fingerprints, in Chemical Methods in Prokariotic Systematics
(Goodfellow, M. and O'Donnell, A. G., eds.), Wiley, Chichester, pp. 493-522.
24
Methods to Determine Proteolytic Activity of Lactic
Acid Bacteria
Graciela Savoy de Giori and Elvira Maria Hebert
1. Introduction
Lactic acid bacteria (LAB) are considered weakly proteolytic when compared
with many other groups of bacteria (e.g., Bacillus, Proteus, Pseudomonas).
However, most strains of LAB rely on a complex proteolytic system that allow
them to liberate essential and growth-stimulatory amino acids and small pep-
tides from the protein-rich substrates such as milk, meat, and vegetables in
which they are primarily found.
The proteolytic system of dairy LAB is composed of an extracellular, cell-
envelope proteinase, various intracellular peptidases, and amino acid and peptide
transport systems for uptake of the products of proteolysis. The action of the cell-
envelope proteinase is not only crucial to the growth of the organism in milk but
also to secondary proteolysis and flavor development in cheese (1).
Many procedures have been used to detect proteolysis of LAB. Traditionally,
the method most widely used is that described by Hull (2). The Hull method
relies on the release of tyrosine- and tryptophan-containing peptides that react
with Folin-Ciocalteau reagent; consequently, this method lacks sensitivity.
In this chapter, we describe different procedures, more sensitive and rapid,
that are routinely used in our laboratory to determine the proteolytic activity of
LAB. These techniques include the use of ophthaldi aldehyde (OPA), chromogenic
peptide (S-Ala), or fluorescein isothiocyanate (FITC)-casein as substrate.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
197
198 Savoy de Giori and Hebert
2. Materials
2. 7. Growth Media
1. MRS broth (3): polypeptone (10 g/L), meat extract (10 g/L), yeast extract (5 g/L),
glucose (20 g/L), sodium acetate (5 g/L), Tween-80 (1.08 g/L), ammonium cit-
rate (2 g/L), K 2 HP0 4 (2 g/L), MgS0 4 °7H 2 (0.2 g/L), and MnS0 4 °4H 2
(0.05 g/L); pH 6.4 ± 0.2. Sterilize in an autoclave at 121°C for 15 min.
2. 10% Reconstituted skim milk (RSM): Dissolve 10 g of skim milk in 100 mL of
distilled water (dH 2 0). Sterilize by autoclaving at 1 15°C for 15 min.
2.2. OPA Method
1. Phosphate buffer (0.1 M, pH 7.0). Solution A (0.2 M NaH 2 P0 4 ): Weigh 27.6 g
NaH 2 P0 4 H 2 and make to 100 mL with distilled water (dH 2 0). Solution B
(0.2 M Na 2 HP0 4 ), weight 53.05 g of Na 2 HP0 4 • 7H 2 and make to 100 mL with
dH 2 0. To prepare 1 L 0.1 M phosphate buffer (pH 7.0), mix 195 mL of solution
A and 305 mL of solution B and bring to 1000 mL with dH 2 0.
2. 20% (w/v) Sodium dodecyl sulfate (SDS): Dissolve 20 g SDS in 100 mL dH 2 with
gentle stirring. Store at room temperature. Solution may become cloudy at tempera-
tures below 20°C, but clarity may be restored by warming to 30°C and mixing.
3. 100 mM sodium tetraborate (borax): Weigh 3.81 gofNa 2 B 4 7 - 10H 2 O and make
up 100 mL with dH 2 0. This solution is stable at least 1 mo at 4°C.
4. The OPA solution is prepared combining the following reagents: 25 mL of
100 mM borax, 2.5 mL of 20% SDS, 40 mg OPA (dissolved in 1 mL methanol),
and 100 f^L (3-mercaptoethanol. Dilute to a final volume of 50 mL with dH 2 0.
This reagent must be prepared daily.
5. 0.75 N Trichloroacetic acid (TCA): This solution is prepared by weighing 61.24 g
TCA and diluting to 500 mL with dH 2 0. The solution is stable for at least 2 wk
when stored at 4°C.
2.3. Chromogenic Method
1. MRS-Ca: MRS medium supplemented with 1.47 g/L CaCl 2 °2H 2 (10 mM).
2. 10 mM CaCl 2 -saline solution: Dissolve 4 g NaCl and 0.73 g CaCl 2 °2H 2 with
500 mL dH 2 0.
3. Tris-hydroxymethyl-aminomethane (Tris) buffer (50 mM, pH 7.8). Dissolve
1.21 g Tris in 50 mL dH 2 0, adjust to pH 7.8 with HC1, and make up to 200 mL
with dH 2 0. The solution is stable for at least 1 mo when stored at 4°C.
4. 5M NaCl: Dissolve 146.25 g NaCl with 500 mL dH 2 0.
5. Phosphate buffer (0.2 M, pH 7.0): Weigh 27.6 g NaH 2 P0 4 °H 2 and 53.05 g of
Na 2 HP0 4 °7H 2 0. Make up to 200 mL with dH 2 0.
6. 80% (v/v) Acetic acid: Add 20 mL dH 2 to 80 mL acetic acid.
7. Substrate A^succinyl-Ala-Ala-Pro-Phe-/Miitroanilide (S-Ala, Sigma). Dissolve the
peptide in dimetyl sulfoxide at a concentration of 20 mM. Store the solution at -20°C.
Determining Proteolytic Activity of LAB 199
2 A. FITC-Casein Assay
1. Tris buffer (50 mM, pH 7.0): Dissolve 1.21 g Tris in 50 mL dH 2 0, adjust to
pH 7.0 with HC1, and make up to 200 mL with dH 2 0. The solution is stable for at
least 1 mo when stored at 4°C.
2. FITC-casein solution (0.4%): Dissolve 4 mg of FITC-casein (Sigma) in 10 mL
of 50 mM Tris-HCl buffer, pH 7.0. Store the solution at -20°C.
3. 5% TCA: Dissolve 5 g TCA in 100 mL dH 2 0. The solution is stable for at least
2 wk when stored at 4°C.
4. Tris buffer (0.5 M, pH 8.5): Dissolve 6.057 g Tris in 50 mL dH 2 0, adjust to
pH 8.5 with HO, and make up to 100 mL with dH 2 0. The solution is stable for at
least 1 mo when stored at 4°C.
5. The CaCl 2 -saline solution is prepared as described in Subheading 2.3.
6. 10% Sodium citrate: Dissolve 50 g sodium citrate with 500 mL dH 2 0.
3. Methods
3. 7. OP A Method
The reaction of OPA with primary amines occurs only in the presence of a
thiol, typically (3-mercaptoethanol, and is enhanced at basic pH. Under these
conditions, l-thioalkyl-2-alkylisoindoles are formed, which absorb strongly at
340 nm (3). The advantages of the OPA assay are the following: (1) the assay
is simple and rapid, (2) the method is sensitive (detecting approx 7 [iM primary
amines) because OPA forms adducts having similar absorptivities with 18 of
the 20 common amino acids (in the Hull method only tyrosine and tryptophane
are detected), and (3) if proteins of known concentration are used as substrate,
a percent hydrolysis can be obtained. The disadvantages of this technique are
the following: (1) The OPA give a weak reaction with cysteine and none with
proline and (2) the measure at 340 nm is the net result of proteolysis and
consumption of amino acids during growth.
1. Inoculate 1% MRS and grow the strains overnight at 30°C (mesophilic bacteria)
or 37°C (thermophilic bacteria).
2. Collect cells by centrifugation at 10,000g for 10 min at 4°C.
3. Wash the pellet twice with phosphate buffer (see Notes 1 and 2).
4. Resuspend the pellet to the original volume in the same buffer.
5. Inoculate (1%) the bacterial suspension into 10 mL RSM.
6. Mix the cultures by vortexing and incubate them for 12 h at the optimum
temperature (see Note 3). Also incubate uninoculated milk as control (see Note 4).
7. To 2.5 mL of the sample homogenized by vortexing, add 0.5 mL dH 2 and 5 mL
0.75 N TCA while agitating the test tube to mix thoroughly the coagulated milk.
8. Vortex vigorously and allow to stand for 15 min.
9. Centrifuge the solution at 13,000g for 15 min and transfer the supernatant to a
clean tube with a pipet (see Note 5).
200 Savoy de Giori and Hebert
10. Add 1 mL of OPA reagent to 50 fiL supernatant in a 1-mL quartz cuvet.
11. Mix briefly by inversion and incubate 2 min at room temperature.
12. Measure the absorbance at 340 nm against the blank (uninoculated milk).
1 3 . Calculate the mmoles per liter of a-amino acid released (mM) from the following
relationship:
1 cm
mM = 8 AA 340 F
where AA 340 is the experimentally observed change of absorbance at 340 nm
using a 1-cm light path, F is the dilution factor corresponding to the assay
procedure, and 8 is the molar absorption coefficient (6000/MVcm).
3.2. Chromogenic Method
In this method, the amount of p-nitroanilide (pNA) released from the
chromogenic peptide by the action of LAB proteinase is measured at 410 nm.
The method is as follows:
1 . Grow the microorganism in 100 mL MRS-Ca at 30°C (mesophilic bacteria) or 37°C
(thermophilic bacteria) at the optical density at 600 nm of 1.5 (see Notes 3 and 6).
2. Harvest cells by centrifugation at 10,000g for 10 min at 4°C (see Note 7).
3. Wash twice with CaCl 2 _saline solution (see Note 8).
4. Resusped in 5 mL Tris buffer (50 mM, pH 7.8).
5. To 200 ^iL resuspended cells (enzyme solution), add 287.5 f^L phosphate buffer
(0.2M, pH 7.0), 225 ^L 5M NaCl, and 37.5 ^L S-Ala (see Notes 9-11).
6. Mix gently and incubate at 30°C (mesophilic bacteria) or 37°C (thermophilic
bacteria) for 30 min.
7. Stop the reaction by the addition of 175 \xL of 80% (v/v) acetic acid.
8. Centrifuge for 5 min at 13,000#.
9. Measure the release of pNA at 410 nm.
10. The concentration of pNA released can be calculated from the derived value of
molar absorption coefficient (8 = 8.800/M/cm):
^MpNA = 8AA 410 Fxl0 3
where AA 410 is the experimentally observed change of absorbance at 410 nm
using a 1-cm light path and F is the dilution factor corresponding to the assay
procedure.
One unit of enzyme is defined as the amount of enzyme required to release 1 jimol
pNA per minute under the conditions of the assay.
3.3.3. FITC-Casein Assay
The procedure described here is based on the techniques described by
Twining (4) with some modifications.
Determining Proteolytic Activity of LAB 201
1 . Grow the microrganism overnight in RSM at 30°C (mesophilic bacteria) or 37°C
(thermophilic bacteria).
2. Inoculate 2 mL of this preculture in 100 mL RSM and incubate at optimum
temperature for 8 h (see Notes 3 and 12).
3. Collect cells by centrifugation at 10,000g for 10 min at 4°C.
4. Adjust pH to approx 7.0 with NaOH.
5. Add 10 mL sodium citrate and let stand about 30 min at room temperature
to clear.
6. Harvest cells by centrifugation at 10,000g for 10 min at 4°C (see Note 7).
7. Wash the pellet twice with CaCl 2 _saline solution (see Note 8).
8. Resuspend the cells in Tris buffer (50 mM, pH 7.0) at optical density at
590 nmof 1.0.
9. Mix 30 f^L cells and 20 \xL FITC-casein.
10. Incubate at optimum temperature for lh.
11. Stop the enzyme reaction by adding 120 jaL TCA.
12. Centrifuge the mixture and neutralize 60 f^L of the supernatant by diluting with 3 mL
of 0.5 M Tris buffer, pH 8.5 (see Note 13).
13. Measure the fluorescein with an excitation of 490 nm and an emission of 525 nm.
14. One unit of the enzyme is defined as the amount of enzyme yielding 1% of the
total initial casein fluorescence as TCA soluble fluorescence after 60 min of
hydrolysis.
4. Notes
1. Saline solution, instead of phosphate buffer, can be use to wash cells.
2. Cell washes are necessary to minimize carryover of free amino acids during
inoculation.
3. Proteinase activity changes during cell growth.
4. A control consisting of uninoculated milk must be sampled at the same time.
5. The samples after the TCA treatment can be frozen at -20°C until they are used.
6. It is always good practice to include positive and negative controls.
7. Keep everything on ice to preserve the enzyme activity.
8. Ca 2+ is added to prevent the release of proteinase to the culture medium.
9. Enzyme solution may be diluted with Tris buffer.
10. Peptide solution of S-Ala and the buffered enzyme solution must be prewarmed
separately before the reaction is started.
1 1 . Other chromogenic substrates such as Suc-Ala-Glu-Pro-Phe-/;-nitroanilide (S-Glu)
or MeOsuc-Arg-Pro-Tyr-p-nitroanilide (MS-Arg) can be used (5).
12. Culturing the cells in skim milk medium is important to prevent the repression of
the enzyme activity by peptides.
13. Thorough mixing is required at each step for this assay. If the TCA supernatant
fraction is not completely neutralized by the pH 8.5 buffer, low-fluorescence
yields are obtained, because FITC is colorless below pH 4.0.
202 Savoy de Giori and Hebert
References
1. Exterkate, F. A. (1990) Differences in short peptide-substrate cleavage by two cell-
envelope-located serine proteinases of Lactococcus lactis subsp. cremoris are related
to secondary binding specificity. Appl. Microbiol. Biotechnol. 33, 401-406.
2. Hull, M. E. (1947) Studies on milk proteins. II. Colorimetric determination of the
partial hydrolysis of the proteins in milk. /. Dairy Sci. 30, 881-884.
3. Church, F. C, Swaisgood, H. E., Porter, D. H. and Catignani, G. L. (1983)
Spectrophotometric assay using ophthaldialdehyde for determination of proteoly-
sis in milk and isolated milk proteins. /. Dairy Sci. 66, 1219-1227.
4. Twining, S. S. (1984) Fluorescein isothiocyanate-labeled casein assay for
proteolytic enzymes. Anal. Biochem. 143, 30-34.
5. Exterkate, F. A., Alting, A. C, and Bruinenberg, P. G. (1993) Diversity of cell
envelope proteinase specificity among strains of Lactococcus lactis and its
relationship to charge characteristics of the substrate-binding region. Appl.
Environ. Microbiol. 59, 3640-3647.
25
Methods for Isolation and Titration of Bacteriophages
from Lactobacillus
Lucia Auad and Raul R. Raya
1. Introduction
Lactic acid bacteria (LAB), mainly Lactobacillus and Lactococcus species,
are useful microorganisms in many biotechnological processes in the food and
feed industries. Bacteriophage contaminations of this important group of Gram-
positive bacteria have been reported since the 1930s (1) and they are known to
be one of the main causes of fermentation failures in the dairy industry. Phages
can enter the processes from outside, survive the pasteurization of milk, and
remain in factory environments for prolonged periods. Other possible sources
of virulent phages are lysogenic bacteria and the prophages they harbor. Lysog-
eny of LAB has been recognized widely. On the analogy of the Escherichia
coli Lambda system (2), temperate phages of Lactobacillus have been regarded
as valuable genetic tools of gene transfer (transduction) and cloning in this
industrially important group of bacteria.
In this chapter, we describe the methods optimized in our laboratory for the
induction, detection, and propagation of phages infecting Lactobacillus species.
They are based on standard protocols developed for phages from Gram -nega-
tive bacteria, in particular for the coliphage Lambda (3), and have been adapted
for bacteriophage attacking lactic acid bacteria.
Mitomycin C is the standard drug used to activate the lytic life cycle of
temperate phages (4,5). Although the double-layer plaque assay (6) is a
quantitative procedure to measure the phage concentration of a lysate solution,
the propagation of phages in liquid and solid media allows the amplification
the titer of the lysate (7).
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
203
204 Auad and Ray a
2. Materials
2. 1. Culture Media
MRS broth (#):10 g/L peptone, 10 g/L meat extract, 5 g/L yeast extract, 20 g/L
glucose, 5 g/L sodium acetate, 1 g/L Tween-80, 2 g/L ammonium citrate, 2 g/L
K 2 HP0 4 , 0.2 g/L MgSO 4 -7H 2 0, and 0.05 g/L MnS0 4 4H 2 0; pH 6.5. Autoclave for
20 min at 121°C. Media can be stored at room temperature for months.
MRS-Ca 2+ soft agar: To MRS, add agar at 0.7% (w/v) and CaCl 2 -6H 2 to a final
concentration equal to 10 mM. Autoclave for 20 min at 121°C. Media can be
stored atroom temperature for months.
MRS-Ca 2+ agar: To MRS, add agar at 1.5% (w/v) and CaClI 2 -6H 2 to a final
concentration equal to 10 mM. Autoclave for 20 min at 121°C. Media can be
stored at room temperature for months.
2.2. Bacteriophage Induction from Lactobacillus Strains
1. A 37°C water bath.
2. Spectrophotometer.
3. Mitomycin C with a concentration of the stock solution equal to 0.1 mg/mL.
4. Refrigerated centrifuge.
5. Membrane filter of 0.45 ^im pore size.
6. Sterile tubes.
2.3. Double-Layer Plaque Assay to Enumerate Bacteriophages
1. 1 M CaCl 2 -6H 2 0.
2. 37°C water bath.
3. 45°C water bath.
4. Petri dishes containing MRS agar (1.5%) with CaCl 2 *6H 2 to a final concentration
of 10 mM.
5. Stove at 37°C.
2.4. Propagation of Phages in Liquid Medium
1. 1 M CaCl 2 -6H 2 0.
2. 37°C water bath.
3. Refrigerated centrifuge
4. Membrane filter of 0.45 \xm pore size.
5. Sterile tubes.
2.5. Propagation of Phages in Solid Medium
1. 1 M CaCl 2 -6H 2 0.
2. 37°C water bath.
3. 45°C water bath.
4. Petri dishes containing MRS agar (1.5%) with CaCl 2 -6H 2 to a final concentration
of 10 mM.
5. Incubator at 37°C.
6. TE buffer: lOmMTris-HCl, 1 mM EDT A, pH 8.0. Autoclave for 20 min at 121°C.
Isolation and Titration of Bacteriophages from Lactobacillus 205
3. Methods
3.1. Bacteriophage Induction from Lactobacillus Strains
1. Inoculate 5 mL of fresh MRS broth with 50 \xL of an overnight culture of the
lysogenic Lactobacillus strain. Measure the initial absorbance at 600 nm.
Incubate in a water bath for 30 min at 37 °C (see Notes 2-4).
2. Add mitomycin C to a final concentration of 0.1-0.5 j^g/mL. Measure the absorbance
at 600 nm each hour for 6-8 h (until a decrease of the optical density is observed).
3. Centrifuge the culture at 5000g for 15 min at 4°C (see Note 5).
4. Filter the supernatants containing the phage particles through a membrane filter
of 0.45 jam of pore size.
5. Store the sterile supernatant at 4°C for several months (see Note 6).
3.2. Double-Layer Plaque Assay to Enumerate Bacteriophages
1. Mix 100 fiL of an overnight culture of the indicator strain grown in MRS broth
with 100 jaL of the decimal dilution of the phage lysate suspension (10°, 10 _1 ,10 -2 ,
10~ /7 )- Use sterile MRS broth to prepare the phage dilutions (see Note 7).
2. Add Ca0 2 -6H 2 to a final concentration equal to 10 mM.
3. Preincubate the microtubes 30 min at 37°C in a water bath to allow adsorption of
the phages.
4. Add the bacteria-phage mixture (200 \xL) to a tube containing 3 mL of molten
MRS-Ca 2+ soft agar at 45°C. Gently mix the tube and pour the contents on Petri
dishes containing 15 mL of solidified MRS-Ca 2+ 1.5% agar. Swirl the plate in
circles in the bench top immediately after pouring to spread the sample and the
soft agar over the plate (see Notes 8-10).
5. Leave plates on the bench until the soft agar has solidified (about 15 min).
6. Incubate the plates upside up (with the agar side down) overnight at 37°C.
7. The following day, count the number of plaques and calculate the titer by multi-
plying the number of plaques by the inverse of the dilution by 10 to express the
titer (T) in PFU/mL (plaque-forming units per milliliter) (see Notes 11 and 12).
3.3. Propagation of Phages in Liquid Medium
1. Inoculate at 2% a fresh, ovenight host bacteria culture in MRS broth. Add
Ca0 2 -6H 2 to a final concentration equal to 10 mM.
2. Incubate at 37°C for 30 min in a water bath.
3. Add at 2% a suspension of the phage lysate with at least 1.0 x 10 4 PFU/mL.
4. Incubate at 37°C for 6-8 h in a water bath until lysis occurred.
6. Centrifuge at 5000g for 15 min at 4°C.
7. Filter the supernatants containing the phage ly sates through a membrane filter of
0.45 f^m pore size.
8. Store the sterile supernatant at 4°C for several months.
206 Auad and Ray a
3 A. Propagation of Phages in Solid Medium
1. Mix 100 \xL of an overnight culture of the indicator strain grown in MRS broth
with 100 f^L of the phage lysate suspension (with at least 1.0 x 10 2 PFU/mL).
2. Add CaCl 2 -6H 2 to a final concentration equal to 10 mM.
3. Incubate the tube 30 min at 37°C in a water bath to allow adsorption of the phages.
4. Add the bacteria-phages mixture (200 fiL) to a tube containing 3 mL of molten
MRS-Ca 2+ soft agar at 45°C. Gently mix the tube and pour the content on Petri
dishes containing 15 mL of solidified MRS-Ca 2+ 1.5% agar. Swirl the plate in
circles on the bench top immediately after pouring to spread the sample and the
soft agar over the plate.
5. Leave plates on the bench until the soft agar has solidified (about 15 min).
6. Incubate the plate without inversion overnight at 37°C.
7. At the time of harvesting the phage, the plaques should touch one another, and the
only bacteria growth visible should be a gauzy webbing that marks the junction
between adjacent plaques (semiconfluent lysis).
8. Remove the plate of the incubator, and add 1 mL of TE buffer over the soft agar.
9. With a micropipet harvest as much of the TE buffer as possible and place in a
sterile microtube.
10. Repeat steps 8 and 9.
11. Centrifuge at 5000g for 15 min at 4°C (see Note 5).
12. Recover the supernatant and store at 4°C (see Note 6).
4. Notes
1. For Lactobacillus delbrueckii ssp. bulgaricus strains, we observed that 42°C is
the optimal temperature of induction (11).
2. Optimal doses of mitomycin C ranged from 0.1-0.2 f^g/mL for most of
L. strains; however, some strains of L. helveticus and L. casei tolerate
0.5 \xglmL of the inducer well (9,10). Higher concentration of mitomycin C
can be toxic for the cells.
3. Wear disposable gloves and suitable protecting clothes when handling mutagenic
solutions like mitomycin C.
4. Store mitomycin C solution at 4°C and protect the drug from light and high
temperatures.
5. The centrifugation described in Subheading 3. can be achieved at room tempera-
ture if a refrigerated centrifuge is not available.
6. Ly sates of phages that do not contain lipids in their structure can be stored at 4°C
for several years with the addition of 0.3% chloroform.
7. Quantification of phage titers by the double-layer procedure should be run in
duplicate or triplicate.
8. The phage and bacteria should be exposed to the warm agar (45°C) for as short a
period of time as possible.
9. One alternative of the double-layer method is to add the phage to the tube
containing molten MRS-Ca 2+ soft agar at 45°C, then add the bacteria and pour
Isolation and Titration of Bacteriophages from Lactobacillus 207
onto the the plate without preincubation at 37°C. However, we recommend
preincubation of the phage-host bacteria mixture to obtain more uniform plaques.
10. Vigorous mixing of the tube containing the phage-host bacteria mixture may
damage the phage particles and introduce air bubbles into the soft agar that could
look like plaques, especially to the inexperienced eye.
1 1 . There are some bacteriophages, particularly temperate phages, that replicate poorly,
resulting in incomplete lysis during propagation in liquid medium. This problem
can be solved by increasing the ratio of bacteriophage to bacteria in the infection.
12. In general, the propagation of phages in solid medium is more efficient than in
liquid culture.
References
1. Whitehead, H. R. and Cox, G. A. (1935) The occurrence of bacteriophages in
starter cultures of lactic streptococci. MZJ Sci. Technol. 16, 319-320.
2. Campbell A. (1994) Comparative molecular biology of lambdoid phages. Ann.
Rev. Microbiol. 48, 193-222.
3. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning. A Lab-
oratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY.
4. Accolas, J. P. and Spillmann, H. (1979) Morphology of bacteriophages of Lacto-
bacillus bulgaricus, L. Iactis and L. helveticus. J. Appl. Microbiol. 47, 309-319.
5. Sechaud, L., Ouzel, P. J., Rousseau, M., Baumgartner, A., and Accolas, J. P.
(1988) Bacteriophages of lactobacilli. Biochimie 70, 401-410.
6. Mata, M., Trautwetter, A., Luthaud, G., and Rikenthaler, P. (1986) Thirteen virulent
and temperate bacteriophages of Lactobacillus bulgaricus and Lactobacillus Iactis
belong to a single DNA homology group. Appl. Environ. Microbiol. 52, 812-818.
7. Leder, P., Tiemeier, D., and Enquist, L. (1977) EK2 derivates of bacteriophage
lambda useful in the cloning of DNA from higher organite: the A,gtWES system.
Science 196, 175-179.
8. De Man, J., Rogosa, M., and Sharpe, M. (1960) A medium for the cultivation of
lactobacilli. /. Appl. Bacteriol. 23, 130-135.
9. Sechaud, L., Rousseau, M., Fayard, B., Callegari, M. L., Quenee, P., and Accolas,
J. P. (1992) Comparative study of 35 bacteriophages of Lactobacillus helveticus:
morphology and host range. AppL Environ. MicrobioL 58, 101 1-1018.
10. Herrero, M., de los Reyes-Gavilan, C. G., Caso, J. L., and Suarez, J. E. (1994)
Characterization of ji393-A2, a bacteriophage that infects Lactobacillus casei.
Microbiology 140, 2585-2590.
11. Auad, L., Fortean, P., Alatossava ,T., de Ruiz Holgado, A. P., and Raya, R. R.
(1997) Isolation and characterization of a new Lactobacillus delbrueckii subsp.
bulgaricus temperate bacteriophage. /. Dairy Sci. 80, 2706-2712.
26
Identification of Yeasts Present in Sour Fermented
Foods and Fodders
Wouter J. Middelhoven
1. Introduction
Lactic acid fermentation is commonly used for food conservation. The main
products of this bacterial process are lactic and acetic acids, which are toxic to
many microorganisms, most yeasts included. The low pH achieved by the lactic
acid fermentation, together with anaerobiosis, provides conditions adverse to
spoiling and pathogenic microorganisms. Hence, the fermented commodities
are stable and can be stored for a long time without loss of quality. The
production of sauerkraut is a good example of this practice. In the dairy indus-
try, buttermilk and yogurt are well-known products. This application of the
lactic acid fermentation originated from central Asia in times immemorial and
has spread from there to Europe and the Orient. It was unknown in other
continents until these were colonized from Europe.
Only a limited number of the approximately 700 yeast species known at
present are tolerant to lactic and acetic acids at low pH. Many of these inhabit
fermented foods and fodders. Some of these are mild pathogens (e.g., Candida
parapsilosis); others are very harmful when present in silage because of their
rapid degradation of lactic and acetic acids under aerobic conditions, which
results in loss of nutritive value. Candida milleri, Issatchenkia orientalis, and
Sac char omyces exiguus are the main causative agents of aerobic spoilage of
maize silage (1). A review of yeast species isolated from various silages has
been given by Middelhoven (2).
In this chapter, easy methods for rapid yeast identification are described.
They include simple light microscopy, physiological growth tests, and some
additional characteristics. The yeast species to be identified are those found in
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
209
210 Middelhoven
various silages (2) and species mentioned in both recent yeast monography
(3,4) as inhabitants of commodities like sauerkraut, buttermilk, cucumber brine,
and pickles. If identification by the methods proposed in this chapter is
unsuccessful, the methods prescribed in both yeast monographs should be
applied. It must be kept in mind that only part of the yeasts present in nature
has been described yet. Unidentifiable yeast strains may represent unknown
species. They are welcomed by yeast culture collections, of which the yeast
collection of the Centraalbureau voor Schimmelcultures (CBS) at Delft, The
Netherlands, is the most prominent.
Before carrying out any of the tests described, it must have been proven that
the isolated yeast cultures are pure and indeed are yeasts. This can be ascer-
tained by plating the cultures on 1% yeast extract, 1% glucose, and 2% agar
and by microscopical examination. Only colonies of one type should develop
on the plates and light microscopy (magnification xlOOO) should reveal true
budding yeast cells which are considerably larger than bacteria (usually 3 \xm
wide or more). However, some species do not propagate by budding but by
splitting cells or fragmenting mycelium (e.g., Dipodascus , Galactomyces sp.).
Some of these yeastlike fungi that do not show budding are frequently isolated
from sour foods and fodders and are treated here like they are in the most
authorative yeast monographs (3,4).
The colonies of most species treated in this identification key are white or
cream; some species are red or orange, but never black. Black yeastlike fungi
are not treated here. For their identification, a culture collection (e.g., the
Centraalbureau voor Schimmelcultures [CBS] at Baarn, The Netherlands,
should be consulted. Slant cultures of isolated strains should be incubated at
25 °C for at least 2 wk, to be sure that no black pigment will develop.
In this chapter, a dichotomous identification key to the yeast species listed
in Table 1 is provided (Table 2). Identification is valid only if the isolated
strain fits the morphological and physiological properties of the species that
are given in Table 3. These were taken from recent yeast monographs (3 ,4)
and from the CBS Yeast Data Base (http.www.cbs.knaw.nl). The nomenclature
of the species is according to Kurtzman and Fell (4). The most current
synonyms are also presented (Table 1).
2. Materials
1. Yeast identification system ID 32 C of BioMerieux (Marcy-l'Etoile, France or
Hazelwood, MO, USA).
2. Soluble starch (Merck).
3. Growth media from Difco Laboratories (Detroit, MI): YM agar, yeast nitrogen
base, yeast carbon base, yeast extract, potato dextrose agar, bacto vitamin-free
yeast base.
Identification of Yeasts in Fermented Foods and Fodder 21 1
Table 1
Names and Current Synonyms of the Yeast Species Treated
1 Avxula adeninivorans , synonym: Trichosporon adeninovorans
2 Candida apicola, synonyms: Torulopsis apicola, Torulopsis bacillaris
3 Candida boidinii, assimilates methanol
4 Candida glabrata, synonym: Torulopsis glabrata
5 Candida holmii, anamorph of Saccharomyces exiguus
6 Candida lactis-condensi, synonym: Torulopsis lactis-condensi
7 Candida milleri
8 Candida parapsilosis
9 Candida pseudolambica
10 Candida sake, synonym: Torulopsis sake
1 1 Candida tenuis
12 Candida tropicalis
13 Candida versatilis, synonym: Torulopsis versatilis
14 Candida wickerhamii, synonym: Torulopsis wickerhamii
15 Debaryomyces etchellsii, synonyms: Pichia etchellsii, Torulaspora etchellsii
16 Debaryomyces hansenii, synonyms: Candida famata, Torulopsis Candida
17 Dipodascus capitatus, synonyms: Trichosporon capitatum, Geotrichum capitatum
18 Galactomyces geotrichum, synonym: Geotrichum candidum
19 Hanseniaspora uvarum, synonym: Kloeckera apiculata
20 Hanseniaspora valbyensis, synonym: Kloeckera japonica
21 Issatchenkia orientalis, synonym: Candida krusei
22 Kluyveromyces lactis, synonyms: Candida sphaerica, Kluyveromyces
marxianus var. lactis
23 Kluyveromyces marxianus, synonym: Candida kefyr
24 Pichia anomala, synonyms: Hansenula anomala, Candida pelliculos a
25 Pichia burtonii, synonyms: Hyphopichia burtonii, Endomycopsis burtonii,
Candida variabilis
26 Pichia canadensis, synonyms: Hansenula canadensis, Hansenula wingei,
Candida melinii
27 Pichia ferment ans , synonyms: Candida lambica
28 Pichia holstii, synonyms: Hansenula holstii, Candida silvicola
29 Pichia membranifaciens , synonyms: Pichia membranaefaciens , Candida valida
30 Pichia ohmeri
3 1 Pichia pijperi, synonym: Hanseniaspora pijperi
32 Pichia subpelliculosa, synonym: Hansenula subpelliculosa
33 Rhodotorula minuta
34 Rhodotorula mucilaginosa, synonym: Rhodotorula rubra
35 Saccharomyces barnettii
36 Saccharomyces cerevisiae, synonyms: S. carlsbergenis, S. chevalieri, S.
ellipsoideus, S.italicus, S. lindneri, S. uvarum
37 Saccharomyces dairenensis, synonym: Saccharomyces dairensis or S. castellii;
species can only be distinguished from each other and from S. rosinii with
certainty by molecular techniques
212 Middelhoven
Table 1 (cont.)
Names and Current Synonyms of the Yeast Species Treated
38 Saccharomyces exiguus, synonyms: Candida holmii, Torulopsis holmii
39 Saccharomyces rosinii, can be distinguished from S. dairenensis and S. castellii
only by molecular methods
40 Saccharomyces spencerorum
41 Saccharomyces unisporus
42 Sacharomycopsis fibuligera , synonym: Endomycopsis fibuliger
43 Saccharomycopsis selenospora, synonyms: Guillermondella selenospora,
Endomycopsis selenospora
44 Stephanoascus ciferrii, synonym: Candida ciferrii
45 Torulaspora delbrueckii, synonyms: Saccharomyces delbrueckii , Candida
colliculosa
46 Trichosporon gracile, fragmenting mycelium, urease positive
47 Zygosaccharomyces bailii
48 Zygosaccharomyces bisporus, synonym: Saccharomyces bisporus
49 Zygosaccharomyces mrakii, synonyms: Saccharomyces mrakii, Torulaspora
mrakii. inositol (20 mg/L) stimulates growth.
50 Zygosaccharomyces rouxii, synonyms: Saccharomyces bailii var. osmophilus
3. Methods
3. 7. Morphology
Cells taken from a young pure slant culture are examined microscopically
(magnification xlOOO) for the presence of budding yeast cells and filaments
(mycelium or pseudomycelium). Several species fail to produce mycelium in
slant cultures. They should be examined in slide cultures. For this purpose, a
Petri dish containing a U-shaped glass rod supporting a glass microscope slide
is sterilized by dry heat at 160-180°C for 2 h. A suitable agar (e.g., maize
[corn] meal agar or potato dextrose agar [both commercialy available]) is
melted and poured into a second Petri dish. The glass slide is quickly removed
from the glass rod with a flame-sterilized pair of tweezers and dipped into the
molten agar, after which it is replaced on the glass rod. After the surface of the
agar has solidified, the yeast is lightly inoculated in either one or two lines
along the slide and a sterile cover slip is placed over part of it. A little sterile
water is poured into the Petri dish to prevent the agar from drying out. The
culture is then incubated at 25 °C. After 3 d the slide is examined microscopi-
cally (magnification x400) for the formation of filaments along the edges of
the streak, both under and around the cover slip. Some genera (e.g., Arxula,
Dipodascus, Galactomyces, Trichosporon) are notable for fragmenting of the
mycelium into arthroconidia, which often lie in a characteristic zigz&g way.
Identification of Yeasts in Fermented Foods and Fodder
213
Table 2
Identification Key
l
2
3
4
6
7
8
9
10(1)
11
12
13
14
15
16
17
18
19
20
21
Nitrate assimilated
Nitrate not assimilated
Ethylamine asssimilated
Ethylamine not assimilated
Inositol assimilated
Inositol not assimilated
Maltose assimilated
Maltose not assimilated
No vitamins required
Vitamins required
No growth at 35 °C
Growth at 35°C positive
No fermentation of glucose
Gas from glucose
Raffinose assimilated
Raffinose not assimilated
Erythritol assimilated
Erythritol not assimilated
Ethylamine assimilated
Ethylamine not assimilated
Colonies red or pink
Colonies white or cream
A/-Acetyl-D-glucosamine assimilated
Af-Acetyl-D-glucosamine not assimilated
No budding yeast cells, fragmenting mycelium
Budding yeast cells, with or without filaments
Xylose assimilated
Xylose not assimilated
Inositol assimilated
Inositol not assimilated
Xylose assimilated
Xylose not assimilated
Rhamnose and raffinose assimilated
Rhamnose and raffinose not assimilated
2-Keto-D-gluconate assimilated
2-Keto-D-gluconate not assimilated
Maltose not assimilated
Maltose assimilated
Cellobiose assimilated
Cellobiose not assimilated
Growth at 30°C absent or weak
Growth at 30°C positive
2
10
3
Candida lactis-condensi
Arxula adeninivorans
4
5
9
Pichia anoniala
6
Candida versatilis
1
Pichia canadensis
8
Pichia subpelliculosa
Pichia hols Hi
Can did a boidin ii
Candida wickerhamii
11
59
12
13
Rhodotorula minuta
Rhodotorula mucilaginosa
14
15
Galactomyces geotrichum
Dipodascus capitatus
16
18
17
Saccharomycopsis fibuligera
Stephanoascus ciferrii
Trichosporon gracile
19
40
20
23
Hanseniaspora uvarum
21
Zygosaccharomyces nirakii
22
214
Middelhoven
Table 2
Identification Key (cont.)
22
23
24
25
26
27
28
29
30
31
32
33
34
35
36
37
38
39
40
41
Tolerates 1% acetic acid
No growth in presence of 1% acetic acid
Mannitol assimilated
Mannitol not assimilated
N-Acetyl-D-glucosamine assimilated
Af-Acetyl-D-glucosamine not assimilated
True mycelium formed
No hyphae or primitive pseudomycelium
Xylose assimilated
Xylose not assimilated
Cellobiose assimilated
Cellobiose not assimilated
Rhamnose assimilated
Rhamnose not assimilated
Raffinose assimilated
Raffinose not assimilated
Raffinose assimilated
Raffinose not assimilated
Fragmenting mycelium present
No hyphae or primitive pseudomycelium
L-Arabinose assimilated
L-Arabinose not assimilated
Maximum growth temperature >40°C
Maximum growth temperature approx 30°C
L-Arabinose assimilated
L-Arabinose not assimilated
Galactose assimilated
Galactose not assimilated
Erythritol assimilated
Erythritol not assimilated
A/-Acetylglucosamine assimilated
Af-Acetylglucosamine not assimilated
Raffinose assimilated
Raffinose not assimilated
Maximum growth temperature >40°C
Maximum growth temperature about 30°C
(18) Soluble starch not assimilated
Soluble starch assimilated
Sucrose assimilated
Sucrose not assimilated
Zygosaccharomyces bailii
Zygosaccharomyces bisporus
23
24
Saccharomyces spencer orum
25
28
26
Debaryomyces hansenii
Candida sake
Pic Ida ohineri
28
34
29
30
Debaryomyces hansenii
Candida tenuis
31
32
Pic Ida burtonii
Debaryomyces hansenii
Debaryomyces etchellsii
33
Candida tropical is
Candida sake
35
36
Candida parapsilosis
Candida boidinii
Candida boidinii
37
38
Torulaspora delbrueckii
Candida sake
Candida apicola
39
Candida tropicalis
Candida sake
41
Saccharomycopsis fibuligera
42
49
Identification of Yeasts in Fermented Foods and Fodder
215
Table 2
Identification Key (cont.)
42
43
44
45
46
47
48
49
50
51
52
53
54
55
56
57
58
Cellobiose assimilated
Cellobiose not assimilated
Melezitose assimilated
Melezitose not assimilated
Lactose assimilated
Lactose not assimilated
Raffinose assimilated
Raffinose not assimilated
A/-Acetylglucosamine assimilated
Af-Acetylglucosamine not assimilated
Glucitol assimilated
Glucitol not assimilated
1% Acetic acid tolerated (growth maybe weak)
1% Acetic acid not tolerated
(41) Af-Acetylglucosamine assimilated
Af-Acetylglucosamine not assimilated
Glucitol assimilated
Glucitol not assimilated
Cellobiose assimilated
Cellobiose not assimilated
Fermentation of glucose positive
No or weak fermentation of glucose
Xylose assimilated
Xylose not assimilated
Cellobiose assimilated
Cellobiose not assimilated
Glucitol assimilated
Glucitol not assimilated
Xylose assimilated, may be delayed
Xylose not assimilated
Glucitol assimilated, may be delayed
Glucitol not assimilated
1% Acetic acid tolerated (growth may be weak)
1% Acetic acid not tolerated
59 (10) Red colonies
Colonies white or cream
60 Sucrose assimiated
Sucrose not assimilated
61 Maltose assimilated
Maltose not assimilated
62 2-Ketogluconate assimilated
43
45
44
Kluyveromyces marxianus
.Kluyveromyces lactis
Pic Iiia canadensis
46
47
Candida apicola
Kluyveromyces marxianus
48 '
Saccharomyces spencerorum
Zygosaccharomyces bailii
Zygosaccharomyces rouxii
50
54
Candida boidinii
51
Hanseniaspora valbyensis
52
53
Pichia membranifaciens
Picliia fermentans
Issatchen kia orien talis
55
56
Pichia pijperi
Hanseniaspora valbyensis
Candida pseudolambica
57
58
Saccharomyces unisporus
Zygosaccharomyces bailii
Zygosaccharomyces bisporus
Zygosaccharomyces rouxii
Rhodotorula minuta
60
61
70
62
66
63
216
Middelhoven
Table 2 (cont.)
Identification Key
63
64
65
66
67
68
69
70
71
72
2-Ketogluconate not assimilated
Hyphae formed
No hyphae or some pseudomycelium
Cellobiose assimilated
Cellobiose not assimilated
Mannitol assimilated
Mannitol not assimilated
(61) Mannitol assimilated
Mannitol not assimilated
No vitamins required or biotin only
Other vitamins required
Grows at 30°C
No growth at 30°C
Ascospores formed
No ascospores formed
Mannitol assimilated
Mannitol not assimilated
True mycelium present
No hyphae or some pseudomycelium
Grows at 40°C
Maximum growth temperature 37°C or lower
64
Candida sake
Torulaspora delbrueckii
Saccharomycopsis fibuligera
65
Torulaspora delbrueckii
Saccharomyces cerevisiae
Torulaspora delbrueckii
67
68
Candida milleri
69
Saccharomyces barnettii
Saccharomyces exiguus
Candida holmii
Torulaspora delbrueckii
71
Saccharomycopsis selenospora
72
Candida sake
Saccharomyces dairenensis
Saccharomyces caste I Hi
Saccharomyces rosinii
A flask culture in 2% glucose, 0.5% yeast extract, 1% peptone (GYEP) broth
is recommended. In a 100-mL conical flask, 50 mL of the broth is put and steril-
ized at 120°C for 20 min. The yeast is inoculated to the glass wall at the liquid
surface. After incubation for 3 d at 25 °C without shaking the culture is examined
for the formation of a sediment and a pellicle that may creep onto the glass wall.
3.2. Assimilation of Carbon Compounds
The easiest way to study the pattern of carbon compound utilization, which
in many cases is species-specific, is by using the yeast identification system ID
32 C of BioMerieux. For inoculation the manufacturer's instructions should be
followed. The test strips are inspected for growth daily, up to 7 d. The test kits
should be prevented from drying out. The test kits must be stored at 4°C and
should not be used after the expiration date. The following carbon compounds
are included in the system:
Table 3
Characteristics of Individual Yeast Species Inhabiting Sour Foods
1
-3
K
K
3
1
1
3
1
3
i
I
■9
1
1
•**
1
&
|
£
-—
3
Yeast species (nr)
1
2
3
4
5
6
7
8
9
10
Budding cells
+
+
+
+
+
+
+
+
+
+
Filaments
+
—
+
W
—
—
—
+
+w
+
Fragmenting
+
Pellicle
+
V
+
—
—
—
—
—
?
w
D-Glucose
+
+
+
+
+
+
+
+
+
+
D-Galactose
+
—
—
—
+
—
+
+
—
+
L-Sorbose
+
+D
V
—
—
—
—
+D
—
+
D-Ribose
+
V
V
—
—
—
—
V
—
V
D-Xylose
+
V
+
—
—
—
—
+
+D
+
L-Arabinose
+
—
V
—
—
—
—
+
—
—
Rhamnose
D
—
V
ct-Methylglucoside
+
—
—
—
—
—
—
+
—
V
Sucrose
+
+
—
—
+
+
+
+
—
+
Maltose
+
—
—
—
—
—
—
+
—
+
Trehalose
+
—
—
V
+
—
+
+
—
+
Cellobiose
+
—
—
—
—
—
—
—
—
V
Melibiose
+
Lactose
D
Raffinose
+
+
—
—
+
+D
+
—
—
—
Melezitose
+
—
—
—
—
—
—
+
—
+
D-Glucosamine
+
—
V
—
—
—
—
V
+D
V
Acetyl-D-glucosamine
+
+
+
—
—
7
—
+
—
V
Soluble starch
+
Glycerol
+
+
+D
+D
—
—
V
+
—
+
Erythritol
+
—
+
Glucitol
+
+
+
—
—
—
—
+
—
+
Mannitol
+
+
+
—
—
—
—
+
—
+
Inositol
+
DL-Lactate
—
—
+
V
-D
—
V
—
+
V
D-Gluconate
+
V
—
+
—
—
—
+D
—
V
D-Glucuronate
+
2-Keto-D-gluconate
+
-D
V
V
—
—
—
+
—
+
Nitrate
+
—
V
—
—
+
—
—
—
—
Fermentation of glucose
+D
D
+
+
+
+
+
+
+
+
Ethylamine (N)
+
+
+
—
—
—
—
+
+
V
Vitamin requirement
OT
BT
B(T)
M
OB
BT
BM
B
OB
Urease
Max. growth T (°C)
45
<35
35
40
<35
<35
<35
>37
35
V
Cycloheximide (100 ppm)
+
—
+
—
V
-D
V
V
—
—
Table 3 (continued)
•8
1
fa
■8
c
a
&5
1
■ —
a
->
•8
c
-—
-si
g
a
-C:
*—
8-
bj
3
>■-
■8
• -v.
3
5
< —
s
&
53
.a
s
1
Yeast species (nr)
ii
12
13
14
15
16
17
18
19
20
Budding cells
+
+
+
+
+
+
—
—
+
+
Filaments
+
+
—
—
+
-W
+
+
V
V
Fragmenting
+
+
—
—
Pellicle
—
W
—
—
—
V
+
+
—
—
d-Glucose
+
+
+
+
+
+
+
+
+
+
d-Galactose
+
+
+
+
+
+
+
+
—
—
L-Sorbose
V
V
—
—
+
V
V
+
—
—
d-Ribose
+
-D
V
+
—
V
V
V
—
—
d-Xylose
+
+
-D
+
+
+
—
+
—
—
L-Arabinose
V
—
-D
+
+
+w
—
—
—
—
Rhamnose
+
—
—
+
—
V
—
—
—
—
a-Methylglucoside
+
V
-D
—
+
+
—
—
—
—
Sucrose
+
V
V
—
+
+
—
—
—
—
Maltose
+
+
V
—
+
+
—
—
—
—
Trehalose
+
+
+
V
+
+
—
—
—
—
Cellobiose
+
+D
+
+
+
+
—
—
+
+
Melibiose
—
—
V
—
—
V
—
—
—
—
Lactose
+D
—
-D
—
—
V
—
—
—
—
Raffinose
-D
—
V
—
—
+
—
—
—
—
Melezitose
+D
V
—
—
+
V
—
—
—
—
D-Glucosamine
-D
V
—
-D
+
V
—
—
—
—
Acetyl-D -glucosamine
+
+
+
+
+
V
?
?
■
Soluble starch
V
+
—
—
—
V
—
—
—
—
Glycerol
+
V
+
+
+
+
+
+
—
—
Erythritol
V
—
—
—
—
V
—
—
—
—
Glucitol
+D
+
—
+
+
+w
—
+
V
—
Mannitol
+
+
+
+
+
+
—
V
—
—
Inositol
dl -Lactate
V
V
V
—
V
V
+
V
—
—
D-Gluconate
+D
V
-D
V
—
+w
—
—
V
—
D-Glucuronate
—
—
—
—
—
V
—
7
—
—
2-Keto-D-gluconate
+
+
+
V
+
+
—
—
+
—
Nitrate
—
—
+
+
Fermentation of glucose
V
+
D
+
+D
-W
—
V
+
+
Ethylamine (N)
+
+
+
+
+
+
+
+
+
+
Vitamin requirement
BT
OB
BT
BT
B
OB
?
M
M
Urease
Max. growth T (°C)
30
>40
30
<35
37
V
>37
V
<35
<30
Cycloheximide (100 ppm)
V
+
V
+
—
V
+
?
+
+
Table 3 (continued)
6fl
* --.
*
5
c
■ —
!*.
3
|
I
-5
a
5
K
ft,
c
*-.
:=
■8
"••4
ft.
55
§
Q
ft.
■ N4
ft,
&5
ft,
" M4
u
&
s
— -
■1
|
• »"«4
ft.
Yeast species (nr)
21
22
23
24
25
26
27
28
29
30
Budding cells
+
+
+
+
+
+
+
+
+
+
Filaments
+
+
V
V
+
+
+
+
V
+
Fragmenting
—
—
—
—
+
—
—
—
—
—
Pellicle
+
+
V
V
V
-W
+
V
+
+
D-Glucose
+
+
+
+
+
+
+
+
+
+
D-Galactose
—
+
D
V
+
—
—
+
—
+
D-Sorbose
—
V
V
—
V
—
—
+
V
+
D-Ribose
—
—
V
V
+
—
—
+
—
V
D-Xylose
—
V
D
V
+
+
+
+
V
—
L-Arabinose
—
—
V
V
V
—
—
+
—
—
Rhamnose
—
—
—
—
—
+w
—
+
—
—
a-Methylglucoside
—
V
—
+
+
V
—
+
—
+
Sucrose
—
+
+
+
+
+
—
+
—
+
Maltose
—
V
—
—
+
+
—
+
—
+
Trehalose
—
+
—
+
+
+D
—
+
—
+
Cellobiose
—
+
V
+
+
+
—
+
—
+
Melibiose
Lactose
—
+
V
—
—
—
—
—
—
—
Raffinose
—
V
+
+
+
—
—
—
—
+
Melezitose
—
+
—
+
V
+
—
+
—
—
D-Glucosamine
+
—
—
—
+w
—
+
+
V
+
Acetyl-D-glucosamine
+
—
—
—
+
—
+
+
+
+
Soluble starch
—
—
—
+
+
—
—
+
—
—
Glycerol
+
V
D
+
+
+
+
+
V
+
Erythritol
—
—
—
+
+
—
—
V
—
—
Glucitol
—
+
V
+
+
+D
—
+
—
+
Mannitol
—
+
V
+
+
+D
—
+
—
+
Inositol
DL-Lactate
+
V
+
+
—
+
+
—
V
V
D-Gluconate
—
—
—
V
V
+
—
V
—
V
D-Glucuronate
2-Keto-D-gluconate
—
—
—
—
+
—
—
V
—
+
Nitrate
—
—
—
+
—
V
—
+
—
—
Fermentation of glucose
+
+
+
+
+
—
+
+
-W
+
Ethylamine (N)
+
+
+
+
+
+
+
+
+
+
Vitamin requirement
BM
M
+
T
BT
BT
B
Urease
Max. growth T (°C)
<40
37V
>40
<37
<37
V
<40
<40
<37
40
Cycloheximide (100 ppm)
—
+
+
—
—
—
—
+
—
-D
Table 3 (continued)
Yeast species (nr)
Oh
•5
■ -~
31
?3
— -
s
-§-
a
a
32
a
33
§
JP
§
34
a
y
|
I — i
Q
w
a
_&3
-v.
I
O
3
"-i
3
65
— -
35 36 37 38 39
&?
40
Budding cells
Filaments
Fragmenting
Pellicle
D-Glucose
D-Galactose
L-Sorbose
D-Ribose
D-Xylose
L-Arabinose
Rhamnose
a-Methylglucoside
Sucrose
Maltose
Trehalose
Cellobiose
Melibiose
Lactose
Raffinose
Melezitose
D-Glucosamine
Acetyl-D-glucosamine
Soluble starch
Glycerol
Erythritol
Glucitol
Mannitol
Inositol
dl -Lactate
D-Gluconate
D-Glucuronate
2-Keto-D-gluconate
Nitrate
Fermentation of glucose
Ethylamine (N)
Vitamin requirement
Urease
Max. growth T (°C)
Cycloheximide (100 ppm)
+ + + + +++++ +
-W+--W-----
+ V-- _____
+ + + + + + + + + +
VVV +V + ++ +
+ _vv _____
VVV __V--
+ V + + _____
v + v _____
+ _ v _ v - - -
- + + + ++-+- +
+ _v _+___
+ + + +++D+- +
+ VVV _____
- + - + ++-+- -
v + v _ V - - -
V-- _____
+ + + V V - +
_ +__ _____ _
+ +VV _____
+ + V V _____
+ +VV + v - - - +
+ + + +VV-- +
_ v - _____ ?
- +-- _____ _
+ +-- +++++ +
+ +V+ _____ +
MBTTT BMM-BMT
- + + _____
V V V <40 31 V V V <37 >37
_+DV--V+D-
Table 3 (continued)
I
1
s
--—
to
S3
g
|
|
1
P
■ ***
R
a
&
CO
■ ""A
■8
3
— -
hi
8
Is.
ft
■ -—
■8
|
1
1
ftp
N'
&3
1
'-5
I
— .
1
1
g
N'
■ — ~
'■-.
I
J
'0
I
Yeast species (nr)
41
42
43
44
45
46
47
48
49
50
Budding cells
+
+
+
V
+
+
+
+
+
+
Filaments
—
+
+
V
-W
+
-W
—
-W
-W
Fragmenting
—
—
—
—
—
+
—
—
—
—
Pellicle
—
V
—
+
—
+
—
—
—
—
D-Glucose
+
+
+
+
+
+
+
+
+
+
D-Galactose
+
—
+
+
V
—
V
V
+
V
L-Sorbose
—
—
—
+
V
V
V
+
—
—
D-Ribose
—
—
—
V
—
V
—
—
—
—
D-Xylose
—
—
+D
+
V
+
—
—
—
—
L-Arabinose
—
—
+D
+
—
+
—
—
—
—
Rhamnose
—
—
—
+
—
—
—
—
—
—
a-Methylglucoside
—
+
—
V
V
—
—
—
—
—
Sucrose
—
+
—
+
V
V
V
—
+
-D
Maltose
—
+
—
+
V
V
—
—
—
V
Trehalose
V
V
—
+
D
+
V
—
—
+w
Cellobiose
—
+
—
V
—
+
—
—
—
—
Melibiose
—
—
—
V
—
—
—
—
+
—
Lactose
—
—
—
—
—
V
—
—
—
—
Raffinose
—
V
—
+
V
—
—
—
+
—
Melezitose
—
V
—
—
V
—
—
—
—
—
D-Glucosamine
—
—
—
—
—
V
—
—
—
—
Acetyl-D-glucosamine
—
—
—
7
—
—
—
—
—
—
Soluble starch
—
+
V
V
—
V
—
—
—
—
Glycerol
—
+
V
+
V
+
V
+
D
+w
Erythritol
—
V
—
+
—
—
—
—
—
—
Glucitol
—
V
—
+
V
V
+
D
+
+
Mannitol
—
V
—
+
+
+
+
D
+
+
Inositol
—
+w
—
+
—
+
—
—
—
—
DL-Lactate
—
+w
+
+
V
+
—
—
—
—
D-Gluconate
—
+w
V
+
V
+
—
V
—
-W
D-Glucuronate
—
+
—
+
—
+
—
—
—
—
2-Keto-D-gluconate
—
—
—
+
+
+
V
V
+
—
Nitrate
Fermentation of glucose
+
+D
+D
—
+
—
+
+
+
+
Ethylamine (N)
+
V
—
+
V
+
+
+
+
+
Vitamin requirement
M
M
M
TB
OB
T
B
BT
BP
Urease
—
—
—
—
—
+
—
—
—
—
Max. growth T (°C)
<37
<40
<37
>40
V
<35
V
<35
<30
V
Cycloheximide (100 ppm)
+
+
+
+
—
+
—
—
+
—
+, positive; -, negative; W, weak response; D, delayed positive (7 days or more); V, variable
results; ?, no data known; 0, no vitamins required; B, biotin required; T, thiamine required; P,
pantothenate required; M, more or other vitamins required.
222 Middelhoven
Monosaccharides: glucose, galactose, L-sorbose, D-ribose, D-xylose, L-arabinose,
Rhamnose, a-methylglucoside
Disaccharides and trisaccharides: sucrose (saccharose), maltose, trehalose,
cellobiose, melibiose, lactose, raffinose, melezitose
Amino sugars: D-glucosamine, acetyl-D-glucosamine
Polyols: glycerol, erythritol, glucitol (sorbitol), mannitol, inositol
Organic acids: DL-lactate, D-gluconate, A-glucuronate, 2-keto-D-gluconate
3.3. Assimilation of Nitrogen Compounds
Potassium nitrate (40 mM) is dissolved in Difco yeast carbon base. The broth
is dispensed (2.5 mL) in culture tubes (15 cm high, 16 mm in diameter) and is
sterilized at 120°C for 20 min. Ethylamine hydrochloride should not be steril-
ized in the presence of glucose. A separately sterilized concentrated solution is
added aseptically to culture tubes with 2.5 mL sterile yeast carbon base, to a
concentration of 40 mM. The culture tubes are inoculated with a drop of a young
culture in yeast carbon base with 40 mM ammonium chloride ( sterilized sepa-
rately). For comparison, a culture tube with yeast carbon base without a nitrogen
source is inoculated. All tubes are incubated at 25 °C in a rotary shaker up to 2 wk
and are inspected for growth daily. Positive growth responses should be con-
firmed by transfer of a loopful of the culture to a second culture tube with the
same growth medium. This should also show growth.
3.4. Fermentation of Glucose
Several yeasts present in foods are able to carry out an alcoholic fermenta-
tion. This appears from the production of gas (i.e., carbon dioxide, in Durham
tubes. The latter are test tubes with a small inverted tube inserted to collect any
gas that may be produced. These tubes contain 10 mL of 2% glucose, and 1%
yeast extract. They are inoculated with a loopful after sterilization for 20 min
at 120°C. The tubes are incubated at 25°C until gas is visible in the insert, or up
to 28 d if no gas is produced. The tubes are shaken at intervals of several days.
3.5. Additional Characteristics
3.5.1. Urease
In a 10 mM potassium phosphate buffer (pH 6.0), Phenol Red is dissolved
(20-50 mg/L). This solution can be stored indefinitely in the dark at room
temperature. Aliquots of 0.5 mL are dispensed in test tubes. Immediately before
use a freshly prepared concentrated urea solution is added to a final
concentration of 20 g/L. A loopful of a 1- to 2- d-old slant culture is added to
the solution. The test tubes are incubated at 37°C irrespective of the yeast's
optimum growth temperature. A dark red color appearing within 5 h demonstrates
a pH rise due to hydrolysis of urea to ammonia and carbon dioxide. Comparison
Identification of Yeasts in Fermented Foods and Fodder 223
with an uninoculated blank is recommended. The reaction is characteristic of
basidiomycetous yeasts (in this study the genera Rhodotorula and Trichosporori).
Most ascomycetous yeasts are urease-negative.
3.5.2. Maximum Growth Temperature
Slants of appropriate growth media (e.g., malt extract agar, Difco YM agar)
are inoculated and incubated at constant temperature, preferably in a
thermostated water bath. The slants are inspected for growth after 1, 2, or 3 d.
3.5.3. Tolerance of 1% Acetic Acid
This test is only used to discriminate Zygosaccharomyces spp. It is carried out
by streaking a young preculture (the same as used in the assimilation tests) on
agar plates of the composition 10% glucose, 1% tryptone, 1% yeast extract, and
2% agar is sterilized for 20 min at 120°C and cooled down to approx 45-50°C.
Glacial acetic acid (1 mL/100 mL) is then added and quickly mixed, and the agar
is poured in Petri dishes.
3.5.4. Resistance to 100 ppm Cycloheximide
This test is included in the ID 32 C test system for assimilation of carbon
compounds.
3.5.5. Assimilation of Starch and Methanol
Merck soluble starch is dissolved (5 g/L) in Difco yeast nitrogen base.
Aliquots of 2.5 mL are dispensed in culture tubes (15 cm high, 16 mm in
diameter) and sterilized for 20 min at 120°C. A concentrated solution of metha-
nol in sterile water is added to culture tubes containing 2.5 mL sterile Difco
yeast nitrogen base. The final methanol concentration should not exceed 5 g/L.
Inoculation and incubation are as described in Subheading 3.3.
3.5.6. Vitamin Requirement
Two procedures are recommended. A 10-fold concentration of bacto
vitamin-free yeast base is prepared by dissolving 16.7 g/100 mL. This concen-
trated broth should be filter-sterilized. Aliquots of 0.25 mL are added to culture
tubes containing 2.25 mL sterile water. Alternatively, the vitamin-free medium
can be prepared (for the composition, see ref. 4, p. 99). If ammonium chloride
and glucose are kept separately, the growth medium can safely be sterilized at
120°C without browning and with less risk of airborne infections than filter
sterilization. Add concentrated sterile vitamin solutions after sterilization, at
final concentrations: biotin (20 [xg/L) and/or thiamine (400 \ig/L). More complex
vitamin requirements are not specified in this study. For inoculation and incuba-
tion, see above. Results should be confirmed by transfer of a loopful to a second
culture tube with medium of the same composition. This should also show growth.
224 Middelhoven
4. Notes
1. Yeast species treated. This chapter deals with yeast species which according to
refs. 2-4 have never been isolated from foods and fodders that underwent a lactic
acid fermentation (Table 1). However, products derived from olives (alpechin,
olive brine) are very rich in yeasts not found elsewhere in commodities. These
species were not included. Neither were yeast species characteristic of fruit juices
and alcoholic beverages.
2. Identification Key. A dichotomous identification key to the treated species is
shown in Table 2.
3. Characteristics of individual yeast species. In Table 3 characteristics of the
treated yeast species observed in this study are listed.
References
1. Middelhoven, W. J. and van Baalen, A. J. M. (1988) Development of the yeast
flora of whole-crop maize during ensiling and during subsequent aerobiosis. /.
SciFoodAgric. 42, 199-207.
2. Middelhoven, W. J. (1998) The yeast flora of maize silage. Food Technol.
BiotechnoL 36,7-11.
3. Barnett, J. A., Payne, R. W., and Yarrow, D. (1990) Yeasts: Characteristics and
Identification. Cambridge University Press, Cambridge, UK (available on disk).
4. Kurtzman, C. P. and Fell, J. W. (eds.) (1998) The Yeasts, A Taxonomic Study.
Elsevier, Amsterdam.
IV
Organisms in the Manufacture
of Other Foods and Beverages
27
Protein Hydrolysis
Isolation and Characterization of Microbial Proteases
Marcela A. Ferrero
1. Introduction
Microbial proteases play an important role in industrial processes. The
proteases of Bacillus spp., Mucor spp., and Aspergillus oryzae account for the
bulk of enzyme production and represent aproximately 40% of the total world-
wide enzyme sales (1).
The large success of microbial proteases in food and other biotechnological
systems can be attributed to the broad biochemical diversity of the micro-
organisms, to the genetic manipulation of the organisms, and to the improved
techniques for the enzyme production and purification.
The screening of microorganism-producing proteases from nature is the first
step to obtain microbial proteases with industrial purposes. Although there are
many microorganisms that produce proteases in nature, for industrial purposes,
it should be convenient to find extracellular protease-producing strains because
of easier recovery and the stability of the enzyme.
Bacterial neutral and alkaline proteases are produced mostly by organisms
belonging to the genus Bacillus. Neutral proteases, called also metalloproteases,
generate less bitterness in hydrolyzed food proteins than do the animal proteases
and, hence, are valuable for use in food industry. They are insensitive to natural
plant protease inhibitors and are therefore useful in the brewing industry. Their
low thermotolerance is advantageous for controlling their reactivity during the
production of food hydroly sates with a low degree of hydrolysis (2).
Fungi contain a wider variety of enzymes than do bacteria. For example,
A. oryzae is used to modify wheat gluten by limited proteolysis. The addition of
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
227
228 Ferrero
proteases reduces the mixing time and results in increased loaf volume. Bacterial
proteases are used to improve the extensibility and strength of the dough.
The alkaline and neutral protease of fungal origin play an important role in
the processing of soy sauce. Soybeans serve as a rich source of food and the
hydrolysate is used in protein-fortified soft drinks and in the formulation of
dietetic feeds. Treatment of soy proteins with fungal proteases results in soluble
hydroly sates with high solubility, good protein yield, and little bitterness (2).
Acid proteases are typically produced by fungi. They belong to the cys-
tein and aspartic proteases groups and have commercial applications in cheese
manufacture.
The isolation of protease-producing microorganisms from natural
environments is relatively easy and a general procedure is carried out, utilizing,
in this case, a proteinaceous substrate in the screening procedure.
As a general procedure for microorganism-producing protease screening, I
will describe the isolation and enzyme characterization of neutral proteases
produced by Bacillus strains, useful in food industries.
Methods for determinating alkaline and acid protease activities will be
described in this chapter because they are very useful in food industries too.
2. Materials
2. 1. Media
1. Skim milk medium (SM): Autoclave skim milk agar, composed of skim milk
(10 g/L) and purified agar (15 g/L). Cool the medium to about 60°C and add
Rose Bengal (2 f^g/mL) or Fungizone (10 ^ig/mL) to avoid development of fungi.
Final pH obtained is about 6.5-7.5 (see Note 1).
2. Minimal synthetic medium (ZM), with the following composition: 1.0 g/L
(NH 4 ) 2 S0 4 , 6.0 g/L K 2 HP0 4 , 3.0 g/L KH 2 P0 4 , 0.01 g/L MgS0 4 -7H 2 0, 0.05 g/L
CaCl 2 -2H 2 0, 0.01 g/L MnS0 4 -2H 2 0, 0.001 g/L FeS0 4 -7H 2 0, 0.001 g/L
ZnS0 4 -7H 2 0, 1.0 g/L trisodium citrate, and 10.0 g/L casein (3).
3. Supplemented medium: The same composition described in item 2, but adding
2.5 g/L yeast extract. This medium is utilized when poor growth is observed
in the minimal medium. Vitamins and growth factors are provided by yeast
extract.
2.2. Sampling
1. Collecting vessels and tools. These can be sterile jars, flasks, or tubes for liquid
samples, or small plastic bags for solids.
2. Flasks or vessels with sterile water to dissolve or disperse the sample.
3. Optical microscope for examining bacteria and kit for Gram staining.
4. Biochemical tests for identification of Bacillus strains.
Protein Hydrolysis 229
2.3. Solutions for Determination of Protease Activity
1 . Casein (10 mg/mL) dissolved in 200 mM sodium phosphate buffer, pH 7,4 and 5 mM
PMSF (phenylmethylsulfonyl fluoride), for determination of neutral protease.
2. Casein (10 mg/mL) dissolved in 50 mM borate buffer, pH 9, and 5 mM EDTA,
for determination of alkaline protease.
3. Bovine serum albumin (BSA) (10 mg/mL) dissolved in 0.1 M citrate buffer, pH
3.0, for determination of acid protease.
4. 10.0% TCA (trichloroacetic acid).
5. Folin-Ciocalteau reagent (Merck Co.), threefold diluted in distilled water.
6. 0.5 M Na 2 C0 3 solution.
7. Standard solution of tyrosine, 1.0 mg/mL.
8. Spectrophotometer and plastic cuvets.
9. Centrifuge for Eppendorf tubes.
3. Methods
3. 1. Sampling
From different substrates obtained from natural habitats, collect samples in
sterile containers. Upon returning to the lab, use the following procedure:
1. Weigh out samples into 250-mL flasks or vessels of aproximately 100 mL of
sterile distilled water with 0.85% NaCl added.
2. After shaking for approximately 1 h, set aside to allow solids to settle. Aliquots
of supernatants are subjected to thermal shock treatment to obtain spore-formers:
5 mL of supernatant is put in several tubes and incubated at 80°C for 10 min. This
procedure is used to isolate spore-forming microorganisms (4).
3.2. Screening
1. Inoculate with 4 mL of the 250-mL Erlenmeyer flasks containing 80 mL of SM.
Incubate this flasks for 2-4 d in a rotary shaker at approximately 37-45°C.
2. After a good cellular density was obtained, 50 jaL of proper dilution are spread on
skim milk plates and incubated at 37°C until colonies are easily visible. If
possible, determine the total count of proteolytic spore-former colonies. Follow
the isolation scheme described in Fig. 1 if necessary (5) (see Note 2).
3. Place at least one of each colony type obtained on skim milk agar as punctures in
the middle of squares formed by a grid.
4. The productivity of the colonies is measured in these plates as a ratio of the halo
formed by the casein hydrolyzed to the diameter of the producer bacteria.
3.3. Identification of the Strains
1. Individual colonies are observed under a microscope, and Gram-stained
preparations are used as part of the identification.
230
Ferrero
Sample
Vin= 1-0.5 cm
Vin= 1-2 cm
a) 1 vol (NaCl) 145mmol dm" 3
b) 80°C-10'
Vin = 0.1-0.5 mm'
e <■
©
Microscopy and Gram's staining
ZM
Fig. 1. Isolation scheme for extracellular enzymes producing spore-forming bacteria.
Protein Hydrolysis 231
2. Identification of isolated strains by biochemical tests described in Bergey's
Manual of Systematic Bacteriology (6) and the API Identifiaction System (7).
3A. Determination of Protease Activity
The determination of proteolytic activity is carried out in the supernatants
from the cultures with casein of the isolated strains. Supernatants were obtained
by centrifugation of 1 mL of culture in Eppendorf tubes at 8000g for 20 min.
Protease activities are measured using a modified Anson method (8). As
a general procedure for all cases, 500 [iL of substrate (casein or BSA) in
proper buffer is mixed with 100 [iL of supernatant of the culture in
Eppendorf tubes and incubate at 37 °C for 30 min in a thermostated water
bath. The reaction is stoped with 100 [iL of 10% TCA in an icebath for
15 min to precipite the undegraded protein. The precipitate is separated by
centrifugation in a Eppendorf centrifuge at 8000g for 5 min. After that, the
amino acids produced from the hydrolysis are determinated by the Folin-
Ciocalteau reagent, mixing 500 [iL of supernatant obtained previously with
2.5 [iL of Na 2 C0 3 in glass tubes. The colorimetric reaction is produced by
the add of 500 [iL of Folin-Ciocalteau reagent and then incubation for
30 min at room temperature in the dark. The color produced is read at 660
nm against the reaction blank and the absorbance values are compared to
calibration values of the tyrosine standard (see Note 3).
The samples are determined by duplicates and two controls are neces-
sary. One of them is using water instead of a supernatant (enzymatic activ-
ity control) and the other is using a supernatant but coagulating the casein
before the incubation. This last control is to measure the internal casein
present in the sample.
Depending of the type of enzyme to be identified, substrate and inhibitors
should be selected (9) (see Note 4). Some characteristics of the protease
enzymes to be considered are as follow:
Neutral proteases, in general, works at pH 5-9 and they are sensitive to metal-
chelating reagents, such as EDTA (9).
Alkaline proteases work at pH 7-9 and depending of the enzyme into the general
classification, they can be inhibited by PMSF, DFP, TLCK or TPCK. The two
lastest are specific trypsin inhibitors (9).
Acid proteases belong to cysteine and aspartic protease groups. They exhibe
optimal activity in pH 3-7. Cysteine proteases are sensitive to sulfydryl reagents,
iodoacetic acid, heavy metals, and iodoacetamide. Aspartic proteases, the most
representative of these enzymes, are sensitive to epoxy and diazo-ketone
compounds in the presence of cooper cations and pepstatine (9).
The unit of enzymatic activity unit was defined as the amount of the enzyme
needed to produce 1 mg of tyrosine at 30 min and 37°C.
232 Ferrero
4. Notes
1. The screening of bacteria, yeast, or fungi is not very different. Antibiotics or
fungicides are convenient to use in selecting desirable microorganims.
2. In some case, it is very important to know the specific substrates and characteristics
of the enzyme to be isolated, especially for screening in agar plates. This provides
the most convenient medium for obtaining good zones clear of hydrolysis.
3. The solution of tyrosine is not easy to stabilize. Tyrosine should be dissolved in a
thermosttated water bath at 60°C with agitation.
4. The determination of the proteolytic activity in liquid medium must be according
to the desired enzyme in order, to offer the optimal conditions for enzyme activity.
References
1. Godfrey, T. and West, S. (1996) Industrial Enzymology , 2nd ed., Macmillan, New
York, p. 3.
2. Rao, M., Tanksale, A. M., Ghatge, M. S., and Deshpande, V. V. (1998) Molecular
and biotechnological aspects of microbial proteases. Microbiol. Mol. Biol. Rev.
62 (3), 597-635.
3. Ferrero, M. A. (1995) Ph.D. Thesis.
4. Castro, G. R, Ferrero, M. A., Mendez, B. S., and Sineriz, F. (1993) Screening and
selection of bacteria with amylolytic activity. Acta Biotechnol.
5. Ferrero, M. A., Castro, G. R., Abate, C. M., Baigori, M. D., and Sineriz, F. (1996)
Thermostable alkaline proteases of Bacillus licheniformis MIR 29: isolation,
production and characterization. Appl. Microbiol. Biotechnol. 45, 327-332.
6. Sneath, P. H. A. (1986) Endospore-forming gram-positives rods and cocci, in
Bergey' s Manual of Systematic Bacteriology, vol. 2. (Sneath, P. A. H., Mc Nair,
N. S., and Sharpe, M. E., eds.) William & Wilkins, Baltimore, pp. 1 1 14-1207.
7. Logan, N. A. and Berkeley, C. W. (1984) Identification of Bacillus strains using
API System. /. Gen. Microbiol., 130(7), 1871-1882.
8. Anson, M. L. (1938) Estimation of pepsin, papain and cathepsin with hemoglobin.
J. Gen. Physiol., 22, 79-89.
9. Kalisz, H. M. (1988) Microbial proteinases, in Advances in Biochemical Engineer-
ing/Biotechnology, Vol. 36 (Fietcher, A., ed.), Springer- Verlag, Berlin, pp. 1-61.
28
Production of Polyols by Osmotolerant Yeasts
Lucia I. C. de Figueroa and Maria E. Lucca
1. Introduction
The growth of microbial cells is often inhibited in environments where the
water activity is much reduced. However, some microorganisms have
developed various strategies in order to resist the stresses to which they are
exposed. The ability to adapt to fluctuations in external osmolarity and the
mechanisms of osmoregulation have been elucidated in some of them (7). Thus,
both prokaryotic and eukaryotic microorganisms include species that can
tolerate a wide range of salt concentrations and/or sugars in the culture medium
during growth; they are called osmotolerant (2).
In the cells of most actively metabolizing organisms, the intracellular
medium must remain relatively constant in ionic strength, pH, and levels of
metabolites. Thus, in media of low osmolality, there are homeostatic
mechanisms that maintain these parameters within the required limits,
especially in maintaining the intracellular osmolality. After a transfer to a
hyperosmotic medium, adaptation to the change is required. For most
organisms, the adaptive response to this change is the intracellular
accumulation of organic compounds, which act as compatible solutes that are
not toxic to the cells, even at the high concentrations required for stabilization
of the osmotic equilibrium. In yeasts, compatible solutes are poly hydroxy
alcohols, such as glycerol, arabitol, erythritol, and xylitol (4). Polyols are usu-
ally used as additives in the food industry.
Glycerol is a simple amphipatic three-carbon alcohol molecule with multiple
commercial applications. The lack of color and odor and the high viscosity of
glycerol make it suitable as an adjunct to ointments and cosmetics. Glycerol is
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
233
234 Figueroa and Lucca
part of many antifreezing agents, and it is used to stabilize enzyme solutions.
Glycerol originating from yeast fermentation contributes to the consistency of
beer, wine, and bakery products, and the control of its level is of interest to
these industries. Yeast stress tolerance in the yeast-producing industry is strictly
related to the overproduction of glycerol (6). Improvement of wine yeast strains
for glycerol production would be advantageous in the case of wines that are
lacking in body. Moreover, glycerol contributes to the taste of wine by
providing sweetness. Sugar- tolerant yeasts isolated from flowers, fermenting
honey, and dry fruits, mostly classified as strains of Zygosaccharomyces rouxii,
Candida magnoliae and Torulaspora delbrueckii produce glycerol and arabitol
(6,9). Salt-tolerant yeasts isolated from salty environments, such as Pichia
miso, P.farinosa, and Debaryomyces hansenii, are able to produce high yields
of glycerol, arabitol, and erythritol (5,10).
Xylitol is a naturally occurring five-carbon polyhydroxy alcohol with a high
sweetening power. It is increasingly used as a food sweetener, dental caries
reducer, and sugar substitute in the treatment of diabetics. It is a normal
intermediate of carbohydrate metabolism in humans and animals. It is also
widely distributed in the plant kingdom, particularly in certain fruits and
vegetables (11).
Xylitol is currently produced by the nonspecific chemical reduction of
D-xylose. Therefore, the biological production of xylitol could be of economi-
cal interest because it does not require a pure xylose syrup, as the chemical
synthesis does. Hence, low-cost hemicellulosic hydrolysates might be potential
substrates (12). Xylose-utilizing yeasts, such as D. hansenii, Candida
guillermondii, and C. parapsilopsis, produce high amounts of xylitol as the
major product of xylose metabolism (13).
Yeasts are relatively easy to isolate from natural habitats, being necessary to
weigh out a sample of the substrate, suspend it in sterile water, and spread a
suitable dilution on either a nonselective medium (usually acidified malt extract
agar to suppress bacterial growth) to obtain organisms of the total population
or on a selective medium to obtain cultures of particular species. After the
plates have been incubated and the colonies have developed, they are ready to
be identified (Table 1).
Protoplast fusion has made a significant contribution to our understanding
of the genetics and biochemistry of yeasts, and it has facilitated the creation of
novel strains of yeasts that display enhanced biotechnological potential.
A protoplast may be defined as an osmotically fragile cell completely devoid
of cell-wall material. Because of their inherent osmotic fragility, the protoplasts
had to be maintained in an environment rendered isotonic by the addition of an
osmotic stabilizer. In the absence of the restraining effect of an intact cell wall,
a protoplast assumes a spherical shape in an isotonic buffer to minimize the
Production of Polyols by Osmotolerant Yeasts
235
Table 1
Yeasts in Some Natural Habitats
Natural habitats
Osmotolerant yeasts
Corn silage
Viticulture residues
Juice fruits
Pickles
Fermenting honey
Dry fruits
Grape musts
Soy sauce
Salty environments
Bakery
Candida tropicalis
Candida shehatae
Hansenula polimorfa
Candida tropicalis
Debaryomyces hansenii
Pichia farinosa
Torulaspora delbrueckii
Candida magnoliae
Hansenula poly mo rp ha
Zygosaccharomyces rouxii
Torulaspora delbrueckii
Zygosaccharomyces rouxii
Pichia miso
Pichia farinosa
Debaryomyces hansenii
Torulaspora pretoriensis
Torulaspora delbrueckii
surface-to-volume ratio. The terms "protoplast" and "spheroplast" are often
used interchangeably, but it should be recognized that the latter term is reserved
for osmotically fragile cells enveloped in cell-wall material. As a result of the
presence of such wall material, a spheroplast may retain its original cellular
shape in isotonic buffer. Yeast cell-wall degradation and subsequent protoplast
liberation are most frequently achieved enzymatically (14).
The fusion technique requires a suitable method for the easy preparation of
protoplasts and for the regeneration to the yeast cell. The usefulness of isolated
protoplast physiological and biochemical research is based on the assumption
that they are physiologically normal, retaining all the properties of the intact
cells from which they are derived (15).
In the fusion process, the yeast cell walls are enzymatically removed, and
the resulting protoplasts are fused together using polyethylene glycol (PEG)
and calcium ions (Ca 2+ ) before being embedded in an osmotically stabilizer
agar under appropriate selected conditions. The mechanism by which PEG and
Ca 2+ bring about protoplast fusion is unknown, but it is thought that the PEG
has the dual role of diminishing the electrostatic field between the lipid
membranes and removing water for the protoplasts (16).
236 Figueroa and Lucca
For a better understanding of this work, we are dividing it into three parts:
1. Isolation and screening of xylitol-producing yeasts from agricultural residues.
2. Osmotolerant hybrids producing glycerol and arabitol obtained by protoplast
fusion.
3. Production of polyols in batch culture.
2. Isolation and Screening of Xylitol-Producing Yeasts
from Agricultural Residues
2. 1. Materials
1. Agricultural residues, as corn silage, viticulture residues, and so forth.
2. Microorganisms: It is necessary to use a yeast strain as the positive control (e.g.,
D. hansenii) and to use another as the negative control (e.g., C. utilis).
3. Isolation medium: YM broth (Difco Laboratories, Detroit, MI), pH 5.0, and the
same YM broth acidified to pH 3.5, also try a medium with 10% NaCl plus 5%
glucose.
Isolation medium for xylitol production: 6.7 g/L yeast nitrogen base (YNB), 5 g/L
yeast extract, 20 g/L D-xylose, 0.03 g/L Rose Bengal, and 20 g/L agar, pH 3.5.
Fermentation assays medium: 30 g/L D-xylose, 2 g/L yeast extract, and 6.7 g/L
YNB (75); pH 5.0.
4. Fermentation assays: Use 250-mL Erlenmeyer flasks containing 100 mL of
medium.
5. Thin-layer chromatography (TLC): Use Merck Silicagel F254 plates.
2.2. Methods
1. Isolation and identification: Samples of 5-10 g have to be obtained and
transported in sterile plastic bags. The samples are suspended in 50 mL of YM
medium diluted 1:10 with sterile water containing 1 g/L Tween-80 (18). After
shaking 60 min at 25°C, the suspension is poured into sterile culture tubes and
stored overnight at 4°C. Most of the supernatant is discarded, and the remaining
(about 2 mL) is shaken in order to resuspend the settled cells. This suspension is
streaked on acidified YM agar. The inoculated plates are incubated at 25°C, and
after 3, 5 and 12 d, well-isolated colonies are transferred on YM agar until growth
is observed. Colonies have to be restreaked and picked on selective medium with
xylose as the sole carbon source.
The yeast strains have to be identified according to their carbohydrate and
nitrogen assimilation patterns, using the keys and description in ref. 19 and the
computerized yeast identification program devised by Barnett, Payne, and Yarrow.
2. For the fermentation assays, the inocula are prepared by growing a loopful of
cells from a stock culture in 50-mL Erlenmeyer flasks containing 15 mL of
fermentation medium, incubated for 48 h at 30°C in a rotary shaker at 150 rpm.
Fermentation flasks have to be inoculated to a final concentration of 10 7 cells/mL
and incubated at 30°C in a rotary shaker at 150 rpm {see Note 1).
Production of Polyols by Osmotolerant Yeasts 237
3. After being spotted with 4 ^L of samples and standards, the plates of TLC are devel-
oped using the double-ascending method in a solvent system consisting of ethyl
acetate-isopropanol-water (130 : 57 : 23), at 30°C, for 35 min. After drying with hot
air, the plates are sprayed with bromocresol green-boric acid (see Note 2).
3. Osmotolerant Hybrids Producing Glycerol and Arabitol
Obtained by Protoplast Fusion
3. 7. Materials
1. Yeast strains: Osmotolerant yeasts (salt tolerant or sugar tolerant) must be used
as one of the parental strains (see Note 3).
2. Maintenance medium: 10 g/L yeast extract, 20 g/L peptone, 20 g/L glucose, and
10 g/L agar (YEPD).
Regeneration media: (a) 10 g/L yeast extract, 20 g/L peptone, 700 g/L glucose,
plus 0.6M KC1 and 30 g/L agar (for sugar-tolerant hybrids); (b) 10 g/L yeast
extract, 20 g/L peptone, 120 g/L glucose, 120 g/L NaCl, plus 1.5M KC1 and
30 g/L agar (for salt-tolerant hybrids).
Selective media: (a) 10 g/L yeast extract, 20 g/L peptone, 700 g/L glucose, plus
15 g/L agar (for sugar-tolerant hybrids; (b) 10 g/L yeast extract, 20 g/L peptone,
20 g/L glucose, 120 g/L NaCl, plus 15 g/L agar (for salt-tolerant hybrids).
3. Pretreatment solution: 0.01 M EDTA, 0.1 M Tris-buffer, 0.6M KC1 (1.2 M -1.4 M
for osmotolerant yeasts), and 1% |3-mercaptoethanol (0.1 M for osmotolerant yeasts).
4. Osmotically stabilized solution: 0.6 M KC1 ( 1 .2 M-\ A M for osmotolerant yeasts).
5. Enzyme solution: 0.08 M phosphate buffer (pH 5.8), 0.06 M KC1, and 5 mg/mL
Novozyme 234.
6. Fusion mixture solution: polyethyleneglycol (PEG) MW 6000, 30% w/v; 10 mM
CaCl 2 in 0.05 M Tris-HCl buffer, pH 8.1.
7. Polyol extraction: see Subheading 2.3.
8. Polyol determination: HPLC, Gilson, equipped with a pump 305, a differential
refractometer 2142 LKB, and a recorder/integrator chromatopac CR601
(Shimadzu). Concentration of sugars were determined with a refractive index
(RI) detector under the following conditions: Rezex ROA (Phenomenex) column
(300 x 7.8 mm); temperature: 55°C; eluent, 0.02N sulfuric acid; flow rate,
0.6 mL/min; sample volume, 20 f^L.
3.2. Methods
1. Protoplast formation
a. Inoculate each of the strains into 10 mL YEPD and grow overnight at 30°C
at 200 rpm.
b. Harvest the cells in mid-exponential growth phase by centrifuging in
Eppendorf tubes.
c. Add pretreatment solution (1 mL), resuspend cells, and incubate at 37°C for
15 min.
238 Figueroa and Lucca
d. Spin down and wash once with osmotically stabilized solution.
e. Add 1 mL of enzyme solution until protoplast formation is complete.
Determine the progress of protoplasting by microscopic observation.
f. Spin down protoplasts of both parental strains at a relatively low speed and
resuspend each pellet in 1 mL of osmotically stabilized solution.
g. If it is necessary to use nonviable protoplasts of one of the parental strains
(see Note 4), resuspended protoplasts in the osmotically stabilized solution
must be killed by heating at 70°C for 5-15 min (or use a petite mutant is
S. cerevisiae is one of the parents).
2. Fusion and regeneration of the hybrids
a. Mix both protoplast suspensions, centrifuge again at relatively low speed,
discard the supernatant, and resuspend the pellet in 2 mL of the fusion mixture
solution. Incubate for 30 min at 30°C.
b. Add the fusion mixture to 100 mL of the osmotically stabilized, melted
regeneration medium at 42°C, mix rapidly, pour as an overlay on Petri dishes
with a base of the same osmotically stabilized regeneration medium, and allow
to harden (see Note 4).
c. Incubate the plates at 30°C for 4-5 d, until colonies appear.
d. Pick colonies to selective media for isolation and characterization of the
desired fusion products (see Note 4).
3. Polyol extraction and determination: Osmotolerant hybrids are cultured in
Erlenmeyer flasks with a high-osmotic-pressure medium to determine polyol
production. The intracellular and extracellular fractions of glycerol and arabi-
tol is determined according to ref. 20. An appropriate amount of cell culture
(usually 1.5 mL) has to be rapidly sampled and centrifuged in an Eppendorf
centrifuge. The clear supernatant containing the extracellular polyols is
transferred to a water bath and boiled for 10 min together with a parallel sample
of the uncentrifuged cell culture. This latter sample contains total polyols (intra-
cellular and extracellular fractions) and has to be cleared by centrifugation. Both
samples are frozen until analyzing. Intracellular polyols are determined by
subtracting the extracellular fractions from that of the total.
Polyols are determined by usual techniques (e.g., HPLC).
Total yields of polyols in the cells and in the supernatants should be compared.
4. Production of Polyols in Batch Cultures
4. 7. Materials
1. Strains: Osmotolerant yeasts.
2. Fermentation medium: 10 g/L yeast extract, 20 g/L peptone, and 500 g/L glucose
(see Note 5).
3. Fermentor: The fermentor should have automatic control of dissolved oxygen
tension, pH, foam, and temperature.
4. Analytical determination: Glucose, ethanol, and polyols can be determined by
HPLC.
Production of Polyols by Osmotolerant Yeasts 239
4.2. Methods
1. Fermentation assays: The fermentation medium is inoculated with 12-h-old
culture of the osmotolerant yeast to a final concentration of 0.25-g/L (dry weight)
cells. The pH is maintained at 3.0 by the addition of either 0.5 N HC1 or 0.5 N
NaOH. The agitation speed is kept at 500 rpm and the temperature at 30°C.
Dissolved oxygen tension is controlled at 60% saturation by supplying air auto-
matically via a proportional integrative and derivative (PID) controller, if the
fluctuations are lower than 5% (see Note 6).
2. Analytical determination: Samples are withdrawn periodically in order to control
the time-course of fermentation until glucose is exhausted. Supernatants obtained
from each sample are analyzed by HPLC. Under the conditions described using
osmotolerant yeasts, high yields of polyols are achieved.
5. Notes
1. Fermentation assays have to be done in order to detect xylitol production in the
isolated yeast strains. Keep in mind that some yeasts that utilize xylose do not
produce xylitol; however, other yeasts such P. farinosa produces xylose from
xylose, xylitol, and heptitols.
2. Xylose and xylitol are visualized as yellow spots on blue background, with the
same retardation factor (Rf) values as the standard ones. Solutions of xylitol (rang-
ing from 5 to 30 g/L) and xylose (20 g/L) have to be used as standards. TLC, a
qualitative technique, is used as a rapid preselection step. Supernatant samples from
the fermentation assays showing spots of at least the same size of that correspond-
ing to the 5 -g/L xylitol standard should be selected to perform further analysis by
high-performance liquid chromatography (HPLC). It is worthwhile to point out
that it is possible to separate xylose from xylitol with this TLC technique.
3. In order to obtain polyol-producing fusion products, it is necessary to use, as one
of the parental strains for the fusion experiment, salt-tolerant yeasts (e.g.,
D. hansenii) or sugar-tolerant yeasts (e.g., T. delbrueckii or Z. rouxii ) (21 22). The
other parental yeast strain could be, e.g., S. cerevisiae, taking into account the per-
formance of this species in fermentation processes (5,6).
4. When hybrids are isolated by complementation of physiological markers, the
regeneration and selective media, and the culture conditions must have selection pres-
sure in order to avoid parental strains development. For osmotolerant yeasts, the salt
or sugar tolerance can be used as selective markers. For example, when fusing a salt-
tolerant yeast (such as D. hansenii) with S. cerevisiae, the medium to be used for
regeneration of the cell wall and isolation of the fusion products can be YEPD + 12%
NaCl, and the incubation temperature at 37°C. S. cerevisiae does not grow on media
containing a high concentration of salt and D. hansenii does not grow at 37°C, so
only the hybrids survive (5).
When both parental strains do not complement their markers for isolating the
fusion products, one important and interesting solution is to use protoplasts from
one of them killed by heating. For example, when fusing a sugar-tolerant yeast
240 Figueroa and Lucca
(such as T. delbrueckii) with S. cerevisiae, the medium to be used for regenera-
tion of the cell wall and isolation of the hybrids can be YEPD with 700 g/L
glucose. S. cerevisiae is not able to grow in this medium, and protoplasts of
T. delbrueckii are not viable, thus only fusion products can grow. As a control
and to verify that the protoplasts of T. delbrueckii are not viable, an aliquot of the
suspension should be spread on Petri dishes containing the regeneration medium
and no growth must be observed (6).
5 . It is necessary to optimize the fermentation culture medium according to the strain
used in order to improve polyol yields (4).
6. According to the critical demand of oxygen of each yeast strain, it is necessary to
assure enough availability of it in the culture medium. Another important param-
eter to consider in the production of polyols is the pH value during the process,
usually in the range 3-4.
References
1. Brown, A. D. (1978) Compatible solutes and extreme water stress in eukaryotic
microorganisms. Adv. Microb. Physiol. 17, 181-242.
2. Lars, A., Nilsson, A., and Adler, A. (1988) The role of glycerol in osmotolerance
of the yeast Debaryomyces hansenii. J. Gen. Microbiol. 134, 669-677.
2a. Spencer, J. F. T. and Sallans, H. R. (1956) Production of polyhydric alcohols by
osmophilic yeasts. Can. J. Microbiol. 2, 72-29.
2b. Spencer, J. F. T., Roxburgh, J. M., and Sallans, H. R. (1957) Factors influencing
the production of polyhydric alcohols y osmophilic yeasts. Agricultural Food
Chem. 5, 64-67.
5. Loray, M. A., Spencer, J. F. T., Spencer, D. M., and de Figueroa, L. I. C. (1995)
Hybrids obtained by protoplast fusion with a salt-tolerant yeast. /. hid. Microbiol.
14,508-513.
6. Lucca, M. E., Loray, M. A., de Figueroa, L. I. C, and Callieri, D. A. (1999)
Characterization of osmotolerant hybrids obtained by fusion between protoplasts
of Saccharoniyces cerevisiae and heat treated protoplasts of Torulaspora
delbrueckii. Biotechnol. Lett. 21, 343-348.
7. Yagi, T. (1991) Effects of increases and decreases in the external salinity on the
intracellular glycerol and inorganic ion content in the salt-tolerant yeast
Zyog saccharoniyces rouxii. Microbios 68, 109-117.
8. Prior, B. A. and Hohmann, S. (1997) Glycerol production and osmoregulation, in
Yeast Sugar Metabolism (Zimmermann, F.K. and Entian, K.D., eds.), Technomic,
Lancaster, PA, pp. 313-337.
9. Spencer, J. F. T. and Spencer, D. M. (1978) Production of polyhydroxy alcohols
by osmotolerant yeasts, in Primary Products of Metabolism (Rose, A.H., ed.),
Academic, London, pp. 393-425.
10. Agarwal, G. P. (1990) Glycerol, in Advances in Biochemical Engineering/Bio-
technology (Fiechter, A., ed.), Sringer-Verlag, Berlin, pp. 95-128.
11. da Silva, S. S. and Afschar, A. S. (1994) Microbial production of xylitol from
D-xylose using Candida tropicalis. Bioprocess Eng. 11, 129-134.
Production of Polyols by Osmotolerant Yeasts 24 1
12. Roseiro, J. C, Peito, M. A., Girio, F. M., and Amaral-Collaco, M. T. (1991) The
effects of the oxygen transfer coefficient and substrate concentration on the xylose
fermentation by Debaryomyces hansenii. Arch. Microbiol. 156, 484-490.
13. Gfrio, F. M., Pelica, F., and Amaral-Collac.o, M. T. (1996) Characterization of xylitol
dehydrogenase from Debaryomyces hansenii. Appl. Biochem. Biotech. 56, 79-87.
14. Cavanagh, K. and Whittaker, P. A. (1996) Application of protoplast fusion to the
non-conventional yeast. Enzyme Microb. Technol. 18, 45-51.
15. Spencer, J. F. T., Bizeau, C, Reynolds, N., and Spencer, D. M. (1985) The use of
mitochondrial mutants in hybridization of industrial yeast strains. VI. Character-
ization of the hybrids, Saccharomyces diastaticus x Saccharomyces rouxii,
obtained by protoplast fusion, and its behavior in simulated dough-raising tests.
Curr. Genet. 9, 649-652.
16. Curran, B. P. G. and Bugeja, V. C. (1996) Protoplast fusion in Saccharomyces
cerevisiae in Methods in Molecular Biology, Yeast Protocols (Evans, L, ed.),
Humana, Totowa, NJ, pp. 45-49.
17. Barbosa, M. F. S., Medeiros, M. B., Mancilha, M., Schneider, H., and Lee, H. (1988)
Screening of yeasts for production of xylitol from D-xylose and some factors which
affect xylitol yield in Candida guilliermondii. J. hid. Microbiol. 3, 241-251.
18. Middelhoven, W. J. (1997) Identity and biodegradative abilities of yeasts isolated
from plants growing in an arid climate. Antoine van Leeuwenhoeck 72, 81-89.
19. Kurtzman, C. P. and Fell, J. W. (1998) The Yeasts, a Taxonomic Study. 4th ed.,
Elsevier Science, Amsterdam.
20. Adler, L., Blomerg, A., and Nilsson, A. (1985) Glycerol metabolism and osmoregu-
lation in the salt-tolerant yeast D ebaryomyces hansenii. J. Bacteriol. 162, 300-306.
21. Spencer, J. F. T., Spencer, D. M., Bizeau, C, Vaughan-Martini, A., and Martini,
A. (1985) The use of mitochondrial mutants in hybridization of industrial yeast
strains. V. Relative parental contributions to the genomes of interspecific and
intergeneric yeast hybrids obtained by protoplast fusion, as the determined by
DNA reassociation. Curr. Genet. 9, 623-625.
22. Legmann, R. and Margalith, D. (1983) Ethanol formation by hybrid yeasts. Appl.
Microbiol. Biotechnol. 1, 320-322.
29
Identification of Yeasts from the Grape/Must/Wine
System
Peter Raspor, Sonja Smole Mozina, and Neza Cadez
1. Introduction
Yeasts are the most significant microorganisms in all conversion steps of
the grape/must/wine system. Because of their metabolic activity, yeasts play a
central role in the must fermentation process and also in contamination and
spoilage of the final products — wines. Consequently, only reliable and rapid
identification of yeast species during process and quality control enables
enologists to assess the role of yeasts as a main protagonist of alcoholic
fermentation or as a contaminant.
Traditionally, yeasts have been identified on the basis of morphological,
physiological and biochemical criteria. However, such identification has many
limitations: more than 90 tests may be required (1-3) and the procedure is
time- and material-consuming and requires an experienced person to exclude
subjective judgment. Some commercially available sets of selected physiologi-
cal/biochemical tests are used for identification of yeasts from different
substrata, but they do not adequately identify wine yeasts (4). In addition,
distinction capacity is low; the differentiation of strains belonging to the same
species is inaccurate or impossible at all. This is not acceptable in studying
mixed-yeast-population dynamics during the must/wine fermentation process
(differentiation of Saccharomyces cerevisiae strains originating from grapes,
starter culture, etc.).
Recently, many simple or more sophisticated molecular techniques have
been introduced for wine yeast characterization. These include restriction and/or
hybridization analyses or direct sequencing of yeast chromosomal or mitochon-
drial DNA or amplification of yeast DNA with specific or nonspecific primers
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
243
244 Raspor, Smole Mozina, and Cadez
in combination with further analyses of amplified fragments (restriction fragment
length polymorphism with polymerase chain reaction amplified ribosomal
DNA [PCR-RFLP of rDNA], random amplified polymorphic DNA [RAPD],
etc.). Among molecular typing methods we recognized the restriction analysis of
amplified fragments of yeast ribosomal DNA as a suitable and rapid method with
most species-specific results (although some exceptions exist). In addition, the elec-
trophoretic karyotyping using pulsed field gel electrophoresis (PFGE) enables
strain differentiation, especially of Saccharomyces sensu stricto yeasts with a large
number of shorter chromosomes.
Considering the knowledge about the limited number of yeast species
occurring in grape/must/wine systems [approx 100 species out of 470, accord-
ing to Barnett et al.(5) or even less (15-20)] relevant for winemaking (6), we
developed a procedure for the identification of yeasts, isolated from grape/
must/wine, on a species and strain level. The protocol is based on rapid
molecular typing of yeasts, but also includes selected classical confirmation
tests resulting from possible misidentification in the case of species nonspe-
cific restriction patterns of amplified rDNA fragments (PCR-ribotypes) of
yeasts. It remains technically rational, economically feasible, and applicable
for the identification of a larger number of yeasts isolated in studies, including
aspects of all conversion steps from grapes (or other sources of yeasts in the
fermentation process) and mixed yeast population dynamics during fermenta-
tion to the assessment of contamination risk of final products.
The identification involves a few steps: isolation, enumeration, and
morphological characterization of yeast strains, isolation of DNA for PCR
amplification and PCR-RFLP of rDNA (PCR ribotyping), analyses of species-
specific PCR-ribotypes, confirmation of species identification with selected
physiological tests, and electrophoretic karyotyping for differentiation of iso-
lates on a strain level (see flow diagram in Fig. 1).
2. Materials
2. 1. Isolation and Enumeration of Yeasts
1 . Acidified yeast-malt agar (Difco, USA). After autoclaving, cool to 60°C and add 1 M
HC1 to a final pH 3.7-3.8; mix and pour plates (/). The medium can also be prepared as
follows: 3.0 g/L yeast extract, 3.0 g/L malt extract, 5.0 g/L peptone, 10.0 g/L glucose,
and 20.0 g/L agar. Follow the other instructions for preparation of Difco YM agar.
2. Membrane filter apparatus (Sartorius, Millipore), sterile filters, 0.45 \im.
2.2. Morphological Characterization of Yeasts
1. YM agar (Difco).
2. Wine diluted to 8-9% (v/v) of ethanol with YM broth (yeast extract [3.0 g], malt
extract [3.0 g], peptone [5.0 g], glucose [10.0 g]) and filtered through membra-
neous filter aseptically.
Identification of Yeasts from Grape/Must/Wine System 245
3. Sporulation media: McClary's acetate agar: 1.8 g/L potassium chloride, 8.2 g/L
sodium acetate tryhidrate, 2.5 g/L yeast extract, 1.0 g/L glucose, 15 g/L agar (7).
5% Malt extract agar: 50 g/L malt extract, 20 g/L agar. Vegetable juice (V8,
Campbell's) agar: Suspend 5 g of compressed baker's yeast in 10 mL of water
and add to 350 mL of V8 vegetable juice, heat in a boiling water bath for 10 min,
filtrate, and adjust pH to 6.8. Melt 14 g agar in 340 mL of demineralized water
and add to V8 juice (7,8).
2.3. PCR-RFLP ofrDNA
2.3.1. Isolation of DNA
1. YEPD agar: 20 g/L glucose, 10 g/L yeast extract, 10 g/L peptone, 15 g/L agar.
2. Solution 1: 0.9 M sorbitol and 0.1 MEDTA. Preparation: Dilute 1MEDTA 1:10
and dissolve 163.9 g/L of sorbitol.
3. Lysing enzyme (Sigma): stock solution 1 mg/mL.
4. Solution 2: 50 mM Tris-HCl and 20 mM EDTA.
5. 10% (w/v) sodium dodecyl sulfate (SDS).
6. 5 M Potassium acetate.
7. Isopropanol.
8. 70% (v/v) Ethanol.
9. TE buffer: 10 mM Tris-HCl (pH 7.5) and 1 mM EDTA.
10. RNase A solution (stock cone. 10 mg/mL TE buffer).
11. Ice-cooled 95% (v/v) ethanol.
2.3.2. PCR Amplification ofrDNA
1. PCR buffer (100 mM Tris-HCl [pH 9.0], 15 mM MgCl 2 , and 500 mM KC1).
2. 200 \kM dNTP.
3. 1 \iM solution of primer 1 (NS 1:5' GTAGTCATATGCTTGTCTC 3' or ITS
1:5' TCCGTAGGTGAACCTGCGG 3) and primer 2 (ITS 4: 5TCCTCCGCT
TATTGATATGC 3) (9).
4. Taq polymerase (cone. 5 U/f^L).
5. Bidistilled sterilized water.
6. PCR tubes and PCR cycler.
2.3.3. Restriction Analysis of Amplified rDNA
1 . Selected restriction enzymes with corresponding restriction buffers (see Note 1).
2. Classical gel electrophoresis equipment, loading buffer, agarose, and DNA
marker with the bands ranging from 100 bp and longer.
3. IX TAE buffer: 40 mM Tris-acetate (pH 8.0) and 1 mM EDTA. Prepare stock
solution 50X TAE: 242 g/L Tris base, 57.1 mL glacial acetic acid, 20 mL of
0.5 M EDTA (pH 7.5). Dilute before use.
246 Raspor, Smole Mozina, and Cadez
4. Ethidium bromide: stock solution 1 mg/mL.
5. Ultraviolet transilluminator; Polaroid camera.
2 A. Confirmative Physiological Testing
The latest detailed and extensive protocols for preparation of materials for
determining physiological and biochemical characteristics of yeasts as well as
useful identification keys for selection of appropriate tests are given in Chap-
ter 1 1 of ref. 7. Also, some older editions of yeast identification keys are useful
(1,2,5). The instructions for preparation of materials, selection of tests, and
testing conditions should be followed exactly to reduce subjective factors as
much as possible.
2.5. Electrophoretic Karyotyping
2.5.1. Isolation of Chromosomal DNA
1. YEPD agar: 20 g/L glucose, 10 g/L yeast extract, 10 g/L peptone, and 15 g/L
agar.
2. 1 M EDTA, pH 7.5; 0.5M EDTA, pH 9.0; 50 mM EDTA, pH 7.5.
3. CPES buffer: 40 mM citric acid, 120 mM Na 2 HP0 4 (pH 6.0), 1.2 M sorbitol,
0.5M EDTA (pH 7.5). Preparation: First prepare CPESa: 24.5 g/L citric acid,
42.7 g/L Na 2 HP0 4 (pH 6.0), and 437 g/L sorbitol. Mix CPESa and 1 M EDTA,
pH 7.5, in the ratio 1:1 and add dithiothreitol (DTT) (final concentration 5 mM)
just before use.
4. Low-melting-point (LMP) agarose (Pharmacia LKB, Sweden, or others).
5. Lysing enzyme (Sigma): stock solution 1 mg/mL.
6. CPE buffer (the same as CPES, but without sorbitol and DDT).
7. Lysis solution: 0.45 M EDTA (pH 9.0), lOmMTris-HCl (pH 8.0), l%Na-lauryl-
sarcosine, 1 mg/mL Proteinase K (Boehringer Mannheim, Mannheim, Germany).
Preparation: Mix 90 mL of 0.5 M EDTA (pH 9.0), 1 mL of 1 M Tris-HCl
(pH 8.0), 5 mL of 20% Na-lauryl-sarcosine solution, and 4 mL of sterile
demineralized water and dissolve 100 mg of Proteinase K. A 20% Na-lauryl-
sarcosine solution should be sterilized before by filtration through a 0.2-fim mem-
branous filter.
2.5.2. Pulsed Field Gel Electrophoresis
1. 0.5X TBE buffer: Stock solution: 5X TBE buffer (0.5 M Tris-HCl [pH 8.0],
325 mM boric acid, and 10 mM EDTA. Dilute in the ratio 1:10 before use.
2. Agarose for PFGE (Bio-Rad chromosomal grade or others).
3. Chromosomal DNA size markers (S. cerevisicte, P. canadensis [H. wingei],
S. ponibe, Bio-Rad).
4. 0.5 |^g/mL ethidium bromide solution (stock solution 1 mg/mL).
Identification of Yeasts from Grape/Must/Wine System 247
w
f^ Isolation and enumeration of yeasts (see 3.1.)
^ w
<J H Morphological characterisation (see 3.2.)
H ^ PCR-RFLP of rDNA (see 3.3)
^ I
q^ ^ Confirmative species
SPECIES-SPECIFIC PCR RIBOTYPES O identification with selected
physiological tests (see 3.4.)
Qg
I
Electrophoretic karyotyping (see 3.5.)
fe h
Fig. 1. Major steps in the isolation and identification of yeasts isolated from the
grape/must/wine system.
3. Methods
The major steps in the isolation and identification of yeasts isolated from the
grape/must/wine system is presented in Fig. 1.
3. 1. Isolation and Enumeration of Yeasts
1. Pipet or weigh out 1 mL/lg of substrate (collected in sterile container), suspend it
in sterile water, dilute accordingly to expected number (up to 10" 7 in the case of
fermenting musts), and spread it on acidified YM agar plates. Incubate 3-6 d at
25 °C and check the growth in intervals, since filamentous fungi may overgrow
the plates (see Note 2). If you isolate yeasts from final products (wines), filter
100-500 mL of wine through the filter membrane (0.45 f^m) and incubate the
membrane on the malt agar plate as described.
2. After incubation count distinctive colonies and determine total colony count.
Restreak colonies of visually distinctive types on YM agar for isolation of pure
cultures and determination of morphological characteristics of the colonies and
vegetative cells (7). If you are interested in yeast community structure, select
plates with the proper number of colonies and restreak all colonies from the plates
for further identification, as many yeasts cannot be distinguished by visual
examination (form and/or color of the colony).
248 Raspor, Smole Mozina, and Cadez
3.2. Morphological Characterization
1. Observe the growth of yeast colonies on YM agar after 5-7 d of incubation:
form, texture, color, surface, elevation, and margin of the colonies. Additional
morphological characteristics could be observed when giant colonies are formed
on YM agar after 3-4 wk and on the liquid substrate, where so-called "film-
forming yeasts" form film already after 24-48 h or with a delay of 3-4 wk
(see Note 3).
2. Suspend the overnight grown culture of yeast in water, place 10 \xL on a micro-
scope slide and cover with the cover slip. Observe the form (spherical, ovoidal,
ellipsoidal, cylindrical, ogival, apiculate, triangular), position (single, paired,
aggregated in clumps), and mode of asexual reproduction (budding [multipolar,
bipolar, unipolar, fission], formation of conidia on stalks, etc.) of yeast cells under
x630 - x 1000 magnification. The shape may reflect the mode of reproduction and,
in some cases, it is a characteristic of particular genera or species. Among wine yeasts,
an example is the apiculate yeasts of HanseniasporalKloeckera, which reproduce
asexually by bipolar budding in basipetal succession on a narrow base (7).
3. Ascospore formation: Grow the cultures on McClary's acetate agar, 5% malt extract
agar, and V8 agar for 14 d. Suspend the culture in water, place 10 \xL on a microscope
slide, and cover with the cover slip. Observe the form of asci and the form and number
of ascospores in ascus (see Note 4).
3.3. PCR-RFLP ofrDNA
3.3.1. DNA Isolation
1. Grow the isolated colonies on YEPD agar plates for 24-48 h at 28°C.
2. Harvest the cells with the loop and suspend them in 1 mL of demineralized water
in Eppendorf tube to wash them and centrifuge (1500g, 5 min).
3. Resuspend the cell pellet in 500 fiL of solution 1 and add 60 fiL of lysing enzyme
solution (cone. 1 mg/mL) (see Note 5).
4. Incubate at 30°C for 30 min. Collect the spheroplasts by centrifugation
(10,000 c ?, 5 min).
5. Resuspend the sediment in 500 f^L of solution 2 and add 13 \xL of 10% (w/v)
SDS. Mix well on vortex and incubate at 65°C for 5 min.
6. Add 200 ^iL of 5 M potassium acetate and cool on ice for 5 min.
7. Centrifuge (19,000g, 15 min) to remove the precipitated protein and transfer
700 ^iL of clear supernatant to an Eppendorf tube. Add the equal volume of iso-
propanol, gently mix, and hold at room temperature for 10 min and collect the
precipitated DNA by centrifuging (14,000g, 10 min).
8. Discard the supernatant and rinse the pellet with 500 ^iL of 70% (v/v) ethanol to
remove the residual isopropanol. Centrifuge (14,000g, 5 min), discard the ethanol,
and dry in the vacuum centrifuge until all traces of ethanol have been removed.
9. Dissolve the DNA in 50 \xh of TE buffer with 1 j^L of RNase A (stock cone.
10 mg/mL) and incubate at 37°C for 30 min.
Identification of Yeasts from Grape/Must/Wine System 249
10. Extract with 70 ^iL of ice-cooled 95% (v/v) ethanol, centrifuge (14,000g, 15 min),
discard the supernatant, and dry the pellet in the vacuum centrifuge. Dissolve in
50 f^L of TE buffer and store in the freezer until use.
3.3.2. PCR Amplification of rDNA
1. Preparation of reaction mixture for one sample (total volume is 20 fiL):
2 fiL of isolated DNA in TE buffer
2 |aL of 1 OX PCR buffer ( 1 00 mM Tris-HCl , pH 9.0; 1 5 mM MgCl 2 , 500 mM KC1)
1.6 ^iL of 200 \xM solution of each dNTP
1 fiL of 1 \kM primer 1 {see Note 6)
1 \\L of 1 \iM primer 2
0.2 fiL of Taq polymerase (cone. 5 U/mL)
12.2 \kL bidistilled sterilized water
Prepare the reaction mixture for all samples tested, dispense 18 jaL into PCR
tubes and add 2 \\L of DNA finally.
2. Place the PCR tubes for amplification of 18S + ITS rDNA (primer NS 1/ITS4) or
ITS region (ITS1/ITS4) in a thermal cycler under the following conditions:
a. Primer NS1/ITS4: 5 min at 95°C followed by 35 cycles of 30 s at 95°C,
30 s at 60°C, and 3 min at 72°C. Finally, heat the mixture at 72°C for
7 min and cool to 4°C.
b. Primer ITS1/ITS4: 5 min at 95°C followed by 35 cycles of 1 min at 95°C,
1 min at 56°C, and 2 min at 72°C. Finally, heat the mixture at 72°C for 7 min
and cool to 4°C.
3. Check the concentration and specificity of the PCR product: Prepare 1% (w/v)
agarose in IX TAE buffer. Mix 1 \\L of PCR product, 9 f^L of distilled water, and
1 \xL of loading buffer and load the gel. Add the molecular marker of appropriate
size. Run the electrophoresis in IX TAE buffer at 250 V for 20 min, stain the gel
in 0.5 \xg /mL of ethidium bromide solution, and observe the product under ultra-
violet (UV) light {see Note 6).
3.3.3. Restriction Analysis of Amplified rDNA
1 . Dispense 4 ^iL of the PCR product in each of four Eppendorf tubes and add 8 f^L of
the restriction mixture (for each tube, 2 U of frequently cutting restriction enzyme
[see Note 1], 1.2 fiL of 10X concentrated corresponding restriction buffer, and
6.8 |nL of water) and incubate 2-3 h at optimal temperature for specific endonu-
clease (primarily at 37°C, but at 65°C for Taq\).
2. After incubation, add 2.0 |^L of loading buffer to the restriction mixture and pipet
the whole volume into agarose wells. Use 1.5% agarose gel when the 18S + ITS
region is amplified or 3.0% agarose gel when only the ITS region is amplified.
3. Before running the electrophoresis, cool the IX TAE buffer to 4°C to avoid the
smiling effect.
4. Adjust the voltage to approx 10 V/cm of the gel and run the electrophoresis for 1-1 .5 h.
250 Raspor, Smole Mozina, and Cadez
5. Stain the gel in ethidium bromide solution (0.5 \xg/mL) for 20-30 min. Rinse
in distilled water or electrophoresis buffer for 30 min and document with
Polaroid camera.
3.3.4. Analysis of Species-Specific Restriction Patterns of Ribosomal
DNA (PCR Ribotypes)
With the PCR primers and restriction enzymes mentioned, species-specific
restriction patterns are generated for most of wine yeast species (see Notes 7
and 8). Here, we recommend a comparison with already published data in the
literature and comparative analyses of species-type strains.
3.4. Confirmative Species Identification with Selected
Physiological and Biochemical Tests
For differentiation of yeast species with identical restriction patterns of
amplified rDNA (and for confirmative identification of all other species), we
recommend the observation of selected physiological and biochemical
characteristics. The tests most often used are fermentation and/or assimilation
of carbon sources, assimilation of nitrogen sources, requirements for vitamins,
growth at various temperatures, resistance to antibiotics, and so forth (7).
The advantage of our protocol is the possibility of a significant reduction in
the number of tests if species-specific restriction patterns of amplified
rDNA fragments are collected first. We recommend combining the pheno-
typic observation with the molecular identification to distinguish among species
where differentiation on the basis of PCR ribotypes is doubtful or impossible
(see Notes 9 and 10).
3.5. Electrophoretic Karyotyping with PFGE
3.5.1. Isolation of Chromosomal DNA
1. Grow the isolated colonies on YEPD agar plates for 24-48 h at 28°C.
2. Harvest the cells with the loop and suspend them in 1 mL of distilled water in an
Eppendorf tube to wash them and centrifuge (1500g, 5 min).
3. Wash the cell pellet in 1 mL of 50 mM EDTA, pH 7.5, centrifuge (1500g, 5 min,)
and discard the supernatant.
4. Resuspend the cells in 40 |iL of CPES buffer and warm the prepared biomass at
42°C to prevent the solidification when 80 ^JL of melted 1% LMP agarose with
1 mg/mL of lysing enzyme is added (see Note 11).
5. Mix by pipetting, pour 100 \xL of biomass into dry block formers with taped
bottom and refrigerate for rapid setting.
6. Remove the agarose blocks from the formers by tapping them in appropriate
containers (i.e., 2 mL cryovials) and incubate them in 1 mL of CPE buffer at
30°C for 1 h without shaking.
Identification of Yeasts from Grape/Must/Wine System 251
7 '. Replace CPE buffer with 50 mM EDTA (pH 9.0) and incubate for 15 min at room
temperature. Repeat the rinsing step three times.
8. At final rinsing, replace EDTA with 1 mL of lysis solution with Proteinase K
and incubate overnight at 50°C or at 37°C for 2-3 h with gentle shaking on the
platform shaker.
9. Dilute AMauryl-sarcosine by rinsing the plugs with 50 mM EDTA, pH 9.0, for 1 h.
10. Store the blocks in 0.5 M EDTA (pH 9.0) at 4°C. Blocks are stable in EDTA for
more than a year.
3.5.2. Pulsed Field Gel Electrophoresis
1 . Melt 1 % (w/v) agarose in 0.5X TBE buffer, cool it to approx 50°C, and pour onto
a level glass plate; place the comb and allow to set.
2. Load the sliced pieces of agarose blocks (approx. 1-2 mm wide, according to the
concentration of DNA in the blocks) (see Note 12) against the bottom and front
surfaces of the well and overlay with melted 1% (w/v) LMP agarose. Add appro-
priate size markers to each gel (see Note 13).
3. Cool the 0.5X TBE buffer in PFGE apparatus to 10-12°C and place the plate
with the gel into the PFGE apparatus (see Note 14).
4. When the running time expires (see Note 15), switch off the power supply and
slide the gel from the plate to a staining solution (0.5 \ig/mL of ethidium bromide
in distilled water or electrophoresis buffer) for 30-40 min. Rinse it in distilled
water for 1 h or longer for improved contrast and photograph. The time of expo-
sure to UV light is restricted to a maximum of 1 min because of degradation of
DNA under UV light.
4. Notes
1. Recommended restriction enzymes are Haelll, Cfol, Hinfl, Mspl, Rsal, ScrFI,
and Taql.
2. Instead of acidified YM agar, special media could be used for isolation and
maintaining of certain yeast species (addition of 0.5% CaC0 3 for Brettanomyces
yeasts, higher pH for Schizosaccharomyces, or higher sugar concentration for
osmotolerant Zygosacharomyces yeasts). If the problem of mold contamination
is to be expected (i.e., botrytizied grapes), 12 mg/L of diphenyl should be
incorporated into the growth media. When you expect bacteria to be present you
may add oxytetracycline (0.01%) to reduce bacterial contamination. Another
limitation of usually used rather nonselective isolation medium is doubtful isola-
tion of certain species from samples containing yeast species in significantly
different concentrations: for example, isolation of S. cerevisiae from grape sur-
face or grape juice, or vice versa, and isolation of non-Sac char omyces species in
later stages of fermentation. Selective lysin agar (Oxoid, England) could be used
in the latter case (6).
3. Some macromorphological features of wine yeasts may be useful for species
identification. An example is the production of certain pigments. Yeasts from
252 Raspor, Smole Mozina, and Cadez
genera Rhodotorula, Rhodosporidium, Cryptococcus, Sporidiobolus, and
Sporobolomyces produce nondiffusible red, orange, and pink carotenoid
pigments. Metschnikowia pulcherrima strains produce diffusible pulcherrimin
pigment. Yeasts belonging to these genera are usually isolated in vineyards, from
grapes, wine-cellar equipment and also in early stages of must fermentation.
Another interesting morphological feature is the formation of giant colonies,
which are prepared by applying a strong inoculum into the center of YM agar
plate and judged after 3-4 wk. Their shape, size, and consistency, topography of
surface, edges, and perpendicular section, and luster are observed and found
characteristic for particular species.
The formation of film could be observed on the surface of wine with low alcohol
content (8-10% v/v) after 3 and 30 d of incubation at 25°C. Typical examples of
film-forming yeasts are Pichia anomala, P. membranifaciens , Candida vini, and
C. krusei.
4. Ascospore morphology is often used for genus delimitation. Among wine yeasts
needle-shaped, spheropedunculate, and ellipsoidopedunculate asci (spores) are
characteristic for M. pulcherrima and M. reukaufii, hat-shaped ascospores for gen-
era Pichia and Dekkera, and round/oval ascospores for Kluyveromyces , Saccharo-
myces, Torulaspora, Zygosaccharomyces , Debaryomyces, and so forth.
5. DNA isolation (Subheading 3.1.1.) should be adapted for yeast genera that
produce large amounts of extracellular mucus (e.g., Rhodotorula, Cryptococcus,
Sporidiobolus) or for genera with a particularly resistant cell wall (e.g.,
Zygosaccharomyces , Schizosaccharomyces). In step 3, increased concentration
of lysing enzyme (12 mg/mL) and the use of Lyticase (12 mg/mL) in addition to
lysing enzyme is recommended (and, sometimes, further purification with Pro-
teinase K and phenol extraction is also required).
6. Comparing the amplification with NS1/ITS4 and ITS1/ITS4 primers, there is no
difference in distinction capacity among all species tested (data not published)
because in both cases, the same variable ITS region is amplified. The difference is in
the length of the PCR product (in the case of NS 1/ITS4, approx 2100 - 2500 bp and
for ITS 1/ITS4, approx 400-800 bp) and in the complexity of the restriction patterns.
7. With PCR-RFLP of rDNA, it is possible to distinguish among the majority of
wine yeasts with some exeptions:
a. In the genus Debaryomyces, it is not possible to distinguish among the species
D. hansenii, D. vanrijiae, D. udenii, D. castellii, and D. polymorphus .
b. It is not possible to differentiate between Saccharomyces bayanus and
S. pastorianus (10).
c. Species-specific restriction patterns for the species Hanseniaspora uvarum and
H. guilliermondii is possible to obtain only with the restriction enzyme Ddel (11).
d. Closely related species of the genera Torulaspora and Zygosaccharomyces
have the same restriction patterns obtained with some restriction enzymes
(i.e., Mspl: there are no differences among type strains T. pretoriensis ,
Z. rouxii, Z. baillii, T. delbrueckii, Z. bisporus, and Z. micro ellipsoides).
Identification of Yeasts from Grape/Must/Wine System 253
&
v
V \C $f ^ ^ ty/^ \r \ \
Fig. 2. Selected species-specific PCR-ribotypes of Torulaspora and Zygosac-
charomyces wine yeasts generated with NS 1 and ITS4 primers and restriction endonu-
clease Cfol.
However, with the restriction enzymes Haelll, Cfol, and Sau3A, it is possible
to obtain species- and genus-specific patterns (Fig. 2) (12).
8. There are also found some intraspecies variations in PCR-ribotypes, which are more
frequent when dealing with strains isolated from geographically distinct environ-
ments and express possible varieties of the same species. Intraspecies differences
so far found are in the species K. lactis, D. polymorphus , P. membranifaciens ,
S. pombe, Z. microellipsoides, H. osmophila, and C. laurentii (11,12).
9. In the cases where final determination of yeast species is not possible just on the
basis of restriction fragments of amplified rDNA (because of limited databases,
lack of variation within different taxa and/or limited number of restriction
enzymes used), a combined study of genotypic and phenotypic features is
necessary. Some examples are as follows: Differentiation between teleomorphic
and anamorhic yeast forms is possible only with the observation of spore forma-
tion because the restriction patterns of rDNA of teleomorph/anamorph pairs are
the same [i.e., Hanseniaspora, Kloeckera (13)]. In addition, although differentia-
tion among very closely related species such as H. uvarumlK. apiculata and
H. guilliermondiilK. apis by molecular tools is very difficult {see Note 7c and
ref. 13), we recommend the testing of growth at 37°C, which is characteristic for
H. guilliermondiilK. apis but not for H. uvarumlK. apiculata (14).
10. In attempts to identify closely related species in the genera Torulaspora in
Zygosaccharomyces , the following tests are recommended: growth at 37°C,
assimilation of galactose, melibiose, a-methyl-D-glucoside and trehalose, growth
on agar with 1% acetic acid, growth with 0.1% cycloheximide and 16% NaCl/5%
glucose (14).
254 Raspor, Smole Mozina, and Cadez
1 1 . For yeasts belonging to the genera Rhodotorula, Cryptococcus, and Sporidiobolus
and others that produce large amounts of extracellular polysaccharides, an
increased concentration of lysing enzyme (12 mg/mL) and also the use of Lyticase
(12 mg/mL) is recommended.
12. An overloaded concentration of DNA will yield a smear instead of clear electro-
phoretic fragments. It may also change the migration rate and result in the wrong
estimation of chromosome size.
13. Chromosomal fragments of S. cerevisiae, P. canadensis (H. wingei) and S. pombe
are suitable commercially available size markers for estimation the length of short
and long yeast chromosomes, respectively.
14. Several apparatuses have been developed for PFGE that provide a homogenous
electric field allowing DNA molecules to migrate in straight lines in the gel.
The most widely used is the contour-clamped homogeneous electric field
(CHEF) in which a hexagonal electrode array allows a switch through an angle
of 120° between pulses. There are at least three commercially available ma-
chines of this type: Pulsaphor, Pharmacia; CHEF DR-11, Bio-Rad and
Hexafield, BRL. Other PFGE devices use rotating gel electrophoresis (RGE),
where the field is stationary but the gel is rotated between fixed points controlled
by microswitches, rotating field electrophoresis (RFE), in which electrodes rotate
around the gel boundary, and, finally, alternating field electrophoresis (TAFE),
in which the gel stands vertically and the electric field passes through the thick-
ness of the gel (15).
The separation process of PFGE is a subject of many parameters:
• Concentration of agarose: The recommended concentration of agarose varies
between 0.9% and 1.2%. At a lower agarose concentration, the resolution of
fragments is lower although the run time can be shorter (15).
• The pulse time: if the pulse time is much shorter than the molecular-reori-
entation time, the molecules do not change the direction and any separation
resulting from molecular reorientation is lost. Typical pulse times vary from
0.1 s for molecules smaller than 10 kbp to 1000 s for those approaching
10 Q Mbp (16).
• The field strength: For separation of very large DNA molecules, it is important
to lower the voltage (17).
• The temperature: with increasing temperature, the mobility of DNA molecules
is increased because of a decrease of viscosity of the buffer (18).
15. The electrophoresis conditions are different for the Sac char omyces sensu stricto
group and other wine yeast species because of the high number of rather small
chromosomes (smaller than 2200 kbp) within the Sac char omyces sensu stricto
group. Other wine yeasts have evidently larger chromosomes (even over 3 Mbp)
and, consequently, different protocols are used for karyotyping Sac char omyces
sensu stricto and other yeasts. As an example, two electrophoresis conditions of
pulse intervals for contour-clamped homogenous field system (CHEF,
Pulsaphor™) are presented:
Identification of Yeasts from Grape/Must/Wine System
255
*
f?
*
A
.#
$
Jb
,<?
/ / # <* # # £ 4 4 J 4 J
C? 0* ^ V * % v *?• 'J' V =?■ ■?
#
/
Fig. 3. Selected electrophoretic karyotypes of S. cerevisiae, C. stellata, and
H. uvarum generated under electrophoresis conditions as described in protocol 1.
(From K. Povhe-Jemec et al., unpublished results.)
Protocol 1
For Saccharomyces sensu stricto yeasts
Phase 1:60 s, 15 h
Phase 2: 90 s, 8 h
Phase 3: 100 s, 1 h
Total run time: 24 h
Voltage: 170 V
Protocol 2
For non-Saccharomyces yeasts
Phase 1: 150 s, 24 h
Phase 2: 300 s, 24 h
Phase 3: 600 s, 20 h
Total run time: 68 h
Voltage: 100 V
Just to differentiate between Saccharomyces sensu stricto and non-Saccha-
romyces yeasts, protocol 1 is recommended (Fig. 3). Large chromosomal
fragments of non-Saccharomyces yeasts remain on the top of the gel, whereas
chromosomes of Saccharomyces are separated throughout the gel.
For differentiation among non-Saccharomyces yeasts, protocol 2 should be
used. The method is not optimized for all genera of wine-associated non-Sac-
charomyces yeasts, but the chromosomal separation is good for the following
genera: Rhodotorula, Sporidiobolus , Zygosaccharomyces , Saccharomy codes,
Debaryomyces, Hanseniaspora, Pichia, and Kluyveromyces. For the genera
256 Raspor, Smole Mozina, and Cadez
Cryptococcus, Dekkera, Metschnikowia, Schizosaccharomyces, and Torula-
spora, further optimization is necessary because of the length of their longest
chromosomal fragments, which exceeds 3.13 Mbp.
References
1. Barnett, J. A., Payne R. W., and Yarrow, D. (1990) Yeasts: Characteristics and
Identification, Cambridge University Press, Cambridge.
2. Barnett, J. A., Payne, R. W., and Yarrow, D. (1996) Yeast Identification PC
Program, version 4, Cambridge University Press, Cambridge.
3. Lachance, M. A. and Starmer W. T. (1998) Ecology and yeasts, in The Yeasts, a
Taxonomic Study (Kurtzman, C. P. and Fell, J. W., eds.), Elsevier, Amsterdam,
pp. 21-30.
4. Praphailong, W., Van Gestel, M., Fleet, G. H., and Heard, G. M. (1997) Evaluation
of the Biolog system for the identification of food and beverage yeasts. Lett. Appl.
Microbiol 24, 455-459.
5. Barnett, J. A., Payne, R. W., and Yarrow, D. (1983) Yeasts: Characteristics and
Identification, Cambridge University Press, Cambridge.
6. Fleet, G. H. (1993) The microorganisms of winemaking — isolation, enumeration
and identification, in Wine Microbiology and Biotechnology (Fleet, G. H., ed.),
Harwood AP, Sydney, Australia, pp. 1-26.
7. Yarrow, D. (1998) Methods for the isolation, maintenance and identification of
yeasts, in The Yeasts, a Taxonomic Study (Kurtzman, C. P. and Fell, J. W., eds.),
Elsevier, Amsterdam, pp. 77-102.
8. Spencer, J. F. T.,and Spencer, D. M. (1996) Maintenance and culture of yeasts, in
Yeast Protocols, Methods in Cell and Molecular Biology, vol. 53 (Evans, I. H.
ed.), Humana, Totowa, NJ, p. 7.
9. White, T. J., Bruns, T., Lee, S., and Taylor, J. (1990) Amplification and direct
sequencing of fungal ribosomal RNA genes for phylogenetics, in PCR Protocols:
A Guide to Methods and Applications (Innis, M. A., Gelfand, D. H., Sninsky, J. J.,
and White, T. J., eds.), Academic, London, pp. 315-322.
10. Smole Mozina, S., Dlauchy, D., Deak, T., and Raspor, P. (1997) Identification of
Saccharomyces sensu stricto and Torulaspora yeasts by PCR ribotyping. Lett.
Appl. Microbiol. 24, 311-315.
11. Esteve-Zarzoso, B., Belloch, C, Uruburu, F., and Querol, A. (1999) Identifica-
tion of yeasts by RFLP analysis of the 5,8S rDNA gene and the two ribosomal
internal transcribed spaces. Int. J. Syst. BacterioL 49, 329-337.
12. Cadez, N., Princic, M., Smole - Mozina, S., and Raspor, P. Unpublished results.
13. Smole Mozina, S., Cadez, N., and Raspor, P. (1998) rDNA RFLPs and AP-PCR
fingerprinting of type strains and grape-must isolates of Hanseniaspora
(Kloeckera) yeasts. Food Technol. Biotechnol. 36, 37-43.
14. Kurtzman, C. P. and Fell, J. W. (1998) The Yeasts, a Taxonomic Study, Elsevier,
Amsterdam.
15. Maule, J. (1998) Pulsed field electrophoresis. Mol. Biotechnol. 9, 107-126.
Identification of Yeasts from Grape/Must/Wine System 257
16. Bustamante, C, Gurrieri., S., and Smith, S. B. (1993) Towards a molecular
description of pulsed-field gel electrophoresis. TibTech 11, 23-30.
17. Pharmacia LKB Technology (1990) Instruction Manual PulsaphorTM System,
Pharmacia LKB Biotechnology, Uppsala, Sweden.
18. Mathew, M. K., Smith, C. L., and Cantor, C. R. (1988) High-resolution separation and
accurate size determination in pulsed-field gel electrophoresis of DNA. 1. DNA size
standards and the effect of agarose and temperature. Biochemistry 27, 9204-9210.
30
Carotenogenic Microorganisms
A Product-Based Biochemical Characterization
Jose Domingos Fontana
1. Introduction
Carotenoid production or occurrence — including derivatives biosynthesized
from precursors — is widespread in nature in both the Prokaryota and Eucaryota
superkingdoms and more than 600 different chemical structures are reported
(1), most of them as tetraterpenoids (C 40 ). Mammalian species lack the biochem-
ical ability for carotenoid biosynthesis, but they convert some of them to vitamin
A or perform other chemical modifications on the diet carotenoid input. At least
four particular carotenoids (Fig. 1) are fully exploited for commercial applica-
tions because their production was consolidated through chemical synthesis:
(3-carotene (C 40 . double cyclic ends), canthaxanthin (diketo-(3-carotene), astax-
anthin (dihydroxy-diketo-(3-carotene), and apocarotenoic acid as its ethyl ester
(C 32 ; single cyclic end). As diluted organosolvent solutions (e.g., 2-4 fig/mL),
these pigments display yellow to orange deep colors. The former nonoxy-
genated product, also obtained from plant sources like carrots and from geneti-
cally improved strains of the molds Blakeslea trispora (2) and Phycomyces
blakesleeanus (3), is mainly employed in pharmaceutical multivitamin formu-
lations or as a food additive in margarines. The three other xanthophyls (oxy-
genated carotenoids) are mainly used in aquaculture (salmonoid fish farming)
and poultry purposes as an enhancer of meat and egg-yolk color. Cantaxanthin
is the pink-orange natural pigment in the edible mushroom Cantharellus
cinnabarinus (Agaricaceae) and in flamingo feathers. Astaxanthin is naturally
found in the orange-red basidiomicetous yeast Phaffia rhodozyma (now Xan-
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
259
260
Fontana
D
COOH
s/s.
Fig. 1. The basic chemical structures for a hydrocarbon carotene (A = |3-carotene)
and for xantophylls (B = canthaxanthin, C = astaxanthin, and D = apocarotenoic
acid, free form).
thophyllomyces dendrorhous) (4), in the chlorophycean unicellular alga Hae-
matococcus pluvialis (5), and in the marine bacterium Agrobacterium
aurantiacum (6). The involved market appeal for carotenoids is strongly sup-
ported by scientific knowledge of their well-known biological activity for
quenching and scavenging of free radicals (e.g., singlet oxygen and other active
oxygen species), which are responsible for the undesirable effect of aging (7).
This is the main reason for a consolidated market estimated about US$ 455
million for 2000 only for astaxanthin and cantaxanthin. Both contributions for
this market — chemical synthesis and microbial source — are experiencing an
increase, but in the second parcel, a doubling is seen every 4 yr (8).
Carotenogenic Microorganisms: Biochemical Characterization 26 1
Extraction, purification and, particularly, characterization of carotenoids
from microorganisms may be carried out by methods exploring their polarity
(i.e., differential solubility or partition between water and water-imiscible
organosolvents but for those more intensively oxygenated, the tight interaction
with protein carriers must be taken in account). A typical case is the strong
association between astaxanthin and actomyosin in salmon flesh; a similar
situation applies in the case of the yeast P. rhodozyma. For the sake of sample
enrichment or purification, a mild saponification may be used (9), although
alternative natural occurrences like esters of xanthophylls (e.g., astaxanthin
palmitate found in fish; bixin, a natural half-methyl ester of a C 2 5 carotenedioic
acid found in the seed tegument of the plant Bixa orellana) are, obviously, lost
as such. Conversely, saponification allows the interference arising from
chlorophylls (e.g., in the case of algal and plant samples) also to be eliminated.
Concerning the characterization of carotenoids, thin-layer chromatography
(TLC) allied to high-pressure liquid chromatography (HPLC) and/or spectros-
copy is a very valuable strategy for carotenoid characterization, although more
sophisticated techniques like 13 C- and *H NMR (nuclear magnetic resonance)
are mandatory for the elucidation of the detailed fine structure determined by
the complex geometrical, optical, and conformational isomerisms.
2. Materials
1. The yeast Phaffia rhodozyma (Xantophyllomyces dendrorhous) as the single
species and Rhodotorula rubra may be obtained from ATCC (American Type
Culture Collection) and the alga Haematococcus pluvialis from the collection
from the University of Texas at Austin. An hypercarotenogenic and genetically
improved strain of P. blakesleeanus was provided by Enrique Cerda-Olmedo
from the Department of Genetics at Seville University, Spain. Any bacterial iso-
late (e.g., "RB" and "A," presently used in TLC analyses) may be considered
from the deep colored aspect of its colonies in a solid media culture (yellow -* red
pigmentation) provided the preliminary spectroscopy of an organosolvent extract
(hexane, acetone or chloroform:metanol 2:1 v/v) appoints dominant maximal
absorbance peaks in the range from 440 to 480 nm and that no marked spectral
shift occurs upon mild acidification or alkalinization. Liquid culture media for
yeast and bacteria growth and carotenoid-based pigmentation may be formu-
lated with 2-3% sucrose or glucose as the carbon source with 0.1-0.2% urea or
peptone as simple and complex nitrogen sources and 0.1% yeast extract provid-
ing all other micronutrients. Phaffia, particularly, affords satisfactory pigmenta-
tion in any sugar cane (beet, too) derivative like crude juice, brown sugar, and
saccharified bagasse (10). The final pH is adjusted to around 4.5 (yeast) and
6.0 (bacteria). Microalgal cultures may be carried out in salt-based improved
media containing NaN0 3 and under strong illumination (11).
262 Fontana
2. Plant sources like corn kernels (Zea mays; dihydroxy-(3-carotene or zeaxanthin),
"urucum" seeds (Bixa orellana; C 2 5 carotenedioic acid monomethyl ester bixin
and its demethylated form norbixin), saffron (Crocus sativus; C 2 o carotenedioic
acid or crocetin as the nucleus for the digentiobioside crocin), and paprika
(Capsicum annuurn; capsorubin and capsaxanthin, C 40 hydroxy/keto deriva-
tives of (3-carotene) are useful for comparative standard preparation of the
respective oxygenated carotenoids (xanthophylls).
3. Premade chromatoplates of finely divided silica gel on aluminum foils (gypsum
as the binder) are the ideal stationary phase for TLC and may be obtained from
suppliers like Merck (art. 1.05553), Schleicher& Schuell, and similar companies.
Sample application of carotenoid solutions (1-2 ^L from solutions containing
>100 \kgl\kL) is preferable as 0.3- to 0.5-cm-long thin bands for resolution
improvement through the help of Bunsen-stretched 5-fiL glass capillaries. Low-
polarity chromatographic mobile phases are based in the mixture of different
proportions of toluene:ethyl acetate:acetone (e.g., 85:7:8; solvent A) or more
complex organosolvent combinations (e.g., hexane:acetone:ethyl acetate:
nitroethane:methanol:water; 79:19:5:3.5:3.5:0.25; solvent B) for superior reso-
lution of carotenoid components. The glass chromatographic tank, internally
aligned with a piece of filter paper in one of the faces to ensure vapor-phase
saturation, should be bubbled with a nitrogen stream just after solvent pouring
and then protected from light by an aluminum foil wrapper. A piece of plastic
film (MagiPak) can be inserted between the tank and its lid to avoid loss of the
more volatile components of the mobile phase and, hence, its alteration, which
leads to less reproducible results. If individual carotenoid-component quantitation
is intended, the freshly ran chromatoplate (natural colors) or after a chromogenic
reagent spraying (iodine vapors or warmed acidified p-anisaldehyde) may be
scanned in a densitometer (the flying spot scanning densitometer CS -930 IPC
apparatus from Shimadzu is a particularly fast and skill apparatus for such a
purpose) following the selection of the appropriate scanning wavelength.
4. Spectroscopy and spectrophotometry may be carried out in any apparatus having
a double-beam arrangement for the solvent blank and the colored sample for the
purpose of light-absorbance measurement at a fixed and known maximum of
absorbance (k max = 470-475 nm for canthaxanthin or astaxanthin) or for the
sample scanning in the visible range from 360 to 600 nm. A spectrum recorder is
the ideal accessory.
5. As a refinement of carotenoid analyses, a HPLC multimodular apparatus
(e.g., 712 WISP and 600 E System Controller from Millipore-Waters, USA or
LC-10-AD from Shimadzu, Japan) having a tunable absorbance detector and
recorder is indicated. The ideal monitoring/recording may be obtained with a
diode array because the simultaneous full spectral analysis may be done simulta-
neously for each resolved peak. A reversed-phase packed column (e.g., Supelcosil
LC-18; 25 cm long; 5-fim silica particles mean diameter; from Supelco)
isocratically irrigated with 1 mL/min (about 600 psi as operating pressure) of
acetonitrile: chloroform:methanol:water = 60:25:10:5) allows satisfactory reso-
Carotenogenic Microorganisms: Biochemical Characterization 263
lution for many carotenoids of microbial and commercial interest, including lyco-
pene (from tomatoes) in addition to the examples depicted in Fig. 1.
3. Methods
3. 7. Sampling, Extraction, and Spectrophotometry
1. Microbial biomass, usually from the stationary phase of growth and other
comparative samples (e.g., carotenoid-containing fruits and seeds) are used as dry
starting materials through lyophilization. Heat application or hot-air ovens should
be avoided for moisture removal because of the ease of oxidation of carotenoids.
Although the dry state is not a sine qua non condition for the efficient carotenoid
extraction, water is better in the next partition step of the moisture-free
organosolvent extract regardless of the coapplication of an intermediate saponifi-
cation step. In any instance, the conjunction of light, heat, and oxygen is very
harmful to carotenoid native structure. Hence, whenever possible, a flux of nitro-
gen (e.g., solvent deaereation) is strongly recommended. For those carotenoids not
readily available as purified standards, the above procedure may be also applied
(e.g., for the preparation of canthaxanthin, astaxanthin, and apocarotenoic acid ethyl
ester starting from the commercial bead-shaped formulations provided by
F. Hoffmann-La Roche Ltd., and respectively designated as Carophyll-Red, -Pink,
and -Yellow where each carotenoid is protected by a mix of starch-encapsulated
gelatin/free sugar and ethoxyquin and ascorbyl palmitate as antioxidants).
2. To each portion of the moisture-free sample (e.g., 100 mg), 1 mL of dimethylsul-
foxide (DMSO) is added and the mixture left for 1 h for complete swelling
followed by the addition of 2 mL of acetone. Centrifugation at > 3000 g for 5 min
renders a supernatant containing most of the apolar and polar (e.g., oxygenated)
carotenoids. Extraction is brought to completion by repeating the swelling step in
DMSO but now with the addition of 2 mL of chloroform:methanol 1:1. Com-
bined supernatants are then adjusted to exactly 10 mL with acetone and an ali-
quot is read against a solvent blank (DMSO:acetone:chloroform methanol =
2:6:1:1) at the appropriated wavelength (e.g., at 444 or 412 nm for |3,(3-carotene-
enriched samples considering the respective absortion coefficients [E l% l cm ] of 2500
or 2180 in hexane:acetone 9:1 (11) or 2550 at 451 nm in pure hexane (12); for
astaxanthin and E 1% 1 cm = 2220 at 492 nm when using acidified DMSO (13) or
E l% \ cm = 2100 at 470 nm also for astaxanthin if the solvent is hexanexhloroform
95.5:4.5 v/v (14). The concentration of carotenoid in the DMSO:acetone:chloro-
form:methanol mix (as in the case of an astaxanthin-enriched sample obtained from
Phaffia or Haematococcus), computing the unit change from 1 g% = 10 g/L to
mg/mL ( 10 3 * 10 1 ) and a correction of E l% { cm * for solvent effects (see below)
would then be from the absorbance reading at X max -472 nm (e.g., A = 0.61 15
for calculation ease):
[Astaxanthin] (in mg/L) = A x \0 A )/E X% X cm * = (0.615 x 10 4 )/2050* = 3 mg/mL = 3 ^i/mL
which in turn is multiplied by 100 (since the total sample organosolvent extract is
Vt = 10 mL but from only 1/10 of g of dry yeast sample) is equal to the amount of
264 Fontana
mg of astaxanthin/g of dry yeast (= 0.3 mg/g; present case). Accordingly, wild-
type strains of the aforementioned astaxanthinogenic yeast most often accumu-
late (stationary phase of growth) about 0.3-0.6 fig astaxanthin/g dry cells (15).
For the sake of precision, an extinction coefficient E l% { cm between 2120 and
1910 (hexane with 2% ethanol or dichlorometane as cosolvent and a maximum
absorption peak centered at A, max = 472 nm) may be considered when working
with other natural sources containing more than one isomeric form of astaxanthin
(e.g., the shrimp Penaeus) (16). In any case, one seldom deals with the occur-
rence of a pure carotenoid when processing natural sources. Hence, the statement
that an absorbance of 0.25 corresponds to a carotenoid concentration of approx
1 |Ag/mL (11). The isomer 3R,3R-dihydroxy-|3,|3-carotene-4,4-dione is the par-
ticular astaxanthin isomer in the yeast Phaffia (Xanthopyllomyces) . The nature of
a selected solvent (or organosolvent mix) may result in deep modification of the
absorbance readings. For instance, the comparative use of hexane or methanol in
normalized solutions of lutein or zeaxanthin (xanthophylls that differ solely by
the position of one double bond) of lycopene (a non-cycle-ended hydrocarbon
carotene) leads to dramatic changes in the absorbance values (with neither
ipsochromic nor bathochromic significant displacements of ^ max ) but deeply
dependent on the carotenoid concentration in the range from 1 to 10 jliM. Lutein
absorbance is minimally affected by solvent; zeaxanthin results in similar values
until 3 \iM but in almost doubled ones when above 6 \kM (methanol leading to an
apparent hyperchromic effect), and lycopene in methanol results, in any concen-
tration range, in fourfold lower values (methanol now resulting in an apparent
hypochromic effect). Solubility and microcrystallization must be considered to
explain these differences besides the much lower contributions from the respec-
tive molar absorbities (e) or extinction coefficients (17). Concerning the aux-
ochromic effects arising from polar substituents like R — OH, and R — COOH
spectrophotometric scanning allows clear distinction between hydrocarbon
carotenes and xanthophylls {see Fig. 2).
3.2. Thin-Layer Chromatographic Analysis
1. Thin-layer chromatographic (TLC) analysis (Fig. 3A), following spontaneous
solvent evaporation allows the calculation of *Rf values for each carotenoid of
interest (e.g., in solvent B, the following Rf are obtained: 0.88 for (3-carotene;
0.82 for apocarotenoic acid ethyl ester; 0.51 for canthaxanthin; 0.36 for
astaxanthin). If a known amount of each standard is applied from a calibrated
capillary or microsyringe, then the use of a densitometer will allow quantitation
of the components in the microbial sample as well as their respective percentage
contribution to the whole carotenoid extract composition (Fig. 4, lower line; e.g.,
peak "A" of astaxanthin contributing to 50% of the carotenoids isolated from
Phaffia rhodozyma). Because carotenoid bands will experience a progressive fad-
Carotenogenic Microorganisms: Biochemical Characterization 265
s
<0
-Q
350 370 390 410 430 450 470 490 510 530 550 570 590
Wavelength (nm)
Fig. 2. Visible spectra for standard (A) and microbial-derived carotenoids (B).
266
Fontana
Absorbance
1.25
1.00
b-Car
0.75
0.5
0.25
0.0
/•■ \A![
2,5
5|
\^ -,../' \ ,....^
7,5
10 cm
Rf
0,36
0,51
0,88
Fig. 3. Densitometric monitoring of TLC plates at 475 nm. Upper line: mix of
astaxanthin (A), canthaxanthin (C), and (3-carotene (B-C) standards from the TLC
lane "m" and in order of increasing /fy values. Lower line: Phaffia rhodozyma crude
extract from the TLC lane Pr.
ing on exposure to air, a permanent record of the freshly run plate with a color
film may be obtained, which may be also used for densitometric purposes.
2. The contribution of liposoluble noncarotenoid components may be progressively
evaluated by exposing the plate to a closed chamber saturated with iodine vapor
(Fig. 3B) and/or spraying with a fine mist of 1% />-anisaldehyde in meth-
anolisulfuric acid 95:5 (Fig. 3C). In the case of the latter chromogenic reagent,
careful heating on a warm plate (100°C) will change the variable natural yellow
to orange-red colors of carotenoids to gray, whereas other noncolored lipid mate-
rials such as triacylglycerols (TAG), glycolipids (GL), phospholipids (PL), and
sterols will stain deeply lilac to violet.
3.3. High-Pressure Liquid Chromatography
1. Isocratic elution allows satisfactory resolution for many carotenoid components
(Fig. 5), but peak overlapping is unavoidable for those derivatives displaying
similar polarities (for instance, the smaller peak preceding R t [retention time] =
3.27 for astaxanthin is attributable to lutein, a dihydroxy-(3-carotene). Better peak
resolution for multicomponent carotenoid samples may be the attained using then
gradient elution.
Carotenogenic Microorganisms: Biochemical Characterization 267
B
>aJL
A_
5min
10min
15min
5 min
10min
15 min
Jts~ **J{— -*.
J-
5 min
10 min
15 min
5 min
10 min
15 min
Fig. 4. High-pressure liquid chromatography with detector wavelength at 475 nm.
Carotenoid standard mixture: astaxanthin, canthaxanthin, apocarotenoic acid ethyl ester,
lycopene, and (3-carotene (A), in increasing order of elution times. Samples from the
organosolvent extracts of Phycomyces blakesleeanus (B), Phaffia rhodozyma (Xantho-
pyllomyces dendrorhous) (C), and aged cultures of Haematococcus pluvialis (D).
268
Fontana
5«s -:;o
£A
,«vt rrs. sx/
5 - 3 5- o.as
A
OO p-C C Ajl A* 1W A Tk ^ -m. -R^. Ti> Hf» $y Cf cy» B T S
-v&O
A *-A, N6. ■. /y\. vj</
• ?*>£ : 49 i S ■ 3.S 3 5. a.15
B
»
4
I
t
4
OO p-c C A A A* tt-S A "Ph. V-- «x. R <% T±> Up Mp CT or B> "P S
5<v6o
H - A ■ ^A /v€. -. f\ -. \x/
t
4 " •
-
V
-4
I -It
OO fj-c C A x A* "ftS A TV. **,' rrv "Rx "P±» Up 4p '^ cr B "P S
Fig. 5. Thin-layer chromatography as such (A) and after iodine vapors (B) or hot
p- anisaldehyde staining (C). Carotenoid standards: (3-C = all-trans isomer of (3-caro-
tene, from Sigma-Aldrich Co; C = canthaxanthin, isolated from Carophyll Red; A! and
A 2 = astaxanthin, isolated or purified from Carophyll Pink; m = mix of these three
standards, and CY and CY' = apocarotenoic acid ethyl ester, isolated from Carophyll
Carotenogenic Microorganisms: Biochemical Characterization 269
4. Notes
1. For hydrocarbon-carotenoid-enriched samples (e.g., (3- and/or a-carotenes in
Phycomyces and carrots; lycopene in tomatoes) previous swelling in DMSO is
not absolutely necessary since there is no noticeable interaction between these
carotenes and protein carriers and hence hexane, acetone, and/or chloro-
form:methanol have enough solubilizing power to yield quantitative yields.
2. Any turbidity interference observed in the organosolvent crude extract may be
eliminated by two different ways: (1) increasing or decreasing the polarity by
the addition of acetone or chloroform; (2) carrying out a cleaning partition with
the addition of an large excess of water (> 4 volumes) and recovering the
carotenoid component(s) in the lower chloroform phase, whereas the upper
phase to be discarded contains the less soluble sample components or contami-
nants as well as most of the polar solvents (DMSO, acetone, methanol).
3. Taking 2500 as an average value of E x% x cm for carotenoid materials, an
absorbance reading of 0.25 is equivalent to a concentration of 1 f^g/mL (see the
equation in Subheading 2.1.).
4. 7?yis defined by the relation (distance traveled by a particular component)/(distance
traveled by the solvent front), thus giving values <1.0 (only exceptionally equal to
1.0). Low /fy values seen in Fig. 2A for Bixa orellana (lane B) and Crocus sativus
(lane S) extracts are in accordance with their less polar main carotenedioic acid
components. Bixin's (C 2 s) relatively higher migration compared to crocin (C 2 o) is
explained by the occurrence of a half methyl ester in the first diacid and/or the double
contribution of two gentibiose substituents at both carboxy ends of the second diacid.
5. Thin-layer chromatography exposure to iodine vapors allows a fast, reversible,
and reinforced staining for carotenoids as well as for most of the other noncolored
liposoluble compounds. Apocarotenoic acid ethyl ester (Fig. 3B; lanes CY and
CY') takes up iodine very strongly. The dominant contribution of fat material
(TAG; PL) in Phaffia crude extract (Fig. 3B,C; lane Pr) can be easily realized
comparing with the adjacent silica-gel-purified sample (Fig. 3B,C; lane Pr')
following exposure to iodine vapors or to the anisaldehyde chromogenic spray
(comparable also with lane 00, a triolein-rich olive oil sample).
Yellow. Microbial and plant sources: RB = a red bacterium isolated from laboratory
surroundings by Tania Bonfim and Miriam Chociai; A = an inulinolytic yellow
bacterium (ref. 4, p. 420); Pr and Pr' = crude and silica-gel-column chromatography-
purified orange pigment prepared from Phaffia rhodozyma; Rr = Rhodothorula rubra;
Pb = Phycomyces blaskeleeanus; Hp and Hp' = pigment mixture of aged cultures of
Haematococcus pluvialis', B = crude extract of Bixa orellana seeds (main carotenoid
component: bixin); P = crude extract from paprika (main carotenoids: capsorubin and/
or capsaxanthin); S = saffron extract (main carotenoid: crocin). The first lane, OO =
olive oil (triolein), is for the control of noncarotenoid liposoluble components or
contaminants (e.g., TAG) when developing the TLC plate with iodine vapor or with
the chromogenic spray of p-anisaldehyde.
270 Fontana
6. It is advisable to include 0.05-0.1% of butylated hydroxytoluene (BHT) in the
solvents as a protectant for carotenoids against oxidation from the extraction
procedure through any purification step.
7. For those natural sources rich in fat materials other than carotenoids (e.g., TAG, PL)
where previous saponification is advisable, the final concentration of NaOH or KOH
in the water/organo solvent mix should not exceed 5% for a short period of treatment
(>30 min) at temperatures not exceeding 60°C. TAG and PL may also be degraded
with commercial lipases (e.g., Novo Lipozyme) which is a safer alternative.
8. 13 C-NMR spectroscopy indicates 19 signals (6, in ppm) for (3-carotene from
12.7 ppm until 137.8 ppm, including 6 = 33.2 ppm for C-4 and C-4'. In
canthaxanthin, a di-ketone derivative at C-4 and C-4' from |3-carotene, this par-
ticular signal is, accordingly, displaced downfield at 198.7 ppm (18).
10. Details about carotenoids occurrence, structure variability, and metabolism may
be found in a fully illustrated brochure prepared at F. Hoffmann-La Roche Ltd.,
Basel, Switzerland (19).
Acknowledgments
The author thanks A. R. C. Lima from L. Hoffmann-La Roche (Brazil) for
the kind provision of the Carophyll series, Professor M. Baron for the
partnership in the project CNPq-PADCT-SBIO/World Bank, Professor G.
Yates for draft reading, S. V. Mendes and L. G. V. Krawiec for the untiring
assistance in the preparation of illustrations, M. Passos for the help with TLC
analyses, and Professor T. M. B. Bonfim and Professor M. B. Chociai for the
cultivation of the "RB" bacterium isolate.
References
1. Pfander, H. (1993) Carotenoids: an overview. Methods Enzymol. 213-B, 1-13.
2. Metha, B. J. and Cerda-Olmedo, E. (1995) Mutants of carotene production in
Blakeslea trispora. Appl. Microbiol. Biotechnol. 42, 836-838.
3. Cerda-Olmedo, E. (1989) Production of carotenoids with fungi, in Biotechnology
of Vitamin, Growth Factor, and Pigment Production (Vandamme, E., ed.) Elsevier
Applied Science, Barking, UK, pp. 27-42.
4. Fontana, J. D., Guimaraes, M. F., Martins, N. T., Fontana, C. A., and Baron, M.
(1996) Culture of the astaxanthinogenic yeast Phaffia rhodozyma in low-cost
media. Appl. Biochem. Biotechnol. 57/58, 413-422.
5. Johson, E. A. and An, G. H. (1991) Astaxanthin from microbial sources. Crit.
Rev. Biotechnol. 11(4), 297-326.
6. Yokoyama, A., Izumida, H., and Miki, W. (1994) Production of astaxanthin and
4-ketozeaxanthin by the marine bacterium, Agrobacterium aurantiacum. Biosci.
Biotechnol. Biochem. 58(10), 1842-1844.
7. Palozza, P. and Krisnky, N. I. (1992) Antoxidant effects of carotenoids in vivo
and in vitro: An overview. Methods Enzymol. 214-B, 403-420.
Carotenogenic Microorganisms: Biochemical Characterization 271
8. Dean, K. L. (1992) IB market forecast: biopigments, in Industrial Bioprocessing , vol.
14, Technical Insights, Englewood, NJ) 14, p. 4.
9. Schmitz, H. H., Poor, C. L., Gugger, E. T., and Erdman, J. W., Jr. (1993) Analysis
of carotenoids in human and animal tissues. Methods Enzymol. 214-B, 102-1 16.
10. Fontana, J. D., Czeczuga, B., Bonfim, T. M. B., Chociai, M. B., Oliveira, B. H.,
Guimaraes and Baron, M. (1996) Bioproduction of carotenoids: the comparative
use of raw sugar cane juice and depolymerized bagasse by Phaffia rhodozyma.
Biore source Technol. 58, 121-125.
11. Schiedt, K. and Liaeen-Jensen, S. (1995) Isolation and analysis in Carotenoids,
vol. 1-A: Isolation and Analysis (Britton, G., Liaeen-Jensen, S., and Pfander, H.,
eds.), Birkhauser, Basel, pp. 104-107.
12. Dawson, M. C., Elliott, D. C., Elliott, W. H., and Jones, K. M. (1991) Data for
Biochemical Research, 3rd ed., Oxford Science Publications, Clarendon Press,
Oxford, UK, p. 240.
13. Boussiba, S. and Vonshak, A. (1992) Enhacement and determination of
astaxanthin accumulation in the green alga Haematococcus pluvialis. Methods
Enzymol 214- A, 386-391.
14. Schuep, W. and Schierle, J. (1995) Carotenoids, vol 1-A, Isolation and Analysis
(Britton, G., Liaeen-Jensen, S., and Pfander, H., eds.), Birkhauser, Basel, Swit-
zerland, pp. 275-276.
15. Johnson, E. A. and Lewis, M. J. (1979) Astaxanthin formation by the yeast Phaffia
rhodozyma. J. Gen. Microbiol. 115, 1733-183.
16. Schiedt, K., Bischof, S., and Glinz, E. (1993) Metabolism of carotenoids and in
vivo racemization of (3S, 3S')-astaxanthin in the crustacean Penaeus. Methods
Enzymol. 214-B, 148-168.
17. Zang, L.-Y., Sommerburg, O., van Kuijk, F. J. (1997) Absorbance changes of
carotenoids in different solvents. Free Radic. Biol. Med. 23, 1086-1089.
18. Breitmeier, E. and Voeter, W. (1978) Carbon-13 NMR Spectroscopy, VCH,
Weinheim, Germany, p. 334-337.
19. Latscha, T. (1988) Carotenoids - Their Nature and Significance in Animal Feeds,
Department of Animal Nutrition, F. Hoffmann-La Roche Ltd., Basel, Switzerland.
31
Genetic and Chromosomal Stability of Wine Yeasts
Matthias Sipiczki, Ida Miklos, Leonora Leveleki,
and Zsuzsa Antunovics
1. Introduction
The conversion of grape juice into wine is a complex fermentation process
in which yeasts play a central role. The composition of the yeast flora in the
fermenting must vary according to geographic location, climatic conditions,
and grape variety (e.g., ref. 1). During the early phase of fermentation,
apiculate yeasts belonging to the species Kloeckera apiculata (Hanseniaspora
uvaruni) are dominant, but Candida, Pichia, Rhodotorula, Kluyveromyces,
Hansenula, Metschnikowia, and Saccharomyces strains can also be detected
(1). Most of them die off when the ethanol concentration rises to around 4%
(2) and leave Saccharomyces to complete the fermentation. The major Sac-
charomyces species found among wine yeasts is S. cerevisiae , but S. bay anus
can also be detected. The S. cerevisiae flora itself is also variable, it can change
in the course of fermentation and various strains can grow simultaneously as
subpopulations (e.g., refs. 3-6).
Where the yeast flora comes from is a matter of scientific discussion (for a
review, see ref. 7). The starting population composed mainly of non-Saccha-
romyces strains is probably determined by the yeasts that live on the grapes or
the leaves of the vine. Many authors believe that the Saccharomyces strains
also come from the grapes. Others, however, think that they originate from the
surfaces of winery equipment and are thus winery-specific residential strains.
Considerable genetic instability has been observed in many S. cerevisiae
strains isolated from fermenting wines. The wine strains are usually diploid
but frequently undergo aneuploidization and/or chromosomal rearrangements
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
273
274 Sipiczki et al.
leading to chromosomal length polymorphism (8-11). These changes severely
affect the pairing and segregation of homologous chromosomes in meiosis,
which may result in low sporulation efficiency (0-75%) and poor spore
viability (e.g., refs. 10 and 12). Because wine yeasts are usually heterozygous
for several traits, the modification of chromosome number or the alteration of
chromosome size (e.g., deletion) may entail changes in the proportion of alleles
or can even eliminate favorable alleles. This variability may have significant
impact on wine quality, because it allows the formation of yeast subpopulations
with impaired fermentation parameters (e.g., fermentation power, the production
of ethanol, secondary compounds, organoleptic and aroma components, etc.). To
promote high velocity and reproducibility of fermentations, many wine producers
inoculate their musts with starter cultures. These cultures can be prepared from
yeasts isolated from fermenting wines or from commercially available dry wine
yeasts. However, they ensure controlled fermentation and reproducible wine quality
only if they are genetically stable and do not segregate.
Genetic stability can be tested by the examination of sporulation morphology
and the viability of spores. The number and the size of the chromosomes can be
determined by pulsed-field gel electrophoresis (PFGE) (13), a technique suitable
for separation of chromosome-size DNA molecules (electrophoretic karyotyping).
1 . 7. Genetic Stability Test by Sporulation and Spore Viability
Most wine yeasts are homothallic. The spores of a homothallic strain
produce clones of vegetative cells that can mate with each other to form cells
with a double amount of DNA. These cells also propagate vegetatively, but
they can also convert to asci, harboring four spores, each of which contains
half the DNA content of the sporulating cell. If the cell was diploid, its spores
would be haploid. Prior to sporulation, the diploid cell replicates its DNA and
undergoes a meiosis, in which the homologous chromosomes pair and then
segregate into four haploid sets. Each set will be incorporated into a separate
spore during sporulation. In natural fermentations, clones of various origin and
genotypes (with differences in the number and size of chromosomes or in
alleles of homologous genes) can grow simultaneously in the must. Matings
between different clones produce hybrids heterozygous for all traits, in which
the clones differ from one another. These heterozygotes may have superb pro-
pagation vigor and fermentation abilities as long as they propagate vegetatively
but segregate into less efficient aneuploids and haploids when sporulating.
Hybrids with chromosomes that cannot properly pair in meiosis (homologous
chromosomes of different length or with translocations or deletions) may be
poor in sporulation, and form asci with aberrant number and/or low viability of
spores. Aneuploids also show sporulation deficiencies.
Stability of Wine Yeasts 275
1.2. Karyotype Stability
As a result of recent technological developments, numerous pulsed-field gel
electrophoresis techniques are now available, all with modifications of the basic
principle of PFGE (for a review, see ref. 14). Contour-clamped homogenous
electric field (CHEF) electrophoresis is a modified PFGE method (15) that
provides high resolution of yeast and fungal chromosomal patterns. The
number and position of the bands (electrophoretic karyotype) in the gel allow
the determination of the number of the chromosomes and the assessment of
their size. Even small size differences can cause detectable changes in the
mobility of the chromosomal bands, which allows the detection of small
chromosomal rearrangements. The intensity of bands is proportional to their
DNA content; the bands corresponding to larger chromosomes show more in-
tensive staining. Occasionally, faint bands can be seen between brighter bands.
These may correspond to chromosomes that are present in single copies (aneu-
ploidy), but mixed cultures containing a minor subpopulation of a different
karyotype also give chromosomal patterns showing heterogeneous staining
(e.g., ref. 12). Electrophoretic karyotyping can also be used to distinguish
Saccharomyces strains from other yeast genera, because the species occurring
in fermenting grape musts have characteristic karyotypes (e.g., refs. 16-19).
2. Materials and Equipment
2. 1. Materials
1. YPG (yeast-peptone-glucose) medium: 1% yeast extract, 0.5% peptone, 2%
glucose, and 2.5% agar (percentages are w/v).
2. YPGL: YPG without agar.
3. Presporulation medium: 1% yeast extract, 1% peptone, 2% glucose, and 1.5%
agar (percentages are w/v).
4. Sporulation medium: 1% potassium acetate, 0.25% yeast extract, 0.1% glucose,
1.5% agar (percentages are w/v).
5. Helicase (snail gut enzyme) solution for the dissolution of asci: enzyme:sterile
water = 1:20.
6. 50mMEDTA,pH8.0.
7. ECP buffer: 50 mM EDTA, 20 mM citrate-phosphate buffer, pH 7.5.
8. Agarose, purity suitable for pulse-field gel electrophoresis (e.g., Bio-Rad).
9. Low-melting agarose for embedding cells or spheroplasts in "plugs" (e.g.,
Sigma A-9414).
10. Lytic enzyme (lyticase, Sigma L-5263; zymolyase, ICN 320931, or Novozyme,
Sigma L-1412) solution for spheroplasting cells. Recommended concentration:
1 mg/mL. Wine yeasts are rather heterogeneous in sensitivity to enzymatic cell-
wall digestion.
11. ESP buffer: 0.5 M EDTA, 0.001 M Tris, and 1% AMauroylsarcosinate, pH 8.0,
with 0.5 mg/mL Proteinase K.
276 Sipiczki et al.
12. 0.5X TBE buffer: 45 mM Tris, 45 mM boric acid, and 0.5 mM EDTA, pH 8.3.
13. Ethidium bromide solution for staining gels: 0.5 u.g/mL.
2.2. Equipment
1. Micromanipulator for dissecting asci and separating spores.
2. Hemocytometer or spectrophotometer for determining cell density.
3. Microfuge (refrigerated, if possible).
4. Equipment for pulse-field gel electrophoresis (e.g., Bio-Rad CHEF DRIII).
5. Molds for casting agarose gels and agarose plugs (should be parts of Bio-Rad
CHEF DRIII set).
6. Ultraviolet (UV)-transilluminator for visualizing DNA in ethidium bromide-
stained gel.
3. Methods
3. 1. Sporulation Efficiency
1. Grow the cells of the desired strain on a YPG plate at 25°C for 48 h.
2. Inoculate a loopful amount of the culture onto presporulation medium and
incubate at 25°C for 24 h.
3. Transfer cells onto sporulation medium.
4. Incubate at 25°C for 72 h, or until spores appear.
5. Take a sample with a small loop and suspend the cells in a drop of water placed
on a microscope slide.
6. Evaluate sporulation efficiency and morphology by microscopic observation. A
low percentage of spores (less than 20% asci) and/or high frequency of asci
containing less than four spores (more than 10%) indicate that the strain has an
"unbalanced" genome prone to segregate spores with variable genotypes.
3.2. Spore Viability
1. Suspend a small loopful amount of sporulating cells (see Subheading 3.1.) in
0.2 mL of helicase solution and incubate at 30°C until the ascus walls are dis-
solved (20-60 min should be sufficient).
2. Spread samples onto YPG plates and dissect asci by micromanipulation to liberate
their spores.
3. Separate the spores on the surface of the medium so that each can form a
separate colony.
4. Incubate at 30°C for 5-7 d and determine the percentage of colony formation.
Values lower than 70% denote deficiencies in chromosome segregation and
indicate genetic instability.
When a micromanipulator is not available, random spore analysis can yield
information about spore viability. For this, the suspension of enzyme-treated
Stability of Wine Yeasts 277
asci is sonicated and the percentage of the free spores is determined in a
hemocytometer. The appropriately diluted samples are then spread on YPG
plates (100-150 potential colony-forming units per plate). After 7 d of
incubation at 30°C, the colonies are counted and the efficiency of colony
formation is determined. This test is based on the assumption that the vegetative
cells and the asci that escaped disintegration will all form colonies, which,
however, may not be the case.
3.3. Karyotype Stability During Vegetative Propagation
1. To test a yeast strain for chromosomal polymorphism, plate its cells onto YPG
medium and isolate single-cell colonies after 7 d of incubation at 25-30°C.
2. Inoculate each colony separately into a flask containing YPGL and incubate the
cultures to late logarithmic/early stationary phase.
3. Take a sample of appropriate size of each culture and subject it to electrophoretic
karyotyping as described in Subheading 3.5.).
4. Compare the patterns of the chromosomal bands. If the patterns are not identical,
the strain is polymorphic.
5. Select one clone showing the most common pattern and culture it by serial
reinoculation into new medium (0.1 mL into 10 mL of YPGL) every 24 h over a
period of 15 d. Assuming a generation time that allows 5 generations between
every 2 inoculations, 80-85 generations will be produced by d 15.
6. Plate a sample from the last culture onto YPG plates and isolate 20 single-cell
colonies. Subject each subclone to electrophoretic karyotyping (Subheading 3.5.)
and compare the chromosomal patterns. If profiles different from that of the original
clone are found, the strain is prone to undergo chromosomal rearrangements. Size
modifications are usually more apparent among the smaller chromosomes.
3A. Meiotic Karyotype Stability
1 . To test a strain for the stability of its chromosomes during meiosis, plate cells onto
YPG medium and select single-cell colonies after 7 d of incubation at 25-30°C.
2. Test each isolate for sporulation by streaking cells onto sporulation medium.
Because wine yeasts are usually homothallic, most of the isolates will sporulate.
3. Select one of the sporulation-proficient clones and determine its chromosomal
DNA profile as described in Subheading 3.5.
4. Streak the clone onto sporulation medium and after sporulation, dissect asci to
liberate spores as described in Subheading 3.2.
5 . Choose 5 complete tetrads or 20 clones from incomplete tetrads. Inoculate each clone
into YPGL, grow it to a late logarithmic/early stationary phase, and subject it to
electrophoretic karyotyping (Subheading 3.5.). Deviations from the chromosome
pattern of the original clone and differences from the profiles of other spore clones
indicate meiotic chromosome instability. Spores of incomplete tetrads usually show
more variable karyotypes.
278 Sipiczki et al.
3.5. Electrophoretic Karyotyping
For the determination of the number and size of the chromosomes by
electrophoresis, it is necessary to keep the chromosomal DNA molecules intact
during the procedure of cell and chromosome dissolution and the subsequent
electrophoretic separation. Therefore, the cells or spheroplasts are embedded in
agarose, which protects the DNA against mechanical breakage while allowing the
free diffusion of solutions necessary for lysis and digestion. To inhibit DNAses, all
treatments are carried out at high concentrations of EDTA. To release the DNA
from the chromosomes, the embedded cells or spheroplasts are treated with
Proteinase K, which degrades most of the chromosomal proteins.
3.5. 1. Growing Cultures for Karyotyping
1. Grow the cells in 50 mL of YPGL until a late logarithmic or early stationary
phase at 30°C. Better resolution of chromosomal bands and lower background
can be obtained with early stationary-phase cultures because they contain fewer
cells being in the S-phase of the cell cycle. The S-phase cells replicate their
chromosomes; thus, their DNA is more sensitive to physical breakage.
2. Determine cell density by either cell chamber (hemocytometer) counts or
photometrically. Flocculation or poor separation of cells may cause a problem in cell
counting. This can usually be overcome by one or two washes with 50 mM EDTA.
3.5.2. Preparation of Agarose-Embedded Cells
1. Centrifuge a sample of the culture that contains approx 5 x 10 9 cells. Wash the
pellet twice with 50 mM EDTA.
2. Add 0.5 mL ECP buffer, resuspend the pellet, and transfer 200 \iL of the
suspension into a 1.5-mL microfuge tube.
3. Add 200 \iL of molten 1.5% w/v low-melting agarose dissolved in ECP buffer
and mix gently at 48°C.
4. Pipet the cell/agarose mixture into molds and let it harden at 4°C for 20 min.
5. Remove the cell/agarose blocks ("plugs") from the molds and transfer them into
microfuge tubes for Proteinase K digestion (see Subheading 3.5.4.).
3.5.3. Preparation of Agarose-Embedded Spheroplasts
Saccharomyces strains vary in the yield of chromosomal DNA when intact
cells are used for karyotyping. The differences can be attributed to the variable
permeability of their cell walls. This difficulty can be overcome by
spheroplasting (partial removal of the cell wall) before electrophoresis. The
most convenient way of spheroplasting is the treatment of the cells with cell-
wall lytic enzymes such as lyticase, zymolyase, or Novozym. Mechanical
disruption has also been reported to be applicable and may be preferred when
spheroplasting is not effective (20).
Stability of Wine Yeasts 279
1 . Centrifuge a sample of the culture that contains 1 9 cells and wash the cells twice
in50mMEDTA.
2. Add 0.5 mL ECP buffer, resuspend the pellet, and transfer 200 jj,L of the
suspension into a 1.5-mL microfuge tube.
3. Prepare spheroplasts from cells. Spheroplasts can be prepared in two ways: either
in agarose block (plug) or in suspension.
a. In agarose block
• Add 200 |iL of molten 1 .5% w/v low-melting agarose dissolved in ECP buffer
to 200 |iL of cell suspension and mix gently at 48°C.
• Pipet the cell/agarose mixture into molds and let it harden at 4°C for 20 min.
• Remove the agarose blocks from the mold and transfer them into a microfuge
tube containing 1 mL ECP buffer supplemented with lyticase.
• Incubate at 37°C for 3-5 h or overnight.
• Discard the buffer by a Pasteur pipet.
• Rinse the plugs in 2-3 volumes of 0.5 mM EDTA and treat them with
Proteinase K (see Subheading 3.5.4.).
b. In suspension
Many cells in the agarose will not be spheroplasted effectively and therefore
will not release their chromosomal DNA during electrophoresis. Better
efficiency can be obtained when spheroplasting is done in suspension and the
spheroplasts are embedded into agarose afterward.
• Add 1 mL ECP buffer containing 1.2 M sorbitol and lyticase to 200 fiL cell
suspension and mix gently.
• Incubate at 25°C.
• Check spheroplast formation microscopically at 15 -min intervals: Mix 10 f^L of
suspension with 30 f^L of water (osmotic shock) on a microscope slide and check
if the cells lyse. When over 80% of cells lyse, most cells have spheroplasted.
• Collect spheroplasts by gentle centrifugation and remove the supernatant with
a Pasteur pipet.
• Wash twice with ECP buffer containing 1.2 M sorbitol.
• Resuspend pellet in 200 \iL of the same buffer.
• Add 200 \\L of molten 1.5% w/v low-melting agarose to 200 \\L of cell
suspension and mix gently at 48°C.
• Pipet the spheroplast/agarose mixture into molds and allow the gel to solidify.
• Remove the cell/agarose blocks from the molds and transfer them into
microfuge tubes for Proteinase K digestion (see Subheading 3.5.4.).
3.5.4. Release of DNA from Chromosomes
Chromosomes and other proteinous structures can be disintegrated by
Proteinase K treatment in the presence of a detergent.
1. Transfer agarose blocks into 1 mL ESP buffer.
2. Incubate at 50°C for 24 h.
3. Remove buffer by pipetting and rinse the blocks twice with 0.5 M EDTA.
4. Use the blocks for electrophoretic karyotyping (see Subheading 3.5.5.) or store
them at 4°C. They can be stored in this solution for several months at 4°C.
280 Sipiczki et al.
3.5.5. Electrophoresis
1. Prepare 1% agarose (w/v) in 0.5X TBE.
2. Assemble the gel casting mold and comb. Ensure that it is resting on a level
surface. Pour the hot agarose into the mold and allow to set.
3. Remove the comb and load the blocks into the wells. Usually, half pieces are loaded.
4. Transfer the loaded agarose plate into the electrophoresis chamber (containing
cooled 0.5X TBE) and fit it in correct orientation (movement of DNA is to the
positive electrodes).
5. Adjust the running parameters according to the instruction manual of the appara-
tus. It is often difficult to choose electrophoretic conditions that give good
resolution of both the smaller and larger chromosomal DNA molecules. A
possible compromise for CHEF DRIII: voltage, 6 V/cm; angle 120°; pulse time,
60s for 15 h and 90s for 9 h.
6. Switch on the buffer pump and start electrophoresis. Check that the buffer is at
the desired running temperature (13°C).
7 . After electrophoresis, switch off the apparatus and transfer the gel into a tray contain-
ing distilled water with ethidium bromide. Stain for 30 min at room temperature.
8. Transfer the gel onto an UV transilluminator to check that DNA bands are stained
sufficiently (see Subheading 4.).
9. Continue staining for another 15-30 min, if necessary.
10. Destain the gel for 30 min in distilled water to reduce background staining.
1 1 . Transfer the gel onto the UV transilluminator and photograph it.
4. Notes
Ethidium bromide is highly toxic so use gloves when staining and viewing
electrophoretic gels. Use goggles or other protective equipment while using
the UV transilluminator.
References
1. Fleet, G. H. and Heard, G. M. (1993) Yeasts: growth during fermentation, in Wine
Microbiology and Biotechnology (Fleet, G. H., ed.), Harwood, Chur, Switzerland,
pp. 27-54.
2. Margalith, P. Z. (1981) Flavor Microbiology, Charles C. Thomas, Springfield, IL.
3. Schiitz, M. and Gafner, J. (1993) Analysis of yeast diversity during spontaneous
and induced alcoholic fermentations. /. Appl. Bacteriol. 75, 551-558.
4. Querol, A., Barrio, E., and Ramon, D. (1994) Population dynamics of natural Sac-
charomyces strains during wine fermentation. Int. J. Food Microbiol. 21, 315-323.
5. Versavaud, A., Courcoux, P., Roulland, C, Dulau, L., and Hallet, J. N.(1995)
Genetic diversity and geographical distribution of wild Saccharomyces cerevisiae
strains from the wine-producing area of Charentes, France. Appl. Environ.
Microbiol. 61, 3521-3529.
Stability of Wine Yeasts 281
6. Nadal,D.,Colomer, B.,andPina,B. (1996) Molecular polymorphism distribution
in phenotypically distinct populations of wine yeast strains. Appl. Environ.
Microbiol. 62, 1944-1950.
7. Martini, A. and Martini, A. V. (1990) Grape must fermentation past and present,
in Yeast Technology (Spencer, J. F. T. and Spencer, D. M., eds.), Springer-Verlag,
Berlin, pp. 105-123.
8. Bakalinsky, A. T. and Snow, R. (1990) The chromosomal constitution of wine
strains of Saccharomyces cerevisiae. Yeast 6, 367-382.
9. Longo, E. and Vezinhet, F. (1993) Chromosomal rearrangements during vegeta-
tive growth of a wild strain of Saccharomyces cerevisiae. Appl. Environ.
Microbiol. 59, 322-326.
10. Guijo, S.,Mauricio, J. C, Salmon, J. M., and Ortega, J. M. (1997) Determination of
the relative ploidy in different Saccharomyces cerevisiae strains used for
fermentation and "flor" film ageing of dry Sherry-type wines. Yeast 13, 101-1 17.
11. Codon, A. C, Benitez, T., and Korhola, M. (1998) Chromosomal polymorphism
and adaptation to specific industrial environments of Saccharomyces strains. Appl.
Microbiol. Biotechnol. 49, 154-163.
12. Miklos, I., Varga, T., Nagy, A., and Sipiczki, M. (1997) Genome instability and
chromosomal rearrangements in a heterothallic wine yeast. /. Basic Microbiol.
37, 345-354.
13. Schwartz, D. C. and Cantor, C. R. (1984) Separation of yeast chromosome-sized
DNAs by pulsed field gradient gel electrophoresis. Cell 37, 65-67.
14. den Dunnen, J. T. and van Ommen, G. J. B. (1993) Methods for pulsed-field gel
electrophoresis. Appl. Biochem. Biotechnol. 38, 161-168.
15. Chu, G., Vollrath, D., and Davis, R. W. (1986) Separation of large DNA molecules
by contour-clamped homogeneous electric fields. Science 234, 1582-1585.
16. Johnston, J. R., Contopoulou, C. R., and Mortimer, R. K. (1988) Karyotyping of yeast
strains of several genera by field inversion gel electrophoresis. Yeast 4, 191-198.
17. Vaughan-Martini, A., Martini, A., and Cardinali, G. (1993) Electrophoretic karyo-
typing as a taxonomic tool in the genus Saccharomyces. Antonie van Leeuwenhoek
63, 145-156.
18. Versavaud, A. and Hallet, J.-N. (1995) Pulsed-field gel electrophoresis combined
with rare-cutting endonucleases for strain differentiation of Candida famata,
Kloeckera apiculata and Schizosaccharomyces pombe with chromosome number
and size estimation of the two former. Syst. Appl. Microbiol. 18, 303-309.
19. Frezier, V. and Dubourdieu, D. (1992) Ecology of yeast strains Saccharomyces
cerevisiae during spontaneous fermentation in a Bordeaux winery. Am. J. Enol.
Vide. 43, 375-380.
20. Kwan, H. S., Li, C. C, Chiu, S. W., and Cheng, S. C. (1991) A simple method to
prepare intact yeast chromosomal DNA for pulsed field gel electrophoresis.
Nucleic Acids Res. 19, 1347.
32
Prediction of Prefermentation Nutritional Status
of Grape Juice
The Formol Method
Barry H. Gump, Bruce W. Zoecklein, and Kenneth C. Fugelsang
1. Introduction
The Formol titration is a simple and rapid method for determination of the
quantity of assimilable nitrogen in juice (1). It provides an approximate, but
useful, index of must nutritional status. The procedure consists of neutralizing
a juice sample with base to a given pH, adding an excess of neutralized for-
maldehyde, and retitrating the resulting solution to an end point. The for-
maldehyde reacts with free amino groups of a-amino acids, causing the amino
acid to lose a proton, which can then be titrated. Free ammonia is also titrated.
Proline, one of the major amino acids in grapes that generally cannot be used by
yeast under wine fermentation conditions, is partially titrated. Arginine, which
contains four nitrogen atoms but only one carboxylic acid group, is titrated to the
extent of the single acid functionality. Traditionally, barium chloride has been
included to precipitate sulfur dioxide so that it does not interfere with the
determination. If the juice is unsulfited or if the sulfur dioxide level is less than
150 mg/L, this part of the procedure may be ignored (see Note 1).
2. Analytical Methodology
2. 7. Materials
1. Sodium hydroxide solution, 1 N.
2. Sodium hydroxide solution, 0.10 N, standardized against potassium hydrogen
phthalate or equivalent.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
283
284 Gump, Zoecklein, and Fugelsang
3. Barium chloride solution, 1 N (0.05 formula weight/L) (see Note 1).
4. Formaldehyde, reagent grade, 37% (v/v or 40% w/v) neutralized to pH 8.0 with
1 N sodium hydroxide.
5. pH meter sensitive to ± 0.05 pH.
6. Calibration buffers for the pH meter.
7. Whatman No. 1 filter paper.
2.2. Method
1. Pour 100 mL of sample into a 200-mL beaker.
2. Neutralize the sample to pH 8.0 using 1 N sodium hydroxide and pH meter.
3. If sulfur dioxide is present, add 10 mL of the barium chloride solution and allow
the sample to sit for 15 min (see Note 1).
4. Transfer the treated sample into a 200-mL volumetric flask. Bring to volume
with deionized water and mix well.
5. Filter the solution through Whatman No. 1 filter paper with or without diatoma-
ceous earth.
6. Transfer a 100-mL aliquot of the sample into a beaker, place calibrated pH/refer-
ence electrodes and a stirbar into the solution, mix, and readjust the pH to 8.0
with 1 N NaOh, if necessary.
7. Add 25 mL of the previously neutralized formaldehyde (pH 8.0) to the aliquot,
mix, and titrate to pH 8.0 using 0.10 N sodium hydroxide (see Notes 3 and 4).
8. The concentration of assimilable nitrogen is calculated as follows:
(NH 4 + + a-amino nitrogen) mg/LN = (mL of 0.1 N NaOH titrated) x 28 (see Note 2)
3. Practical Considerations and Recommendations
Fermentation problems may arise from numerous sources, including
deficiencies in the fruit and processing (Fig. 1). Difficulties may arise from a
combination of factors and a variety of sources. It is often the impact of two or
more conditions that cause a problem of greater significance than would be
predicted by a single parameter alone. Once yeast fermentative vigor and
vitality have diminished, revitalization may be difficult, if not impossible.
Thus, winemakers must approach each winemaking step with as complete an
understanding as possible. The following is a review of practical issues
influencing fermentation.
3.1. Vineyard
Fermentation problems are often vineyard-specific. Nitrogen deficiency in
apparently healthy grapes can be severe. Drought, grapevine nutrient
deficiencies, high incidences of fungal degradation, and level of fruit maturity
all influence must nitrogen and vitamins. Cultivar, rootstock, crop load, and
growing season may also influence juice or must nitrogen. Some varieties,
such as Chardonnay, have a greater tendency toward deficiency. Higher total
Prefermentation Nutritional Status of Grape Juice
285
Microbiological
Antagonism
Native flora
Inhibitory metabolites
Respiratory deficient
(petite) strains
Winemaking
Practices
Clarification
Fermentation temperature
Temperature shock
Sulfur dioxide
Yeast and bacterial starter preparation
Viability and concentration of enoculum
YEAST VIABILITY
AND
FERMENTATIVE
PERFORMANCE
Inhibitory Compounds
Sugar
Ethanol
Fatty acids
Carbon dioxide
Killer toxins
Mycotoxins
Phytoalexins
Pesticides and Fungicides
Deficiencies
Nitrogen
Phosphate
Vitamins
Minerals
Oxygen
Cation Imbalance
Fig. 1. Environmental and processing factors influencing viability and fermentative
performance of wine yeasts.
nitrogen may also be associated with certain rootstocks. For example, grapes
grown on St. George are higher in total nitrogen than those on AXR1.
As seen in Fig. 2, the concentration of a-amino nitrogen in Cabernet
Sauvignon grapes changes as a function of maturity and crop load. Henick-
Kling et al. (2) compared the concentrations of the two important sources of
assimilable N (FAN and NH 4 + ) among six cultivars at maturity over two
seasons (Table 1). This study illustrated large variations from one season to
the next in both free ammonia and a-amino nitrogen and significant differ-
ences in the concentration of both sources of nitrogen among cultivars.
Mold growth on fruit has been reported to cause fermentation problems as a
result of the production of metabolites and the depletion of nitrogen (3-5).
Botrytis cinerea produces a group of mold-derived heteropolysaccharides
collectively referred to as 'Botryticine" (6). The mycotoxins stimulate
S ac char omy ces sp. to produce high and inhibitory levels of acetic acid at the
onset and during the latter stages of alcoholic fermentation (5). Botrytis cinerea
can consume 41% of the total amino acid concentration in the fruit, causing as
Gump, Zoecklein, and Fugelsang
9/1 8/97
9/23/97
9/28/97
1 0/3/97
1 0/8/97
10/13/97
low
medium
high
Fig. 2. a-Amino nitrogen (mM) of Cabernet Sauvignon grapes cluster thinned to
low (2.6 kg/vine), medium (4.9 kg/vine), and high (5.3 kg/vine) crop level in 1997.
(From B. W. Zoecklein and C. W. de Bordenave, unpublished).
much as a 51% reduction in proline (7). Further, the presence of native yeasts,
particularly Kloeckera apiculata, is known to deplete important vitamins such
as thiamine. Fruit from diseased vines may also contain inhibitory levels of
phy to alexins produced by the plant in response to the parasite (8). These may
be inhibitory toward Saccharomyces sp.
3.2. Yeast Strains
Strain differences among Saccharomyces sp. may be significant in terms of
nitrogen requirements, the time frame for uptake and release of specific amino
acids during fermentation, and the ability to ferment to dryness. Henschke and
Jiranek (9) reported that the Montrachet strain had the highest nitrogen demand
and exhibited the highest rate of amino acid and ammonium ion accumulation
relative to sugar fermented among several strains studied. When considering
utilizing unfamiliar strains, the winemaker is urged to consult the supplier's
technical representatives.
3.3. Yeast Starter Population Density
Yeast populations should be large enough to overwhelm indigenous
microflora and grow to (2-5) x 10 6 yeast cells/mL juice (1-3% [v/v] of an
active starter). These concentrations apply when the °Brix is below 24, the pH
is above 3.1, and the temperature is above 13°C (55°F). Increases in the inocu-
lum volume should be made when parameters are outside these values.
Prefermentation Nutritional Status of Grape Juice 287
Table 1
Survey Results from 1993 and 1994; Mean Content of Free Ammonia
and Free Amino Nitrogen
Free ammonia (mg/L)
Free amino nitro
gen (mg/L)
Cultivar
1993
1994
1993
1994
Cayuga White
68
32
74
197
Chardonnay
46
55
151
177
Riesling
52
56
102
123
Seyval Blanc
19
14
82
156
Pinot Noir
52
88
135
116
Cabernet Sauvignon
49
69
74
142
Mean (all cultivars)
48
52
103
152
Source: ref. 2.
3 A. Yeast Preparation
Rehydration protocol should strictly adhere to the yeast supplier's recommen-
dations to assure maximum viability. Viability and vigor decrease as rehydration
temperatures vary above or below those recommended. After rehydration, the
yeast should be added to the juice/must within 20-30 min or, alternatively, a
carbohydrate source added. If this is not done, yeasts undergo a premature decline
phase, resulting in an inoculum of low viable cell density. Significant yeast cell
death occurs when temperature differentials between starter and juice/must are
more than 5-7°C. Monk (10) reported that the addition of rehydrated yeast (40°C
[104 °F]) directly to a must at 15°C (60°F) kills approximately half of the cell
population. In cases where the yeast is expected to ferment at low temperature, it
is desirable to acclimate the starter to that temperature.
3.5. Nutrient Addition
Many juice/musts lack sufficient assimilable nitrogen and other components
needed by yeast for fermentative growth. Although some have suggested that a
minimum of 140 mg/L assimilable nitrogen is required by yeasts, others rec-
ommend 250 mg N/L or more. Morris et al. (11) suggested that concentration
levels of 500-900 mg/L of assimilable nitrogen are required for healthy fer-
mentations. Yeast with lower concentrations of N may perform well under
optimum, but not adverse, conditions. Concentrations of 500-900 mg N/L give
yeast the ability to produce cellular proteins needed to meet the worst environ-
mental conditions (C. Cone, personal communications, 1996). Phosphate
deficiency may also have a direct impact on yeast cell growth and fermentative
288 Gump, Zoecklein, and Fugelsang
performance (9). Inorganic phosphate is required for synthesis of ATP/ ADP
and nucleic acids. Supplementation should be carried out using a balanced
source of diammonium phosphate (DAP) (25.8% ammonia, 74.2% phosphate),
amino acids, minerals, and vitamins. Diammonium phosphate additions of 1 g/L
(8.3 lbs/1000 gal) provide 258 mg/L fermentable nitrogen which exceeds the
suppliers' recommended level. In the United States, the legal limit of DAP is
960 mg/L, which corresponds to 203 mg N/L.
3.6. Timing of Nutrient Additions
Amino acids are not incorporated equally by yeast and their incoporation
may vary significantly among yeast strains (12). Some are utilized at the
beginning of the growth cycle, some later, and some not at all. Ammonia, on
the other hand, is consumed preferentially to amino acids in growing popula-
tions. Stationary-phase yeast also vary significantly in terms of the order of
amino acid incorporation, and do not always show preference for ammonia
over amino acids (12). Therefore, timing of DAP additions is important. A
single large addition of DAP at the beginning may lead to an excessive fermen-
tation rate and an imbalance in the uptake and usage of amino acids. To avoid
this problem, multiple additions at 16° Brix and 10° Brix are preferred.
Although the addition of ammonium salts may not significantly benefit
stationary-phase yeast (13), the addition of specific amino acids may have a
stimulatory effect and extend fermentative activity (14). Single amino acids
may be quickly utilized to resynthesize transporter proteins that are rapidly
"turned over" during accelerated growth. Supplements added after about half
the fermentation is completed may not be used by the yeast because alcohol
prevents their uptake. For the same reason, adding nutrients to a stuck
fermentation is seldom effective. With increasing ethanol concentrations, the
permeability of the plasma membrane to hydrogen ions increases. This requires
intracellular enzymes and ATPases to pump protons back out of the cell in order
to balance the internal pH of the yeast cell against the external pH of the juice/
must. Because of the competing nature of these coupled transport systems, nitro-
gen is picked up by the cell only in the early stages of fermentation, stored in
vacuoles and used on demand. Nitrogen added late in the fermentation may not
be transported into the cell (75). Once stopped because of nutrient stress, the
fermentation may require significant effort to restart and finish.
3.7. Vitamin Addition
Juice/musts can be vitamin deficient as well as deficient in assimilable
nitrogen when there is a high incidence of microorganisms (mold, yeast, and/
or bacteria). Growth of Kloeckera apiculata has been reported to rapidly reduce
thiamine levels below those required by Saccharomyces sp. (16). Further, the
Prefermentation Nutritional Status of Grape Juice 289
use of S0 2 may lead to additional reductions in levels of thiamine (13).
Sac char omyces sp. has been shown to synthesize all required vitamins, with
the exception of biotin. However, vitamin supplementation has been
demonstrated to be stimulatory (17). Thus, it is usually desirable to add a mixed
vitamin supplement with the nitrogen additions.
3.8. Yeast Hulls
Yeast hulls are by-products of the commercial manufacture of yeast extract.
Consisting of cell walls and membranes, hulls are added to enhance fermenta-
tion rates and to restart stuck fermentations. Their mode of action has been
described as lowering the concentration of inhibitory C 8 _ 10 fatty acids.
Ingledew (18) reported that yeast hulls stimulate yeast populations by providing
a source of C 16 and C 18 unsaturated fatty acids that act as oxygen substitutes
under long-term fermentative conditions. Additionally, hulls may provide a
source for some amino acids as well as surface area to facilitate release of
potentially inhibitory levels of saturated C0 2 .
3.9. Oxygen/SO 2
Although not directly stimulatory to fermentation, oxygen is required by
yeasts for synthesis of cell-membrane precursors, including steroids (primarily
ergosterol) and lipids (principally oleanoloic acid). Yeast propagated aerobically
contains a higher proportion of unsaturated fatty acids and up to three times the
steroid level of anaerobic yeast. Without initial oxygen, replication is usually
restricted to four to five generations, as each yeast budding cycle reduces the
sterol content of the membrane by approximately half. When the level reaches
a critical point, replication stops and fermentation must continue with the popu-
lation present at that point. Slight aeration of yeast starters may play an impor-
tant role in subsequent fermentative performance. Wahlstrom and Fugelsang
(20) reported increased cell density and more rapid fermentations when aer-
ated starters were used compared with nonaerated starters.
The grape itself may supply at least a portion of the lipids needed by yeast
during fermentative growth. Up to two-thirds of the cuticular waxes in some
grape varieties are composed of oleanolic acid. This fatty acid has been found
to replace the yeast's requirement for ergosterol supplementation under
anaerobic conditions (19). Thus, pomace contact, either prior to pressing in
white wine production or extended during red wine fermentation, extracts this
and other essential components from the grape cuticle.
In the absence of sulfur dioxide, grape-derived oxidative enzymes (tyrosi-
nases) catalyze conversion of nonflavonoid phenols to their corresponding
quinones. The reaction brings about rapid (but reversible) browning of the juice
while consuming oxygen required by yeasts during the early stages of growth
290 Gump, Zoecklein, and Fugelsang
(Fig. 3). Grape tyrosinase is readily and rapidly inactivated by addition of S0 2
to the juice/must. However, sulfur dioxide addition also inactivates thiamine.
If additions of more than 50 mg/L S0 2 occur, thiamine (in the form of nutri-
tional supplements) should be added to the fermenter.
3. 70. Hydrogen Ion Concentration (pH)
Yeast growth occurs over the pH range from 2.8-8.0 (17). However, cultures
do not function equally well throughout this wide range. Biomass is produced
best above pH 4.0 and slows as the pH decreases. Low pH reduces the tolerance
of Saccharomyces sp. to ethanol. Kudo et al. (21) demonstrated a relationship
between the concentrations of K + and H + and the completion of alcoholic
fermentation. They suggested that a minimum K + /H + of 25:1 is required. As
pH drops below 3.2, the increase in H + raises the risk of premature arrest of
fermentation. Added stress is placed on yeast at low pH values and is com-
pounded by low nutrient concentrations, temperature extremes, high sugar,
and/or high alcohol. Additionally, highly chaptalized juice has a limited buff-
ering capacity. As a result, organic acid and C0 2 production during the initial
stage of fermentation can drop the pH (C. Cone, personal communication,
1995). Juice/musts with pH <3.1 should receive an increased yeast inoculum.
3.77. Nonsoluble Solids
Nonsoluble grape solids serve as nutritionally important substrates and as
oxygen reservoirs during the early stages of fermentation. Additionally, solids
"hold" yeasts (native and inoculated strains) in suspension during the early
stages of fermentation and before the evolution of large amounts of carbon
dioxide. Conventional white juice processing calls for some level of suspended
solids reduction prior to inoculation. However, reduction below 0.5% can result
in nutrient deficiencies and promote premature sedimentation of yeast. The
addition of bentonite may help to keep yeast in suspension during the initial
stages of fermentation while helping to achieve protein stability. However,
bentonite additions can also reduce must nitrogen and should be done in
conjunction with supplemental nutrient additions. If processing protocol does
not include pre fermentation bentonite additions, it may be necessary to mix
tanks to achieve resuspension and dissipation of carbon dioxide.
3. 72. Fermentation Temperature
Yeast growth at either end of the recommended temperature range affects
the integrity and operation of the cell membrane. Growth at upper temperature
limits brings about inactivation/denaturation of cell-membrane-associated
transporter proteins and other enzymes whereas at low temperatures, fluidity/
pliability is compromised (22). Cell-membrane function is also affected by the
Prefermentation Nutritional Status of Grape Juice 291
HO \ / R >> 0-\ // R+ H
2
HO
Tyrosinase
O
(Colorless) (Brown)
Fig. 3. Enzymatic oxidation of nonflavonoid phenols. (From ref. 8.)
presence of increasing concentrations of ethanol. The two antagonists act in
synergy, narrowing the Saccharomyces sp. temperature tolerance range and,
potentially, bringing about premature interruption of fermentation. For low
(<10°C [50°F]) temperature fermentations, increased inoculum levels and
nutrient additions are recommended.
3. 73. C0 2 Toxicity
Carbon dioxide in concentrations of up to 0.2 atm stimulates yeast growth.
Above this level, carbon dioxide becomes inhibitory. Pekur et al. (23) reported
that, at increased pressures, carbon dioxide reduces the yeast's uptake of amino
acids. Agitation can be used to help prevent growth-limiting accumulations of
ofC0 2 .
3. 74. Sugar Toxicity
Increased osmotic pressure associated with high sugar concentrations can
inhibit yeast growth. Although Saccharomyces sp. are among the most tolerant
species to high sugar concentrations, such environments are often nitrogen defi-
cient. Fermentation under these conditions begins slowly and may stick prior
to completion. In cases where sugar levels range from 25°Brix to 30°Brix,
yeast starters should be prepared at greater than 5 x 10 6 yeast cells/mL. For
>30°Brix musts, an additional 1 x 10 6 yeast/mL should be used. Ice wines and
some late harvest wines require substantially more yeast inoculum, up to
20 x 10 6 yeast/mL (C. Cone, personal communication, 1996).
3.75. Glucose/Fructose
Grape juice usually contains approximately equivalent concentrations of
glucose and fructose sugars. However, glucose is fermented preferentially to
fructose. Stress can affect the yeast's ability to metabolize the last residual
292 Gump, Zoecklein, and Fugelsang
fructose. This problem appears to occur more frequently with the S. bayanus
strains, which are glucophilic (24). Fructose syrup should be used only as the
last choice for chaptalization.
3. 16. Alcohol Toxicity
Alcohol and its metabolic precursor acetaldehyde are toxic to all yeasts,
including Sacccharomyces sp. Alcohol has a profound effect on all aspects of
yeast metabolism, ranging from membrane integrity to nitrogen uptake and
sugar transport. There are many environmental factors that act in synergy with
alcohol to inhibit yeast growth, including low pH, high temperature, acetic
acid, sugar, short-chain fatty acids, nitrogen depletion, and deficiency of sterols
and vitamins. Acetaldehyde has also been reported to play a significant
inhibitory role in the survival of Saccharomyces sp. during fermentation (25)
and may increase the yeast's sensitivity to increasing concentrations of ethanol
(26). Light aeration during the growth phase stimulates synthesis of cell-mem-
brane precursors, which helps maintain cell integrity. During fermentation, nitrogen
supplementation of 250-500 mg /L is likewise helpful in mitigating the antagonis-
tic affects of alcohol.
3.77. Microbially Compromised Fruit, Native Yeast/Bacterial
Fermentations, and Late Starter Addition
Usually non-Sac char omyces species from the vineyard and winery-associ-
ated Saccharomyces sp. dominate the initial and early stages of fermentation
of uninoculated musts. Their growth may result in significant depletion of
nitrogen and vitamins such as thiamine. Among vineyard-related native
species, KloeckeralHanseniaspora are typically found at highest population
densities. Kloeckera sp. are tolerant of both low temperature and the presence
of sulfur dioxide. The yeast can produce high levels of ethyl acetate while
significantly depleting nutrient levels.
Inhibitory metabolites produced by mold and native yeast/bacteria growing
on fruit or in the early stages of fermentation may have a significant effect on
the fermentative performance of Saccharomyces species. Acetic and lactic acid
bacteria and native yeast can produce potent inhibitors and deplete must nitro-
gen and vitamins levels. Acetic acid is a strong inhibitor of Saccharomyces sp.,
especially when combined with other antagonistic factors such as high alcohol.
Acetic acid levels of >0.8 g/L in stuck wine may need to be reduced before
attempting re fermentation (27). The technology to accomplish this goal is
commercially available (28).
Some Saccharomyces sp. and strains and some non-Sac c char omyces yeasts
can produce killer toxins that inhibit other sensitive strains and may play a role
in stuck fermentations. It is suggested that vigorous strains be used for high-
Prefermentation Nutritional Status of Grape Juice 293
risk fermentations. Increasing the level of yeast inoculum along with nitrogen
supplementation of 250-500 mg/L may also help overcome these effects.
3. 18. Pesticides and Fungicides
Pesticides and fungicides can influence fermentation by producing stress
metabolites, such as reductive compounds, and by inhibiting and/or preventing
fermentation. Not all yeasts and bacteria are affected in the same way. For
example, there is a significant difference between systemic and contact
fungicides with regard to residues. Vinification style influences residue
concentrations. Prefermentation clarification and utilization of bentonite can
affect the final concentration of contact fungicides in white wine fermentation.
Close adherence to spray schedules, use of minimal applications, and avoidance
of late-season applications are recommended.
3. 19. Conclusions
Overall, the Formol method can provide a very useful index of the nutritional
status of a juice or must. The simplicity of this procedure and its general ability
to correctly describe the amount of assimilable nitrogen make it ideal for use in
the winery production laboratory.
4. Notes
1. A series of samples of a juice with 0, 25, 50, and 150 mg/L S0 2 added were
titrated using the Formol procedure but ignoring the addition of barium sulfate.
The average titration values determined for the various levels of S0 2 addition
differed by 5.3% or less. This would indicate that it is not necessary to add barium
sulfate to a sulfited juice sample. This would also simplify the procedure,
permitting one to take a 50-mL juice sample directly for titration.
2. The full equation for calculating assimilable nitrogen is
mg N/L = (mL of NaOH) x (0.10 meq OH7mL) x (1 meq N/1 meq OH")
x (200 mL/100 mL-dilution factor) x 10 (to convert to liters) x 14 mg/meqN
= mL x 28
If a different concentration of base is used, the equation requires an additional
term: Normality of NaOH used/0.1. The dilution factor in the equation (200 mL/
100 mL) is changed if one uses a sample volume other than 100 mL and dilution
to 200 mL. As there are ten 100-mL samples in a liter, the factor " x 10" is
required to convert results to a mg/L basis.
3. A new bottle of formaldehyde may have a pH as low as approx 3.5. This will
require about 0.5 mL of \ N sodium hydroxide to neutralize. If the formaldehyde
is not neutralized, significant overtitrations may result yielding high values for
fermentable nitrogen. The pH of the formaldehyde will begin to drop with time
and should be readjusted periodically to pH 8.0.
294 Gump, Zoecklein, and Fugelsang
4. Taylor (29) noted that various authors have recommended other pH values,
ranging between 6 and 9, for the initial neutralization pH and final titration pH. It
has been our experience with standard solutions of various amino acids that
working with pH 8.0 for both the initial neutralization of the sample and for the
final titration end point minimizes errors. The use of a pH meter for end-point
detection is an important feature of this method; the use of phenolphthalein as an
indicator does not provide the same precision and accuracy.
5. Formol titrations of known concentrations of seven a-amino acids (alanine, argi-
nine, serine, threonine, a-amino butyric, aspartic, and glutamic acid) and proline
showed recoveries from 90% to 120% for the former and an approximate 17-33%
recovery for proline. The percentage recovery appears to increase with the abso-
lute amount of proline present. Similarly, Formol titration of known concentra-
tions of ammonium chloride solutions (at approx 50 and 100 mg/L nitrogen) also
exhibited quantitative recoveries.
6. The arginine recovery is quantitative for the single carboxylic group. However,
because arginine contains four nitrogen atoms, its recovery understates the
amount of nitrogen present. Ingledew (18) reported that arginine converts to
ornithine and urea and that under the anaerobic conditions during fermentation,
ornithine is almost quantitatively converted to proline. Thus, it would appear that
arginine readily provides two assimilable nitrogens (in the urea formed) to the
yeast, with a third nitrogen tied up as proline, and the fourth even more tightly
bound possibly to an enzyme system (C. J. Muller, personal communication).
7. Formol titrations of known mixtures of the eight amino acids mentioned in Note
5 also showed nearly quantitative recoveries when the titration factors (percent-
ages recovered) for proline and arginine were considered. The Formol method,
therefore, overstates the available nitrogen from proline and understates the avail-
able nitrogen from arginine. The positive and negative errors introduced with the
titration of these two juice components are partially compensating. If the amount
of proline in the must is much larger (approx 10 times) than the amount of argin-
ine, the method will overstate the amount of available nitrogen. If the amount of
proline is only double the amount of arginine, then the positive and negative
errors in the titration essentially balance out.
8. Under oxidative conditions proline is oxidized to glutamic acid and becomes
available to the yeast, and the Formol method will generally understate the
ultimate amount of nitrogen available.
9. Direct titrations of 25-mL samples of juice with correspondingly smaller amounts
of formaldehyde added were made. Other than the greater difficulty in accurately
reading small volume increments from the burette, there was no significant impact
on the procedure.
References
1. Giannessi, P., and Matta, M. (1978) Azoto amminico, in Trattato di Scienza e
Technica Enologica, Vol. I. (Brescia, A. E. B., ed.) Analisi e Controllo dei mosti e
dei Vini, Italy, pp. 87-88.
Prefermentation Nutritional Status of Grape Juice 295
2. Henick-Kling, T., Edinger, W. D., and Larsson-Kovach, I.-M. (1996) Survey of
available nitrogen for yeast growth in New York grape musts. Wein-Wissenschaft
51(3), 169-174.
3. Rapp, A., and Reuther, K. H. (1971) Der Gehalt von Aminosauren in gesunden
und edelfaulen Beeren verschiedener Rebsorten. Vitis 10, 51-58.
4. Dittrich, H. H. (1987) Die Garbeeinflussung 5.5 Stickstoff in Mikrogiologie des
Weines (2nd ed.) (Ditrick, H. H., ed.). Ulmer, Stuttgart.
5. Doneche, B. J. (1993) Botrytized wines, in Wine Microbiology and Biotechnology
(Fleet, G. H., ed.), Harwood Academic Publishers, Grey, Switzerland.
6. Dubourdieu, D., Pucheu-Plante, B., Mercier, M., and Ribereau-Gayon, P. (1978)
Structure, role et localisation d'un glucane secrete par Botrytis cinerea dans la
baie de raisin. C. R. Acad. Sci. Paris, 287D, 571-573.
7. Sponholz, W. R. (1991) Nitrogen compounds in grapes, must, and wine in
International Symposium on Nitrogen in Grapes and Wine (Rantz, J., ed.)
American Society for Enology and Viticulture, Davis, CA, pp. 67-77.
8. Smith, D. A., and Banks, S. W. (1986) Biosynthesis, elicitation and biological
activity of isoflavonoid phtoalexins. Phytochemistry 25, 979-995.
9. Henschke, P. A., and Jiranek, V. (1993) Metabolism of nitrogen compounds, in
Wine Microbiology and Biotechnology (Fleet, G. H., ed.) Harwood Academic,
Australia, pp. 27-54.
10. Monk, P. R. (1986) Rehydration and propagation of active dry wine yeasts.
Austral. Wine bid. J. 1(1), 3-5.
1 1 . Morris, J. R., Main, G. and Threfall, R. (1996) Fermentations: problems, solutions
and preventions. Vide. Enol. Sci. 51(3), 210-213.
12. Manginot, C., Roustan, J. L., and Sablayrolles, J. M. (1998) Nitrogen demand of
different yeast strains during alcoholic fermentation. Importance of stationary
phase. Enzyme Microb. Tech. 23, 5 1 1-517.
13. Lafon-Lafourcade, S. and Ribereau-Gayon, P. (1984) Developments in the
microbiology of wine production. Prog. hid. Microbiol. 19, 1-45.
14. Manginot, C. and Sablayrolles, J. M. (1997) Use of constant rate alcoholic
fermentations to compare the effectiveness of different nitrogen sources added
during the stationary phase. Enzyme Microb. Tech. 20, 373-380.
15. Bisson, L. F. (1996) Yeast and biochemistry of ethanol formation in Principles
and Practices ofWinemaking (Boulton, R. B., Singleton, V. L., Bisson, L. F., and
Kunkee, R. E., eds.), Chapman & Hall, New York, p. 140.
16. Bataillon, M. and Rico, A. (1996) Early thiamine assimilation by yeasts under enological
conditions: impact on alcoholic fermentation kinetics. /. Ferm. Bioeng. 82, 145-150.
17. Fleet, G. H. and Heard, G. M. (1993) Yeasts — growth during fermentation, in
Wine Microbiology and Biotechnology (Fleet, G. H., ed.), Harwood Academic,
Australia, pp. 27-54.
18. Ingledew, W. M. (1996) Nutrients, yeast hulls and proline in wine fermentation.
Wein-Wissenschaft 51(3), 141-146.
19. Brechot, P., Chauvet, J., Dupuy, P., Croson, M., and Rabatu, A. (1971) Acide
oleanoique facteur de aroissance anaerobic de la levure du vin. C.R. Acad. Sci.
272, 890-893.
296 Gump, Zoecklein, and Fugelsang
20. Wahlstrom, V. L. and Fugelsang, K. C. (1988) Utilization of Yeast Hulls in
Winemaking. Calif. Agric. Tech. Inst. Bull. 880103. California State
University, Fresno.
21. Kudo, M., Vagnoli, P., and Bisson, L. F. (1998) Imbalance of potassium and
hydrogen ion concentrations as a cause for stuck enological fermentations. Am. J.
Enol. Vitic. 49, 296-301.
22. Stanier, R. Y., Adelberg, E. A., and Ingraham, J.L. (1976) Introduction to the
Microbial World, Prentice- Hall, Englewood Cliffs, NJ.
23. Pekur, G. N., Bur'yan, N. L, and Pavlenko, N. M. (1981) Characteristics of
nitrogen metabolism in wine yeasts under different fermentation conditions. Appl.
BiocJiem. Microbiol. 17, 248-252.
24. Schultz, M. and Gafner, J. (1993) Sluggish alcoholic fermentation in relation to alter-
ations of the glucose-fructose ratio. Chem. Mikrobiol. Technol. Lebenom. 15, 73-78.
25. Stanley, G. A. and Douglas, N. G. (1993) Inhibition and stimulation of yeast
growth by acetaldehyde. Biotechnol. Lett. 15, 1199-1204.
26. Jones, R. P. (1989) Biological principles for the effects of ethanol. Enzyme
Microbiol. Biotechnol. 11, 130-153.
27. Rasmussen, J. E., Schultz, E., Snyder, R. E., Jones, R. S., and Smith, C. R. (1995)
Acetic acid as a causative agent in producing stuck fermentations. Am. J. Enol.
Vitic. 46, 278-280.
28. Smith, C. R. (1999) Vinovation, Inc. New Tools for an Ancient Craft, Vinovation,
Inc., Sebastopol, CA.
29. Taylor, W. H. (1957) Formol titration: an evaluation of its various modifications.
Analyst 82, 488-498.
33
Enological Characteristics of Yeasts
Fabio Vazquez, Lucia I. C. de Figueroa, and Maria Eugenia Toro
1. Introduction
The final product of spontaneous grape must fermentation (natural fermen-
tation) is the result of the combined action of different yeast species and vine
varieties. Both of them contribute, in different ways, to the organoleptic
properties of wine (1). At the first fermentation stages, lemon-shaped, low-
ethanol-tolerant species (Kloeckera, Hanseniaspora) are predominant. During
the fermentation process, these species are replaced by high-ethanol-tolerant
Saccharomyces cerevisiae and other related species (2,3). The variety and
proportion of different yeasts in the must depend on factors such as geographic
location, climatic conditions, and grape variety (3,4).
It is possible to isolate pure cultures of yeast, which can be supplied to
winemakers as pure culture slants and then be propagated in the winery to
provide starters ("selected pure cultures").
On the basis of organoleptic testing of wines, different authors have claimed
advantages for either natural fermentations or the use of selected cultures and
active dry yeasts (3). Production and use of dry wine yeasts started in the United
States in the mid-1960s and expanded worldwide thereafter. Today, more than
100 different strains are commercially available. With a worldwide production
of wine of 246,423,000 hL (5) and a yeast usage rate of 10-20 g/hL, the
potential market for selected dry yeast can be estimated in the range of 5000
tons annually (6). It soon became obvious that these strains are not the universal
solution to the fermentation of grape musts. So, there is a need for the selection
of strains better adapted to different regions of the world and their respective
grape varieties. Moreover, Fleet (7) concluded that indigenous strains of
S. cerevisiae are far better adapted to grow in grape must than any inoculated
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
297
298 Vazquez, Figueroa, and Toro
strain. It should be emphasized, however, that the assignment of all wine yeast
strains to a single species does not imply that all strains of Saccharomyces are
equally suitable for wine fermentation. Wine yeast strains differ mainly in their
ability to contribute to the bouquet of wine and their fermentation performance (8).
Selected culture has been therefore the objective of many investigations
related to the desirable properties of wine yeasts and their influence on the
composition of wine and its organoleptic characteristics. Numerous features of
yeasts have been studied, some desirable are, as shown in Table 1, some always
desirable, and others always undesirable (9).
Desirable requirements described in Table 1 are complex and difficult to
define genetically without a better understanding of the biochemistry involved
and need careful selection of appropriate yeasts of natural environments or
culture collections. At present, no wine yeast in commercial use has all the
characteristics listed in Table 1, and it is well established that wine yeasts vary
according to their winemaking abilities.
When wine fermentation takes place with the addition of S0 2 , the number of
yeast species involved in the process is almost exclusively reduced to several
S. cerevisiae resistant to this antiseptic. Strains belonging to the same species
may present differences in their tolerance to S0 2 (4,10,11).
Optimal conversion of carbohydrates to ethanol in wine making requires
cells tolerant to high concentrations of both. The sugar conversion rate may be
calculated as fermentation vigor (FV), which indicates the maximum yield of
ethanol that a yeast strain can produce during fermentation with sugar excess
(12). Ethanol is clearly inhibitory for yeasts: Cell growth stops at relatively
low ethanol concentrations and fermentation stops at relatively higher ones.
Yeast tolerance to ethanol has been correlated with membrane fluidity and both
phenomena have been associated with membrane lipid composition (13). Some
sugar-tolerant yeasts are also alcohol tolerant, but these two characteristics are
not necessarily related (14).
Some yeast strains liberate proteins or glycoproteins that kill sensitive
yeasts. These proteins or glycoproteins are named killer factors. Yeasts are
classified, according to the killer factor: killer (K), sensitive (S), and neutral
(N). Different genera of yeast may present killer activity. Two species of
double-stranded RNAs with different functions and distinct molecular sizes
are encapsulated in viruslike particles, and they are responsible for producing
the toxic proteins or glycoproteins in S. cerevisiae. Killer yeasts are immune to
their own toxin but can be sensitive to toxins of other killer types. Killer
character in S. cerevisiae is a genetically complex phenomenon because it
depends on both cytoplasmic factors and chromosomal genes.
Killer action depends on the ratio of killer to sensitive cell amounts at the
fermentation beginning, on the presence of protein-adsorbent substances,
Enological Characteristics of Yeasts
299
Table 1
Characteristics of Saccharomyces cerews/ae Affecting Winemaking
Process
Desirable
Undesirable
Ability to begin fermentation in high ethanol
concentrations (3,6,8-10,13,14,25,26,28,29)
Rapid initiation of fermentation immediately
upon inoculation (3,8,9,29)
Efficient conversion of grape-must sugar to
ethanol (3,6,8,9,12 ,14,29)
Flocculating capacity at the end of
fermentation to help clarification
(8,9,10,21,2229)
Fermentation at low temperatures
(6,8-10,1925,27,29)
Retention of viability during storage (8,9)
Sulfur dioxide resistance (3,4,6,8-10,2529)
Killer factor or resistance to killer toxins
(6,8-10,15)
Film-forming capacity (sherry wines) (9,26)
Malic acid degradation (6)
Production of glycerol to contribute to the
sensory qualities of wine (1,6,8)
Uniform rate of fermentation (8,9,29)
Low foam ability (8,29)
Low volatile acid, acetaldehyde, sulfite,
and a higher alcohol production (8,25 ,29,30)
Low hydrogen sulfide or mercaptan
production (8,202529)
Ability to begin fermentation in high sugar
concentration (3 25)
Production of desirable fermentation bouquet
and reproducible production of the correct
levels of flavor and aroma compounds (3,8,9,29)
Production of sulfur dioxide and
mercaptan (6,9,10)
Formation of ethyl carbamate
precursors (e.g., urea) (6,9)
Production of
polyphenol oxidase (6)
on the environmental conditions, and on the growth phase of the sensitive
cells (15).
Killer phenomenon in yeasts appears to be an important characteristic in
industrial fermentations. In winemaking, there is a consensus about the
consequences that these toxins have on other yeasts during fermentation. Killer
strains have been found in wines from different regions of the world (15-17).
Generally, fermentation process in making white wine is controlled at low
300 Vazquez, Figueroa, and Toro
temperatures in order to obtain high-quality products. Many floral and fruity
esters have low boiling points and are readily lost through evaporation at higher
fermentation temperatures, and the wine assumes a vinous, heady bouquet. As
the fermentation temperature is lowered, the risk of premature stoppage
increases (18). Therefore, a yeast strain that has good fermentation ability at
low temperatures is desired. The study of these characteristics is important to
establish a definition of cryophilic wine yeasts and to select and improve useful
cryophilic wine yeasts more efficiently (19).
Sulfidric problems remain as some of the most common in wine fermenta-
tion. Hydrogen sulfide results in an objectionable aroma when it is present in
wine. Typically, yeast cells produce only enough H 2 S to meet biosynthetic
requirements. An excess of H 2 S in the final fermentation product can presum-
ably arise through either its increased formation or its reduced consumption by
metabolism (20).
Flocculation ability, whereby yeast cells aggregate in clumps that rapidly
sediment in the culture medium, has received considerable attention owing to
its industrial application (21). This phenomenon is of great interest for
industrial fermentations such as brewing, winemaking, and biological produc-
tion of ethanol because it leads to an efficient separation of yeast cells from the
fermenting medium (22). The mechanism of flocculation in S. cerevisiae has
been proposed to involve surface proteins (lectins) binding to carbohydrates
receptors on neighboring cell walls (23).
The aim of this work is the development of primary screening techniques
through the modification of classical ones, together with the advances in the
basic understanding of wine yeast physiology and growth.
The screening techniques proposed in this work are grouped in five sections:
(1) efficient conversion of grape-must sugar to ethanol, (2) flocculating
capacity at the end of fermentation to help clarification, (3) hydrogen sulfide
production, (4) Killer factor or resistance to killer toxins, and (5) ability to start
fermentation in high ethanol concentrations, low temperatures, high sugar
concentration, and sulfur dioxide resistance
2. Materials
2. 7. Strains
1. Yeasts to be enologically characterized in these screening tests may be iso-
lated from natural environment (grape, grape must, or wine) or may belong
to specific culture collections. Comparison with commercial wine yeasts is
recommended.
2. Reference killer yeast: ATCC 36900 (NCYC 738).
3. Reference sensitive yeast: NCYC 1006.
Enological Characteristics of Yeasts 301
2.2. Media
1. General propagation medium: 10 g/L yeast extract, 20 g/L peptone, and 20 g/L
glucose (YEPD), agarized if it is necessary.
2. General inoculum medium: filter-sterilized commercial concentrated must, dilute
to 13°Brix with distilled water, plus yeast extract (0.1 g/L).
3. Inoculum medium for S0 2 resistance test: 6.7 g/L yeast nitrogen base broth
(YNB) and 10 g/L glucose.
4. Fermentation medium for the test of efficient conversion of grape-must sugar to
ethanol: Commercial concentrated must should be diluted to 27°Brix by the
addition of distilled water, plus yeast extract (1 g/L) and steam-sterilized at 90°C
for 15 min (see Note 1).
5. Fermentation medium for the test of hydrogen sulfide production: Filter-steril-
ized commercial concentrated must should be diluted to 22°Brix with distilled
water. Sodium metabisulfite is added to this medium to give a total S0 2 concen-
tration of 25 mg/L.
6. Medium for S0 2 resistance: 6.7 g/L YNB broth and 10 g/L glucose. It is divided
into nine lots and sodium metabisulfite is added to give total S0 2 concentrations
of 0, 25, 50, 75, 100, 150, 200, 250, and 300 mg/L. This medium is filter-steril-
ized and the pH is adjusted to 4.0.
7. Medium for testing ability to begin fermentation at 30°Brix: Filter-sterilized
commercial concentrated must should be diluted to 30°Brix with distilled water;
the pH is adjusted to 4.0.
8. Medium for screening ability to start fermentation at high ethanol concentration
and low temperature: Filter-sterilized commercial concentrated must should be
diluted at 22°Brix. For the ethanol test, it must be adjusted to 8%, 9%, 10%, 11%,
and 12% v/v with absolute ethanol (see Note 2).
9. Buffered-agarized YEPD medium: 10 g/L yeast extract, 20 g/L peptone, 20 g/L
glucose, 0.03 g/L methylene blue, and 20 g/L agar, buffered with 0.1 M citrate/
phosphate.
10. Must-agarized medium (MAM): grape must (commercial concentrated or fresh)
at 22°Brix; 10 g/L yeast extract, 0.03 g/L methylene blue, and 20 g/L agar (15).
2.3. Solutions and Devices
1. Washing solution for flocculating capacity assay: 0.25 M EDTA (22).
2. Flocculation buffer: 0.51 g/L CaS0 4 , 6.80 g/L CH 3 COONa, and 4.05 g/L
CH3COOH. glacial. The solution should have a pH of 4.5 (adjust if necessary).
3. Trapping solution for hydrogen sulfide production test: 4.3 g/L 3CdS0 4 -8H 2 0,
and 0.6 g/L NaOH.
4. Vaseline-paraffin overlay: 50% solid vaseline and 50% pure paraffin mixed
and molten.
5. Muller valve: glass device that contains sulfuric acid (50%) that allows only C0 2
to escape from the system.
302 Vazquez, Figueroa, and Toro
6. Cadmium hydroxide traps: Test tubes (200 mm; 25 mm inside diameter) contain-
ing 60 mL of the trapping solution are used. The glass tubing (250 mm; 3 mm
inside diameter) is attached to the fermentation flask neck by a compression cap
and O-ring. The outlet end is curved 90° and connected to Teflon tubing, to which
a disposable 22.5-cm transfer pipet is attached. This micropipet is inserted
through a plug and immersed into trapping solution to create a fermentation lock
and trap of H 2 S that emerged with gases, exiting the fermentation flask (20,24).
3. Methods
3. 7. Efficient Conversion of Grape-Must Sugar to Ethanol
1 . Microfermentation conditions: Fermentation is carried out in 1 25-mL Erlenmeyer
flasks with 87.5 mL of the fermentation medium (Subheading 2.2., item 4), seeded
with 10 6 cells/ml (Subheading 2.1., item 1) from a 24-h culture of the inoculum
medium (Subheading 2.2., item 2). After aseptic closing of the flask by the Miiller
valve, the weight loss is followed for several days until the end of fermentation (con-
stant weight). Fermentation systems are incubated statically at 25 °C.
2. Ethanol determination: It is expressed as volume percent and is indirectly
estimated by multiplying the C0 2 weight loss in grams by a stoichiometric factor
of 1.3642 (12); see Note 3.
3.2. Flocculating Capacity at the End of Fermentation to Help
Clarification
1 . Sample conditions: When microfermentation is concluded (see Subheading 3.1.),
cells must be recovered by centrifugation. In order to disperse cells, they must be
washed twice with washing solution (Subheading 2.3., item 1), then twice with
bidistilled water; centrifuged and the supernatant discharged.
2. Determination of sedimentation volume: Ten milliliters of flocculation buffer
(Subheading 2.3., item 2) is measured into a 15-mL graduated (0.01-mL) centri-
fuge tube and 0.25 g (fresh weight) of the washed yeast is added. The yeast suspen-
sion is placed in a water bath at 20°C for 20 min. The suspension is then dispersed
by vortexing, and 10 min later the volume of deposited yeast is measured.
3. Supernatant cell concentration measurement: When flocculation is completed,
samples of the supernatant are taken and dispersed in washing solution (Sub-
heading 2.3., item 1). Cell concentration is determined spectrophotometrically
at 620 nm and expressed as percentage of total cell concentration (22).
3.3. Hydrogen Sulfide Production
1. Fermentation conditions: A single yeast colony (Subheading 2.1., item 1) is
seeded into 25 mL of propagation medium (Subheading 2.2., item 1) in a 1 25-mL
Erlenmeyer flask, incubated overnight with shaking at 250 rpm and at 30°C.
Enological Characteristics of Yeasts 303
Yeasts were subcultured to 2 x 10 6 cells/mL into 50 mL of inoculum medium
(Subheading 2.2., item 2) in 250 mL baffled Erlenmeyer flasks and incubated
with shaking (250 rpm) to the early stationary phase. This culture serves as
inoculum for fermentation trials (5 x 10 6 cells/mL). The fermentation progress is
monitored by C0 2 weight loss at 24-h intervals.
2. Trapping of hydrogen sulfide: An Erlenmeyer flask (500 mL) with 300 mL of
inoculated fermentation medium (Subheading 2.2., item 5) is fitted with H 2 S
traps. Trapping is conducted in the dark to avoid photo-oxidation of CdS in the
trap. A separate trap is used to each flask. This trapping assembly allows mea-
surement of total H 2 S produced during a given time period. Traps are replaced at
24-h intervals (20,24); see Note 4.
3. Hydrogen sulfide determination: The H 2 S content of the samples is immediately
analyzed colorimetrically (672 nm). H 2 S formation is calculated from a standard
curve (see Note 5).
3 A. Killer Factor or Resistance to Killer Toxins
Assay for killer and sensitive phenotype: Strains to be tested for sensitivity
(Subheading 2.1., item 1) are grown for 24-h on YEPD-agarized medium
(Subheading 2.2., item 1). Then, 10 5 cells (determined spectrophotometri-
cally) are suspended in 1 mL of sterile water and mixed with 19 mL of molten
media (Subheading 2.2., items 9 and 10). The suspension is poured into a
Petri dish and the agar is allowed to solidify. The plate is streaked with the
reference killer yeast strain (Subheading 2.1., item 2) and incubated at 20°C
for 72 h. A positive killer reaction (that means that the lawn yeast is sensitive)
is recorded in those cases where an evident and clear zone of inhibition
surrounded the streak on the plate. In a similar way but using a sensitive yeast
strain (Subheading 2.1., item 3) lawn as a reference, a potential killer yeast may
be tested.
3.5. Ability to Start Fermentation in High Ethanol Concentrations,
Low Temperatures, High Sugar Concentration, and Sulfur
Dioxide Resistance
These four desirable characteristics are screened with a similar methodology.
For this reason, they are grouped in this section.
1. S0 2 resistance: Ten milliliters of the medium (Subheading 2.2., item 6) with
25 mg/L of S0 2 is inoculated with 10 6 viable cells (Subheading 2.1., item 1)
from an overnight culture in inoculum medium (Subheading 2.2., item 3). Tubes
are overlaid with vaseline-paraffin that solidify immediately, incubated at 25-30°C
and was checked every 24 h for C0 2 production. Assays are recorded as positive
when the vaseline-paraffin overlay is displaced (see Note 6). Yeasts from positive
tubes are used to inoculate higher S0 2 concentrations (25).
304 Vazquez, Figueroa, and Toro
2. Ability to start fermentation at 30°Brix: Ten-milliliter aliquots of grape-must
medium (Subheading 2.2., item 7) are inoculated (10 6 cells/mL) with cells grown
overnight in 13°Brix medium. Tubes are overlaid with the vaseline-paraffin
mixture. Fermentation is followed in the same way, for 5 d, as was described in
Subheading 3.3., step 1).
3. Ability to start fermentation in the presence of 8-12% ethanol: Aliquots of
medium (Subheading 2.2., item 8), adjusted with ethanol to the desired concen-
trations, are seeded with cells cultured as was described. The C0 2 production is
evaluated by displacement of vaseline-paraffin overlay.
4. Fermentation at low temperature: This is determined in a similar way. If fermen-
tation at 4°C is assayed, it must be checked at 24-h intervals for 10 d (see Note 7).
4. Notes
1 . In all experiments, the proposed commercial concentrated musts may be replaced
by filter-sterilized fresh must of the available grape variety. In the specific case
of this experiment, if fresh must is used, it may be improved with glucose to the
required concentration.
2. If this test is used for the selection of sherry wine yeasts, concentration of the
grape juice has to be adjusted to 14.5% v/v of ethanol (26).
3. With the results obtained in this experiment it is possible to calculate the follow-
ing: fermentation vigor (FV), which indicates the maximum ethanol yield (as %
v/v) that a yeast strain can produce by fermentation in the presence of a sugar
excess; and fermentation rate (FR), calculated as the amount of C0 2 produced
after 3 d of fermentation (C0 2 /d). If volatile acidity (g acetic acid/L) is analyzed,
fermentation purity (FP) can be evaluated. It indicates the amount of volatile
acidity formed in relationship to ethanol produced (g volatile acidity/L percent of
ethanol [v/v]), (12).
4. New micropipets must be fitted at the time trap tubes are changed, because the
used micropipets frequently contain precipitated CdS.
5. Production of H 2 S may be assayed qualitatively by the blackening of lead acetate
paper (1).
6. Despite the fact that tests grouped in this section are qualitative, the moment
when the displacement of the vaseline-paraffin overlay occurs should be recorded
(first day, second day, etc.).
7. There is a general agreement that the production of floral or fruity wines demands,
among other things, a fermentation temperature of 15°C or lower. Nevertheless,
the temperature considered low by different authors varies from 7°C to 15°C,
depending on the grape variety and the different kind of winemaking process
(18,19,27).
References
1. Romano, P., Suzzi, G., Comi, G., Zironi, R., and Maifreni, M. (1997) Glycerol and
other fermentation products of apiculate wine yeasts. /. Appl. Microbiol. 82, 615-6 18.
Enological Characteristics of Yeasts 305
2. Ciani, M. andPicciotti,G. (1995) The growth kinetics and fermentation behaviour
of some non-Saccharomyces yeast associated with wine making. Biotechnol. Lett.
17, 1247-1250.
3. Martini, A. and Vaughan-Martini, A. (1989) Grape must fermentation: past and
present, in Yeast Technology (Spencer, J.F.T. and Spencer, D.M., eds.), Springer-
Verlag, New York, pp. 105-123.
4. Constant!, M., Reguant, C, Poblet, M., Zamora F., Mas, A., and Guillamon, J. M.
(1998) Molecular analysis of yeast population dynamics: effect of sulphur dioxide
and inoculum on must fermentation. Int. J. Food Microbiol. 41, 169-175.
5. Bull OIV (1995) 69, 789-790.
6. Degree, R. (1993) Selection and commercial cultivation of wine yeast and
bacteria, in Wine Microbiology and Biotechnology (Fleet, G. H., ed.) Harwood
Academic Publishers, Grey, Switzerland, pp. 421-447.
7. Fleet, G. H. (1990) Growth of yeast during wine fermentation. /. Wine Res. 1,
211-223.
8. Pretorius, I. S. and van der Westhuizen, T. J. (1991) The impact of yeast genetics and
recombinant DNA technology on the wine industry. S. Afr. J. Enol. Vitic. 12, 3-31.
9. Colagrande, O., Silva, A., and Fumi, M. D. (1994) Recent applications of biotech-
nology in wine production. Biotechnol. Prog. 10, 2-18.
10. Ubeda, J., Briones, A. I., Izquierdo, P., and Palop, L. I. (1995) Predominant
Saccharomyces cerevisiae strains in the fermentation of Airen grape musts with
S0 2 . Food Sci. Technol. 28, 584-588.
11. Romano, P. and Suzzi, G. (1993) Sulphur dioxide and wine microorganisms in
Wine Microbiology and Biotechnology (Fleet, G. H., ed.) Harwood Academic
Publishers, Grey, Switzerland, pp 373-393.
12. Ciani, M. and Maccarrelli, F. (1998) Oenological properties of non-Saccharomyces
yeasts associated with wine-making. World J. Microbiol. Biotechnol. 14, 199-203.
13. Alexandre, H., Rousseaux, I., and Charpentier, C. (1994) Relantionship between
ethanol tolerance, lipid composition and plasma membrane fluidity in Saccharo-
myces cerevisiae and Kloekera apiculata. FEMS Microbiol. Lett. 124, 17-22.
14. Benitez, T., del Castillo, L., Aguilera, A., Conde, J., and Cerda-Olmedo, E. (1983)
Selection of wine yeasts for the growth and fermentation in the presence of ethanol
and sucrose. Appl. Environ. Microbiol. 45, 1429-1436.
15. da Silva, G. A. (1996) The occurrence of killer, sensitive, and neutral yeasts in
Brazilian Riesling Italico grape must and the effect of neutral strains on killing
behaviour. Appl. Microbiol. Biotechnol. 46, 1 12-121.
16. Hidalgo, P. and Flores, M. (1994) Occurrence of the killer character in yeasts
associated with Spanish wine production. Food Microbiol. 11, 161-167.
17. Vazquez, F. and Toro, M. E. (1994) Occurrence of killer yeasts in Argentine
wineries. World J. Microbiol. Biotechnol. 10, 358-359.
18. Subden, R. E. (1987) Current developments in wine yeasts. CRC Biotechnol. 5, 49-65.
19. Kishimoto, M., Oshida, A., Shinohara, T., Soma, E., and Goto, S. (1994) Effect of
temperature on ethanol productivity and resistance of cryophilic wine yeasts.
/. Gen. Appl. Microbiol. 40, 135-142.
306 Vazquez, Figueroa, and Toro
20. Jiranek, V., Langridge, P., and Henschke, P. A. (1995) Regulation of hydrogen
sulphite liberation in wine-producing Sac char omyces cerevisiae strains by
assimilable nitrogen. Appl. Environ. Microbiol. 61, 461-467.
21. Mota, M. and Soares, E. V. (1994) Population dynamics of flocculating yeasts.
FEMS Microbiol. Rev. 14, 45-52.
22. Sieiro, C, Reboredo, N. M., and Villa, T. (1995) Flocculation of industrial and
laboratory strains of Sac char omyces cerevisiae. J. hid. Microbiol. 14, 461-466.
23. Cubells Martinez, X., Narbad, A., Carter, A. T. and Stratford, M. (1996) Floccu-
lation of the yeast Candida famata (Debary omyces hansenii): an essential role for
peptone. Yeast 12, 415-423.
24. Thomas, C. S., Boulton, R. B., Silacci, M. W., and Gubler, W. D. (1993) The
effect of elemental sulphur, yeast strain and fermentation medium on hydrogen
sulphide production during fermentation. Am. J. Enol. Vide. 44, 211-216.
25. Parish, M. E. and Carroll, D. E. (1987) Fermentation characteristics of Saccharo-
myces cerevisiae isolates from Vitis rotundifolia grapes and musts. Am. J. Enol.
Vitic. 38, 45-48.
26. Martinez, P., Perez Rodriguez, L., and Benitez, T. (1997) Velum formation by
flor yeasts isolated from sherry wine. Am. J. Enol. Vitic. 48, 55-62.
27. Kishimoto, M., Soma, E., and Goto, S. (1994) Classification of cryophilic wine
yeasts based on electrophoretic karyotype, G+C and DNA similarity. /. Gen. Appl.
Microbiol. 40, 83-93.
28. Reed, G. and Nagodawithana, T. W. (1988) Technology of yeast usage in wine-
making. Am. J. Enol. Vitic. 39, 83-89.
29. Thornton, R. J. (1991) Wine yeast research in New Zealand and Australia. CRC
Biotechnol. 11, 327-345.
30. Romano, P., Suzzi, G., Turbanti, L., and Polsinelli, M. (1994) Acetaldehyde
production in wine yeast. FEMS Microbiol. Lett. 118, 213-218.
34
Utilization of Native Cassava Starch by Yeasts
Lucia I. C. de Figueroa, Laura Rubenstein, and Claudio Gonzalez
1. Introduction
Cassava (Manihot esculenta) is a root crop of tropical American origin and
is the fourth most important staple crop in the tropics. In the developing world,
it is surpassed only by maize, rice, and sugarcane as a source of calories;
cassava's starchy roots produce more food energy per unit of land than any
other staple crop. Cassava is grown almost exclusively in the arid and semiarid
tropics, where it accounts for approximately 10% of the total caloric value of
staple crops. The cassava plant is extremely robust, is resistant to disease and
drought, and can grow in relatively low-quality soils (1).
This staple crop has many favorable characteristics, some of them are as
follows: Cassava is well adapted to marginal soils (low fertility, high acidity)
on which most other crops fail; cassava has the ability to tolerate environmen-
tal stress (drought), pest and disease attacks and to recover readily; compared
to other staple crops, it gives relatively high yields and is an excellent source of
carbohydrate; harvesting of cassava roots can take place from 6 to 36 mo after
planting, thus providing the farmer with a permanent source of food (I).
Different types of cassava satisfy a range of needs. There are early-maturing
varieties and late -maturing varieties. There are giant-size cassava and pygmy
types. There are also sweet cassavas and bitter ones to taste. Cassava roots are
used as pig meal, as fuel, and also for brewing beer.
Part of the total world cassava production (about 22%) is incorporated into
animal feed. A similar amount is converted into starch for industrial use and
another portion to human food in some developing countries. In addition, new
high-yielding varieties of cassava, with outputs of 100 ton/ha could provide
the fermentation industry with an abundance of raw material (2).
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
307
308 Figueroa, Rubenstein, and Gonzalez
Cassava starch is composed of unbranched amylose (20 ± 5%) and branched
amylopectin (80 ± 5%), both of which can be hydrolyzed acidically or
enzymatically (either with pure enzymes or amylase-producing microorganisms)
to release their constituent glucose and maltooligosaccharides. Both products are
easily transported across the cell membrane and metabolized by yeasts (3).
The ability to hydrolyze starch is reasonably widely distributed among the
different genera and species of yeasts. Several laboratories around the world
have been involved in recent years in the construction, isolation and/or
evaluation of amylolytic yeast strains (Table 1). A major thrust of this work
has been toward generating some amylolytic capability in situ during the
fermentation stages of the processes. The advantage are those relating to: a
reduced need to purchase or produce in separate process amylolytic enzymes,
simplification of the processing stages that precede fermentation, improved
efficiencies of starch conversion, and the possibility of producing amylolytic
enzymes or the glucose released from the starch molecule for use in syrup
manufacture, as by-products of alcohol fermentation (4,5), or for obtaining a
medium suitable for production of oenological yeasts.
The degradation products of starch are mainly used as basic carbohydrate
sweeteners in the food industry. The extensive fermentation pattern revealed
that during the fermentation of cassava starch by the fungus Rhizopus
oligosporus or by the yeast Endomycopsis fibuligera, a higher concentration of
glucose accumulation can be obtained (6,7).
Enzymatic hydrolysis of raw starch at ambient temperatures without cooking
has a tremendous economic advantages over high-temperature methods.
Uncooked raw cassava starch can be hydrolyzed to glucose by amylolytic yeast
enzymes. The amylolytic fermentative yeasts (Table 1) produce extracellular
amylases (a-amylase, amyloglucosidase) and can utilize soluble or raw starch
as the sole carbon source.
Cassava tubers, contain about 3% protein (dry basis), and their leaves yield
5-10 tons/ha dry matter, of which about 25% is good quality protein. This
protein could either be extracted and purified for human consumption or fed
directly to animals.
The use of cassava as a feedstock for single-cell protein (SCP) in developing
countries would have social and macroeconomic as well as technical advantages,
as its cultivation on a large scale would provide much-needed rural employment.
Also, export of the finished SCP to developed countries could be a large earner of
foreign currency (8). The sugars formed by the amylolytic organisms in the cassava
starch can be used as substrates for the generation of microbial biomass rich in
protein. Mixed cultures of yeasts for the production of SCP have already been used
elsewhere, with the Symba process being used commercially in Sweden. It is also
possible to treat the cassava starch for SCP production by submerged fermentation
of two organisms Endomycopsis fibuligera and Candida utilis (9).
Utilization of Cassava Starch by Yeasts
309
Table 1
Amylolytic Yeasts
Genera and species
Amylolytic enzymes
a-Amylases Glucoamylases Debranching Ref.
Candida tsukubaensis ;
now Pseudozyma
tsukubaensis (12)
Lipomyces kononenkoae
Lipomyces star key i
Endomycopsis capsularis',
now Saccharomycopsis
capsularis (12)
En domycopsis fibuligera ;
now Saccharomycopsis
fibuligera (12)
Schwanniomyces castelli.,
S. alluvius,
or S. occidentalis;
now Debaryomyces
occidentalis (12)
Pic Ida burtonii
Saccharomyces diastaticus;
now Saccharomyces
cerevisiae var
diastaticus (12)
Candida edax;
now Stephanoascus
smithiae (12)
\ a
\ a
\ a
V
1
1
\ a
V
V
l a
V
2
2
\ a
4 b
21,22
Transferase
23
24
25
26,27
Glucoamylases 28,29
26
30-33
\ a
34
a They produce at least one type of each enzyme.
h Three unlinked genes STA (1-3) and SGA 1 (specific glucoamylase for sporulation).
In the present chapter, we will describe five aspects of the utilization of
native cassava starch by yeasts: (1) Isolation and screening of amylolytic yeasts
from agricultural and industry starch residues, (2) a new method of screening
and differentiation of amylolytic enzymes from yeast strains, (3) ethanol
production from native cassava starch by mixed culture using amylolytic yeasts
and bacteria, (4) hydrolysis of native cassava starch using amylolytic yeast
enzymes for application to enological yeast production and (5) fusion of
yeast protoplasts and isolated nuclei of filamentous fungi.
310 Figueroa, Rubenstein, and Gonzalez
2. Materials
Agricultural and industry starch residues, as cassava roots, starch factory
effluents, potato-processing wastewater, and so forth and as substrates for the
isolation and screening of amylolytic yeasts.
2. 1. Strains
1 . Yeast strains for screening and differentiation of amylolytic enzymes (see Note 1).
2. Use of an amylolytic yeast and a bacteria strain for ethanol production by mixed
culture (see Note 2).
3. Use of enological yeast when using hydrolyzed cassava starch as culture medium,
and amylolytic yeasts for hydrolyzing native cassava starch (see Note 3).
4. When fusing yeast protoplasts and isolated filamentous fungi: yeast strains and
filamentous fungi have to be used (e.g., strains of Aspergillus, Rhizopus,
Aureobasidium, etc.) (see Note 4).
2.2. Media
1. General isolation medium: YM broth (Difco), pH 5.0, and the same YM broth
acidified to pH 3.5.
2. Medium for isolation of amylolytic yeasts: 5 g/L yeast extract, 20 g/L cassava
flour starch, 0.03 g/L rose bengal, 10 \ig/mL erythromycin, 150 jag/mL ampicil-
lin, and 20 g/L agar; pH 3.5.
3. Preparation of a-amylase-resistant starch (a-RS) medium for isolation of
amylolytic yeasts: Two hundred grams of wheat starch is simultaneously gelati-
nized and liquefied at 80°C in 1 L of 2 mM CaCl 2 with 1000 U of commercial
a-amylase. Then, the solution is cooled and incubated with more 1000 U of
a-amylase preparation for 3 h at 55°C. The resulting insoluble material is
collected, washed several times with water by centrifugation (8000g, 15 min),
and then lyophilized; yield is approx 5% (see Note 5).
Basal medium for isolation and selection with a-RS: 5 g/L a-RS, 1.0 g/L
NH4NO3, 1.4 g/L KH 2 P0 4 , 0.5 g/L CaCl 2 , 0.2 g/L MgS0 4 -7H 2 0, 0.05 g/L
chloramphenicol, and 0.1 g/L yeast extract; pH 5 (10).
4. Culture medium for screening and differentiation of amylolytic enzymes: 20 g/L
yeast extract, 20 g/L starch, and 20 g/L agar in 10 mM acetate buffer; pH 4.5.
5. Yeast inoculum medium for mixed cultures: 10 g/L yeast extract, 20 g/L peptone,
50 g/L Lintner starch (YEP-starch medium); pH 4.5.
6. Bacteria inoculum medium for mixed cultures: 10 g/L yeast extract, 1 g/L
NH 4 (S0 4 ) 2 , 1 g/L KH 2 P0 4 , 1 g/L MgS0 4 -7H 2 0, 100 g/L glucose, RMG medium;
pH 5.6 (see Note 6).
7. Fermentation media for mixed cultures: They have to be prepared by replacing
the glucose in RMG with different concentrations of native cassava flour (e.g.,
50, 100, or 150 g/L, w/v); pH 6.2. Media are sterilized for 15 min at 121°C.
8. Medium for production of amylolytic enzymes: 2 g/L NH 4 (S0 4 ) 2 , 2 g/L KH 2 P0 4 ,
0.5 g/L MgS0 4 -7H 2 0, 4 g/L yeast extract, 20 g/L starch; pH 5.0.
Utilization of Cassava Starch by Yeasts 311
9. Basal cassava starch-hydrolyzed medium: It is obtained by adding 150 g/L of
cassava flour into the amylolytic yeast culture.
10. Cultivation medium for filamentous fungi, Czapek's: 3.0 g/L NaN0 3 , 1.0 g/L
K 2 HP0 4 , 0.5 g/L MgS0 4 , and 0.01 g/L FeS0 4 , with 50 g/L glucose.
1 1 . Regeneration medium for recovery of fusion products: 10 g/L Czapek's medium
plus starch, 2 g/L yeast extract, 0.6 M KC1, and 30 g/L agar.
12. Selective medium for fusion products: 10 g/L Czapek's medium plus cassava
raw starch, 2 g/L yeast extract, 0.6 M KC1, and 20 g/L agar.
2.3. Solutions
1. Solution for enzymatic activity assay: lOg/L starch, in 10 mM acetate/acetic acid
buffer (pH 4.5) and 20 g/L 3,5-dinitrosalycilic acid (DNS), in 1 NNaOH solution
(DNS reagent).
2. Pretreatment solution for protoplast formation from fungal mycelium: 0.01 M
dithiothreitol (DTT) in citrate-phosphate buffer pH 7.3.
3. Osmotic stabilizer solution for protoplast formation from fungal mycelium:
citrate-phosphate buffer pH 5.8 with 0.7 M KC1, as an osmotic stabilizer.
4. Enzyme solution for protoplast formation from fungal mycelium: citrate-phos-
phate buffer (pH 5.8) containing 0.7 M KC1 and 7 mg/mL of Novozyme 234
(Novo Biolab, Denmark). KC1 is added as an osmotic stabilizer.
5. Solution for lysing filamentous fungi protoplasts: 180 g/LFicoll, 20 mMKH 2 P0 4 ,
0.5 mM Ca 2+ , ImM phenylmethylsulfonyl fluoride (PMSF); pH 6.5.
6. Solution for purifying filamentous fungi nuclei: 70 g/L Ficoll, 20 mM KH 2 P0 4 ,
0.5 mM Ca 2+ , ImM PMSF, 1 M sorbitol, and 200 g/L glycerol.
7. Fusion mixture solution for fusing yeast protoplasts with nuclei of filamentous
fungi: 300 g/L polyethylene glycol 4000 (average molecular weight 3300-4000)
in 10 mM CaCl 2 solution.
2.4. Zymograms
Polyacrylamide gels for electrophoresis (PAGE). Solutions: 10 g/L starch
(pH 4.5) and Lugol solution.
3. Methods
3. 1. Isolation and Screening of Amylolytic Yeasts from
Agricultural and Industry Starch Residues
1 . Isolation and Identification using YM broth. Samples of 5-10 g are obtained and
transported in sterile plastic bags. The samples are suspended in 50 mL of YM
medium (Subheading 2.2., item 1.) diluted 1:10 with sterile water containing
1 g/L Tween-80 (11). After shaking 60 min at 25°C, the suspension is poured
into sterile culture tubes and stored overnight at 4°C. Most of the supernatant is
discarded, and the remaining (about 2 mL) is shaken in order to resuspend the settled
312 Figueroa, Rubenstein, and Gonzalez
cells. This suspension is streaked on acidified YM agar. The inoculated plates are
incubated at 25°C, and after 3, 5, and 12 d, well-isolated colonies are transferred on
YM agar until growth is observed. Colonies are restreaked and picked on selective
medium with cassava flour starch as the sole carbon source (Subheading 2.2., item
2.) and incubated at 30°C until growth occurred (see Note 7).
The yeast strains are identified according to their carbohydrate and nitrogen
assimilation patterns, using the keys and description in ref. 12 and the computer-
ized yeast identification program devised by Barnett, Payne, and Yarrow.
2. Isolation and identification using basal medium with ct-RS. Samples are
suspended in sterilized water and then 1 drop of each supernatant obtained on
centrifugation is added to 5 mL of the medium (Subheading 2.2., item 3.) in a
test tube. After shaking the tubes at 30°C for 1-3 d, 1 drop of the culture in each
tube is spread on the medium solidified with 2% agar in Petri dishes, and incu-
bated for 1-3 d. The colonies producing large "halos" are picked up and purified
by streaking on selective medium with cassava flour starch as sole carbon source.
3. Enzyme determinations. Enzymatic extracellular amylolytic activity is deter-
mined by the DNS method (see Note 8). The reaction mixture contains 100 fiL of
supernatant obtained from samples of one culture centrifuged 5 min at 5000g,
and 400 ^iL of the solution for enzymatic activity (Subheading 2.3., item 1). The
mixture is incubated 15 min at 45°C. The reaction is stopped by adding 770 fiL
of DNS reagent, and the reducing sugars released are determined at 590 nm (13).
One unit of enzyme is defined as the amount that liberates 1 jLimol of reducing
sugars per minute per milliliter.
3.2. New Method of Screening and Differentiation of Amylolytic
Enzymes from Yeast Strains
1 . Culture conditions and recovery of the crude extracts. Yeasts are cultured in Petri
dishes (with the medium described in Subheading 2.2., item 4) 48 h at 30°C.
Once the colonies appear, they are scraped off and samples of agar of 1 cm
diameter of each colony are taken. The agar is cut in small pieces and put into
Eppendorf tubes. Samples are frozen at -20°C for 4-6 h and the supernatant is
recovered by centrifugation for 10-15 min.
2. Enzymatic activity assays. Extracellular activities are determined by recovering
of the supernatants. Amylolytic activity of yeasts is determined using the method
in Subheading 3.1., step 3.
The extracellular amylolytic activity is determined by measuring the reducing sugar
groups released from starch by a colorimetric method, based on the reduction of
3,5-dinitrosalicylic acid. One unit of enzyme activity is defined as the amount that
liberates 1 fimol of reduced group per minute per milliliter of enzyme sample.
3. Zymograms. The polyacrylamide gel electrophoresis (PAGE) is done according
to Davis (14). Enzymatic activity is detected in the PAGE gels by zymographic
techniques. To detect amylolytic activity, the gels are incubated in the starch
solution (Subheading 2.4.) for 4 h. Gels are stained with Lugol solution and the
amylolytic activity zones are detected by the presence of clear areas on the blue
gel (see Note 9).
Utilization of Cassava Starch by Yeasts 313
3.3. Ethanol Production from Native Cassava Starch by Mixed
Culture Using Amylolytic Yeasts and Bacteria
1 . Inocula. Yeast strain is incubated for 16 h at 30 °C in YEP-starch medium (Subhead-
ing 2.2., item 5). The bacteria strain is grown in RMG medium (Subheading 2.2.,
item 6.) for the same period, see Note 6. The cultures have to be centrifuged 5 min at
5000g, and the pellets (about 0.14 g of dry biomass) are resuspended in water (2 mL
final volume) and used as the inoculum.
2. Fermentation assays. They are performed in 500 mL Erlenmeyer flasks contain-
ing 200 mL of medium (Subheading 2.2., item 7), at 30°C on a rotary shaker at
200 rpm. The culture is shaken in order to ensure its homogeneity because of the
high viscosity of the medium containing native cassava starch (see Note 10).
3. Analytical and enzymatic determinations. Growth can be determined by optical
density measurements at 660 nm. Starch is determined as follows: To 1 mL of sample,
1 mL of 1 M HC1 was added. The mixture is boiled for 45 min and then neutralized
with 1 mL of 1 M NaOH solution (75). The reducing sugars released are measured
colorimetrically using the 3,5-dinitrosalycilic acid (DNS) method (13).
Glucose can be measured enzymatically using a glucose-oxidase-peroxidase
method. Ethanol can be determined in a previously distilled sample using an
immersion refractometer.
The enzymatic extracellular amylolytic activity is determined by the DNS
method. Amylolytic activity of yeasts is determined using the method described
in Subheading 3.1., step 3. One unit of enzyme is defined as the amount that
liberates 1 umol of reducing sugars per minute per milliliter.
3A. Hydrolysis of Native Cassava Starch Using Amylolytic Yeast
Enzymes; Application to Enological Yeast Production
Fermentation assays. Batch cultures are done using the medium described in
Subheading 2.2., item 8. for obtaining yeast biomass and hydrolyzed cassava
flour. It is better to use a fermentor, and the optimum adequate conditions are
450 rpm, 30°C for 12-24 h, according to the yeast strain used (see Note 11).
After that, this culture with the hydrolyzed cassava flour (Subheading 2.2.,
item 9.) must be sterilized in order to destroy the amylolytic yeast cells.
Enological yeasts propagation is done using the sterilized hydrolyzed
cassava starch as culture medium. Enological properties are evaluated by
microvinifications .
3.5. Fusion of Yeast Protoplasts and Isolated Nuclei of
Filamentous Fungi
1. Protoplasts formation from fungal mycelium. Cultures of filamentous fungi are
grown in Czapek's medium with 50 g/L glucose as the carbon source (Subhead-
ing 2.2., item 10). These flasks are inoculated with 1 x 10 6 fungal spores/mL and
314 Figueroa, Rubenstein, and Gonzalez
incubated for 18 h at 30°C in a rotary shaker operated at 200 rpm. The mycelium
is recovered by filtration and washed three times with sterile water.
Washed mycelium is resuspended in the pretreatment solution (Subheading 2.3.,
item 2) and incubated for 1 h at 30°C without agitation. The mycelium is then
filtered through filter paper and has to be washed three times with the osmotic
stabilizer solution (Subheading 2.3., item 3). The biomass is resuspended in the
enzyme solution (Subheading 2.3., item 4). The suspension is incubated at 30°C
with agitation at 100 rpm for 4-5 h. Protoplast formation should be monitored
under a phase-contrast microscope. The protoplasts suspension is filtered through a
filtration device to remove the remaining mycelium and other debris and washed
three times with the osmotically stabilized solution (16,17).
2. Isolation of fungal nuclei. Filamentous fungi nuclei are isolated by differential cen-
trifugation of suspensions of lysed protoplasts in Ficoll solutions at 4°C as follows:
a. Protoplasts are lysed in the solution for lysing (Subheading 2.3., item 5).
This solution lyses the protoplasts but not the nuclei that remain intact.
b. Nuclei suspension is treated with the solution for purifying the nuclei
(Subheading 2.3., item 6).
The final purified pellet of nuclei is resuspended in 0.5 mL of the solution for
purifying, and the nuclei should be used immediately for fusion with yeast proto-
plasts. Isolated nuclei should be stained with 4',6-diamino-2-phenylindole (DAPI)
and observed using fluorescence microscopy (16,17).
3. Fusion of yeast protoplasts with nuclei of filamentous fungi. Yeast protoplasts
are obtained by standard methods. Protoplasts are resuspended in 0.5 mL of a
0.4-M CaCl 2 solution, mixed with the suspension of nuclei and centrifuged at
12,000g for 10 min. The supernatant is discarded and the pellet is resuspended in
the fusion mixture solution (Subheading 2.3., item 7). The suspension is incu-
bated at 25°C for 10 min (16,17).
4. Regeneration of the fusion products. The fusion mixture is added to the
osmotically stabilized, melted regeneration medium (Subheading 2.2., item 11)
at 42°C, mixed, poured as an overlay on a base of the same osmotically stabilized
regeneration medium, and allowed to harden. Plates are incubated at 30°C for
4-5 d until yeastlike colonies appear. These colonies are transferred to selective
medium (Subheading 2.2., item 12) for isolation and characterization of the
desired fusion products. Yeastlike colonies growing on the selective medium have
to be selected (16,17) (see Note 12).
4. Notes
1. Screening and differentiation of amylolytic enzymes from yeast strains should be
done by using yeasts that grow in media with starch as sole carbon source (Table 1).
2. It is necessary to use amylolytic yeast strains, better those that produce cc-amy-
lase as well as glucoamylase (Table 1) in order to hydrolyze native cassava starch,
and, for example, Zymomonas mobilis, an efficient ethanol producing aerotolerant
Gram-negative bacterium (18).
Utilization of Cassava Starch by Yeasts 315
3. It is necessary to use amylolytic yeast strains that produce a-amylase as well as
glucoamylase in order to hydrolyze native cassava starch (Table 1).
4. In order to use filamentous fungi as a-amylases or glucoamylases donor strains,
the best ones are Aspergillus oryzae and Aspergillus niger. Taking into account
that the starch molecules to hydrolyze are from cassava, it is important also use
strains such as Aureobasidium pullulans as the donor strain. This fungus produce
the enzyme pullulanase with a very good debranching activity.
5. cc-amylase-resistant-starch (a-RS) is a helical inclusion complex between short-
chain amylose (degree of polymerization approximately 90) and lipid, similar to
the complex between amylose and /z-butanol (10).
6. RMG medium is specific for Z. mobilis, one of the best ethanol-producing bacte-
ria, and for this reason, it is recommended to use this microorganism for ethanol
production using a mixed culture from native cassava starch (7).
7. When colonies appear on the starch plates, they have to be refrigerated at 0-4°C
for 3-4 d, in order to observe "halos" visible of hydrolysis of the starch around
the colonies.
8. Amylolytic enzymes should be measured colorimetrically using the 3,5-dini-
trosalycilic acid (DNS) method (13).
9. The zymographic profiles obtained from solid-media crude extracts are compa-
rable with those obtained after precipitating liquid media with acetone. The
described technique permits the differentiation of different amylolytic enzyme
activities. With this technique it is possible to differentiate strains of microorgan-
isms with the same enzymatic amylolytic activity from their own zymographic
profiles at the initial screening.
The methodology described with the aim of recovering crude extracts from solid
media allows the evaluation of numerous samples and the identification of
amylolytic enzymes in a very simple and rapid way. This procedure can be used
as a routine screening method without any special equipment. It also allows for
the preliminary characterization of the strains of microorganisms by their
zymographic profile (19).
10. If amylolytic strains of E.fibuligera and Z. mobilis are used, the inocula have to be
prepared as follows: E.fibuligera has to be incubated for 16 h at 30°C in a 250-mL
shaken flask (200 rpm) containing 100 mL of YEP-starch. Z. mobilis has to be
grown in RMG without agitation, for the same time and the same temperature. The
cultures have to be centrifuged for 5 min at 5000g and the pellets (about 0.14 g of
dry biomass) are resuspended in water, 2 mL final volume, and used as inoculum.
1 1 . Endomycopsis fibuligera is an adequate amylolytic yeast strains for this purpose.
With this strain, it is possible to obtain a complete cassava flour hydrolyzed in
12 h (20). The culture medium described is very suitable and cost-effective for
enological yeasts production.
12. Fusion of yeast protoplasts either with nuclei from other yeast strains or with
nuclei from unrelated organisms has been known to be feasible for some time. In
the case we are discussing, viable nuclei are isolated from the donor strain and
fused in the conventional manner with protoplasts from the recipient yeast strain.
316 Figueroa, Rubenstein, and Gonzalez
The fusion of yeast protoplasts with fungal nuclei is a useful technique to improve
the methods of transferring genetic information between strains, especially those
that are dissimilar or distantly related.
References
1. Komen, J. (ed.) (1990) Cassava and Biotechnology, Proceedings of a Workshop,
Directorate General for International Cooperation, The Hague, Amsterdam.
2. Ejiofor, A. O., Chisti, Y., and Moo-Young, M. (1996) Culture of Saccharomyces
cerevisiae on hydrolyzed waste cassava starch for production of baking-quality
yeast. Enzyme Microb. Technol. 18, 5 19-525.
3. Kristiansen, A. (1994) Integrated design of a plant, in The Production of Baker' s
Yeast, VCH Verlagsgesellschaft, Weinheim, Germany, p. 21.
4. Tubb, R. S. (1986) Amylolytic yeasts for commercial applications. Tibtech, April,
98-104.
5. Spencer, J. F. T. and Spencer, D. M. (1997) Taxonomy: the name of the yeasts, in
Yeasts in Natural and Artificial Habitats (Spencer, J. F. T. and Spencer, D. M.,
eds.), Springer-Verlag, Berlin, pp. 11-22.
6. Garg, S. K. and Doelle, H. W. (1989) Optimization of cassava starch conversion
to glucose by Rhizopus oligosporus. Nircen J. 5, 297-305.
7. Gonzalez, C, Delgado, O., Baigorf, M., Abate, C, de Figueroa, L. I. C, and
Callieri, D. A. (1998) Ethanol production from native cassava starch by a mixed
culture of Endomycopsis fibuligera and Zymomon las mobilis. Acta Biotech nol. 2,
149-155.
8. MacLennan, D. G. (1976) Single cell protein from starch: a new concept in protein
production. Search 7, 155-163.
9. Manilal, V. B., Narayanan, C. S., and Balagopalan, C. (1991) Cassava starch
effluent treatment with concomitant SPC production. World J. Microbiol.
Biotechnol.7, 185-190.
10. Bergmann, F. W., Abe, J., and Hizukuri, S. (1988) Selection of microorganisms
which produce raw-starch degrading enzymes. Appl. Microbiol. Biotechnol. 27,
443_446.
1 1 . Middelhoven, W. J. (1997) Identity and biodegradative abilities of yeasts isolated
from plants growing in an arid climate. Antonie van Leeuwenhoek 72, 81-89.
12. Kurtzman, C. P. and Fell, J. W. (1998) The Yeasts, a Taxonomic Study, 4th ed.
Elsevier Science, Amsterdam.
13. Miller, G. L. (1959) Use of dinitrosalicilic acid reagent for determination of
reducing sugars. Anal. Chem. 31, 426-428.
14. Davis, B. J. (1964) Ann. NY Acad. Sci. 121, 404-427.
15. Laluce, C. and Mattoon, J. R. (1984) Developments of rapidly fermenting strains
of Saccharomyces diastaticus for direct conversion of starch and dextrins to
ethanol. Appl. Environ. Microbiol. 48, 17-25.
16. Vazquez, F., Heluane, H., Spencer, J. F. T., Spencer, D. M., and de Figueroa,
L. I. C. (1997) Fusion between protoplasts of Pichia stipitis and isolated filamen-
tous fungi nuclei. Enzyme Microb. Technol. 21, 32-38.
Utilization of Cassava Starch by Yeasts 317
17. Heluane, H., Vazquez, F., and de Figueroa, L. I. C. (1998) Fusion of yeast proto-
plasts and isolated nuclei. Acta Biotechnol. 18, 353-359.
18. Swings, J. and De Ley, J. (1977) The biology of Zymomonas. Bacteriol. Rev. 41, 1-46.
19. Gonzalez, C, Martinez, A., Vazquez, F., Baigori, M., and de Figueroa, L. I. C.
(1996) New method of screening and differentiation of exoenzymes from indus-
trial strains. Bio technol. Tech. 10, 519-522.
20. Gonzalez, C., Vazquez, F., Toro, M. E., Baigori, M., and de Figueroa, L. I. C.
(1997) Hidrolisis de harina de mandioca empleando Endomycopsisfibuligera. Su
aplicacion en la produccion de levaduras de interes enologico. VII Mexican
Congress of Biotechnology and Bioengineering and II International Symposium
on Bioprocess Engineering, Mazatlan, Mexico.
2 1 . Onishi, H. (1972) Candida tsukubaensis sp. Antonie van Leeuwenhoek, 38, 365-367.
22. de Mot, R., van Oudendijck, E., and Verachtert, H. (1984) Purification and char-
acterization of an extracellular glucoamylase for the yeast Candida tsukubaensis
CBS 6389. Antonie van Leeuwenhoek 51, 275-287.
23. Spencer-Martins, I. and van Uden, N. (1979) Extracellular amylolytic system of the
yeast Lypomyces kononenkoae . Eur. J. Appl. Microbiol. Biotechnol. 6, 24-250.
24. Kelly, C. T., Moriarty, M. E., and Fogarty, W. M. (1985) Thermostable extracel-
lular a-amylase and a-glucosidase of Lipomyces starkeyi. Appl. Microbiol.
Biotechnol. 22, 352-358.
25. Soni, S. K., Sandhu, I. K., Bath, K. S., Banerjee, U. C., and Patnaik, P. R. (1996)
Extracellular amylase production by Sac char amy copsis capsularis and its evalu-
ation for starch saccharification. Folia Microbiol. 4, 243-248.
26. Sills, M. A., Panchal, Ch.J., Rusell, I., and Stewart G. G. (1987) Production of amy-
lolytic enzymes by yeasts and their utilization in brewing. CRC Biotechnol. 5, 105-1 16.
27. Futatsugi, M., Ogawa, T., and Fukuda, H. (1993) Purification and properties of
two forms of glucoamylase from Saccharomycopsis fibuligera. J. Ferment.
Bioeng. 6, 521-523.
28. Oteng-Gyang, K., Moulin, G., and Galzy, P. (1981) A study of the amylolytic
system of Schwanniomyces castellii. Z. Allg. Microbiol. 21, 537-544.
29. Ingledew, W. M. (1987) Schwaniomyces: a potential superyeast? CRC Biotechnol.
5, 159-176.
30. Tamaki, H. (1978) Genetic studies of ability to ferment starch in Sac char omyces'.
gene polymorphism. Mol. Gen. Genet. 164, 205-209.
31. Errat, J. A. and Stewart, G. G. (1978) genetic and biochemical studies on yeast
strains capable of utilizing dextrins. /. Am Soc. Chem. 36, 151-161.
32. Pretorius, I. S., Chow, T., Modena, D., and Marmur, J. (1986) Molecular cloning
and characterization of the STA2 glucoamylase gene of Saccharomyces
diastaticus. Mol. Gen. Genet. 203, 29-35.
33. Pugh, T. A., Shah, J. C, Magee, P. T., and Clancy, M. (1989) Characterization
and localization of the sporulation glucoamylase of Saccharomyces cerevisiae.
Biochem. Biophys. Acta 994, 200-209.
34. Moussa, E. and Baratti, J. (1988) Isolation and characterization of an amylolytic
yeast Candida edax. World J. Microbiol. Biotechnol. 4, 193-202.
V
Special Methods and Equipment
35
Reactor Configuration for Continuous Fermentation
in Immobilized Systems
Application to Lactate Production
Jose Manuel Bruno-Barcena, Alicia L. Ragout de Spencer,
Pedro R. Cordoba, and Faustino Siheriz
1. Introduction
There is great commercial interest in using immobilization technology for
fermentation processes. Microbial immobilization is one of the novel methods
in fermentation technology, especially important in the food and beverage
industry, which allows the use of increased cell concentrations in the bioreactor,
reducing process cycle times and increasing volumetric bioreactor productiv-
ity as compared with traditional batch and chemostat methods of fermentation.
Results from bioreactor studies have demonstrated that immobilized cells have
advantages over free cells, such as protection from toxic substances, increased
plasmid stability and increased catalytic activity (1). Because of these advan-
tages, methods employing immobilized microbial cells are used extensively in
many industrial applications.
In immobilized cell reactors, whole cells are fixed on a cheap artificial or
natural inert support while the substrate and products are continuously flowing
with the mobile phase. The methods and modes used for immobilized cell
systems include, among others, attachment by crosslinking agents, entrapping
in a polymer gel matrix and adsorption to a preformed support. The last system
allows better results than the others because of a continuous replacement of
senescent cells by new growth of intact cells in the biofilms that are naturally
produced and adsorbed to the support.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
321
322 Bruno-Barcena et al.
This chapter describes a method of immobilization by adsorption of whole
cells with emphasis on applying this technique to the production of lactic acid,
an important chemical for the food, agricultural, and pharmaceutical industries
(2), using adherent phenotypes of lactic acid bacteria.
2. Materials
1. Basal medium (MB) (3) medium: 10 g/L yeast extract, 0.05 g/L MgS0 4 -7H 2 0,
2.5 g/L (NH 4 ) 2 HP0 4 , and 0.005 g/L MnS0 4 -H 2 0. Glucose concentration can be
varied according to the experiment. Glucose and Mn 2+ must be autoclaved sepa-
rately (see Note 1).
2. Organism: Different strains of lactic acid bacteria may be used for lactic acid
production with immobilized cells (see Note 2).
3. Reactor: The reactor consists of a water-jacketed glass column (3.5 cm internal
diameter x 14 cm height) filled with the desired support material. The water-
jacketed reactor is connected to a temperature-controlled water bath. The column
must be provided with an external loop having a vessel equipped with a stirring
device, a pH electrode, and a pH control unit, through which the medium can be
continuously recycled in the reactor. A recycling ratio of 50:1 may be employed
using the same ascentional velocity (1.5 cm/min) in the reactors in all the assays.
Ammonium hydroxide ( 1 .5 M or higher) is used to control pH. The system can be
assembled according to the scheme in Fig. 1.
4. Pumps: The media is fed to the column using a variable-speed pump (Watson
Marlow 101 U/R). This pump is capable of delivering the medium at rates as low
as 0.001 mL/min using a 0.5-mm bore silicone tubing. Additional pumps are
used for withdrawing the spent broth and for recycling.
5. Supports: Different inert supports can be used for the immobilization of cells
(see Note 3):
a. Poraver®: Porous foam glass particles (having a mean diameter of 2-4 mm, a
porosity of 60%, and a density of 0.2 g/cm 3 (a gift from Dennert Poraver
GmbH, Postbawer Heng, Germany). Wash thoroughly with tap water, select
the beads without air bubbles inside, and dry at 150°C.
b. Polyurethane foam: This foam is used for domestic purposes and is widely avail-
able. The usual porosity is 91%. Cut blocks oflOxlOxlO mm, boil in water,
wash five times with distilled water, dry, and use to fill the reactors.
c. Luff a cylindrical This is another form of sponge also used as a bath sponge. Cut
into blocks and clean the pieces by boiling in water. Dry and use as support.
6. Solutions for lactate determination
• Buffer glycine-hydrazine (SIGMA).
• NAD (Yeast : N-7004 98%).
• L(+)-Lactate(L-1750 Sigma 95%).
• D(-)-Lactate (N-7004 Sigma 98%).
• L(+)-nLDH (Beef heart, 1000 units/mL).
• (-)-nLDH (L. leishmanii: L-3888 Sigma 300 U: 0.33 mL; 5.3 mg protein/mL;
290 U/mg protein).
Reactor Configuration for Continuous Fermentation
323
;k
Pump 1
Medium
Fig. 1 . Schematic diagram of the upflow packed-bed reactor. A, alkali; 1 , feed pump
for complete medium; 2, recycling pump; 3, alkali pump; C, pH controller; F, air filter;
IC, heat exchanger; L, external pH controller device; M, sampling port; R, reactor;
P, pH electrode.
3. Methods
3. 7. Variables to Determine
The kinetic and yield parameters can be evaluated by the classical chemostat
equations; for this reason, it is necessary to know the different volumes in the
reactor.
1. Active volume of reactor. To determine the active volume, the support material
is placed in the interior of the reactor without empty zones to obtain good packing
bed. The active volume will be the volume of water that is fed through the bottom
of the reactor from a graduated device such as a buret with appropriated connec-
tions that permits the reactor to fill up to the operating volume. The real active
volume must include the volumes of all tubing, fittings components and the neu-
tralization vessel if used.
2. Porosity. As described in the above paragraph, the porosity of the filling material
that will support the microbial growth can be determined by filling a measured
volume of a glass recipient with the inert support that will be placed in the final
form in the operating reactor. The volume of liquid added to this device compared
to the volume of column initially considered will represent the porosity of the
material and can be calculated as
(Volume of column occupied by the support/Volume of liquid added) x 100
324 Bruno-Barcena et al.
3. Flow control. Install a flow meter in the portion of tubing between the feeding
reservoir and the fed pump. Before sterilization interrupt the feeding line and
connect a T-tube with an appropriate connection provided with a clamp to a
graduated tube (10-mL pipet). This pipet can be used to calibrate the flow rate by
measuring the time needed to deliver a given amount of liquid expressed in
milliliters per minute or milliliters per hour.
4. Ascentional velocity. It is necessary to know the cross-sectional area through which
the liquid will flow in the upflow mode through the reactor. The real cross-section
area will be the geometrical surface multiplied by the porosity factor of the porosity
of the support.
The ascending velocity expresses the volume of medium that is allowed to flow
through the area section of the reactor per unit of time. This will be determined
from the section of passage and the net flow of liquid ascending through the
column. The units are centimeters per hour and will be calculated as
Ascending ve locity = Flow (cm 3 /h)
Area section (cm 2 )
5. Recycle ratio. The operation of the reactor requires an external recycling loop,
similar to the agitation of a chemostat, for liquid homogenization and to avoid
pH gradients and dead zones. It is necessary for adequate control of the operation
to know the ascending velocity, which depends on the recycle ratio (see Note 4).
This ratio can be calculated, from the flow through the external loop (see item 3)
and referring it to the actual feed flow rate. This ratio relates the times of the
recycling flow with respect to the feed flow rate. It will be calculated as
Recycle ratio = Feeding flow (mL/h) / Flow through external loop (mL/h)
Example:
Reactor glass volume: (Jt/4) (3.5 cm) 2 (14 cm) = 134.6 cm 3
Active volume (Poraver): (134.6 cm 3 ) x (60%) / 100 = 80.7 cm 3
External loop and vessel volume,
leave: 19.3 cm 3
Total active volume of: 100 cm 3
For a dilution rate of D = 0A3h~ 1
The feeding flow is (0.13 Ir 1 ) x (100 mL) =13.2 mL/h
If recycle ratio is: 50:1
The external flow is: 50 x (13.2 mL/h) = 660 mL/h = 660 cm 3 /h
Calculating the sectional area: (12.25 cm 2 ) (0.6) = 7.35 cm 2
The ascentional velocity is: (660 cm 3 /h) / (7.35 cm 2 ) = 98.8 cm/h =
1.5 cm/min
3.2. Preparation of the Reactor
Once the reactor and silicone tubes and fittings are properly cleaned, the
system is assembled according to the scheme in Fig. 1 (see Notes 5 and 6).
Reactor Configuration for Continuous Fermentation 325
First, fill the reactor with the desired support and connect and test the neutral-
izing device with the pH electrode, the agitator, and all the pumps. Fill the
whole system from the bottom of the reactor with distilled water and sterilize
all the system for 60 min at 121 °C (1 atm).
Verify all the connections and replace the water with culture medium. Hold
the system at the controlled temperature and pH for at least 24 h prior to inocu-
lation with the selected strain previously grown at the temperature to be used
for culturing.
3.3. Microorganism
The adhesive strain could be obtained in a chemostat. An example of a con-
tinuous culture yielding the adhesive phenotype of Streptococcus salivarius
ssp. thermophilus involve 7 d at 0.057 h _1 , 6 d at 0.12 h _1 , 15 d at 0.19 h" 1 , and
3 d at 0.26 hr 1 . When the biofilm is visually detected, the dilution rate is increased
stepwise up to 0.96 h" 1 . For the final selection of the adhesive phenotype, use
dilution rates between 0.96 and 6.0 h _1 (4).
3.4. Cultivation of Microorganism
1 . Aseptically inoculate the reactor in the bottom of the column, use a sterile syringe
with 6% (v/v) of an overnight culture of adhesive strain and leave for 24 h in a
batch mode.
2. Set pH to 5.5, temperature to 42°C, and stirring speed to 150 rpm in the external
vessel.
3. Determine the feed flow and start the continuous culture by pumping the medium
in upflow mode through the reactor at the lowest dilution rate.
4. Growth is monitored by the absorbance at 620 nm using a spectrophotometer.
Obtain a sample from the sampling device and determine the density of free cells
by measuring optical density. The dry weight of cells is determined from a definite
volume of broth collected and filtered through a weighed 0.22-fim cellulose acetate
membrane filter, washing with 0.9% saline solution and drying at 105°C.
5. Centrifuge the sample and determine residual sugar and total lactic acid in the
supernatant by high-performance liquid chromatography. Determine glucose with
an enzymatic kit (Sigma), and l(+) and D(-)-lactic acid according to the proce-
dure described below.
6. Steady states must be maintained for a least 15 generations prior to any sampling.
The samples must be withdrawn along five retention times at each dilution rate
(see Note 8).
7. Change the dilution rate starting at the slowest retention time and repeat steps
4 and 5.
8. At the end of the process, determine the amount of cells immobilized on the
support by the difference between the dry weight of the immobilized biocatalyst
(a portion of support and cells) and that of the support prior to use. Dry the mate-
rial at 105°Cfor72h.
326
Bruno-Barcena et al.
Table 1
Determination of l (+)-Lactic Acid
Sample
Blank
Standard curve
Solutions
Standard
Standard
Standard
Standard
1
2
3
4
Buffer glycine-hydrazine
2.5 mL
2.5 mL
2.5 mL
2.5 mL
2.5 mL
2.5 mL
NAD + (40 milf)
0.2 mL
0.2 mL
0.2 mL
0.2 mL
0.2 mL
0.2 mL
H 2 bidistilled
0.2 mL
0.150 mL
0.1 mL
0.050 m.
l(+)- Lactate (2 mM) (5)
[200 |xL]
0.050 mL
0.1 mL
0.150 mL
0.2 mL
l(+) nLDH
20 \xL
20 jxL
20 jxL
20 jxL
20 [xL
20 [xL
Note: Allow to stand at 37°C for 30
min. Wavelength: 334-^
365 nm.
Table 2
Determination of D(-)-Lactic Acid
Sample
Blank
Standard curve
Solutions
Standard
Standard
Standard
Standard
1
9
— -
3
4
Buffer glycine-hydrazine
3mL
3mL
3mL
3mL
3mL
3mL
NAD + (40 mM)
0.2 mL
0.2 mL
0.2 mL
0.2 mL
0.2 mL
0.2 mL
H 2 bidistilled
0.2 mL
0.175 mL
0.150 mL
0.1 mL
0.050 mL
d(-) Lactate (10 mM) (5)
[200 jiL]
0.025 mL
0.050 mL
0.1 mL
0.150 mL
d(-) nLDH
20 \iL
20\iL
20 |iL
20 |iL
20 |iL
20 |xL
Note: Allow to stand at 37°C for 60 min. Wavelength: 334-365 nm.
Table 3
Dilution Factor of Samples to Determine
Lactate in each liter (g) Dilution with water Dilution factor
<0.1
0.1-1
1-10
> 10
1+9
1+99
1+999
1
10
100
1000
3.5. Stereospecific Lactic Acid Determination
L(+)-and D(-)-lactate dehydrogenases are used to determine the concentra-
tions of each isomer of lactic acid {see Note 7), in which the reaction products
are pyruvate and NADH. The increase in NADH, as measured by the change in
extinction at 340 (334, 365) nm, is directly proportional to the amount of lac-
tate (Tables 1 and 2).
Samples of culture medium stored at -20°C are stable for long periods.
Dilute a portion of the sample with distilled water using an appropriate dilution
factor (Table 3).
Reactor Configuration for Continuous Fermentation 327
4. Notes
1 . In practice, it is often more convenient to sterilize the component parts separately
and then reassemble them carefully before use. Sufficient medium for a whole
experiment should be sterilized.
2. Adhesive variants can be selected in a chemostat according to the method
described by Ragout et al. (4). The attachment of the cells could be facilitated by
growing in a mixed culture with a biofilm-forming organism such as Streptomy-
ces viridosporus (6) and also the adsorption could be facilitated by use of a
cationic polymer, polyethyleneimine (7).
3. If the chosen support has a lower density than water, a good packed bed with a
perforated stopper is needed.
4. To maintain the ascending velocity constant, it is necessary to change the flow
through the external loop each time the feed flow rate is changed.
5 . Depending on the configuration of the reactor design, samples may be taken from
either the overflow system or from the recycling loop (Fig. 1). Care should be
taken to avoid introducing contamination.
6. The pH electrode can be placed in the top of the column design, and adjustments
to pH can be done automatically in the recycle loop.
7. Isomers of lactic acid can be determined using techniques described by
Gutmann and Walhlefeld (8) for L(+)-lactate and Gawehn and Bergmeyer (9)
for D(-)-lactate. These methods permit a stereospecific determination.
8. In a continuous-culture system, for every volume of fresh medium entering on
the reactor, an equal volume of spent medium leaves. The volume of the reactor
can be controlled by a simple overflow system in which the entering volume
causes the discharge of the same volume of medium through the top by increas-
ing the pressure in the system. In the same way, the volume can be controlled by
a tube placed in the top of the reactor that draws off the excess liquid to the preset
level, in this last operation mode, an air filter may be added at the top of the
column.
References
1. Cassidy, M. B., Lee, H., and Trevors, J. T. (1996) Environmental applications of
immobilized cells: a review. /. Ind. Microbiol. 16, 79-101.
2. Kharas, G. A., Sanchez-Riera, F., and Severson, D. K. (1994) Polymers of lactic
acid, in Plastic from Microbes: Microbial Synthesis of Polymer Precursors
(Mobley D. P., ed.), Carl Hanser Verlag, Munich, pp 93-137.
3. Bruno-Barcena, J. M., Ragout, A. L., Sineriz, F. (1998) Microbial physiology
applied to process optimization: lactic acid bacteria, in Advances in Bioprocess
Engineering II (Galindo, E. and Ramirez, O. T., eds.), Kluwer Academic,
Amsterdam, pp. 97-1 10.
4. Ragout, A., Sineriz, F., Kaul, R., Guoqiang, D., and Mattiasson B. (1996) Selec-
tion of an adhesive phenotype of Streptococcus salivarius subsp. thermophilics
for use in fixed-bed reactors. Appl. Microbiol. Biotechnol. 46, 126-131.
328 Bruno-Barcena et al.
5. Ragout, A. (1988) Estudio de la Fisiologfa de bacterias lacticas de interes
industrial crecidas en cultivo continuo, Ph.D. Thesis. University of Tucuman,
Tucuman, Argentina, pp. 66-68.
6. Dimerci, A., Pometto, A. L., Ill, and Johnson K. E. (1993) Lactic acid production
in a mixed-culture biofilm reactor. Appl. Environ. Microbiol. 59, 203-207.
7. Guoqiang, D., Kaul, R., and Mattiasson, B. (1992) Immobilization of Lactobacil-
lus casei cells to ceramic material pretreated with polyethyleneimine. Appl.
Microbiol. Biotechnol. 37, 305-310.
8. Gutmann, I. and Walhlefeld, A. W. (1974) L(+) lactate. Determination with lactate
dehydrogenase and NAD, in Methods of Enzymatic Analysis, 2nd ed. (Bergmeyer,
H. U. and Gawehn, K. eds.), Academic, New York, pp. 1464-1468.
9. Gawehn, K. and Bergmeyer, H. U. (1974) d(-) lactate. Determination with lactate
dehydrogenase and NAD, in Methods of Enzymatic Analysis, 2nd ed. (Bergmeyer,
H. U. and Gawehn, K. eds.), Academic, New York, pp. 1469-1475.
36
Molecular Characterization of Yeast Strains
by Mitochondrial DNA Restriction Analysis
Maria Teresa Fernandez-Espinar, Amparo Querol,
and Daniel Ramon
1. Introduction
The characterization of yeasts at the strain level is of relevance from an
industrial point of view because numerous yeast strains belong to the natural
flora of commercial fermented foods and beverages (bakery products, cheeses,
cold meats, wines, and beers) and take part in fermentation processes. The
addition of active dry yeasts is increasingly used to ensure the final quality of
these products. In this sense, a fast and easy method is required for quality
control of dry yeast production to ensure that the final product is identical to
the original strain, and for control of the fermentation process to ensure that the
latter really is conducted by the inoculated yeast. In addition, the importance of
yeasts in the spoilage of foods is increasingly recognized (1). In consequence,
accurate identification of these yeasts in the spoiled product as well as the
detection of the origin of contamination are of great interest for food
laboratories as an inevitable part of the control of the process and quality
assurance. Between the techniques employed for yeast strain characterization,
the mitochondrial DNA restriction analysis appears as one of the most sensitive
method to differentiate among strains (2). This technique has been used success-
fully for strain differentiation (3-5). However, mitochondrial DNA purification
is too complex and time-consuming to be used in industrial applications.
Recently, a new mitochondrial restriction analysis method that does not
require previous isolation of mitochondria or purification of mitochondrial
DNA has been developed in our laboratory for Saccharomyces cerevisiae
strains (2,6). This technique has been used successfully by other authors to
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
329
330 Fernandez-Espinar, Querol, and Ramon
characterize strains of other yeast species (7-9). This method relies on the
different GC content of the nuclear and mitochondrial genomes, approximately
40% (10) and 20% (11), respectively. In this way, G+C-rich restriction sites
are much more frequent in the yeast nuclear DNA than in the mitochondrial
genome because of its higher G+C-content. Then, digestion with G+C-rich
restriction endonucleases yields an overdigestion of the nuclear DNA, which is
cut in a few larger fragments. After electrophoresis separation, mtDNA
restriction fragments are easily visualized in the upper part of the gel.
Here, we describe the application of this method to the characterization of a
large number of wild and commercial yeast strains in a fast and reliable way.
These considerations and the simplicity of the equipment required confer to the
method a great industrial interest.
2. Materials
1. Culture medium: YEPD (yeast extract peptone dextrose): 1% yeast extract, 2%
peptone, 2% glucose. The medium must be autoclaved at 121° C for 20 min.
2. Organisms: Different yeast strains may be used for mitochondrial DNA restric-
tion analysis. The strains are maintained on Petri dishes with YEPD solid medium
(see Note 1).
3. Restriction enzymes: Total DNA is digested with specific restriction
endonucleases that recognize 4-bp or 5-bp GC-rich restriction sites; 4 bp: Alul,
Cfol, Haelll, Hpall, Mael, Maell, Mbol, Mvnl, Sau3Al, Rsal, Taql; 5 bp: Ddel,
Hinfl, Ital, Maelll, Sau96l, ScrFI. (See Note 2.)
4. Microcentrifuge for 1.5-mL tubes.
5. Microwave oven. The microwave is used to prepare agarose gels by melting the
agarose in the electrophoresis buffer until a transparent solution is obtained. A
boiling-water bath or a hot plate can be used instead.
6. Electrophoresis apparatus. The equipment is composed of the following:
• Plastic tray to pour the agarose slab gel.
• Electrophoresis tank with a lid containing shielded electrical connections.
• Combs to generate different number of wells of different sizes that allow to
analyze many samples simultaneously.
A power supply is necessary to plug the electrophoresis apparatus and allow the
migration of the DNA toward the anode. The voltage applied is usually 100 V. If
the gel is running overnight, the voltage should be 20-25 V.
7. Ultraviolet transilluminator for DNA visualization in the gel.
8. Molecular weight standard. Phage X DNA cut with the restriction endonuclease
Pstl (can be purchased from commercial sources). The set of DNA size markers
(in bp) obtained is 11509, 5080, 4649, 4505, 2840, 2577, 2454, 2443, 2140,
1980, 1700, 1159, 1092, 805,516,467,448, 339, 265, 247, and 210.
9. Solutions and buffers:
a. Solutions for DNA extraction:
• Solution I (1 M sorbitol, 0.1 M EDTA, pH 7.5).
Characterization of Yeast Strains 331
• Solution II (50 mM Tris-HCl, 20 mM EDTA, pH 7.4).
• 10% sodium dodecyl sulfate (SDS).
• 5 M potassium acetate: To 60 mL of 5 M potassium acetate, add 1 1.5 mL of
glacial acetic acid and 28.5 mL of H 2 0.
• TE (10 mM Tris-HCl, and 1 mM EDTA, pH 7.5).
• Zymolyase (2.5 mg/mL in solution I).
b. 10X Gel loading buffer (50% glycerol in water, 0.25% bromophenol blue,
and 0.25% xylene cyanol FF).
c. Electrophoresis buffer: 50X TAE concentrated stock solution (242 g Tris base,
57.1 mL glacial acetic acid, and 100 mL 0.5 M EDTA, pH 8.0).
d. Ethidium bromide stock solution (10 mg/mL in water). Use gloves and handle
with care, ethidium bromide is mutagenic.
3. Methods
3. 1. Microorganism Growth
Yeast cells must be grown for 12-16 h in 5 mL of YEPD with moderate
agitation (200-250 rpm). Incubation temperature depends on the yeast species
under study (usually between 25°C and 28°C) (see Note 1).
3.2. DNA Extraction
The total DNA is obtained by the method of Querol et al. (2) as follows:
1. Spin down the cells from the culture in a centrifuge at 3500 rpm for 5 min, wash
with 5 mL of sterile distilled water, and resuspend in 0.5 mL of solution I.
2. Transfer the cells to a 1.5-mL microcentrifuge tube, to which 0.02 mL of a
solution of Zymolyase 60 (2.5 mg/mL) is added. Incubate the tubes at 37°C for
30-60 min to obtain spheroplasts (see Note 3).
3. Pellet the spheroplasts in a microcentrifuge at maximum speed for 1 min and
resuspended them in 0.5 mL of solution II. After resuspension, 0.05 mL of 10%
SDS is added and the mixture incubated at 65°C for 30 min (see Note 3).
4. After incubation, add 0.2 mL of 5M potassium acetate and place the tubes on ice
for 30 min (see Note 3) .
5. Centrifuge the tubes at maximum speed in a microcentrifuge for 15 min (see
Note 4).
6. Transfer the supernatant to a fresh microcentrifuge tube and precipitate the DNA
by adding the same volume of isopropanol.
7. After incubation at room temperature for 5 min, centrifuge the tubes at room
temperature for 10 min and wash the DNA with 70% ethanol, vacuum dry and
dissolve in 50 fiL of TE, pH 7.4.
3.3. Mitochondrial DNA Digestion
Yeast DNA (8-10 fiL) is digested with restriction enzymes according to the
instructions of the supplier in a final volume of 20 [iL. Add to the reaction
mixture 2 [iL of a 500-^xg/^iL solution of pancreatic RNase DNase-free.
332 Fernandez-Espinar, Querol, and Ramon
3 A. Mitochondrial Restriction Fragment Separation
Restriction fragments are separated by horizontal 0.8% agarose gel electro-
phoresis using IX TAE electrophoresis buffer. Two microliters of 10X gel
loading buffer must be added to each sample before loading. Marker DNA
(k Pstl) should be loaded into slots on both sides of the gel.
3.5. Staining DNA in Agarose Gels and Mitochondrial DNA
Patterns Visualization
After electrophoresis is completed (until the bromophenol blue and xylene
cyanol FF contained in the gel loading buffer have migrated the appropriate
distance through the gel), stain the gel by soaking it in a solution of the
fluorescent dye ethidium bromide (0.5 jxg/mL) at room temperature for 30-45
min. The background fluorescence caused by unbound ethidium bromide can
be reduced by soaking briefly the stained gel in water. The DNA is then
visualized on an ultraviolet transilluminator.
4. Notes
1. The method was initially developed to differentiate S. cerevisiae strains in order
to solve enological problems that can substantially affect the quality and
organoleptical characteristics of the wine. However, this method can be used also
in the differentiation of industrial yeast strains involved in biotechnological pro-
cess other than wine fermentation (beer brewing, bakery products, dairy prod-
ucts, cold meat products, active dry yeast production, etc.) as well as in the
characterization of spoilage yeasts.
2. Because the GC content of mitochondrial DNA of the strains tested can be
different depending on the species, it is recommended to test beforehand a great
number of restriction enzymes in order to use those showing an extensive
polymorphism for further analysis .
3. When the strains analyzed are S. cerevisiae, incubation at 37°C with solution I
and zymolyase can be reduced to 20 min. In the same way, the amount of SDS
used can be reduced from 0.05 to 0.013 mL. Incubation for 5 min at 65°C with
the SDS and then 10 min on ice are enough.
4. If a microcentrifuge refrigerated is available, centrifugation at 4°C is
recommended to avoid the resuspension of the precipitate.
References
1. Deak, T., Beuchat, L. R. (1996) Handbook of Food Spoilage Yeasts (Clydesdale,
F. M., ed.) CRC, New York.
2. Querol, A., Barrio, E., and Ramon, D. (1992) A comparative study of different
methods of yeast strain characterization. System. Appl. Microbiol. 15, 439-446.
3. Lee, S.Y. and Knudsen, F. B. (1985) Differentiation of brewery yeast strains
by restriction endonuclease analysis of their mitochondrial DNA. /. Inst. Brew.
91, 169-173.
Characterization of Yeast Strains 333
4. Dubordieu, D., Sokol, A., Zucca, P., Thalouarn, P., Datte, A., and Aigle, M. (1987)
Identification des souches de levures isolees de vins par l'analyse de leur ADN
mitochondrial. Connaiss. Vigne Vin. 21, 267-278.
5. Vezinhet, F., Blondin, B., and Hallet, J. N. (1990) Chromosomal DNA patterns
and mitochondrial DNA polymorphism as tools for identification of enological
strains of Sac char omyces cerevisiae. Appl. Microbiol. Biotechnol. 32, 568-571.
6. Querol, A., Barrio, E., Huerta, T., and Ramon, D. (1992) Molecular monitoring of
wine fermentations conducted by active dry yeast strains. Appl. Environ.
Microbiol. 58, 2948-2953.
7. Romano, A., Casaregola, S., Torre, P., and Gaillardin, C. (1996) Use of RAPD
and mitochondrial DNA RFLP for typing of Candida zeylanoides and
Debaryomyces hansenii yeast strains isolated from cheese. System. Appl.
Microbiol. 19, 255-264.
8. Guillamon, J. M., Sanchez, I., and Huerta, T. (1997) Rapid characterization of
wild and collection strains of the genus Zygosaccharomyces according to
mitochondrial DNA patterns. FEMS Microbiol. Lett. 147, 267-272.
9. Ibeas, J. I., Lozano, I., Perdigones, F., and Jimenez, J. (1996) Detection of
Dekkera-Brettanomyces strains in Sherry by a nested PCR method. Appl. Environ.
Microbiol. 62, 998-1003.
10. Barnett, J. A., Payne, R. W., and Yarrow, D. (1990). Yeasts, Characteristics and
Identification. Cambridge University Press, Cambridge, UK.
11. Bernardi, G., Piperno, G., and Fonty, G. (1972) The mitochondrial genome of
wild type yeast cells. I. Preparation and heterogeneity of mitochondrial DNA.
/. Mol. Biol. 65, 173.
37
Selection of Yeasts Hybrids Obtained by Protoplast
Fusion and Mating, by Differential Staining,
and by Flow Cytometry
Tohoru Katsuragi
1. Introduction
Chapter 38 deals with methods for hybridization of yeasts in different genera
by protoplast fusion and for selection of hybrids by double-fluorescence staining
and use of a micromanipulator. This chapter describes a similar but automated
and rapid procedure for selection of hybrids; flow cytometry and cell sorting are
used (1). Mating, instead of fusion, followed by flow sorting as is done to obtain
hybrids (2) also is described, together with some modifications.
2. Materials
2. 7. Protoplast Fusion
Unless otherwise noted, materials used are as in Chapter 38.
1 . Fluorescent dyes. Green and red fluorescent dyes are used in combination. (Approxi-
mate peak emission wavelengths, measured by fluorescence spectrophotometry with
excitation at 488 nm, are given for the case of Saccharomyces diastaticus 25 1 , stained
as described later.) Use dyes at the concentration of 50 f^g/mL, unless otherwise
noted. Dyes are obtained from Molecular Probes, Inc. (Eugene, OR).
a. Green fluorescence. Fluorescein isothiocyanate isomer I (FITC; 520 nm,
strong fluorescence).
b. Red fluorescence. Tetramethylrhodamine isothiocyanate (TRITC; 570 nm,
moderate fluorescence). Also usable are rhodamine 6G (R6G; 550 nm, strong
fluorescence), 4-chloro-7-nitrobenz-2-oxa-l,3-diazole (NBD; 5 f^g/mL;
550 nm, moderate fluorescence); ethidium bromide (560 nm, weak fluores-
cence); rhodamine B (570 nm, moderate fluorescence); Nile Red (580 nm,
weak fluorescence).
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
335
336 Katsuragi
2. The sheath fluid used is osmotic buffer autoclaved and filtered through an in-line
membrane filter (pore size, 0.2 \xm).
3. Flow cytometer. Use a FACStar II flow cytometer (Nippon Becton-Dickinson
K.K., Tokyo) with an argon-ion laser (488 nm; at 50 mW) and 530 (±30)- and
580 (±42)-nm band-pass filters for measurement of the green fluorescence signal
(FL1) and the red fluorescence signal (FL2) respectively (see Note 1).
4. Collection tubes. Glass test tubes measuring 10 x 85 mm are wrapped in foil and
sterilized in an autoclave (see Note 2).
2.2. Mating
Materials and models of combination are those of Bell et al. (2).
1 . Strains: Genetic markers are not needed for selection of hybrids. Parents must be
haploid and of the opposite mating type. Strains of Sac char omyces cerevisiae
used by Bell et al. (2) were from the Australian National Reference Laboratory in
Medical Mycology (AMMRL), Sydney, and are used here as models.
a. Strain PB1 AMMRL 57.9 (MAT* trpl hisl MAL6T::lacZ).
b. Strain SMC19-A AMMRL 57.11 (MATa MAL2-8 C MAL3 leul SUC3).
2. Media
a. Rich medium contains 2% (w/v) glucose, 1% (w/v) peptone, 0.5% (w/v) yeast
extract, and 0.3% (w/v) KH 2 P0 4 . Solidify, if desired, with 2% (w/v) agar.
b. YNB, as a minimum medium, contains 0.67% (w/v) yeast nitrogen base
(Difco Laboratories, Detroit, MI).
3. Fluorescent dyes: Green and orange fluorescent dyes are used in combination.
Cell Tracker (CT) probes and another dye can be obtained from Molecular Probes
and Sigma Chemical Co. (St. Louis, MO), respectively. Typically used at the
concentration of 10 \xM (see Note 3).
a. Green fluorescence: CT-Green (CMFDA); CT-BODIPY; CT-Yellow-Green.
b. Red fluorescence: CT-SNARF; PKH-26.
4. The sheath fluid used is Coulter IsoFlow (Beckman Coulter).
5. Flow cytometer. Bell et al. (2) used a FACSCalibur instrument (Becton
Dickinson, Lane Cove, NSW, Australia) with an argon-ion laser (488 nm; set at
15 mW) (see Note 4). Linear gains are used for parameters of the forward scatter
channel (FSC) and the side scatter channel (SSC). Fluorescence is monitored at
the green fluorescence signal FL1 of 525 ± 5 nm and the red fluorescence signal
FL2 at 575 ± 5 nm.
6. Collection tubes: Sterile tubes are used (see Note 5).
3. Methods
3. 1. Protoplast Fusion
Protoplast fusion is done as in Chapter 38 except that fluorescence labeling is
always done after protoplasting, unlike labeling with 4,6-diamino-2-phenylindole
(DAPI), which was used to label cells before protoplasting. (DAPI is not used
here because it does not fluoresce strongly with the 488-nm laser.)
Selection of Hybrids by Double-Fluorescence Cytometry 337
3.2. Mating
3.2.1. Growth
1. Grow two yeast strains overnight on rich medium.
2. Collect, wash, and suspend cells in saline at the concentration of 4 x 10 8 /mL.
3.2.2. Fluorescence Labeling
One yeast strain is stained with a green fluorescent dye; the other is stained
with an orange fluorescent dye.
1 . Prepare a stain mixture ( 1 mL) containing 975 f^L of YNB medium, 25 f^L of cell
suspension, and 1 fiL of a 10 mM stock solution of one of the CT dyes. As a rule,
incubate the mixture at 30 °C for 45 min in the dark. The working concentration
will be 10 \xM (see Note 6). For staining with PKH-2, see Note 7.
2. Centrifuge the mixture for 1 min at 12,000g and remove all supernatant that can
be withdrawn with a pipet.
3. Wash the cells to remove unbound dye by three repetitions of the following
procedure: suspend the pellet in 1 mL of YNB medium, incubate the suspension
at 30°C for 30 min to allow unbound dye to mix with the medium, and obtain the
cells by centrifugation as in step 2.
3.2.3. Mating Procedure
1. Suspend stained cells in 500 fiL of 10X YNB medium.
2. Transfer two parents to a 1.5-mL Eppendorf tube and vortex the tube.
3. Pellet the cells by centrifugation for 1 min at 12,000g {see Note 8).
4. Place the tube in the dark at 20°C for 16 h.
5. Vortex the tube for 10 s to disrupt aggregates immediately before flow cytometry.
3.3. Flow Cytometry
1 . Align and calibrate the instrument each day before use, following the instructions
from the manufacturer and with Coulter Flow-Check fluorospheres (Beckman
Coulter) as standard beads.
a. For sorting with a jet-in-air cell sorter (FACStar II), fit the deflexion-plate
cassette on the instrument.
b. Adjust the pressure of the sheath fluid line to set the rate of flow.
c. Adjust the power of the laser.
d. Arrange the dichroic mirrors and optical filters.
e. Focus the laser beam so that it precisely illuminates a small area.
f. Monitor cytometric parameters (FSC, SSC, FL1, and FL2). (See Note 9.)
g. Adjust the gain voltages of the detectors (voltages for the photomultiplier
tubes) to the sensitivity needed for the standard beads.
338 Katsuragi
h. For sorting with a jet-in-air cell sorter, set drop-drive frequency and adjust
voltage applied to the deflexion plates so that the deflexion spots come in the
opening of the tubes for right and left sorting.
i. Estimate the sort delay time.
2. Place the sample in the cytometer and allow the sample to flow into the sensing area.
3. Adjust the pressure of the sample line so that the flow rate is no more than 1000
cells (events) per second during analysis.
4. Change the threshold to a level just below that of the lowest signals for yeast cells.
5. Inspect the cytometric parameters in dot plots on an FSC-versus-SSC cytogram
and an FLl-versus-FL2 cytogram (see Note 10).
6. Accumulate data for at least 10,000 cells.
7 . Define a sort window on the FL 1 -versus-FL2 cytogram so that the cells in the window
have both FL1 and FL2 fluorescence. Select these as hybrids (see Note 11).
8. Change the flow rate to about 300 cells (events) per second or fewer for sorting.
9. Place collection tube(s) in the cytometer.
10. Allow more cells to flow through and sort possible hybrids into the collection tube.
3A. Recovery of Hybrids
3.4.1. Hybrids from Fusion
Sorted cells are recovered from the collection tube by being spread on
regeneration plates, which are incubated as usual.
1 . Spread the contents of the collection tube on plates of regeneration agar.
2. Cover the agar plates by overlaying each with about 10 mL of molten soft agar.
3. Incubate for several days.
4. Transfer cells from a colony on a regeneration plate onto a plate or a slant of
growth medium.
5. Incubate the cells for a few days more until cultures are thick enough for
preparation of a master plate or of stock cultures.
6. Examine colonies of the sorted populations for confirmation of fusion by, in this
case, incubating the cells on starch.
3.4.2. Hybrids from Mating
1. Sort about 20,000 cells.
2. Collect the cells by centrifugation.
3. Suspend the cells in 2 mL of YNB medium.
4. Place the cell suspension in the cytometer for a second round of sorting as in step
\(see Note 12).
5. Collect the cells by centrifugation in step 2 (see Note 13).
6. Use sorted cells to inoculate a plate of rich medium and incubate the plate for
48 h for preparation of a master plate or of stock cultures.
7. Examine colonies of the sorted populations for confirmation of the mating by
formation of colonies on an appropriate minimum medium and by the expression
of lacZ, in this model case.
Selection of Hybrids by Double-Fluorescence Cytometry 339
4. Notes
1. The Becton Dickinson FACStar II is a jet-in-air cytometer that uses the droplet-
catcher sorting principle.
2. Glass tubes are used for droplet sorting with the jet-in-air cytometer to prevent
static electricity from building up on the surface of tubes. They already contain a
small amount of sheath fluid to protect cells from drying.
3. Dye stock solutions are prepared at the concentration of 10 mM in dimethyl
sulfoxide, dispensed as single-use portions, and stored at -50°C until use.
4. The Becton Dickinson FACSCalibur is a flow-in-capillary cytometer that uses
the catcher-tube sorting principle; the Becton Dickinson FACSort instrument is
similar. A flow-in-capillary cytometer always yields a high volume of sort fluid
in the collector.
5. Centrifuge tubes are convenient because they can be used to pellet cells in the
next step. Plastic tubes must be coated with bovine serum albumin before use, as
described in the user's manual from Becton Dickinson to prevent adsorption of
cells onto their surface.
6. The concentration to be used depends on the yeast strains and the physiological
conditions of the cells and must be decided after preliminary staining of the cells
with dyes in a range of concentrations.
7. PKH-26 did not stain either strain of yeast cells used here brightly under the
various incubation conditions described in the manufacturer's instructions with
the dye concentration in the range from 2-8 \xM.
8. This procedure is to encourage mating by bringing the cells close together.
9. FSC is used as the trigger for acquisition of cytometric data. A threshold is
tentatively set at the appropriate level.
10. For cancellation, if needed, of red and green components of the FL1 (green)
fluorescence and FL2 (red) fluorescence, respectively, fluorescence compensa-
tion is done for each measurement with the operating software.
11. So that doublets or multicell clusters are not selected as hybrids, a sort window is
defined also on the FSC-versus-SSC dot plot by the region with low FSC and low
SSC values.
12. The model described here (2) is an example of the concentration of hybrids by
repeated sortings: before sorting, 33% of the population were hybrids; after one
round of sorting, the proportion of hybrids increased to 70%; after the second
round, it increased to 96%.
13. If the number of sorted hybrids is expected to be a dozen or so as in rare-mating
hybridization, concentrate sorted cells, using membrane filters with 0.2-^im pores.
Acknowledgments
The author thanks Professor Yoshiki Tani of the same school for col-
laboration in screening of microorganisms with cell sorters. He is indebted
to Dr. John F. T. Spencer, coeditor of this book, for continuous encourage-
340 Katsuragi
ment throughout preparation of this chapter. Thanks also are due to Ms. Caro-
line Latta, Osaka City University Medical School, for critical reading of the
manuscript.
References
1. Katsuragi, T., Kawabata, N., and Sakai, T. (1994) Selection of hybrids from
protoplast fusion of yeasts by double fluorescence labelling and automatic cell
sorting. Lett. Appl. Microbiol. 19, 92-94.
2. Bell, P. J., Deere, D., Shen, J., Chapman, B., Bissinger, P. H., Attfield, P. V., et
al. (1998) A flow cytometric method for rapid selection of novel industrial yeast
hybrids. Appl. Environ. Microbiol. 64, 1669-1672.
38
Selection of Hybrids by Differential Staining
and Micromanipulation
Tohoru Katsuragi
1. Introduction
Microorganisms have been used intensively by the food industry as well as
by pharmaceutical and other chemical industries. A great number of global
companies take advantage of fermentation processes in the manufacture of a
spectrum of useful products. Many of these processes involve yeasts, which
have been used in the production of foods and alcoholic drinks long before the
existence of microorganisms was known. Biochemical engineering of microbes
has made possible the industrial production of a wide variety of metabolites on
a commercial scale at low cost. These metabolites are a tiny proportion of the
compounds produced in nature by living organisms. Progress in biological
chemistry, genetics, and molecular biology has been put to practical use in the
manufacture of foods. Such recent advances have led to the development of a
number of commercial products. However, as with other agricultural products,
consumers do not necessarily accept so-called engineered or recombinant
foods, which involve genetically engineered organisms and enzymes in their
production, and the processes themselves may not be generally acceptable
because genetic engineering itself may be viewed with doubt. One example is
the use of antibiotic resistance marker genes, considered undesirable when
incorporated into industrial yeasts because the products are released into the
environment. In addition, genetic markers introduced into parent strains for
convenience in the selection of mutants may cause practical problems; a new
gene once introduced may produce unnecessary metabolites and thereby disrupt
the metabolism of the cell, use energy that could be used for growth, or
consume a substance that would otherwise be a source of the desired product
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
341
342 Katsuragi
(1). For these reasons, classical genetics and conventional techniques such as
mating and protoplast fusion are preferable for use in strain improvement of
yeasts. Mating followed by selection is a traditional technique still useful for
strain improvement (2,3). The use of protoplast fusion to produce hybrid yeasts
is a way to solve the problem when a mating reaction does not occur. Protoplast
fusion also makes possible the construction of new strains that are hybrids
between different species or even different genera.
When two yeast strains with complementary genetic markers (e.g.,
nutritional complementation) are fused, their hybrids can be identified by
growth on a selective medium. Many industrial yeast strains, however, lack
selectable genetic markers, making identification of hybrids by genetic
complementation difficult: when parent strains and hybrids can grow on the
same medium, there is no easy way to distinguish between hybrids (those
formed between the two parents) and nonhybrids.
In this chapter an effective technique for selection of hybrids obtained by
protoplast fusion without use of genetic markers is described; instead, two
fluorescent dyes are used for labeling (4). Under a fluorescence microscope,
hybrids are detected as cells that have been stained by both of the dyes, and
these cells are selected by use of a micromanipulator (5).
2. Materials
1. Strains: Genetic markers are not needed for selection of hybrids and there is no
restriction as to what combinations of strains are chosen as parents. A model has
been selected for description of the protocol here.
a. Sac char omyces cerevisiae AKU 4111, the sake yeast Kyokai No. 7; a strain
for ethanol fermentation.
b. Saccharomycopsis fibuligera IFO 0106; a strain for saccharification.
2. Media
a. Growth medium: 1% (w/v) glucose, 0.5% (w/v) peptone, and 0.3% (w/v) yeast
extract at pH 5.5. Dispense as 5-mL portions in 16-mm test tubes or 100-mL
portions in 500-mL Erlenmeyer flasks. Solidify, if desired, with 2% (w/v) agar.
b. Regeneration medium: Growth medium containing 0.6 M KC1. For agar
plates, dispense a 20-mL portion in a 90-mm Petri dish. Store regeneration
agar in a flask until it is used to cover agar plates inoculated with protoplasts.
3. Buffers
a. Buffer is 60 mM potassium phosphate buffer, pH 7.5, unless otherwise noted.
b. Osmotic buffer: 0.6 M KC1 as osmotic stabilizer in the buffer {see Note 1).
4. Fluorescent dyes obtained from Molecular Probes, Inc. (Eugene, OR) through
Wako Pure Chemical Industries (Osaka). Keep prepared solutions in the dark or
wrapped in aluminum foil to protect contents from light. They can be stocked for a
few days in the refrigerator. Use a B-excitation cassette for microscopic observation,
a. Fluorescein isothiocyanate isomer I (FITC), 50 |ig/mL, dissolved in osmotic
buffer; fluoresces green.
Selection of Hybrids 343
b. 4,6-Diamino-2-phenylindole (DAPI), 150 ^ig/mL, dissolved in buffer; fluo-
resces yellow. For orange fluorescence (which, however, is not strong), use
tetramethylrhodamine isothiocyanate (TRITC) or rhodamine 6G (R6G) (see
Note 2).
5. Protoplasting solution. Dissolve Zymolyase-20T (Kirin Brewery Co., Tokyo)
to the concentration of 5-100 fig/mL in osmotic buffer containing 10 mM
2-mercaptoethanol (see Note 3) .
6. Fusion solution: 33% polyethylene glycol (PEG) 6000 (Wako) and 50 mM CaCl 2
in osmotic buffer.
7. Soft agar: 0.5% (w/v) agar in osmotic buffer. Pour over microscope slide glass to
fix cells on it (see Note 4).
8. Microscope. Use a Diaphot 300 inverted microscope equipped with a Narishige
single-handed micromanipulator (Nikon Corp., Tokyo) (see Note 5).
9. Micromanipulation tips: Commercially available or make tips from glass capil-
lary tubes using a kit made by Narishige and obtainable from Nikon. Use a tube
to make two tips with openings of about 5-15 ^im with the use of the puller in the
kit. Make opening flat, if desired, using a grinder.
3. Methods
Techniques used are sterile and all procedures are done at room temperature
unless otherwise stated. Cells are collected by centrifugation at 2000g for 5 min
when necessary. Starting with the staining procedure, containers are wrapped
in foil when being handled in a lighted room.
Standard methods are presented here and modifications may be needed for
particular microorganisms.
3.7. Cultivation
Culture at 30°C, with gentle shaking when broth is used. Collect cells by
centrifugation with three steps of washing with buffer. Growth is expressed as
the optical density at 610 or 660 nm. Dilute cultures 1:10 with saline and mea-
sure their absorbance. Multiply absorbance by the dilution rate to give the opti-
cal density.
The preliminary measurements described here often are helpful.
Optical density vs cell density curve. Dilute cell suspensions with saline, if necessary,
for measurement of their optical density, and count under a microscope with use
of a hemacytometer. Plot the optical density versus cell density to obtain a cali-
bration curve.
Growth curve. Withdraw samples during cell growth and measure the optical density
to plot the growth curve.
344 Katsuragi
3.2. Fluorescence Labeling
1 . Grow two yeast cultures in growth medium for 10 h to the early or mid-exponen-
tial growth phase (see Note 6).
2. Add 1 volume of DAPI solution to 9 volumes of one of the yeast cultures.
Incubate the mixture for 4 h without shaking the culture.
3. Collect cells from the other yeast culture, wash them, suspend them at a density
of 10 6 -10 8 /mL in osmotic buffer, and treat them as described in Subheading 3.3.
Stain with FITC.
3.3. Protoplasting
1. Collect cells treated with DAPI, wash them with osmotic buffer, and resuspend
them at a density of 10 6 -10 8 /mL.
2. Incubate the suspensions at 30°C for 10 min. Collect cells and suspend them at a
density of 10 9 /mL in protoplasting solution. Incubate the mixture for 30 min
more. Collect the protoplasts, wash them with an osmotic buffer, and suspend
them in the same buffer (see Note 7).
3. Collect (from Subheading 3.2., step 3) the protoplasts to be stained and suspend
them in FITC solution. Incubate the mixture at 30°C for 3 min and then
immediately collect the cells, wash with osmotic buffer, and suspend in the
bufffer at a density of about 10 9 /mL (see Note 8).
4. Estimate the rate of formation of protoplasts (see Note 9).
3.4. Protoplast Fusion
1. Mix portions of about 0.1 mL each of two suspensions of stained protoplasts
prepared from different yeasts so that the protoplasts from the two parents are
present in roughly equal numbers.
2. Collect protoplasts and suspend them in 0.2 mL of fusion solution.
3. Incubate the mixture at 30°C for 60 min. Immediately collect all cells, including
the protoplasts that fuse together, by centrifugation at 3000g for 5 min and
suspend them in osmotic buffer.
3.5. Microscopy and Micromanipulation
1. Melt soft agar in a flask, cool it to 40°C in a water bath, and use it to cover the
surface of a regeneration plate that contains selected protoplasts, transferred as
described next.
2. Transfer treated protoplasts from the suspension described in Subheading 3.4.,
step 3 onto soft agar on a microscopic slide glass and spread them by gentle
shaking of the slide from side to side (see Note 10).
3. Leave the slide undisturbed for the liquid portion to seep into the agar. The
protoplasts will then be set firmly on the surface.
Selection of Hybrids 345
4. Fix a micromanipulator tip to the manipulator hand.
5. Set the slide on the stage and inspect the specimen.
6. Select a protoplast that has both green and red fluorescence as a probable fusant.
7. Aspirate a small volume of osmotic buffer inside the capillary and then introduce
a bubble of air, which will separate the buffer inside from the droplet containing
the protoplast to be picked up.
8. Move the micromanipulator tip over the slide glass into the field of view by coarse
manipulation in the X and Y directions with the joystick. Bring the end of the tip
up to the selected protoplast by fine manipulation. Touch the agar near the
protoplast with the tip by manipulation in the Z direction.
9. Press the agar softly in the Z direction, causing fluid to ooze from the agar bed.
10. Detach the protoplast from the agar by aspirating it into the tip together with the
fluid on the agar.
11. Detach the micromanipulator tip holder by hand and carefully move the tip to a
position above a regeneration plate. Transfer its contents (the protoplast
suspension together with osmotic buffer) onto the regeneration plate by pipetting.
12. Select more protoplasts as probable fusants by repetition of steps 6-11 . If desired,
use a new micromanipulator tip each time.
3.6. Regeneration
1 . Cover the regeneration plate with about 1 mL of molten soft agar from a stock flask.
2. Incubate the plates at 30°C.
3. Within a week, check for regenerated yeast cells, seen as colonies on the plate.
4. Transfer individual cells separately from a colony onto growth agar when
preparing master plates or slants for characterization {see Note 11).
4. Notes
1 . Sorbitol may be used at the concentration of 1 .0 M as an osmotic stabilizer instead
of 0.6 AfKCL
2. Both TRITC and R6G can be used in the same way and at the same time as FITC.
Staining must be done after protoplasting. See Subheading 2 of Chapter 37.
3. The enzyme is used to remove yeast cell walls. Zymolyases (from Arthrobacter
luteus) have (3-1,3-glucan laminaripentaohydrolase and (3-1,3-glucanase
activities. The concentration is decided in preliminary experiments. Zymolyase
6000 (Kirin Brewery) is typically used at the concentration of 0.4 mg/mL. Other
lytic enzymes of other origins or other commercial sources (e.g., snail gut juice
or Novozyme SP234 from Novo-Nordisk Bioindustry, Chiba, Japan) and
combinations of such enzymes can be used and may be more effective.
4. Soft agar can be prepared so as to have an even surface on the slide glass when
die-cast with a plastic spacer plate 1.0 mm thick and measuring 20 x 40 mm on
the edge, with a circular or square hole about 10 mm across. (The spacer can be
made by hand from an acrylic plate with a cutter and reamer.) The spacer plate is
346 Katsuragi
put on a slide glass, a slight excess of molten agar is poured into the hole, and
another slide glass is placed on the spacer plate carefully so that air is not trapped
under it. The agar gels quickly. Just before use of the plate, the slide glass on top
is slid off sideways. Agar plates with a higher concentration of agar (e.g., 2%)
can be useful also; sample protoplasts set rapidly and firmly on the surface
because the agar bed readily absorbs small amounts of liquid.
5 . A dark room may not be needed, although FITC and some other dyes are labile to
light. Ordinary microscopes also work well with a micromanipulator if there is enough
space between the specimen on the stage and the objective for insertion of a
micromanipulator tip. The problem is greater with objectives giving greater magnifi-
cations. Objectives with a long focal length can be used to solve the problem.
6. The phase of exponential growth is suitable for the protoplast fusion of yeasts.
Yeasts usually enter that phase after culture for 8-16 h. The time needed can be
estimated from the growth curve, and preliminary experiments will show whether
the early or mid-exponential phase is more suitable for fusion.
7. The protoplasts can be stored for a few days at 5°C in a solution of 1.2 M KC1
containing 50 mM CaCl 2 .
8. When on the protoplast membrane, FITC is unstable to light, as it is in solution,
and careful handling is necessary. In addition, FITC sometimes may be eluted;
in that case, the protoplasts are not washed thoroughly at this point but are
washed only once.
9. The rate of protoplast formation (P) is estimated as follows. Equal volumes of
suspensions of untreated and treated cells are spread separately on growth
medium. Plates are incubated for 4-7 d. Colony counts will give the viable cell
count for both cultures. The count for untreated cells on growth medium (in)
minus that for treated cells on growth medium (n) gives the number of whole
protoplasts, which is divided by /// to give P:
P = (m — n)/m
Usually, the rate of regeneration of stained protoplasts is 75% or more. The rate
of regeneration of fused protoplasts is not known, but it probably is almost the
same as this percentage, changing in proportion.
10. The appropriate volume of the protoplast suspension to be transferred for isolation
of the protoplasts from each other is decided on beforehand. Sometimes dilution
with osmotic buffer is needed.
11. In the model used here for illustration, alcohol fermentation and saccharification
are the desired activities for incorporation into the fusants. Such fusants can grow
on starch (without sugars) and produce alcohol.
Acknowledgments
The author thanks Dr. Takuo Sakai, Department of Applied Biological
Chemistry, Osaka Prefecture University, Sakai, Osaka (presently, Faculty of
Agriculture, Kinki University, Nara) for providing information about
Selection of Hybrids 347
experimental details and for notes about these techniques. He is indebted to Dr.
John F. T. Spencer, editor of this book, for continuous encouragement
throughout preparation of this chapter. Thanks also are due to Ms. Caroline Latta,
Osaka City University Medical School, for critical reading of the manuscript.
References
1. Spencer, J. F. T. and Spencer, D. M. (1983) Genetic improvement of industrial
yeasts. Annu. Rev. Microbiol. 37, 121-142.
2. Spencer, J. F. T. and Spencer, D. M. (1977) Hybridization of non-sporulating
and weakly sporulating strains of brewer's and distiller's yeasts. /. Inst. Brew.
83, 287-289.
3. Evans, I. H. (1990) Yeast strains for baking: recent developments, in Yeast
Technology (Spencer, J. F. T. and Spencer, D. M., eds.), Springer-Verlag, Ber-
lin, pp. 13-53.
4. Sakai, T., Koo, K.-I., Saitoh, K., and Katsuragi, T. (1986) Use of protoplast fusion
for the development of rapid starch-fermenting strains of Saccharomyces
cerevisiae. Agric. Biol. Cheni. 50, 297-306.
5. Sakai, T.,Kanemoto,T., and Inoue,H. (1988) New method for selection of hybrid
strains in protoplast fusion of yeast. Cheni. Express (Osaka) 3, 743-746.
39
Flotation Assay in Small Volumes of Yeast Cultures
Sandro Rogerio de Sousa, Maristela Freitas Sanches Peres,
and Cecilia Laluce
1. Introduction
Flocculation is a naturally occurring process of reversible aggregation (cell-cell
aggregation) of yeast cells (1), whereas flotation is defined as microbial enrich-
ment in foams (2), which can be carried out either by induced flotation (with addi-
tion of flotation agents) or spontaneous flotation (without addition of flotation
agents). The spontaneous flotation of Saccharomyces cerevisiae was first described
in 1991 by Gehle et al. (3), who correlated flotation with the ability of the strain
DSM 2155 to form cell aggregates. In 1996, Palmieri and collaborators (4) showed
that flocculation and flotation were separate phenomena, by studying a new float-
ing strain of Saccharomyces cerevisiae, which was highly hydrophobic but not
flocculant. Batch flotation has been used by a number of authors for the separation
of yeast cells (4,5), bacteria (6), algae (7), bacterial spores, vegetative cells (8),
recovery of minerals, coal and crude petroleum (9), deinking recycled pulp paper
and de-oiling water (10,11).
Measurement of flotation parameters has been described for yeast (3 ,4) : ( 1 ) cell
recovery (percentage of the total cells from the medium present in the foam; Sub-
heading 3.3., step 1), (2) enrichment factor (cell concentration in the liquid foam
or "yeast cream" divided by the initial concentration in the medium before flota-
tion; Subheading 3.3., step 2), expressing how much higher the concentration of
the cells in the liquid foam is, compared with that in the initial medium, and (3) con-
centration factor (cell concentration liquid foam divided by the concentration in
the residual medium after flotation; Subheading 3.3., step 3) expressing how much
greater the concentration of cells in the liquid foam is, compared with that in the
residual medium left in the column after flotation.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
349
350 de Sousa, Peres, and Laluce
During the injection of air into the medium, a volume of liquid foam (Vs)
proportional to the initial volume of medium (Vp) is formed, leading to a correlation
factor Vr. Vp~ l (factor of volumetric changes; Subheading 3.3., step 4), which
varies from zero (Vr is zero, when all the medium spills out from the column) to 1
(residual medium Vr = Vp, when no foam is formed or a small volume of foam
that does not spill out of the column is obtained). As part of the medium is drained
off the culture as a liquid phase entrapped among the air bubbles, the cell concen-
tration in the foam is dependent on the bubble size (lower or higher water content
among the bubbles) generated by the culture (12) and the affinity of the cells for the
air bubbles. Thus, the flotation efficiency (FLT EFF . Subheading 3.3., step 5) is
another parameter, which expresses the percentage of the total cells in a volume Vp
of medium (added to the column initially) and transferred to the foam by flotation.
The flotation efficiency varies with the changes in the affinity of the cells for the air
bubbles and/or the volume of medium entrapped among the bubbles. The flotation
ability the yeast cells changes with the total hydrophobicity of cell surface (4),
which can be measured by the affinity of cells (bacteria or yeasts) to the organic
phase formed whenp-xylene is added to the cell suspension (4,13).
The flotation process is well known for being relatively economical and has
been applied to separations in large volumes of liquid, such as in recovery of
minerals and waste residue treatments. A great deal of research is lacking in
this area for a better understanding of the flotation phenomenon and its appli-
cation to industrial microbial processes in which complex media are used.
Simple and fast assays are helpful for physiological and genetic studies when
great numbers of measurements are required. In this chapter, a simple system
for measurement of batch flotation and the operation of the system for the
determination of flotation parameters in cultures of yeast cells are described.
Comparing the flotation ability among yeast strains, effects of determina-
tion of medium composition on flotation, and choice of a suitable frother or
collector can be obtained using this simple system.
2. Materials
1. Flotation system as described in Subheading 3.1., step 1.
2. Yeast culture grown for 12-48 h in a chemically synthetic medium, described by
Brown et al. (15) and modified by Palmieri et al. (5), prepared as follows (g/L of
distilled water):
a. Carbon source: glucose, 20 g.
b. Salt mixture (150 ml added to 1 L medium): Ammonium sulfate (20.8 g),
KH 2 P0 4 (13.3 g), MgS0 4 -7H 2 (3.6 g), NaCl (0.7 g), and CaCl 2 (0.6 g).
Sterilize the mixture in autoclave for 20 min at 120°C (1 atm pressure).
c. Trace element mixture (104 \ih/L added to each liter of medium): H 3 B0 3 (0.1 g),
MnSQ 4 , ZnS0 4 -7H 2 (0.7 g), FeCl 3 -6H 2 (0.5 g), KI (0.1 g), and CuS0 4 -5H 2
Flotation Assay in Small Volumes of Yeast Cultures 351
(0.1 g). Lower the pH of the mixture to values around 1.0, with the addition of
HO solution (to avoid salt precipitation during storage at 4°C) and sterilize in
autoclave for 20 min at 120°C (1 atm pressure).
d. Growth factor mixture (2 mL mixture added to each liter of medium): myo-
inositol (15 g), calcium pantothenate (2.4 g), pyridoxine-HCl (2.4 g),
thiamine-HCl (8.4 g), and biotin (0.18 g). Sterilize the solution by filtration
(filter membrane of 0.22 ^im pore size from Millipore, GSWP 025 00).
3. Stationary culture of yeast cells grown at 30°C (10 7 -10 8 cells/mL after 12-48 h)
in a rotary shaker operated at 150 rpm.
4. Filtration membranes (filter membrane of 0.65 f^m pore size from Millipore,
DAWP 025 00).
5. Infrared lamp.
3. Methods
3. 7. Setup of the Flotation System
1. Attach a glass compartment to a 50-mL graduated cylinder (30 cm high and
2.5 cm inner diameter) at a distance of 20 cm from the bottom of the column, so
that the upper part of the glass cylinder is located inside the compartment for
foam collection, as shown in Fig. 1.
2. Connect a flowmeter with a standard valve (Cole-Parmer, P-032 16-55) at the air
line between the compressor and the air outlet tube.
3. Attach a microporous sparger (Cole-Parmer, model H-0 19 19-59) at the terminal
end of the air outlet tube, located at the bottom of the glass cylinder (Fig. 1).
3.2. Operation of the Flotation System
1. Add 10-12 mL culture of known biomass (Vp) to the flotation column (14).
2. Aerate for 2 min at 0.36-0.48 L/min airflow rate (14).
3. Add 2-3 drops of amyl-alcohol to the foam before measurement of the biomass
in the liquid foam (Cs).
4. For measurement of biomass in the initial culture (Cp), liquid foam (Cs), and
residual volume of the medium (Cr) resulting from flotation, harvest and wash
the cells with water by filtration, and dry up the Millipore membranes at constant
weight under an infrared lamp for 3 h.
3.3. Calculation of the Flotation Parameters
1. Total cell recovery or flotation yield obtained as follows (4):
FLT(%) = [(Cp-Cr)/Cp~ l ] x 100
2. Enrichment factor calculated as follows (3):
Enrichment factor (undimensionless) = CsCp~ l
352
de Sousa, Peres, and Laluce
Fig. 1. Apparatus used for flotation: A = during flotation and B = after flotation. A
"yeast cream" (0.1-0.2 mL), containing practically all the cells present in 11 mL of
medium (0.5 mg/mL initial concentration), was collected in the foam compartment
located at the top of the column. The flotation time was 2 min. (From ref. 14.)
3. Concentration factor calculated as follows (3):
Concentration factor (undimensionless) = CsCr~ l
4. Factor of volumetric changes, calculated as follows:
Factor of volumetric changes (undimensionless) = VrVp~ l
5. Flotation efficiency or FLT EFF obtained as follows:
FLT EFF (%) = [(Cp-Cr)Vr(CpVp)- 1 ] x 100
where FLT EFF (%) = [(biomass in the foam obtained from an initial volume of
medium equivalent to Vr) x (total biomass in the medium before flotation or
CpVp)- 1 x 100.
An efficiently cell recovery (>90%) by flotation requires a highly hydro-
phobic cell wall (80%) (4); and flotation parameters are dependent on both the
initial cell concentration and flotation time (14).
Flotation Assay in Small Volumes of Yeast Cultures 353
Acknowledgments
The authors thank Dr. J. T. F. Spencer for the opportunity of having a chap-
ter included in this book and Ms. Doris Barnes for the careful reading of the
manuscript.
References
1. Calleja, G. B. (1987) Cell aggregation, in The Yeasts, Vol. 2, 2nd ed., (Rose, A. H.
and Harrison, J. S., eds.), Academic, London, pp. 165-238.
2. Dognon, A. and Dumonte, A. (1941) Concentration et separation des
microorganismes par moussage. CR Soc. Biol. 135, 884-887.
3. Gehle, R., Sie, T. L., Kramer, T., and Schurgerl, K. (1991) Continuous cultivation
and flotation of Hansenula polymorphs and Saccharomyces cerevisiae in an
integrated pilot plant reactor-flotation column-system. /. Biotechnol. 17,147-154.
4. Palmieri, M. C, Greenhalf, W., and Laluce, C. (1996) Efficient flotation of yeast
cells grown in batch culture. Biotechnol. Bioeng. 50, 248-256.
5. Hashim, M. A., SenGupta, B., Kumar, S. V., Lim, R., Lim, S. E., and Tan, C. C.
(1998) Effect of air to solid ratio in the clarification of yeast by colloidal gas
aphrons. /. Chem. Technol. Biotechnol. 71, 335-339.
6. Grieves, R. B. and Wang, S. L. (1966) Foam separation of Escherichia coli with a
cationic surfactant. Biotechnol. Bioeng. 8, 323-336.
7. Levin, G. V.,Clendenning, J. R.,Gibor, A., and Bogar, F. D. (1961) Harvesting of
algae by froth flotation. Appl. Microbiol. 10, 169-175.
8. Boyles, W. A. and Lincoln, R. E. (1958) Separation and concentration of bacterial
spores and vegetative cells by foam flotation. Appl. Microbiol. 6, 327-334.
9. Hornsby, D. and Leja, J. (1982) Selective flotation and its surface chemical
characteristics, in Surface and Colloid Science (Matijevic, E., ed.), Plenum, New
York, vol. 12, pp. 217-313.
10. Huls, B. J. (1994) When innovations occur: their effect on a large mining
company, in Innovations in Mineral Processing (Yalcin, T. ed.), Acme, Sudbury,
Canada, pp. 1-14.
11. Finch, J. A. (1995) Column flotation: a selected review-Part IV: novel flotation
devices. Min. Eng. 8: 587-602.
12. Gaden, E. L., Jr., and Kevorkian, V. 1956 Foams in chemical technology. Chem.
Eng. 63, 151-184.
13. Rosenberg, M., Gutnick, D., and Rosenberg, E. (1980). Adherence of bacteria to
hydrocarbons: a simple method for measuring cell surface hydrophobicity. FEMS
Microbiol. Lett. 9, 29-33.
14. De Sousa, S. R. and Laluce, C. (2000) Flotation assays in small volumes of yeast
cultures. Biotechnol. Lett., in press.
15. Brown, S. W., Sugden, D. A., and Oliver, S. G. (1984) Ethanol production and
tolerance in grand and petite yeast. /. Chem. Tech. Biotechnol. 34B, 116-120.
40
Obtaining Strains of Saccharomyces Tolerant
to High Temperatures and Ethanol
Maristela Freitas Sanches Peres, Sandro Rogerio de Sousa,
and Cecilia Laluce
1. Introduction
Strains tolerant to high temperatures, ethanol levels, and high concentrations
of sugar are highly desirable for a fermentation process. The maintenance of a
high degree of viability during the operation of a process, biomass storage, and
pauses between batches is fundamental. Fermentations at 35-40 °C or higher
have the advantage of facilitating ethanol recovery, leading to significant sav-
ings on operational costs of refrigeration.
Mutants may arise either during cell-cycle progression (natural mutants) or
adaptation to the process in response to environmental stresses (1-5).
Prolonged exposure to different types of stresses, such as anaerobiosis (6),
nutrient starvation at the stationary phase (7), high levels of ethanol, low pH,
and high temperature occur either during process operation or over long peri-
ods of biomass storage. Alterations in cell morphology induced by "fusel"
alcohols have also been described (8), and chromosomal rearrangements have
been observed for Saccharomyces cerevisiae in a continuous process, when
growth was limited by the concentration of organic phosphate (9).
Mutation associated with positive selection can improve the process (enrich-
ment with the improved mutant) and the original strain is supplanted by variants
and/or contaminants from the environment in a matter of time. Thus, a
continuous process or batch process with cell reuse could be a source of useful
industrial strains. Industrial fermentations for ethanol and beverage production
do not occur under aseptical conditions. A screening program for isolation and
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
355
356 Peres, de Sousa, and Laluce
evaluation of yeasts for fuel ethanol production was carried out in our labora-
tory from 1985 to 1993, supported by the Funda?ao Banco do Brasil (funds
from Brazil Bank, proc. FIPEC/1- 1337-4 and proc. FBB/10-1078-2). Yeasts
are usually submitted to nutritional and temperature stresses during the process
operation at a number of Brazilian alcohol plants. Methods of strain screening
and measurement of tolerance were compared and thermotolerant strains,
which were also tolerant to high concentrations of sugar and external ethanol,
were obtained (10-15). At present, Brazilian alcohol plants are already using
yeasts isolated during operation of the fermentation process.
Screening of yeasts for glucose fermentation at 40 °C showed that strain 62
of S. diastaticus was the most thermotolerant yeast out of a total of 65 yeast
strains from various genera (16). Strain 62 was found capable of completely
utilizing 15% glucose at 40°C, producing 6.38% ethanol (w/v) and showing
good cell viability (80.5%) after 24 h fermentation. Similarly, an Indian
distiller's yeast (Saccharomyces) produced 6.9-7% ethanol (v/v), fermenting
15% glucose (17). Thermotolerant yeasts (genus Saccharomyces) isolated from
Brazilian alcohol plants (10 thermotolerant strains out of a total of 460 iso-
lates), showed higher ethanol yields at 40°C than the baker's yeast strains used
as starters (10,13) for a long period. The screening procedure, used for samples
collected from Brazilian alcohol plants, was based on measurements of the
levels of ethanol and viability at the end of the fermentation of 25% sucrose in
a rich medium at 40°C (10). Under such stressful conditions, the screening was
oriented toward the selection of thermotolerant yeasts, which were also toler-
ant to high ethanol and sugar concentrations.
The assay of the glycerol-3-phosphate dehydrogenase (not included among
the procedures described in this chapter) seems to be helpful in the evaluation
of strains tolerance to ethanol. Cells of strain MT-2, which accumulated less
ethanol and biomass in the medium during growth, also showed high levels of
intracellular glycerol-3-phosphate dehydrogenase (15). Similarly, higher lev-
els of glycerol were also obtained for thermotolerant strains of S. cerevisiae,
during the fermentation of grape juice, as compared to levels attained using
nonthermotolerant strains (18). The activity of invertase attached to the cell
wall is important when sucrose is the carbon source. It is also dependent on
increases in temperature (15).
7. 7. Assessment of Thermotolerance
Ethanol and temperature have several effects on yeast and fermentation
processes (13,14,19). Levels of ethanol formation and viability are good
indicators of thermotolerance in fermentation processes operated at high cell
density; growth is another important indicator of tolerance at low cell density.
Thermotolerance of the isolates (S. cerevisiae) obtained from Brazilian alco-
Saccharomyces Tolerant to High Temperatures and Ethanol 357
hoi plants were assessed on the basis of maintenance of viability, biomass, and
ethanol formation, during fermentation of 15% sugar-cane syrup (total reduc-
ing sugar, w/v) at 40°C (13). Isolates that were thermotolerant under agitation
conditions, became relatively thermosensitive (low viability) in fermentations
carried out under nonagitated conditions (13). The biorectors used in the
alcohol plants for fuel ethanol production are not operated under agitated
conditions. The ethanol yields depend on the interactive effects established
between sugar concentration in the medium and temperature. As a result of
increases in the total reducing sugar from 22.5% to 33.5% (nonagitated flasks),
inhibition of ethanol formation and decreases in viability at 40°C were observed
for the thermotolerant isolates, and the highest levels of ethanol were reached
at 35 °C (optimum temperature at high sugar concentration) (13). Thus, ethanol
formation at temperatures above 35 °C are greatly limited by increases in sugar
concentration, as well as by increases in the temperature.
A thermotolerant strain should first be evaluated in repeated batch
fermentations in 20-mL test tubes before the final evaluation in a 5- to 30-L
fermentor, as described in Subheading 3.8., step 1, for the assessment of ther-
motolerance during cell recycling in repeated batch fermentations. Figure 1
shows the changes in viability and ethanol formation, during the fermentation
of 10% sugar-cane syrup at 40°C by the thermotolerant yeast 78 I (S. cer-
evisiae) in repeated batches (for 24-h cycles). The viability was high (ranging
from 75-90%), the final ethanol was 5-6% (v/v), and the residual sugar was low
(0.5-1.5 %, w/v). Growth was observed at the end of each 5-h cycle (early sta-
tionary phase), leading to rises in biomass from 1 1.0- to 14.5-mg/mL initial cells
to 13.5- to 15.5-mg/mL final cells. The final biomass was constant after five
fermentation cycles and the residual sugar was low ([0.5-1.0] ± 0.5%, w/v).
7.2. Assessment of Alcohol Tolerance
The inhibitory effect of ethanol on growth is greater than on fermentation
and dependent on the strain and composition of the medium. It is also well
known that the accumulation of ethanol in yeast cultures leads to decreases in
viability, growth, and ethanol formation. The effects of ethanol on yeasts are
still not extensively understood and some methods used to determine ethanol
tolerance in yeasts are not universally accepted. A variety of definitions and
methods used to determine ethanol tolerance under different conditions have
been proposed for alcohol tolerance by a number of authors (15,20-23). Meth-
ods for the measurement of internal ethanol are controversial and the informa-
tion obtained provides little help for the understanding of the toxic effects (24).
Production of high levels of ethanol requires a strain that should be tolerant
to both high sugar concentration and levels of external ethanol, for yeast cells
are continually being exposed to external ethanol during fermentation
358
Peres, de Sousa, and Laluce
e
£
Dit
s
£
V— *"
C/3
C/l
V)
tSi
<n
£
o
o
JO
^J
B_
■•
efl
rt
C
fa
t-100
I ' > ' I ' I ' I
5 10 15 20 25
— • — i — • — i — > — i — ■ — i — ■ — r
5 10 15 20 25
Number of Cycles
Fig 1. Effect of cell recycling (isolate 781) in batch fermentations at 40°C using
diluted sugar-cane syrup as the raw material containing 10% total reducing sugar, and
11- to 14-mg/mL initial cells at the beginning of the fermentation cycles.
processes. Thus, the resistance of 5. cerevisiae strains to high levels of added
ethanol (7% external ethanol, v/v) in a medium of high sugar concentration
(19-20%, w/v) seems to be a reasonable criterion for the screening of alcohol-
tolerant strains at 30°C and low initial cells in a rich medium (15). As growth
and fermentation take place simultaneously, biomass formation was another
indicator of alcohol tolerance in the medium containing 19-20% initial sucrose
and external ethanol added initially. Constant levels of final ethanol (16.5-20.3%
ethanol produced plus the amount added) and total sugar consumption were
observed, when ethanol was added to the medium over a range from 2-8% or
2-6% (v/v) initial concentration, depending on the strain. Inhibition of growth
was observed for wall ethanol additions over a range from 2-9% initial ethanol
(15). In Fig. 2, strain MT-2 shows the accumulation of 17.3% final ethanol
(produced and added to the medium, v/v), when the initial reducing sugar was
19% in the sugar-cane syrup and the ethanol added initially was 6% (v/v).
Final ethanol increased, reaching the highest level (17.3%, v/v) at 6% added
ethanol, whereas the produced ethanol was constant (1 1.3%, v/v), and a total
sugar consumption observed over a range from 2—A% (v/v) ethanol added ini-
tially. The measurements of viability, ethanol, and residual sugar were made at
the early stationary phase for each concentration of added ethanol, and the
Saccharomyces Tolerant to High Temperatures and Ethanol
359
>
S
>
u t
W) o S
0>
3
"3
3
0>
o
c
05 *.
S
• MM
to
J3
Ed
20-
8 10
[ Initial ethanol, %, v/v ]
Fig 2. Effect of the concentration of ethanol (%, v/v), added initially to the medium, on
fermentation (A) and biomass formed by strain MT-2 (B). Residual sugar and final etha-
nol (produced plus added initially) were measured at the late stationary phase (after 7 d).
Symbols for viability: (▼), 2 d; (♦), 7 d.
biomass formation was greatly decreased above 6% ethanol added initially to
the medium.
Losses in viability are minimized by the decreases in growth and
fermentation rates, when the levels of external ethanol rises during fermenta-
tion or is added to the medium (13 ,15,19). Thus, more ethanol can be obtained
at the expense of less biomass formation in fermentation process, when both the
level of external ethanol and the temperature of process are properly adjusted.
Maintenance of high levels of viability, ethanol yields, as well as the control of
the rate of the entire process can be obtained by adjustment of levels of the exter-
nal ethanol and temperature.
The control of aeration is important in assessing strain tolerance to ethanol
and temperature. Strains that produce high levels of ethanol, and maintain rela-
tively high viability in agitated cultures may show great losses in viability in
nonagitated cultures (14). In addition, cell density utilized must be taken into
consideration for the obtention of reproducible data in evaluation of tolerance
of the isolates to ethanol and temperature. Less growth and increased product
formation have been observed with the increases in cell density, as significant
changes in the cell physiology occur when the cell density is raised (25-28).
360 Peres, de Sousa, and Laluce
2. Materials
2. 7. Media
1 . YPD medium for plating of samples and maintenance of cultures prepared in 2 mL
vials: 1% yeast extract, 2% peptone, 2% glucose, and 2% agar. Sterilize at 120°C
and 1 atm pressure for 15 min.
2. Modified YPD medium containing rose bengal and propionic acid for obtention
of isolates (29): Dissolve the agar (2%) by boiling the medium and adding both
the rose bengal (0.003%) and propionic acid (0.19%, v/v) before pouring into the
plates (for use in Subheading 3.5., step 2). Sterilization is not required.
3. Raw material (10% total reducing sugar, w/v) for inoculum growth (to prepare
70 mL initial medium as described in Subheading 3.4.): 70 mL raw material
(syrup or molasses) in a 250-mL Erlenmeyer flask. Sterilize at 120° C and 1 atm
pressure.
4. Raw material (25% total reducing sugar, w/v) for screening of isolates at
40°C (to prepare 15 mL initial medium as decribed in Subheading 3.5.,
step 5): 9.87 mL diluted raw material (38% syrup or molasses, v/v) at pH
4.5 (adjusted with H 2 S0 4 ) added to a loosely capped test tube (180 mm high
and 15 mm inner diameter) before sterilization (120°C and 1 atm pressure
for 15 min).
5. Raw material (15% total reducing sugar, w/v) for assessment thermotolerance
to 40°C (to prepare 70 mL initial medium as described in Subheading 3.6.,
step 1, and Subheading 3.7., step 1): Add 52.5 mL raw material (20% syrup
or molasses, w/v) at pH 4.5 (adjusted with H 2 S0 4 ) in a 250-mL Erlenmeyer
flask and close with rubber stopper perforated with a needle. Sterilize at
120°C and 1 atm pressure for 15 min.
6. Raw material (10% total reducing sugar [w/v] at pH 4.5) for the repeated batch
fermentations at 40°C (20 mL initial volume as described in Subheading 3.8.,
step 1): Add 10 mL raw material (20% syrup or molasses, w/v) to a 50-mL
centrifuge tube and close with a rubber stopper perforated with a needle. Sterilize
at 120°C and 1 atm pressure for 15 min.
7. Raw material (20% total reducing sugar, w/v), for alcohol-tolerance studies at
30°C (to prepare 70 mL initial medium as described in Subheading 3.9.,
step 1): Place 50 mL raw material (28% total reducing sugar, w/v) in a 250-mL
Erlenmeyer flask closed with rubber stopper perforated with a needle. Sterilize
at 120°C and 1 atm pressure for 15 min and add 4.9 mL absolute ethanol after
cooling at room temperature.
Use of the raw material gives more validation to the assessment of thermotol-
erant yeasts and/or alcohol tolerant yeasts for industrial applications. The fer-
mentation process is greatly dependent on the medium and its nutritional
supplementation (30-32). The addition of nutritional supplementation will def-
inately change the results. Improvements (data not shown) in growth and ethanol
Saccharomyces Tolerant to High Temperatures and Ethanol 361
formation by strain 781 grown on sugar-cane syrup (15% total reducing sugar) at
40°C were obtained with addition of 0.05% yeast extract and other extracts (addi-
tions equivalent to the presence of 3-4% solid supplement in the medium)
obtained when concentrated suspensions of wheat bran, wheat germ, and castor
oil bran were autoclaved for 10 min at 120°C and 1 atm. Saponified lipids (soy
bean lecithin and peanut oil) led to remarkable increases in biomass (mainly
below 40°C) and final viability when the 0.05-0.5% solid precipitate resulting
from ethanol evaporation (after saponification) was present in the medium.
2.2. Other Materials and Solutions
1. Filtration membrane of 0.65 f^m pore size from Millipore (DAWP 025 00).
2. Filtration membrane of 0.22 jam pore size from Millipore (GSWP 025 00).
3. Infrared lamp or an oven at 105°C.
4. Analytical balance.
5. Aluminum pans (for use with membrane filters in dry weight determinations).
6. Standard hemocytometer chamber.
7. Gas chromatography operating with flame ionization detector.
8. Sorvall centrifuge (model RC-5B) operating with the rotor SS-34.
9. Eppendorf microcentrifuge (model 5415C).
10. DNS solution (33): 3.5-dinitrosalycilic acid (5 g) plus 100 mLNaOH (2N), solid
KNaC 4 H 4 6 (150 g), and distilled water to make up a 250-mL final solution.
11. Reducing sugar solution (33): glucose (90 mg) plus fructose (90 mg) in 100 mL
distilled water.
12. Methylene blue solution (g/100 mL distilled water) (34): 0.025 g methylene blue,
0.9 g NaCl, 0.048 g KC1, 0.048 g NaHC0 3 , 1 g glucose.
13. A shaker (New Brunswick Scientific Co. Inc., model no. G-25) for propagation
of cultures.
3. Methods
3. 1. Biomass Determination
1. Wash the cells obtained from 1- to 2-mL cell suspension with distilled water in
a membrane filter (0.65 ^im pore size) and dry up the filters containing the
washed cells for 3-4 h under an infrared lamp or 16 h in an oven at 105°C.
Weigh the filters (triplicates of preweighed aluminum pans) after the drying of
the samples and express the dry weight in milligrams per milliliter.
2. Correlate dry weights (mg/mL) (abscissa) with the absorbance units (assay-
blank) of the cell suspensions at 600 nm (ordinate) to obtain the standard curve
for biomass determination.
3. Convert absorbance of the unknown samples (600 nm) into biomass by using
the standard curve or multiplying the inverse of the tangent from the standard
curve by the absorbance of the unknown samples.
362 Peres, de Sousa, and Laluce
3.2. Cell Viability (34)
1. Dilute the cell suspension ([2-4] x 10 8 cells/mL) and mix 0.1 mL diluted suspen-
sion with 0.9 mL of methylene blue solution (Subheading 2.2., item 12).
2. Load the hemocytometer with the dye solution and count the cells, as
recommended by the standard counting procedure (35).
3. Count yeast cells in 10 min and express the viability as a percentage of the total
cells that have lost the capacity of reducing the methylene blue. The vital cells
are colorless and the dead (or low-vitality cells) are blue.
Measurements of viability must be obtained at the early stationary phase for
evaluation of tolerance to the temperature, while it is still high (15). Decreases
in viability caused by both the fermentation time and temperature, have been
observed at the stationary phase, whereas the biomass and ethanol levels re-
main constant. However, the losses in viability are greatly diminished in the
presence of ethanol added initially to the medium, when the tolerance to exter-
nal alcohol is assessed under conditions described in Subheading 3.9.
3.3. Total Reducing Sugar (33)
1. Prepare two tubes, one containing 1.5 mL water and 1.5 mL of diluted samples,
and a second tube containing 3 mL water blank.
2. In order to obtain the standard curve, prepare five tubes containing 3 mL diluted
standard solution (standard reducing solution prepared as described in Subhead-
ing 2.2., item 11, plus water), with different concentrations of reducing sugar.
3. Add 5 mL distilled water to all tubes.
4. Add 1.5 mL DNS solution (Subheading 2.2., item 10).
5 . Boil the tubes in a water bath for 3 min, cool rapidly, add 1 mL distilled water, and
read the optical density at 540 nm against the tube containing 3 mL water (blank).
6. The difference in absorbance between the tubes containing sugar and the blank
gives the amount of reducing sugar, when read on the standard curve obtained
(plot of reducing sugar [mg/mL] vs absorbance units).
3.4. Inoculum Growth
1 . Transfer a loopful of cells from a fresh stock culture to a 250-mL Erlenmeyer flask
containing 70 mL of diluted raw material (10% total reducing sugar, Subheading
2.1., item 3), and cultivate for 24 h at 30°C in a shaker operating at 170 rpm).
2. Decant the cell overnight in a refrigerator at 4°C, aspirate, and discard the superna-
tant. The concentrated cell suspension is used as the inoculum (48-60 mg/mL).
3. Determine the biomass of the cell suspension by filtering and washing the cells in a
membrane filter from Millipore or by reading the absorbance, as described in
Subheading 3.1.
3.5. Obtention and Screening for Tolerant Isolates (10)
1. Take samples (100 mL cell suspension) from more than one bioreactor in a fuel
alcohol plant, operated daily for more than 1 mo in batch process with cell reuse
(at the end of each batch) or at the fermented wort outlet in a continuous culture.
Saccharomyces Tolerant to High Temperatures and Ethanol 363
2. Plate each sample (three Petri dishes) to obtain colonies on YPD medium
containing Rose Bengal and propionic acid (Subheading 2.1., item 2). Incubate
the plates for 5 d at 30°C for single colony formation.
3. Select isolates (5-10 colonies) on the basis of their size, morphology (rough or
smooth), and rose bengal assimilation by the cells (white to deep-pink colonies).
4. Transfer the isolates to vials containing YPD medium and maintain the stock
cultures at 4°C after 2 d growth at 30°C.
5. Inoculate the tubes containing 25% total sugar as described in Subheading 2.1.,
item 4, and the cultures (4.5 x 10 8 cells/mL) are incubated for 12 h at 40°C. Levels
of ethanol as high as 10.0-1 1.5% (v/v) are obtained for the tolerant isolates.
3.6. Thermotolerance (Biomass and Ethanol Yields and Viability
as Determinant Factors) in Low-Cell Density Fermentation (14)
1. Inoculate 52.5 mL of diluted raw material (containing 20% sugar-cane juice or
molasses, as described in Subheading 2.1., item 5) with the concentrated
inoculum (Subheading 3.1.) plus water to reach a total volume of 70 mL culture
containing 15% total reducing sugar and 0.025 mg/mL initial cells (dry weight).
Transfer the cultures to a shaker at 40°C operating at 170 rpm.
2. Measurement of biomass after 4 d: values not exceeding 1.3-1.7 mg/mL (dry
weights) in nonagitated cultures and 2.0-4.0 mg/mL in shaken cultures, when
sugar-cane juice is used.
3. Measurements of ethanol: values not exceeding 7.5-9.9% ethanol (v/v) after 8 d
in nonagitated cultures and 9.0-9.9% ethanol (v/v) after 5 d in agitated cultures,
when sugar-cane juice is used.
4. Measurements of viability: values as high as 80-90 % after 4 d in nonagitated
cultures and 88-100% after 3 d in agitated cultures, when sugar-cane juice is used.
3.7. Thermotolerance (Ethanol Yields and Viability as
Determinant Factors) in High-Cell Density Fermentation (13)
1. Inoculate 52.5 mL raw material (20% sugar-cane juice or molasses, as described
in Subheading 2.1., item 5) with concentrated inoculum (Subheading 3.1.) plus
water to make up 70 mL culture containing 15% total reducing sugar and
20 mg/mL initial cells (dry weight). Incubate at 40°C without shaking.
2. Measurements of ethanol after 12 h: ethanol levels as high as 8-10% (v/v) can be
obtained when sugar-cane syrup is used without nutritional supplementation.
3. Measurements of viability after 9 h: values as high as 50-90% can be obtained
(depending on the strain) when sugar-cane syrup is used.
3.8. Thermotolerance (Ethanol Yield and Viability as Determinant
Factors at 40° C) During Cell Recycling in Repeated Batch
Process of High Cell Density
1. Add the inoculum (concentrated cell suspension prepared as described in
Subheading 3.1.) and sterilized water (as described in Subheading 2.1., item 6)
364 Peres, de Sousa, and Laluce
to reach 20 mL initial culture containing 10% total sugar and 10 mg/mL initial
cells when sugar-cane syrup is used.
2. Transfer the tubes to a water bath at 40°C and incubate for 6 h before sampling
(0.1 mL cell suspension) for determination of viability.
3. Centrifuge the tubes at 8000g for 5 min and discard the supernatant after determi-
nation of the final ethanol (produced plus added initially to the medium) and
residual sugar without nutritional supplementation.
4. Resuspend the cells by vortexing the pellet with part (10 mL) of the fresh
medium (20% total reducing sugar), and add more fresh medium plus water to
the suspension to obtain 20 mL of the final suspension containing 10% total
sugar and 10.0 mg/mL initial cells. Incubate for another additional 5- to 6-h
period.
5. Repeat steps 2-4 of Subheading 3.8. (20 fermentation cycles) as illustrated in
Fig.l.
Repeated batch fermentations at 40°C (as described in Subheading 2.1.,
item 6, for the evaluation of maintenance of thermotolerance during cell reuse
at high cell density) cannot be carried out when sugar concentration is high.
Considerable growth is maintained during the repeated baths using 10% sugar-
cane syrup as shown in Fig. 1. When the sugar concentration is raised above
22% (total reducing sugar) in single-batch experiments, remarkable inhibitory
effects of the temperature on viability and ethanol formation were observed at
above 35°C (8,13).
Increases in temperature and ethanol induce mutation mainly in processes
with cell reuse (3,5). Strain 781 was submitted to a great number of fermenta-
tion cycles (82 cycles) and samples were plated on medium containing glyc-
erol as sole carbon source for evaluation of respiratory competence (data not
shown). Decreases in the size and increases in the number of colonies showing
no growth on glycerol medium were observed during the repeated cycles.
Above the 50th cycle, decrease in number of small colonies occurred followed
by the appearance of colonies (normal size after growth on glycerol medium)
showing improved tolerance (higher biomass yield, fermentation activity, and
viability) to fermentation at 40°C.
3.9. Alcohol Tolerance (Biomass, Ethanol Formation, and Viability
in the Presence of 7% Added Initially to the Medium, as Determinant
Factors) in Low-Cell-Density Fermentation at 30° C (15)
1. Add concentrated inoculum (Subheading 3.1.) and sterilized water to Erlen-
meyers flasks containing 50 mL raw material (28% total reducing sugar, w/v)
and 4.9 mL absolute ethanol (as described in Subheading 2.1., item 7) to reach a
70-mL final volume of medium (20% initial reducing sugar, 7% initial ethanol
[v/v], and 0.025-mg/mL initial cells). Incubate the cultures at 30°C in a shaker
operated at 170 rpm.
Saccharomyces Tolerant to High Temperatures and Ethanol 365
2. Measurements of biomass, final ethanol, and viability at early stationary phase
(4 d without to 5-7d with ethanol added initially): values of biomass as high as
3.0-3.5 mg/mL for biomass, 15-17% final ethanol (produced plus added ini-
tially), and 85-95% viability are obtained when sugar-cane syrup is used without
nutritional supplementation.
As ethanol added initially to the medium (6-8% ethanol, v/v) has no effect
on the final ethanol formation (depending on the strains, the medium, and other
operational conditions) (15,21), a limiting concentration of added ethanol
above 6% (v/v) is recommended to make the effects of external ethanol on
growth and fermentation, more evident as shown in Fig. 2.
Acknowledgments
The authors are grateful to Dr. J. F.T. Spencer for the opportunity of having
this chapter included in this book and Ms. Doris Barnes for the careful reading
of the manuscript.
References
1. Cairns, J.,Overbaugh, J., and Miller, S. (1988) The origin of mutants. Nature 335,
142-145.
2. Foster, P. L. (1993) Adaptive mutation: the uses of adversity. Ann. Rev. Microbiol.
47, 467-504.
3. Watson, K. (1987) Temperature relations, in The Yeast: Yeast and the Environment
(Rose, A. H. and Harrison, J. J. eds.), Academic, New York, pp. 41-71.
4. Jinks-Robertson, S., Greene, C, and Chen, W. (1998) Genetic instabilities in
yeast, in Genetic Instabilities and Hereditary Neurological Diseases (Wells, R. D.
and Warren, S. T., eds.), Academic, San Diego, pp. 485-507.
5. Laluce, C. (1997) Variability in yeast cultures and mutants generated by process
conditions, in Ciencia de Alimentos: Avangos e perspectivas na America Latina
(Rodriguez-Amaya, D. B. and Pastore, G. M., eds.), Faculdade de Engenharia de
Alimentos, Campinas, Brasil, pp. 172-176.
6. Pahl, H. L. and Baeuerle, P. A. (1994) Oxygen and the control of gene expression.
BioEssays 16, 497-502.
7. Werner-Washburne, M., Braun, E., Johnston, G. C, and Singer, R. A. (1993) Station-
ary phase in the yeast Saccharomyces cerevisiae. Microbiol. Rev. 57, 383-401.
8. Dickinson, J. R. (1996) "Fusel" alcohols induce hyphal-like extensions and
pseudohyphal formation in yeasts. Microbiology 142, 1391-1397.
9. Adams, J., Puskas-Rozsa, S., Simlar, J., and Wilke, C. M. (1992) Adaptation and
major chromosomal changes in populations of Saccharomyces cerevisiae. Curr.
Genet. 22, 13-19.
10. Laluce, C, Bertolini, M. C, Hernandes, J., Martini, A., and Martini, A. V. (1987)
Screening survey for yeasts that ferment sucrose at relatively high temperature.
Ann. Microbiol. 37, 151-159.
366 Peres, de Sousa, and Laluce
11. Ernandes, J. R., Matulionis, M., Cruz, S. H., Bertolini, M. C, and Laluce, C.
(1990) Isolation of new ethanol-tolerant yeasts for fuel ethanol production from
sucrose. Biotechnol. Lett. 12, 463-468.
12. Bertolini, M. C, Ernandes, J. R., and Laluce, C. (1991) New yeast strains for
alcoholic fermentation at higher sugar concentration. Biotechnol. Lett. 13, 197-202.
13. Laluce, C, Palmieri, M. C, and Cruz, R. C. L. (1991) Growth and fermentation
characteristics of new selected strains of Saccharomyces at high temperatures and
high cell densities. Biotechnol. Bioeng. 37, 528-536.
14. Laluce, C, Abud, C. L., Greenhalf, W., and Peres, M. F. S. (1993) Thermo-
tolerance behavior in sugar cane syrup fermentations of wild type yeast strains
selected under pressures of temperature, high sugar and added ethanol. Biotechnol.
Lett. 15,609-614.
15. Peres, M. F. S. and Laluce, C. (1998) Ethanol tolerance of thermotolerant yeasts
cultivated on mixtures of sucrose and ethanol. /. Ferment. Bioeng. 85, 388-397.
16. D'Amore, T., Celotto, G., Russell, I., and Stewart, G. G. (1989) Selection and
optimization of yeast suitable for ethanol production at 40°C. Enzyme Microbiol.
Technol. 11,411-416.
17. Banat, I. M., Nigam, P., and Marchant, R. (1992) Isolation of thermotolerant,
fermentative yeasts growing at 52°C and producing ethanol at 45°C and 50°C.
World J. Microbiol. Biotechnol. 8, 259-263.
18. Rainieri, S., Zambonelli, C, Tini, V., Castellari, L., and Giudici, P. (1998) The
enological traits of thermotolerant Saccharomyces strains. Am. J. Enol. Vitic.
49,319-324.
19. van Uden, N. (1984) Effects of ethanol on temperature relations of viability and
growth in yeasts. Crit. Rev. Biotechnol. 1, 263-272.
20. Casey, G. P. and Ingledew, W. M. (1985) Reevaluation of alcohol synthesis and
tolerance in brewer's yeast. ASBC J. 43, 75-83.
21. Casey, G. P. and Ingledew, W. M. (1986) Ethanol tolerance in yeasts. Crit. Rev.
Microbiol. 13,219-280.
22. D'Amore, T. and Stewart, G. G. (1987) Ethanol tolerance of yeast. Enzyme
Microb. Technol. 9, 322-330.
23. Kalmokoff, M. L. and Ingledew, W. M. (1985) Evaluation of ethanol tolerance in
selected Saccharomyce strains. ASBC J. 43, 189-196.
24. Pamment, N. B. and Dasari, G. (1989) Intracellular ethanol concentration and its
estimation, in Alcohol Toxicity in Yeasts and Bacteria (Van Uden, N. F., ed.),
CRC, Boca Raton, FL, pp. 147-192.
25. Quain, D. E. (1988) Studies on yeast physiology — impact on fermentation
performance and product quality. /. Inst. Brew. 95, 315-323.
26. Ratledge, C. (1987) Biochemistry of growth and metabolism, in Basic Biotechnology
(Bu'Lock, J. D. and Kristiansen, B., eds.), Academic, London, pp 1 1-55.
27. Ratledge, C. (1991) Yeast physiology — a micro-synopsis. Bioprocess. Eng. 6,
195-203.
28. Walker, G. M. (1998) Yeast: Physiology and Biotechnology, Wiley, Chichester,
UK, pp. 101-264.
Saccharomyces Tolerant to High Temperatures and Ethanol 367
29. Booth, C. (1971) Fungal culture medium, in Methods in Microbiology, Volume 4
(Booth, C, ed.), Academic, London, pp. 49-94.
30. Dombek, K. M. and Ingram, L. O. (1986) Magnesium limitation and its role in
apparent toxicity of ethanol during yeast fermentation. Appl. Environ. Microbiol.
52,975-981.
31. Thomas, K. C. and Ingledew, W. M. (1992) Production of 21% (v/v) ethanol by
fermentation of very high gravity (VHG) wheat mashes. /. Ind. Microbiol. 10, 6 1-68.
32. Jones, A. M. and Ingledew, W. M. (1994) Fuel alcohol production: appraisal of
nitrogenous yeast foods for very high gravity wheat mash fermentation. Process
Biochem. 29, 483-488.
33. Naudin, O., Boudarel, M. J., and Ramirez, A. (1986) Measurement of yeast
invertase during alcoholic fermentation. Biotechnol. Lett. 8, 591-592.
34. Lee, S. S., Robinson, F. M., and Wang, H. Y. (1981) Rapid determination of yeast
viability. Biotechnol. Bioeng. Symp. 11, 641-649.
35. Kistler, A. and Michaelis, S. (1997) Counting yeast cells with a standard
hemocytometer chamber, in Methods in Yeast Genetics (Adams, A., Gottschling,
D. E., Kaiser, C. A., and Steams, T., eds.), Cold Spring Harbor Laboratory Press,
Cold Spring Harbor, NY, Appendix G, p. 177.
41
Multilocus Enzyme Electrophoresis
Timothy Stanley and Ian G. Wilson
1. Introduction
Multilocus enzyme electrophoresis (MEE) is a method for characterizing
organisms by the relative mobilities under electrophoresis of a large number of
intracellular enzymes. These differences in mobility are directly related to
mutations at the gene locus that cause amino acid substitutions in the enzyme
coded by the gene. Differences in the electrostatic charge between the original
and substituted amino acid will affect the net charge of the enzyme, and hence
its electrophoretic mobility. Thus, it is possible to relate mobility differences
to different alleles at the gene locus for the enzyme in question. These mobility
variants are called electromorphs. The unique profile of electromorphs
produced for each strain of organism is called an electromorph type (ET).
MEE was first used in the study of the population genetics of Drosophila (1)
and humans (2). It soon became a standard technique in eukaryotic evolution-
ary biology. Later, MEE was applied to microorganisms, with extensive work
being done on the genetic structure of natural populations of bacteria (3). More
recently, it has been used in the epidemiological typing of bacteria and other
microorganisms.
2. Materials
1. Breaking buffer (stock solution). Tris 10.0 mM, Disodium EDTA 1.0 mM. Adjust
to pH 6.8 and store at 4°C. For working buffer add 0.5 mM NADF.
2. The sonicator used is a 150-W MSE model.
3. Good-quality starch is essential for successful electrophoresis. Sigma potato
starch S4501 produces a gel of high mechanical strength.
4. See Table 1 for electrophoresis buffers.
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
369
Table 1
Electrophoresis Buffers
Tris-citrate (pH 8.0)
Electrode buffer (pH 8.0)
Gel buffer
Tris
83.2 g Electrode buffer diluted
1:29
Citric acid monohydrate
33.0 g
H 2
1 L
Tris-citrate (pH 6.3)
Electrode buffer (pH 6.3)
Gel buffer (pH 6.7)
Tris
27.0 g Tris
0.93 g
Citric acid monohydrate
10.07 g Citric acid monohydrate
0.63g
H 2
1 L H 2
Tris malate (pH 7.4)
1L
Electrode buffer (pH 7.4)
Gel buffer
Tris
12.11 g Dilute electrode buffer 1:10
Maleic acid
11.61 g
Disodium EDTA
3.72 g
MgCL 2 6H 2
2.03 g
NaOH
6.0 g
H 2
1 L
Potassium phosphate (pH 7.0)
Electrode buffer (pH 7.0)
Gel buffer
K 2 HP0 4 anhydrous
87. Og Dilute electrode buffer 1:9
KH 2 P0 4 anhydrous
68.0 g
H 2
1 L
Lithium hydroxide (pH 8.1)
Electrode buffer (pH 8.1)
Gel buffer (pH 8.5)
LiOH
2.52 g Tris
3.63 g
Boric acid
18.55 g Citric acid monohydrate
1.05 g
H 2
1 L Boric acid
185 mg
LiOH
25 mg
H 2
1L
Borate (pH 8.2)
Electrode buffer (pH 8.2)
Gel buffer (pH 8.7)
Boric acid
18.55 g Tris
9.21 g
NaOH
2.4 g Citric acid monohydrate
1.05 g
H 2
1 L H 2
Tris borate (pH 8.0)
1L
Electrode buffer (pH 8.0)
Gel electrode
Tris
60.6 g Dilute electrode buffer
1:9
Boric acid
40.2 g
Disodium EDTA
6.0 g
H 2
1 L
Multilocus Enzyme Electrophoresis 371
5. The gel mold (Fig. 1), cutting tool (Fig. 2), and cutting table (Fig. 3) are not
available commercially. They can be fabricated in any competent plastics
workshop at little cost. The gel mold is made of 2 mm Perspex. Its dimen-
sions depend on the make of electrophoresis tank used, in this case, the
Multiphor II tank with a narrow cooling plate (Pharmacia LKB Biotechnol-
ogy). The wire of the cutting tool is a guitar high E string. It is tensioned with
two screws and locking nuts set into the sides of the tool. The cutting table
has a central section recessed by 2.0 mm. The gel block is placed in this recess
allowing thin sections of the gel to be sliced.
6. As a staining tray we use plastic sandwich boxes, but any plastic tray can be
used. Because no lids are available, cover with plastic wrap to reduce evapo-
ration during staining. For staining buffers and reagents see Table 2.
0.2 M Tris-HCL (pH 8.0)
Tris 24.2 g
H 2 IL
Adjust pH with HCL
0.2 M Phosphate buffer (pH 7.0)
a. NaH 2 P0 4 .H 2 27.6 g
b. Na 2 HP0 4 .7H 2 53.6 g
Stock solution mix equal volumes of (a) and (b).
For working solution, dilute 1:25 with H 2 and adjust pH with NaOH.
Malic acid solution
dl malic acid
288 g
NaOH
160 g
H 2
1 L
Dissolve the malic acid in the H 2 0, then cool with running cold water while
slowly adding the NaOH. Mixing the acid with the alkali produces a very
exothermic reaction, it is very important to keep the mixture cool, otherwise
this reaction can become explosive.
Glycine-KOH buffer (pH 7.5)
Glycine 11.3 g
HoO 11
Adjust pH with 1 M KOH.
Methyl-thiazolyl blue (MTT) solution
MTT 1.25 g
H 2 100 mL
Table 2
Staining Methods for Enzymes
Enzyme
Buffer
Substrate
Coenzyme
Dye and Inorganic ion
catalyst
Coupling enzyme
Alcohol dehydrogenase
0.2MTris-HCl
Ethanol (3 mL)
NAD (20 mg)
MTT(l.OmL)
(ADH)
pH8.0
(50 mL)
Isopropanol
(2mL)
PMS(1.5mL)
Sorbitol dehydrogenase
0.2 M Tris-HCl
Sorbitol
NAD (20 mg)
MTT.(l.OmL)
(SDH)
pH8.0
(50 mL)
(125 mg)
Sodium
pyruvate
(50 mg)
Pyrazole (50 mg)
PMS(1.5mL)
Glycerol 3-phosphate
0.2 M Tris-HCl
DL-a glyceral-
NAD (20 mg)
MTT(l.OmL)
dehydrogenase
pH8.0
dehyde
PMS(1.5mL)
(GPD)
(25 mL)
0.5 g Agar in
25 mL hot
buffer
Disodium salt
(650 mg)
Sodium
pyruvate
(200 mg)
Mannitol 1 -phosphate
0.2 M Tris-HCl
Mannitol 1-
PMS(1.5mL)
NAD (20 mg)
MTT(l.OmL)
dehydrogenase
pH8.0
phosphate
(M1P)
(50 mL)
(5mg)
Lactate dehydrogenase
O.lMGlycine-
Fructose 1,6-
NAD (20 mg)
MTT(l.OmL)
(LDH)
KOH pH 7.5
(50 mL)
diphosphate
trisodium
salt (10 mg)
Hydroxybutyrate
dehydrogenase
(HBD)
Malate dehydrogenase
(MDH)
Malic acid (ME)
Isocitric dehydrogenase
(IDH)
6 Phosphogluconate
dehydrogenase
(6PD)
Glucose 6-phosphate
dehydrogenase
(G6P)
Threonine
dehydrogenase
(THD)
Glycolate oxidase
(GOX)
0.2 M Tris-HCl
pH8.0
(50 mL)
0.2 M Tris-HCl
pH8.0
(44 mL)
0.2 M Tris-HCl
pH8.0
(42 mL)
0.2 M Tris-HCl
pH8.0
(46 mL)
0.2 M Tris-HCl
pH8.0
(40 mL)
0.2 M Tris-HCl
pH8.0
(50 mL)
0.2 M Phosphate
buffer pH 7.0
(50 mL)
0.2 M Tris-HCl
pH8.0
(25 mL)
0.5 g Agar in
25 mL hot
buffer
dl Sodium
lactate 60%
(w/w) syrup
(1.0 mL)
dl 3- (or 2- or
3-) hydroxy-
buterate
(100 mg)
2.0 M Malic
acid (6.0 mL)
PMS(1.5mL)
NAD (20 mg)
NAD (20 mg)
MTT(l.OmL)
PMS(1.5mL)
MTT(l.OmL)
PMS(1.5mL)
2.0 M Malic NADP (10 mg) MTT(l.OmL)
acid (6.0 mL) PMS(1.5mL)
0.2 M Isocitric
acid
(2.0 mL)
6-phospho-
gluconic
acid (20 mg)
Glucose 6-phos-
phate
disodium salt
(100 mg)
L-Threonine
(50 mg)
Glycolic acid
(50 mg)
NADP (10 mg)
NADP(lOmg)
NADP (10 mg)
NAD (20 mg)
Peroxidase
(10 mg)
MTT(l.OmL)
PMS(1.5mL)
MTT(l.OmL)
PMS(1.5mL)
MTT(l.OmL)
PMS(1.5mL)
MTT(l.OmL)
PMS(1.5mL)
o-Dianisidine
(10 mg)
NaCl
(200 mg)
0.2 M MgCl 2
(1.0 mL)
0.2MMgCl 2
(2.0 mL)
0.2MMgCl 2
(2.0 mL)
0.2MMgCl 2
(10.0 mL)
0.2MMgCl 2
(0.5 mL)
Table 2 (continued)
Enzyme
Buffer
Substrate
Coenzyme
Dye and
catalyst
Inorganic ion Coupling enzyme
Glyceraldehyde 3-
0.2 M Tris-HCl
Fructose 1,6
NADP (10 mg)
MTT(l.OmL)
Arsenic acid Aldolase (50 U)
phosphate (NADP)
pH8.0
diphosphate
PMS(1.5mL)
(75 mg)
dehydrogenase (GP2)
(50 mL)
(100 mg)
Xanthine dehydrogenase
0.2 M Tris-HCl
Hypoxanthine
NAD (20 mg)
MTT(l.OmL)
(XDH)
pH8.0
(50 mL)
(100 mg)
PMS(1.5mL)
Alanine dehydrogenase
0.2 M Phosphate
DL-alanine
NAD (20 mg)
MTT(l.OmL)
(ALD)
buffer pH 7.0
(50 mL)
(50 mg)
PMS(1.5mL)
Glutamate (NAD)
0.2 M Tris-HCl
L-Glutamic acid
NAD (20 mg)
MTT(l.OmL)
Dehydrogenase (GDI)
pH8.0
(50 mL)
(200 mg)
PMS(1.5mL)
Glutamate (NADP)
0.2 M Tris-HCl
L-Glutamic
NADP (10 mg)
MTT(l.OmL)
Dehydrogenase (GD2)
pH8.0
(50 mL)
acid
(200 mg)
PMS(1.5mL)
Leucine dehydrogenase
0.2 M Phosphate
L-Leucine
NAD (20 mg)
MTT(l.OmL)
(LED)
buffer pH 7.0
(50 mL)
(50 mg)
PMS(1.5mL)
Aspartate oxidase
0.2 M Tris-HCl
D-Aspartic acid
Peroxidase
o-Dianisidine
(ASO)
pH8.0
(50 mL)
(200 mg)
Flavin adenine
dinucleotide
disodium
salt (10 mg)
(5mg)
(10 mg)
Amino acid oxidase
0.2 M Tris-HCl
D-Phenylalanine
Peroxidase
o-Dianisidine
(AAO)
pH8.0
(50 mL)
(200 mg)
(5mg)
(10 mg)
Aspartic acid dehydro-
0.2 M Phosphate
L-Aspartic acid
NAD (20
mg)
MTT(l.OmL)
genase (ASD)
buffer pH 7.0
(50 mL)
(50 mg)
PMS(1.5mL)
Lysine dehydrogenase
0.05 M Phos-
L-Lysine
NAD (20
mg)
MTT(l.OmL)
(LYD)
phate buffer
pH7.0
(50 mL)
(50 mg)
PMS(1.5mL)
Glutathione reductase
0.2 M Tris-HCl
Oxidized
NADPH
MTT(l.OmL)
(GSR)
pH8.0
(25 mL)
0.5 g Agar in
25 mL hot
buffer
glutathione
(20 mg)
(5mg)
2,6-Dichloro-
phenol-indo-
phenol (2 mg)
Catalase 1 (CAT)*
Na 2 S0 3
"(750 mg)
H 2 (50 mL)
30% H 2 2
(2.5 mL)
1.5% KI
solution
(50 mL)
Catalase 2 (CAT)*
H 2 (50 mL)
30% H 2 2
(50 |j,L)
50:50 mixture
2.0% K 3 Fe(CN) 6
2.0%FeCl 3
Superoxide dismutase
0.2 M Tris-HCl
NAD (20
mg)
MTT(l.OmL)
(SOD) 6
pH8.0
(50 mL)
PMS(1.5mL)
Glutamic oxaloacetic
0.2 M Tris-HCl
Pyridoxal 5-
Fast Blue BB
transaminase (GOT)
pH8.0
(50 mL)
phosphate
(lmg)
L-aspartic acid
(50 mg)
a-Ketogluteraric
(100 mg)
salt (100 mg)
Table 2 (continued)
Enzyme
Buffer
Substrate
Coenzyme
Dye and
catalyst
Inorganic ion Coupling enzyme
Glutamic-pyruvic
transaminase (GPT)
Hexokinase (HEX)
Creatine kinase (CTK)
Nucleoside triphosphate
adenylate kinase
(AK3)
0.2 M Tris-HCl
pH8.0
(25 mL)
0.5 g Agar in
25 mL hot
buffer
0.1 M Glycine
KOH pH 7.5
(46 mL)
0.1 M Phosphate
buffer pH 7.0
(25 mL)
0.5 g Agar in
25 mL hot
buffer
0.2 M Tris-HCl
pH8.0
(25 mL)
0.5 g Agar in
25 mL hot
buffer
L-Alanine
(50 mg)
a-Ketogluteric
acid (40 mg)
D-Glucose
(200 mg)
ATP (50 mg)
Phosphocreatine
sodium salt
(20 mg)
ADP (30 mg)
Glucose (40 mg)
Glucose (40 mg)
AMP trisodium
salt (25 mg)
GTP trisodium
salt (15 mg)
Phosphoenol-
pyruvate
(20 mg)
NAD(5mg) MTT(l.OmL)
NADP(2.5 mg) PMS ( 1 .5 mL)
N ADP ( 1 mg) MTT ( 1 .0 mL)
PMS (1.5 mL)
NADP ( 1 mg) MTT ( 1 .0 mL)
PMS (1.5 mL)
NADP ( 1 mg) MTT ( 1 .0 mL)
PMS (1.5 mL)
0.2 M MgCl 2
(2mL)
0.2 M MgCl 2
(2.0 mL)
Glutamic dehydro-
genase (40 mg)
Glucose 6-phosphate
dehydrogenase
(10 U)
Hexokinase (10 U)
Glucose 6-phosphate
dehydrogenase
(10 U)
Hexokinase (15 U)
Glucose 6-phosphate
dehydrogenase
(10 U)
Pyruvate kinase
(20 U)
Phosphoglucomutase
(PGM)
0.2 M Tris-HCl
pH8.0
Glucose 6-
phosphate
NADP (2 mg) MTT ( 1 .0 mL)
PMS (1.5 mL)
0.2 M MgCl 2 Glucose 6-phosphate
(2.5 mL) dehygrogenase
Glucose pyrophos-
phorylase (GPP)
Esterase (EST)'
Alkaline phosphate
(ALP)
(25 mL)
0.5 g Agar in
25 mL hot
buffer
0.2 M Tris-HCl
pH8.0
(50 mL)
0.2 M Phosphate
buffer pH 7.0
(50 mL)
disodium salt
(10 mg)
(50 U)
0.1 M Tris-HCl
pH8.5
(50 mL)
Polyyinylpyrro-
lidone (PVP-40)
(100 mg)
UDP glucose
sodium salt
(50 mg)
Pyrophosphate
sodium salt
(40 mg)
Glucose 1,6-
diphosphate
tetraacyclo-
hexylammonium
salt (5 mg)
a-Naphthyl
acetate or
a-Naphthyl
propionate or
(3-Naphthyl
acetate or
p-Naphthyl
propionate
(1.5mLof
1% solution
in acetone)
|3-Naphthyl acid
phosphate
(50 mg)
NADP(lOmg)
MTT(l.OmL)
PMS(1.5mL)
Fast Blue RR
salt (20 mg)
Fast Blue BB
salt (50 mg)
0.2 M MgCl 2
(2.0 mL)
0.054 M EDTA
pH7.5
NaCl(l.Og)
0.25 M MnCL
(2.0 mL)
0.2 M MgCl 2
(1.0 mL)
Glucose 6-phosphate
dehydrogenase
(10 U)
Phosphoglucomutase
(30 U)
Table 2 (continued)
Enzyme
Buffer
Substrate
Coenzyme
Dye and
catalyst
Inorganic ion Coupling enzyme
Acid phosphatase
(ACP)
Peptidase (PEP)'
Guanine deaminase
(GDA)
Adenoside deaminase
(ADA)
0.05 M Sodium
acetate-HCL
pH5.0
(50 mL)
0.2MTris-HCl
pH8.0
(25 mL)
0.5 g Agar in
25 mL hot
buffer
0.2MTris-HCl
pH8.0
(20 mL)
0.5 g Agar in
25 mL hot
buffer
0.2 M Phosphate
buffer
(25 mL)
0.5 g Agar in
25 mL hot
buffer
a-Naphthyl acid
phosphate
(50 mg)
P-Naphthyl acid
phosphate
monosodium
salt (50 mg)
Peptide (20 mg)
Guanine-HCL
solution
(3.0 mL)
Adenosine
(15 mg)
Fast Black K
salt (20 mg)
o-Dianisidine
(20 mg)
MTT(l.OmL)
PMS (1.5 mL)
MTT(l.OmL)
PMS (1.5 mL)
0.25 MnCl 2
(0.5 mL)
Peroxidase (250 U)
L-Amino acid
oxidase (2.0 mg)
Xanthine oxidase
(1U)
Xanthine oxidase
(1U)
Nucleoside phospho-
rylase (1 U)
Cytidine deaminase
H 2 (25 mL)
Cytidine (45 mg)
MTT (6.0 mg)
(CDA)
2% Agar
(25 mL)
containing
cytidine
(45 mg)
{see Buffer)
Dithiothreitol
(10 mg)
Aldolase lyase (ALD)
O.lMTris
Fructose 1,6-
NAD (20 mg)
MTT (1.0 mL)
Sodium
Glyceraldehyde 3-
acetate pH
diphosphate
PMS(1.5mL)
arsenate
P0 4 dehydroge-
7.5 (50 mL)
(100 mg)
(100 mg)
nase (50 U)
Triphosphate
isomerase (100 U)
Citrate synthase (CTS)
1.0 M Tris-HCl
Oxalacetate
Acetyl-CoA
MTT (250 mg)
pH8.0
acid (20 mg)
(50 mg)
in 0.2 M
(10 mL)
Tris-HCl
pH 8.0 (50 rr
2,6-Dichloro-
phenol-indo-
phenol (40 rr
iL)
iL)
Fumarase (FUM)
0.2 M Tris-HCl
pH8.0
(48 mL)
MTT (1.0 mL)
PMS(1.5mL)
Makic acid dehydro-
genase (150 U)
Acontase (ACO)
0.2 M Tris-HCl
c/s-Acontic
Fumaric acid
NAD (50 mg)
0.2MMgCl 2
Isocitric dehydro-
pH8.0
acid (30 mg)
(50 mg)
(5.0 mL)
genase (5 U)
(15 mL)
Glyoxalase (GLO)
0.2 M Phosphate
buffer pH 7.0
(48 mL)
Methylgloxal
(2.5 mL)
Reduced gluta-
thione
(250 mg)
MTT (50 mg)
2,6-Dichloro-
phenol indo-
phenol
(1.0 mL)
Table 2 (continued)
Enzyme
Buffer
Substrate
Coenzyme
Dye and
catalyst
Inorganic ion Coupling enzyme
Triose phosphate
isomerase (TPI)
Mannose phosphate
isomerase (MPI)
Phosphoglucose
isomerase (PGI)
Glcosyltransferase
(GFT)
Shikimate dehydro-
genase (SHK)
0.2 M Tris-HCl
pH8.0
0.5 g Agar in
20 mL hot
buffer
0.2 M Tris-HCl
pH8.0
(25 mL)
0.5 g Agar in
25 mL hot
buffer
0.2 M Tris-HCl
pH8.0
(23 mL)
0.5 g Agar in
25 mL hot
buffer
0.1MKH 2 PO 4
pH 6.8~
(50 mL)
0.2 M Tris-HCl
pH8.0
(50 mL)
a-Glycerophos- NAD (40 mg)
phate (650 mg)
Sodium
pyruvate
(250 mg)
Arsenic acid
(50 mg)
MTT(l.OmL)
PMS(1.5mL)
Mannose 6-
phosphate
(10 mg)
Fructose 6-
phosphate
disodium
salt (18 mg)
Sucrose (5.0 g)
Shikimic acid
(50 mg)
NAD (20 mg) MTT ( 1 .0 mL)
NADP ( 1 mg) PMS ( 1 .5 mL)
NAPD (5.0 mg) MTT ( 1 .0 mL)
PMS (1.5 mL)
NADP ( 1 mg) MTT ( 1 .0 mL)
PMS (1.5 mL)
0.2MMgCl 2
(1.0 mL)
a-Glycerophosphate
dehydrogenase
(4U)
Lactate dehydro-
genase (50 U)
Glyceraldehyde
3 -phosphate dehydro-
genase (40 mL)
Glucose 6-dehydro-
genase (10 U)
Phosphoglucose
isomerase (50 U)
0.2 M MgCl 2 Glucose 6-phosphate
(23 mL) dehydrogenase
(10 U)
Sodium azide
(12 mg)
0.1MMgCl 2
(2.0 mL)
Adenylate kinase
(ADK)
Carbamate kinase
(CAK) e
(3-Galactosidase (BGA/
0.2 M Tris-HCl
pH8.0
(25 mL)
0.5 g Agar in
25 mL hot
buffer
0.2 M Tris-HCl
pH8.0
(25 mL)
0.5 g Agar in
25 mL hot
buffer
Phosphate citrate
buffer pH 8.0
H 2 (30 mL)
ADP (25 mg)
Glucose
(100 mg)
NADP(lOmg)
MTT(l.OmL)
PMS(1.5mL)
0.2 M MgCl 2
(0.5 mL)
ADP (25 mg)
Glucose
(100 mg)
Carbamyl
phosphate
disodium
salt (100 mg)
6-Bromo-2-p
D-galacto-
pyraniside
(10 mg)
dissolved in
5 mL methanol
NADP(l.Omg)
MTT(l.OmL)
PMS(1.5mL)
0.1MMgCl 2
(1.0 mL)
Hexokinase (10 U)
Glucose 6-phosphate
dehydrogenase
(15 U)
Hexokinase (20 U)
Glucose 6-phosphate
dehydrogenase
(10 U)
o-Dianisidine
tetrazotized
zinc chloride
complex
°Incubate slice in H 2 2 solution for 15 min at 37°C. Rinse in tap water several times then add inorganic ion mixture. Remove staining mix when
negative staining bands appear.
^Incubate under fluorescent light or bright sunlight until negative staining bands appear.
'Pre soak slice in 50 mL phosphate buffer for 20 min then pour off. Add Fast Blue to 50 mL phosphate buffer, mix for 5 min, and add ester solution.
Pour immediately onto slice. Many other esters can be used.
J Many different peptides can be used, e.g., L-alanyl-L-leucine, L-phenylalanyl-L-proline, L-leucyl-L-alanine, L-phenylalanyl-L-leucine (hard to dis-
solve), L-leucyl-L-leucyl-L-leucine, L-alanyl-L-threonine, L-alanyl-L-tyrosine.
''Stains for ADK as well as CAK. Run both gels at same time. Extra bands on CAK gel are carbinate kinase ETs.
^Add substrate solution to phosphate citrate buffer. Pour on slice incubate at 37° C for 15 min then pour off. Dissolve dye in 30 mL H 2 0, adjust pH with
sodium bicarbonate, pour on slice, incubate for 5 min if BGA was induced and 1 h if it was not.
382
Stanley and Wilson
Fig. 1. Gel mold.
Fig. 2. Gel slicer.
Phenazine methosulfate (PMS) solution
PMS
H 2
1.0 g
100 mL
Store both solution in the dark at 4°C until needed. Both MTT and PMS are
very toxic and should be treated with care. If a fumehood is not available,
gloves and face masks should be worn when working with these chemicals.
Spillage onto bare skin should be washed off immediately.
Multilocus Enzyme Electrophoresis
383
Fig. 3. Gel table.
0.05 M Sodium acetate buffer (pH 5.0)
Sodium acetate
H 2
6.8 g
1L
Adjust pH with HC1.
Phosphate citrate buffer (pH 5.0)
1.0 M phosphoric acid
2.0 M NaOH
Citric acid monohydrate,
H 2
10.2 mL
10.2 mL
1.03 g
76.9 mL
0.1 M Tris acetate buffer (pH 7.5)
Tris
H 2
12.11 g
1L
Adjust pH with glacial acetic acid then add:
Potassium acetate 19.63 g
Cobalt chloride 333 mg
L-cysteine hydrochloride 35.2 mg
Guanine-HCl solution
Guanine-HCl
50 mg
Dissolve in 10 mL warm 0.1 M NaOH. Add to 40 mL H 2
384 Stanley and Wilson
3. Methods
3. 1. Growth of Bacteria
The microorganisms to be studied must be in a pure culture and growing
luxuriantly. Old cultures should not be used because although high weight of
culture may be achieved, enzyme activity will be low, as a majority of cells
will not be in a logarithmic growth phase. Solid or liquid media can be used,
but solid media is the most convenient (see Note 1).
10 11 Organisms are required for enzyme extraction. This is usually equiva-
lent to 0.5 g (wet weight) of culture. When optimum growth of the organism is
achieved the culture on each plate is scraped off using a plastic loop into a
breaking buffer for enzyme extraction.
Take care not to scrape off too much growth media along with the culture, as
this will add foreign enzymes to the electrophoresis gel, making interpretation
of the stained gel difficult.
3.2. Extraction of Enzymes
Any method of extraction can be used as long as the extracted enzymes
remain in their native state. Methods used include (1) freezing and grinding
with fine sterile sand, (2) freeze/thawing with liquid nitrogen, (3) chemical or
enzymic breakdown of the cell wall, and (4) sonication. The method chosen
usually depends on the relative resistance of the organism under study to lysis
(see Note 2). The most common method used is sonication.
1. The suspension of organism in breaking buffer is placed in a 2.0-mL Eppendorf
tube and sonicated using a microtip probe with 15- to 30-s bursts of sonication
interspersed with 30 s cooling in ice water. This cycle is repeated four to six times.
2. When sonication is complete the suspension is centrifuged at 30,000g for 30 min at 4°C.
3. The supernatant is then aliquoted in 100 f^L amounts and stored at -70°C. Enzyme
stability varies with different species, but there is usually insignificant loss of
activity after storage at -70°C for several months.
3.3. Electrophoresis
Carry out MEE using any support medium that allows electrophoresis under
native conditions. Starch, polyacrylamide and cellulose acetate have all been
used. Of the three, starch is the most common, (see Note 3).
A large number of buffer systems have been described for MEE. Table 1
shows the most common ones used (3,4). Unfortunately, the choice of buffer
depends on trial and error (see Note 4).
3.3.1. Starch Gel Preparation
1. Seal the legs of the mold (Fig. 1) with PVC insulating tape and level on a
leveling table.
Multilocus Enzyme Electrophoresis 385
2. Suspend 82.0 g of starch with 820 mL of electrolyte buffer in a 2-L conical flask
(see Note 5). Heat on a ring gas burner with wire gauze. While the mixture is
heating, lift the flask off every 10 s and swirl the contents. At this stage the
suspension should be white and fluid. After approx 5 min heating, the mix will
suddenly become viscous and gray in appearance, it is important at this stage to
continue to mix the contents of the flask vigorously. After approximately a fur-
ther 2 min heating, the starch gel should become more translucent and less vis-
cous. Small bubbles will start to form at the sides of the flask and its contents will
start to steam gently. The gel is now ready to degas.
3. Quickly transfer the molten gel to a prewarmed thick-walled flask, with a side
arm. Stopper the flask and degas the gel by applying a -80 kPa vacuum for 1 min
to the side arm (see Note 6).
4. Pour the starch suspension into the mold until there is a convex meniscus. Remove
any air bubbles trapped down the side legs of the mold with a Pasteur pipet.
5. While the gel is still molten, cover the starch surface with plastic wrap to reduce
evaporation. Stick the wrap to the sides of the mold, and adjust the tension of the
wrap to remove any wrinkles on the surface of the gel. Burst any large air bubbles
trapped under the plastic wrap with a hypodermic needle. Place the mold at 4°C for
2-3 h until it has set. The gel will keep for 24 h, but it is best used as soon as it has set.
3.3.2. Loading the Gel
1. First remove the plastic wrap covering. Then make a vertical cut through the gel
running parallel with one of the side arms 25 mm from the end wall. Carefully
push a blunt spatula into the cut and make sure the gel is completely separated
into two sections.
2. Add 30 \\L of each extract to filter paper strips 20 mm x 5.0 mm. Allow the strip
to dry until all surface moisture has gone, before carefully inserting the strip into
the slit in the gel (see Note 7).
3. The first, middle, and last extract in the gel should be a control extract (see
Note 8). The very last strip at one end of the gel should be loaded with 2.0%
amaranth dye to act as a marker (see Note 9).
3.3.3. Running Conditions
1. Electrophoresis is carried out at a temperature of 4°C to prevent degradation of
the catalytic activity of the enzymes under study (see Note 10).
2. Before putting the gel mold in the electrophoresis tank, remove the tape sealing
the legs of the mold.
3. Place the mold in the tank with the extracts at the cathode side of the tank. Attach
the leads from the tank to the power supply and apply a constant voltage across
the gel. The voltage required depends on the buffer being used and the length of
time available for electrophoresis (see Note 11).
4. Electrophoresis is complete when the marker dye has migrated approximately
5.0 cm.
386 Stanley and Wilson
3.3.4. Slicing the Gel
1. After electrophoresis switch off the power to the tank and remove the mold.
2. Trim the gel slab to the size of the recessed part of the cutting table by cutting
right through the gel with a sharp thin blade. These cuts should be approximately
1 .0 cm from the first and last extract and several centimeters above the distance
traveled by the dye marker (see Note 12).
3. Remove the outer unwanted parts of the gel slab leaving the central portion
containing the electrophoresed enzymes. Cut off the upper right-hand corner of
the gel slab so that the correct orientation of the gel slices can be maintained
during staining. Finally, remove the filter paper strips used to load the enzyme
extracts into the gel.
4. Carefully lift the gel slab and place it, top side up, in the recessed section of
the cutting tray. Make sure there are no air bubbles between the gel slab and
the cutting table.
5. Rest the cutting tool at one end of cutting table with the cutting wire resting
against the edge of the gel slab. Slowly draw the cutting wire through the gel slab
using an even pressure. No downward pressure on the gel slab should be needed
at this point.
6. When the cutting tool has completely cut through the gel slab, carefully lift the
gel slab off the gel slice. This can be achieved by introducing a blunt instrument
between the gel slab and the gel slice at one end, then slowly lifting up to break
the surface tension between the two pieces of the gel. Place the gel slab on a glass
plate until another slice is needed.
7. Remove the gel slice from the cutting table in a similar manner to that previously
mentioned and place it in a staining tray at 4°C until required. Replace the gel
slab on the cutting table and repeat the slicing operation reversing the direction
of the cutting tool after each slice is cut. Continue until sufficient slices have
been cut (see Note 13).
3.4. Staining and Recording Results
The location of enzymes in the gel after electrophoresis can be determined
by the enzymes catalyzing specific reactions with a substrate that produces a
colored product. For some enzymes, such as catalase, the substrate is colored
instead of the product. The commonest methods of staining are electron trans-
fer dyes and modified histochemical stains (2,3,5). Specific staining methods
are shown in Table 2. All stains are incubated at 37°C unless otherwise stated.
1. Add the reactants to the buffer and allow to dissolve. Add MTT and PMS just
before the staining mixture is added to the gel slice.
2. Gently rock the staining tray until the gel slice floats free in the staining solution.
Cover the tray and incubate, usually in the dark at 37°C.
3. If an agar overlay is needed, the reactants are mixed with half the volume of
buffer. In the other half, melt 0.5 g of Oxoid No. 1 agar. Allow the agar to cool to
Multilocus Enzyme Electrophoresis 387
55 °C. Mix both solutions together just before pouring over the gel. Leave the gel
for 2 min on a level surface to set before incubation.
4. Regularly check the development of the staining reaction until optimum develop-
ment has occurred. This varies greatly between enzymes (see Note 14).
5. When staining is complete, score the relative migration of the enzymes by eye.
The enzymes are scored in order of increasing anodal migration, but this can only
be done after all gels have been run. Until that is accomplished, the control
extracts are scored as 6 and all other results are related to this result, i.e.,
electromorphs that migrate less than the control are scored 5, the next 4, and so
on. Electromorphs that migrate further score 7, the next 8. Do not mistake a weak
reaction for a negative result (see Note 15). Figure 4 shows a stained gel of the
enzyme malate dehydrogenase. In this example, the controls are in lanes 1 , 8, and
18 and so are scored as 6. Extracts 5, 8, 11, 15, and 16 also score 6. Extract 7
scores 5. Extracts 2-4, 6, 9 and 12-14 score 7. Extract 17 scores 8. The extract in
lane 10 does not produce a band and so is scored as 0.
6. After scoring the gel, a permanent record can be made by either photography or
by fixation with an acid-alcohol wash (see Note 16).
7 . After all extracts have been run once further, gels are run to check that null results are
not due to weak reactions. Re-extraction of some extracts may be needed. Extracts
with the same mobilities are also rerun together as a check on intergel comparability.
8. Once all gels have been run and all results collected, these results must be converted
to a form that can be analyzed, i.e., they must be numbered in order of decreasing
anodal migration. First tabulate the results. Then, taking the results of each enzyme in
isolation, the electromorph with the greatest migration is scored 1 , the next furthest 2,
and so on until all the results have been converted.
3.5. Data Analysis
The type of analysis carried out on MEE data depends on the aims of the
study in question.
Genetic diversity (h) can be calculated using the formula
h=l-^X 2 i[n/(n-l)]
Xj = frequency of the ith allele at the locus
n = number of isolates or ETs
n/(n - 1) = correction for small sample size
Genotypic diversity can be derived from the same formula. In that case X t is
the frequency of the /th ET and n is the number of Ets.
Genetic distance (D) between pairs of isolates or ETs can be calculated using
several different coefficients (6). It is usually calculated as the proportion of
loci at which dissimilar alleles occur, i.e., the number of mismatches. These
CO
00
00
Multilocus Enzyme Electrophoresis 389
coefficients can be either unweighted or weighted. If they are weighted, the
contribution of each locus to (D) is multiplied by the reciprocal of the mean
genetic diversity at the locus in the total sample being analyzed. Weighting in
this manner emphasises the significance of variation at loci that are have low
genetic diversity. A variety of statistical methods can be used to produce a
graphical representation of the relatedness between isolates or ETs (6).
Figure 5 shows a dendrogram of genetic distance between pairs of ETs
calculated using the proportion of mismatches method. Figure 6 shows a three-
dimensional graph of a principal coordinate analysis of the same data. Both
were produced by a macro subroutine running on the SAS statistical package
(7). There are many other computer packages available that can be used for the
analysis of MEE data (8-10).
4. Notes
1. The use of liquid and solid culture is a personal choice. Higher yields can usually
be achieved with liquid culture, but this is offset by the more complicated proce-
dure needed in harvesting the organism and the greater problems of contamination.
2. Freezing/grinding with fine glass beads (Sigma, cat. no. G4694) is one of the
simplest methods, but it is time consuming and can result in low yields of enzyme
(3). Freeze thawing with liquid nitrogen is quick and produces good yields of
enzyme but, as there are few references to its use, its suitability for a wide range
of organisms is in doubt (11). Some organisms with thick cell walls resist physi-
cal disruption. In this case, enzymatic digestion of the cell wall can be used, such
as lysozyme with staphylococci (9) and lyticase with yeasts (10).
3. Each support medium has its own advantages. Cellulose acetate needs little prepa-
ration and has low sample volumes and short run times (12). Polyacrylamide can
produces high-definition bands and the pore size of the gel can be varied (13).
Starch is the most popular support media. This is due to the ability to cast thick
gels, which can be sliced several times, allowing a different enzyme to be assayed
with each slice. It is also the cheapest of the support media.
4. Gel buffers affect greatly the resolution of enzymes. One of the major factors is
the pH of the buffer. The further the pH of the buffer is from the isoelectric point
(pK) of the enzyme, the quicker the enzyme will move through the gel, leading to
greater separation between electromorphs. Unfortunately, the pK of enzymes are
only known for a few common organisms, such as Escherichia coll. As there is
more variation between types of enzymes than between enzymes of different
species, it is best to try buffers used for the same enzyme in other studies even if
they are from different species.
Fig. 4. (opposite) Stained gel of malate dehydrogenase. Extracts of Campylobacter
stained for the enzyme malate dehydrogenase. The control extracts are in lanes 1,8,
and 18. Lane 10 shows a null result.
390
Stanley and Wilson
h
mi
?
j-
^h
n
jn i i | i i i 1 — p~ n — i — | i i i i — i — ii i i M — r— i i — n — | . . i i i i i i i |
0,1 0.2 O.J 0.4 0.5 0.6 O.J
GENETIC D I STANCE
Fig. 5. Dendrogram of genetic distance. The dendrogram shows the genetic dis-
tance at which varius Ets are related. Genetic distance is estimated by moving from
left to right across the dendrogram until two lines join. The relevant genetic distance is
then read off the scale.
Multilocus Enzyme Electrophoresis
391
PC3
0.19
0.019
-0. 155
0. 329
. 600
.574
- 3 2
PCI 0-039
-0.241 -0 I
Fig. 6. Cluster diagram of Campylobacter Ets. The diagram shows the relationship
between Campylobacter Ets in three dimentions. One large and one small cluster can
be seen. O, human isolates of Campylobacter. □, chicken isolates of Campylobacter.
7,
8,
9,
10
The actual amounts of starch and buffer depend on the size of the gel mold. I usu-
ally use a 10% starch gel, but this depends on the particular gelling properties of
the starch used. This can vary even between different lots from the same manu-
facturer. The actual concentration of starch used can vary between 12.0-9.5%.
The preparation of a starch gel requires skill. The point at which a gel is perfectly
cooked is difficult to define and the times given in the method are only approxi-
mate. Undercooked gels will not set properly and will have low mechanical
strength. Overcooked gels are dense, will distort during electrophoresis, and are
difficult to slice. Undergassed gels are full of small bubbles. A perfect gel will be
transparent, free from lumps, and pours smoothly. With care it is usually possible
to produce satisfactory gels after only a few attempts.
To aid inserting the filter paper strips, use a blunt probe such as a spatula to pry
open the gel at the cut. If the gel is loaded left to right, move the probe to the right
of the strips as they are inserted.
Control extracts are needed for intergel comparison of enzyme mobility. Controls
are chosen from extracts at the start of the trial. They need to give a strong reac-
tion and have average mobility with all the enzymes tested.
The dye marker acts as a check that electrophoresis has taken place as until stained
the enzymes are colorless. It is also used as a guide in trimming the gel.
The gel can be kept cool by several methods. A large basin of ice can be placed
on the tank, but this is unsatisfactory for overnight runs unless the ice can be
392 Stanley and Wilson
replaced when it melts. A better method is to put the entire electrophoresis tank
in a refrigerator. With some tanks, a cooling plate can be placed below the mold
and connected to an external cooling unit.
1 1 . The higher the voltage, the quicker the run time, but higher voltage increases the
heat generated by electrical resistance in the gel. This can degrade the enzymes,
but more importantly, high heat will break down the physical characteristics of
the gel causing it to contract and split. For this reason, I have found it is very
difficult to load run and stain a gel within an 8-h working day. An alternative is to
run the gel overnight at a voltage of 90-100 V.
12. Most enzymes run slower than the dye marker, but occasionally some enzymes
such as peptidase have very mobile electromorphs which may run faster, so it is
always advisable to trim the gel leaving as much as possible above the dye marker.
13. As with cooking the gel, slicing takes practice. The most important factor is a
good gel. The mechanical strength of a well-cooked gel is surprisingly high. Even
the seemingly flimsy gel slices can be lifted by one end in the fingers. If the gel
does break into pieces it is usually possible to piece them together in the staining
tray like a jigsaw. The top slice should always be discarded due to its uneven
surface. The bottom slice can be used, but false negative results can occur if the
filter paper strips are not pushed right to the bottom of the gel. Because of this
possibility, the bottom slice should only be used if no other slices are available.
14. Catalase is unusual as it only takes 30 s to develop. It must be read quickly as the
bands fade rapidly. The other stains take 30-60 min to develop. Weak extracts
may need to be left for several hours.
15. The reason for this complicated procedure is that until all samples are run it is
impossible to know which electromorph has the greatest mobility. By arbitrarily
scoring the control as 6, and relating all other results to this score, it is possible to
construct a result table which, when all the results are produced, can be converted
to a form ready for analysis (see Subheading 3.5.).
16. Fixation is not very satisfactory. Gel contract and whiten, weak bands may be
lost, and it is difficult to store large numbers of fixed gels. Photographing the
stained gel to produce a permanent record is the method of choice. Photograph-
ing gels with a digital camera and storing the resulting images on a computer is a
very useful way of cataloguing large numbers of gels.
17. Intergel comparison is possible but errors can occur in scoring between gels.
Running check gels with extracts that seem to have the same mobility is the best
way to overcome this although it is possible to make some intergel comparisons
with photographed gels.
References
1. Lewontin,R. C. and Hubby, J. L. (1966) A molecular approach to the study of the
hetrozygosity in natural populations. II. Amount of variation and degree of het-
erozygosity in natural populations of Drosophila pseudoobscura. Genetics 54,
595-609.
Multilocus Enzyme Electrophoresis 393
2. Harris, H. and Hopkinson, D. A. (1976) Handbook of Enzyme Electrophoresis in
Human Genetics, North-Holland Publishing, Amsterdam.
3. Selander, R. K., Caugant, D. A., Ochman, H., et al. (1986) Methods of multilocus
enzyme electrophoresis for bacterial population genetics and systematics. Appl.
Environ. Microbiol. 51, 873-884.
4. Morizot, D. C. and Schmidt, M. E. (1990) Starch gel electrophoresis and his-
tochemical visualisation of proteins, in Electrophoretic and Isoelectric Focusing
Techniques in Fisheries Management (Whitmore, D. H., ed.) CRC Press, Boston,
pp. 23-80.
5. Rothe, G. (1994) Electrophoresis of Enzymes: Laboratory Methods, Springer-
Verlag, Berlin, New York.
6. Sneath, P. H. A. and Sokal, R. R. (1073) Numerical Taxonomy, W. H. Freeman,
San Francisco.
7. Graves, L. M. et al. (1994) Comparison of ribotyping and multilocus enzyme elec-
trophoresis for subtyping of Listeria monocytogenes isolates /. Clin. Microbiol.
32, 2936-2943.
8. Rodriguez, E., De Meeus, T., Mallie, M., et al. (1996) Multicentric epidemiologi-
cal study of Aspergillus fumigatus isolates by multilocus enzyme electrophoresis
/. Clin. Microbiol. 34, 2559-2568.
9. Musser, J. M. and Kapur, V. (1992) Clonal analysis of methicillin-resistant
Staphylococcus aureus strains from intercontinental sources: association of the
mec gene with divergent phylogenetic lineages implies dissemination by horizon-
tal transfer and recombination. /. Clin. Microbiol. 30, 2058-2063.
10. Pujol, C, Joly S.,Lockhard, S. R., et al. (1997) Parity among the randomly ampli-
fied polymorphic DNA method, multilocus enzyme electrophoresis, and southern
blot hybridization with the moderately repetitive DNA probe Ca3 for fingerprint-
ing Candida albicans. J.Clin. Microbiol. 35, 2348-2358.
11. Hall, L. M. C, Whiley, R. A., Duke, B., et al. (1996) Genetic relatedness within
and between serotypes of Streptococcus pneumoniae from the United Kingdom:
analysis of multilocus enzyme electrophoresis, pulsed-field gel electrophoresis,
and antimicrobial resistance patterns. /. Clin. Microbiol. 34, 853-859.
12. Richardson, B. J., Baverstock, P. R., and Adams, M. (1986) Allozyme Electro-
phoresis, Academic Press, London, New York.
13. Hames, B. D. (1998) Gel Electrophoresis of Proteins, 3rd ed., Oxford University
Press, London.
42
Bacteriocin Production Process by a Mixed
Culture System
Suteaki Shioya and Hiroshi Shimizu
1. Introduction
Lactic acid bacteria (LAB) have been received much attention as bacteriocin
producers. Antimicrobial proteins and peptides produced by bacteria, termed
bacteriocin, are widely acknowledged to be important contributors to those
organisms that survive dominate or die in microbial ecosystem such as our
food supply or digestive tract. Also, there is tremendous interest in their use as
a novel means to ensure the safety of minimally processed foods, because
bacteriocins are proteins and natural (1).
In order to enhance the productivity of those bacteriocins from LAB, one of
the key issues is to remove lactate from the fermentor. Removal of lactate pre-
vents the growth inhibition due to the increase in lactate concentration and the
decrease in pH. In this chapter, one of methods to remove lactate is described
by showing the data of nisin production from Lactococcus lactis as a typical
example, but the method can be easily modified to other bacteriocin produc-
tion process using LAB.
Nisin is an antimicrobial peptide produced by certain Lactococcus species.
Nisin has been accepted as a safe and natural preservative in more than 50
countries (2-4). Nisin inhibits the vegetative growth of a range of Gram-posi-
tive bacteria. Because nisin, in particular inhibits food-borne pathogens, e.g.,
Listeria monocytogenes, Staphylococcus aureus, and psychro trophic entero-
toxigenic Bacillus cereus, the effectiveness of nisin as a food preservative of
these strains in various preservation conditions have been investigated in detail
(5-7). Not only the use of nisin-producing LAB as fermentation starters, but
From: Methods in Biotechnology, Vol, 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
395
396 Shioya and Shimizu
also the direct addition of nisin to various kinds of foods such as cheese, mar-
garine, flavored milk, canned foods, and so on, are permitted (3). The develop-
ment of effective nisin production systems using LAB is a new field of interest.
The most important problem in nisin production is the inhibition of growth due
to the increase in lactate concentration and the decrease in pH. To avoid growth
inhibition by the decrease in pH due to the accumulation of lactate in LAB
fermentation processes, pH control methods by the addition of alkali or by the
extraction of lactate using organic solvents have been reported (8,9). However,
the methods of extraction with organic solvents could not be used for food
additive production. In this regard, removal of lactate in an appropriate way
from the reactor will be preferable for pH control. Continuous culture with
separation systems, such as membrane (10-12) or electrodialyzer (4,13,14),
have been reported. Instead of a separation system, a mixed culture system is
utilized for removal of lactic acid (15) and explained in this chapter. The
method can be easily modified to other bacteriocin production process using
LAB.
2. Materials
2. 7. Microorganisms and Media
L. lactis subsp. lactis ATCC 11454 (American Type Culture Collection,
Rockville, MD) was used as a nisin-producing microorganism. Kluyveromyces
marxianus MSI was isolated from kefir grains in our laboratory and identified
according to tests for morphological and biochemical properties (16). Staphy-
lococcus aureus IFO 12732, which was obtained from the collection at the
Institute for Fermentation Osaka (IFO), Japan, was used as a indicator micro-
organism in the bioassay measurement of nisin concentration. The composi-
tions of media for growth of microorganisms are summarized as follows.
Medium A, used for seed culture and preculture of L. lactis (pH7.0), contained
5 g/L of maltose, 5g/L of polypeptone (Nihonseiyaku) and 5 g/L of yeast extract
(Difco Laboratories, Detroit MI). Medium B, used for seed culture and
preculture of K. marxianus (pH 7.0), contained 10 g/L of L-lactate, 10 g/L of
polypeptone, and 10 g/L of yeast extract. Medium C, used for primary culture
of L. lactis, contained maltose at 10 g/L in anaerobic culture without pH control
and at 33-37 g/L in anaerobic culture with pH control and aerobic culture with
pH control (pH 6.0), 10 g/L of polypeptone and 10 g/L of yeast extract. Medium
D, used for primary culture of K. marxianus (pH 6.0), contained 40 g/L of
L-lactate, 10 g/L of polypeptone and 10 g/L of yeast extract. Medium E, used
for mixed culture of L. lactis and K. marxianus (pH 6.0), contained 42 g/L of
maltose, 10 g/L of polypeptone and 10 g/L of yeast extract. Medium F, used
for bioassay of nisin (pH 7.0), contained 10 g/L of glucose, 5 g/L of
polypeptone, 5 g/L of yeast extract and 5 g/L NaCl. Selective medium G, used
Bacteriocin Production Process 397
for determination of L. lactis colony-forming unit (CFU), (pH 7.0), contained
5 g/L of maltose, 5 g/L of polypeptone, 5 g/L of yeast extract, 5 mg/L of cyclo-
heximide (Wako) and 15 g/L of agar 15 g/L. Selective medium H, used for
determination of K. marxianus CFU (pH 7.0), contained 5 g/L of glucose, 5 g/L
of polypeptone, 5 g/L of yeast extract, 5 mg/L of streptomycin (Nacalai tesque),
and 15 g/L of agar. Initial maltose concentration in the pH-controlled anaero-
bic, pH-controlled aerobic, and mixed cultures were 33.2 g/L, 36.8 g/L, and
41.4 g/L, respectively.
2.2. Equipment and Facility
Precultures of L. lactis was performed in a 500-mL Erlenmeyer flask
containing 200 mL of medium inoculated with 200 mL of the seed medium.
The flask was statically incubated at 30°C for 10 h and harvested cells were
inoculated to the primary culture medium. Preculture of K. marxianus was
performed with 100 mL medium in 500 mL Erlenmeyer flask with 100 mL
inoculation of the seed medium. The flask was incubated in the same way as
the seed culture. After 16 h, the cells were harvested by centrifugation at
10,000g for 15 min and used to inoculate the primary culture medium.
Primary cultures were performed in a 5-L jar fermenter (EPC Control Box,
Eyla, Japan) equipped with temperature, pH, dissolved oxygen concentration
(DO), and gas flow control systems. The working volume was 2 L. The partial
pressure of C0 2 in the exhaust gas was measured using a C0 2 gas analyzer
(Horiba, cat. no. VBI-210). Air or nitrogen was supplied to the fermenter for
aerobic or anaerobic cultivation conditions, respectively.
The cascade controller was developed for the systems that have more than
one output with one manipulation (17). In this study, the cascade control strat-
egy was applied in order to control pH level via DO control by manipulating
the agitation speed. Control strategy was coded by the N88B ASIC (NEC) on a
personal computer (NEC cat. no. PC-9801BX). The control strategy and
inoculum conditions in the mixed culture are described later.
3. Method
3. 1. Design of a Mixed CultureSystem
In order to remove lactate from the fermenter, a mixed culture system can be
constructed and a pH cascade control system for the mixed culture system can
be designed by following the procedure described as follows.
1. Select carefully a combination of carbon sources and microorganisms. For a
targeted bacteriocin including a LAB, first select a carbon source, which should
be commercially available and a microorganism which should or prefer not to
assimilate the carbon source for the LAB but assimilate lactic acid quickly.
398 Shioya and Shimizu
2. For this purpose, screen the microorganisms from some sources such as fermented
food, because the fermented food is a good source for bacteriocin producing LAB
as well as lactic acid-assimilating yeasts and bacteria. For nisin production, the
carbon source is maltose and a yeast; K. marxianus was isolated from kefir grains.
For another candidate, the carbon source is lactose and a yeast; Candida vinaria
was isolated from cheese. This design is important step for a successful applica-
tion of the method to other bacteriocin production process.
3.2. Assessment of the System Based on Kinetic Data
3.2. 1. Analytical Methods of Experiments
Cell concentration of the pure cultures was measured as dry cell mass and
optical density (OD). As for dry cell mass, the cell was filtered by membrane
filter (pores size 0.45 mm, Advantec) and dried in the oven at 70°C. OD was
measured at 660 nm by UV spectrophotometer (UV-2000, Hitachi). The viable
cell concentrations of L. lactis and K. marxianus in mixed culture were deter-
mined as colony forming units (CFU) on selective media G and H, respec-
tively. Relationship between dry cell concentration (DW) and CFU was
approximated as a linear line by the least square method correlation coefficients
of data and estimated values by the determined linear line were also calculated.
Concentrations of L-lactate, acetate, and formate in the medium were analyzed
enzymatically by F-kit lactate, F-kit acetate, F-kit formate (Boehringer Mann-
heim), respectively. Ethanol concentration was measured by gas chroma-
tography (Hitachi G-3000). Glucose concentration was measured using a
glucose analyzer (Model 2700, YSI Inc.). Maltose concentration was measured
after hydrolysis to glucose as follows: 100 mL of 2N-HC1 was added to the
same volume of the sample and boiled at 100°C for 20 min. Two hundred
milliliters of 1 N NaOH was added and glucose concentration was measured
using the glucose analyzer. The calibration curve for ethanol concentration and
maltose concentration were determined as linear lines by the least square
method. Accuracy of measurement was evaluated by correlation coefficients.
Nisin concentration was measured by a bioassay method based on the
method of Matsuzaki and co-workers (18) as follows: 5 mL of medium F was
inoculated with S. aureus IFO 12732 and incubated on a reciprocal shaker at
30°C, 100 strokes/min for 12 h. Fifty microliters of the cell suspension of
S. aureus and 50 [iL of the sample solution were added to 5 mL of fresh medium
and incubated on the reciprocal shaker under the same conditions. After 12 h,
the cell concentration was measured as optical density at 660 nm (OD660) by
UV-spectrophotometer (Hitachi U-2000). A calibration curve was made for
each new nisin concentration measurement, using commercially available nisin
as a standard (Sigma, St. Louis, MO, 1000 international units (IU)/mgsolid;
nisin content 2.5 wt %). The sample was diluted so that the value of OD 660 was
Bacteriocin Production Process 399
in the range of 0.1-1.5 absorbance units, because in this range nisin concentra-
tion was linearly related to OD 660 . The calibration curve for bioassay of the
nisin was made at each fermentation experiment by the least square method.
Nisin concentration was represented by weight concentration (mg/L) and a
nisin concentration of 1 mg/L was equivalent to 40 IU/mL (12).
3.2.2. Collection of Kinetic Data of Pure Cultures
3.2.2.1 . Anaerobic Pure Culture of L. lactis
In order to investigate kinetic parameters for both microorganisms, pure
cultures should be done with and without pH control. The effect of DO concen-
tration on kinetic parameters should be also analyzed from the experimental
data. For anaerobic pure culture of L. lactis without pH control,
1. Inoculate L. lactis in the 5-L jar fermenter aseptically.
2. Monitor pH change every one minute without control. Store online data in the hard
disk of a computer that is connected to fermentation equipment. Flow nitrogen gas
in order to make anaerobic condition.
3. Take 10 mL sample every hour.
4. Measure offline data of concentrations of dry-cell (DW), nisin, L-lactate, and maltose.
For the case with pH control, the same methods as ones discussed above
except for pH control are employed.
3.2.2.2. Aerobic Culture of L. lactis
Since the aerobic cultivation of LAB is not common, but the aerobic growth
of, and production of lactate by, have been reported (19). For lactate to be
effectively assimilated by K. marxianus , aerobic conditions must be used.
Hence growth of L. lactis under aerobic conditions was investigated.
1. Inoculate L. lactis in the 5-L jar fermenter aseptically.
2. Control pH at 6.0 by addition of NaOH.
3. Flow air and control DO at 6 mg/L by changing agitation speed.
4. Online and offline data should be measured and stored.
One of the results is shown in Fig. 1.
3.2.2.3. Aerobic Culture of K. Marxianus
In order to determine the specific lactate consumption rate of K. marxianus,
aerobic fermentation should be performed, especially the data of the effect of
the DO concentration on rate of lactate consumption are key ones to develop a
cascade controller.
1. Inoculate K. marxianus in the 5-L jar fermenter aseptically.
2. Control pH at 6.0 by addition of NaOH.
400
Shioya and Shimizu
2 4 6 8 10 12
Time (h)
Fig. 1. Aerobic growth of L. lactis with pH control achieved by the addition
of NaOH.
3. Flow air and control DO at several points (0-8) mg/L by changing agitation speed.
4. Online and offline data should be measured and stored.
3.2.2.4. Calculating Kinetic Parameters
The kinetic parameters, such as specific rates, were evaluated using the least
square method. An example for the specific production rate of nisin is as
follows: the material balance of nisin production is represented as
d(pV)
(1)
where/?, V,X L , and p^are the nisin concentration, culture volume, cell concen-
tration of L. lactis, and specific production rate of nisin, respectively. Equa-
tion 1 was integrated as
ffvd( P V)=f p N (VX L )dt
o o
(2)
where the suffix indicates the initial values of the variables. If p^is constant,
Equation 2 can be rewritten
pV-poV =p N f<f(VX L )dt
(3)
Bacteriocin Production Process 401
If the plot of pV vs the integral of VX L is a linear relationship, it concludes that
p^ is constant estimated from the slope of the linear line by the least square method.
Algorithm of investigation of kinetic parameters is summarized as follows.
1. Give material balance equations for interested materials, e.g., cell, substrates,
and products.
2. Integrate the equations with respect to time.
3. Plot the data so that the interested kinetic parameter becomes the slope of the
curve.
4. Check the linearity of the curve.
5 . If the plot shows the linear relation, estimate the slope by the least square method.
Spreadsheet software like Excel (Microsoft Co.) is available.
6. Evaluate regression lines statistically. If the lag, log, and stationary phases
existed, data for making one linear line should be determined. Check the consis-
tency of the basis for determination by the correlation coefficients.
All of the kinetic parameters of L. lactis and K. marxianus are shown in Tables
1 and 2, respectively. The correlation coefficients for all the parameter estimations
in the least square methods are also shown in these tables. The basis for determin-
ing the kinetic parameters over the first 5 h (0-5) and from 5 h to the completion of
the experiment at 8, 12, or 1 1 h was mainly due to that the growth under anaerobic
condition without pH control was ceased after 5 h. All the correlation coefficients
of kinetic parameters were higher than 0.9, and it was concluded that the estimated
values of kinetic parameters were consistent.
3.2.3. Assessment of the System
3.2.3.1. Simulation Model
In order to develop a cascade pH controller, a simulation model for dynam-
ics of pH in the mixed culture of L. lactis and K. marxianus is useful. The
dynamics of concentrations of lactate, L, and acetate, A, are represented by
Eqs. 4 and 5, respectively.
dL = p L X L - v L X K (4)
dt
dA
dt
= PaX l (5)
where X L , p L , and p A are cell concentration, specific production rates of lactate
and acetate of L. lactis, respectively, andX^, and v L are cell concentration and
specific lactate consumption rate of K. marxianus, respectively. From overall
electroneutrality balance, total cation concentration in the medium have to be
equal to anion concentration. H + ion concentration (10~ PH ), OH~ ion
concentration (10 pH ~ 14 ), dissociated lactate ion concentration, and dissociated
Table 1
Kinetic Parameters of L. lactis Under Various Conditions
4\
O
IV)
Anaerobic conditions
Aerobic conditions
Without pH control
With pH control
With pH control
Mixed
culture
(0-5 h)
(0-5 h)
(5-8 h)
(0-5 h)
(5-12 h)
(0-5 h)
(5-11 h)
\i L a 0.30
0.73
0.25
0.45
0.20
0.63
0.22
1/h (r 2 =0.919) h
(r 2 = 0.988)
(r 2 = 0.982)
(/- 2 = 0.967)
(r 2 = 0.977)
(,-2= 0.985)
(7- 2 = 0.976)
9l c 0.81
0.70
0.67
0.67
0.34
d
d
(r 2 = 0.976)
(r 2 = 0.955)
(r 2 = 0.995)
(r 2 = 0.931)
(7- 2 = 0.997)
g-lactate/g-cell/h
p/ NM
0.29
0.16
0.32
0.23
0.28
0.24
(r 2 = 0.994)
(7-2= 0.994)
(7- 2 = 0.986)
(7- 2 = 0.989)
(,-2=0.997)
(,-2=0.984)
g-acetate/g-cell/h
Pi/ 4.0
9.4
3.9
7.6
5.2
9.7
5.8
(,-2=0.940)
(7- 2 =0.972)
(r 2 = 0.985)
(7- 2 = 0.989)
(,-2=0.984)
(,-2= 0.998)
(,-2=0.994)
mg-nisin/g-cell/h
y l/a/ 3.7
/
2.0
1.29
d
(r 2 =0.95)
(r 2 =
= 0.94)
(r 2
= 0.88)
mol-lactate/mol-maltose (0-
-8h)
(0-8 h)
W NM
0.96
1.55
0.94
(r 2 =
= 0.91)
(r 2
= 0.98)
(r 2
= 0.99)
mol-acetate/mol-maltose (0-
-8h)
(0-8 h)
(0
-11 h)
"Specific growth rate; ''correlation coefficient of the least square method; 'specific lactate production rate; f/ cannot be
evaluated; ''specific acetate production rate of; ^specific nisin production rate; •* lactate production yield with respect to maltose;
7 'acetate production yield with respect to maltose. NM, these values were not measured.
Bacteriocin Production Process 403
Table 2
Kinetic Parameters of K. marxianus
Pure culture
D0(
mg/L)
Mixed culture
0.5
2^
\i K a 0.12
0.38
0.48 0.31
1/h (r 2 = 0.987)^
(r 2 = 0.988)
(r 2 = 0.991) (r 2 = 0.987)
(0-5 h) (5-1 1 h)
v L c 0.13
0.71
d d
(r 2 = 0.965)
(r 2 = 0.997)
g-lactate/g-cell/h
"Specific growth rate; ''correlation coefficient of the least square
method; 'specific consumption rate of maltose of K. marxianus; ^cannot
be evaluated.
acetate ion concentration were balanced with ion concentration of acid and
base, except lactate and acetate as
X -X -KM" iQPg-i4 < L/MW l) (A/MW a )
acid base v u i + io-ph+p^. 1 + io-p h+ p^ (6)
where X acid , X base , MW A , MW L , pK L , and pK A are total dissociated ion
concentrations of acid and base, except lactate and acetate, molecular weights
of acetate and lactate, and pK values of lactate and acetate, respectively. Third
and fourth terms in the right-hand side of Eq. 6 corresponds to dissociated
lactate ion concentration, and dissociated acetate ion concentration,
respectively. By rewriting the right-hand side of Eq. 6 as a nonlinear function
of pH, L, A as /(pH, L, A) and differentiating Eq. 6 with respect to time (t),
Eq. 7 is obtained.
[d(X acUI -X hase )/dt] = [(d{/)/(dpH)] • [(dpH)/(dt)] + [(djQ/(dL)] • [(dL)/(dt)] + [(d/)/(3A)] ■ [(dA)/(dt)] (7)
Because the changes in X acid and X base are negligible compared with the
changes in concentrations of lactate and acetate, the dynamics of the pH change
with time is described as
dpH/dt = - [(df/dL) • (dL/dt) + (df/dA) • (dA/dt)]/(df/dpU) (8)
By substituting Eqs. 4 and 5 to Eq. 8,
dpU/dt = - [(df/dL)(p L X L -v L X K )/MW L + (df/dA)(p A X L )/MW A ]/(df/dpU) (9)
The terms (d//dpH), (df/dL), and (df/dA) in Eq. 9 are positive and the produc-
tion rate of acetate at the beginning of the batch culture is negligible. Thus, it is
404
Shioya and Shimizu
DO(mg/L)
Fig. 2. Effect of DO level on the specific rate of lactate consumption by
K. marxianus .
easily understood that if the rate of lactate production by L. lactis is higher than
the rate of lactate consumption by K. marxianus, i.e., the term (p[X L - v L X K ) is
positive, pH decreases. On the other hand, when the consumption of lactate is
higher than production, i.e., the term (p L X L - v L X K ) is negative, pH increases.
Then, the lactate consumption rate by K. marxianus must be increased or
decreased, depending on whether the pH level is above or below the set point of
6.0 as long as lactate exists in the medium. The specific lactate consumption rate
(v L ) by K. marxianus can be controlled within a limited range (0-0.7 g-lactate/
g-cell/h) by changing the DO level (0-2 mg/L) as shown in Fig. 2. The DO
concentration in the medium can be controlled by manipulating the agitation
speed of the impeller. It was found that the pH level in the medium of the mixed
culture system can be controlled by changing the set point of DO control. This
type of controller is categorized as a cascade controller (17).
Using Eq. 9, dynamics of pH can be predicted. Kinetic parameters can be avail-
able from the fermentation data analysis. Algorithm for development of simulation
model of dynamics of pH in the mixed culture is summarized as follows.
1. Give all the material balance equations in terms of all the fatty acids that are
produced and/or assimilated by one or more than one microorganism.
2. Establish an overall electroneutrality balance equation.
3. By differentiation of the electroneutrality balance equation, get an ordinary
differential equation of the pH.
4. Simulate pH dynamics with these equations numerically by the Runge-Kutta
method if necessary.
5. Examine the roles of both microorganisms for pH control from the dynamic equa-
tion and develop the controller.
Bacteriocin Production Process 405
3.2.3.2. Inoculum Size of Mixed Culture
So that the lactate concentration was constant at initial time of the operation,
i.e., the start of the fermentation, the decision of the ratio of inoculum sizes of
L. lactis and K. marxianus is very important. If lactate accumulates to a high
level in the medium at the beginning of mixed culture, the growth rate of
L. lactis is dramatically decreased, causing a fatal condition. For a reliable
mixed culture operation, the p L was overestimated as 2.0 g-lactate /g-cell/h,
which was three times higher than the actual data (see Table 1). On the other
hand, v L was initially set to 0.5 g-lactate/g-cell/h. Then, the ratio of X L mdX K
was set to 0.25, which can be derived by setting the right-hand side of Eq. 4 to
zero, which is equivalent to that lactate concentration being constant. For the
same reasons, the right-hand side of Eq. 9 becomes zero because the third term is
negligibly small at the beginning, which means that pH does not change. After
all, before the primary culture experiment started, concentrations of both micro-
organisms in the precultures were determined by measuring the OD 660 and
inoculum size was set as X L /X K - 0.25 in the following experiments. The
algorithm for determination of inoculum size is follows.
1 . Examine the specific production rate of fatty acids (lactate) by LAB and specific
consumption rate of the fatty acids, which is assimilated by another microorganism.
2. For a reliable mixed culture operation, overestimate the specific production rate
of lactate.
3. From the dynamic equation of pH, decide the initial cell concentrations of both
microorganisms so that the pH does not change.
4. Measure cell concentration in the preculture and adjust inoculum size for the
primary culture according to step 3.
3.3. pH Cascade Controller Design
3.3.1. System Analysis Using the Simulation Model
A cascade controller of pH coupled with DO control developed here is
shown in Fig. 3. Proportional and integral (PI), and proportional, integral, and
differential (PID) controllers were used as precompensators of DO and pH in
the cascade controller, respectively. The dynamic response of boxes A and B
can be analyzed using the simulation model. The analysis is useful for design
of the controllers, especially selection of controllers and determination of
control parameters. The dynamic response of pH due to the DO change, shown
in a box A in Fig. 3, is as follows: when the DO changes, v L changes according
to the relationship between DO and v L shown in Fig. 2. Noted that Fig. 2 shows
a static relationship. However, when the DO level changes dynamically, there
is a dynamic time delay from DO change to v L , because cell activity for lactate
assimilation occurs after changes in activities of many enzymes due to change
406
Shioya and Shimizu
RpH
+
RDO
+
AGT
(B)
DO
(A)
pH
pH Controller ^O-**
(PID controller)
DO Controller
(PI controller)
Dynamic system
of DO
DO Sensor
Dynamic system
ofpH
pH Sensor
Fig. 3. Scheme of a cascade pH controller incorporating DO control. Two outputs
of pH and DO were measured by pH and DO sensors, respectively. Manipulation was
only via agitation speed (AGT), which changed DO, and DO changed pH via lactate
consumption by K. marxianus. The pH was controlled by the DO set point, RDO.
in DO concentration. The change in pH is based on the dynamics described by
Eq. 9. The dynamic response of the agitation speed of the impeller to the DO
level, shown in box B of Fig. 3, is as follows: when the agitation speed changes, the
mass transfer rate of oxygen from air bubble to liquid changes, with a very small
time delay, and the dynamics of DO are described by the balance between oxygen
supply from air bubble to liquid and consumption rate of oxygen by both micro-
organisms.
3.3.2. PI (DO) Control Strategy
For the DO controller shown in Fig. 3, the digital PI controller used is
represented by
+
AGT(f) = KJ [RDO(0 - DO(0] + % 2 [PDO(i) - DO(i)] )
T i2 =i
(10)
where AGT(f), DO(f), RDO(f), Af, K p , and T t are the agitation speed of the
impeller and DO at time (t), and the set point of DO control, sampling time,
proportional gain and integral time in the controller, respectively. In the
conventional PI controller, RDO(0 was usually treated as a constant value, but
it was given as the output of pH controller in the cascade controller. The PI
controller was actually used as a velocity form by rewriting Eq. 10 as
AGT(0 = AGT(r - 1) + Kp { [DO(r - 1 ) - DO(f)] + [RDO(0 - RDO(r - 1) + -i [RDO(r) - DO(r)] }
(11)
where the initial value of AGT, AGT(O), was set to 100 rpm. In the velocity form
of the controller, the AGT(f) was realized by correcting AGT(^ - 1). Although
Eqs. 10 and 11 are completely equivalent, the overshoot would be reduced in the
velocity form, when manipulating variables of AGT have upper and lower limits.
Bacteriocin Production Process 407
3.3.3. PID (pH) Control Strategy
For the pH controller, the PID controller was used shown as
RDO(I) = K p { [RpH - pH(0] +f i [RpH - pH(i)] +if[pH(f - 6) - pH(f)] } (12)
where pH(0, RpH, and 7^ are pH at time t, the pH set point, and derivative time
in the controller, respectively. In this controller, the derivative of pH was esti-
mated by subtracting the present pH from the pH data at time (t - 6). The PID
controller was used as a velocity form in the same way as the PI (DO) control-
ler as
RDO© = RDO(r - \)+KJpH(t - 1) - pH(t) +^-[RpH - pH(r)] +I±[- pH(r) + pH(f - 1) + pH(r - 6) -pH(r - 7)] }
(13)
RDO at the initial time, RDO(O), was set as 1.0 mg/L. Because there was a
large delay between DO change and specific lactate consumption rate of
K. marxianus responses, the derivative correction term in the controller was
very important for detecting the pH change, whereas there was a small delay
from the agitation change to the DO response.
The control parameters of the PI (DO) controller — sampling time (A*),
proportional gain (K p ), and integral time (T t ) — are set to 0.5 min, 40 rpm-L/mg,
and 2.0 min, respectively. Control parameters of the PID (pH) controller — set
point of pH (RpH), sampling time, (At), proportional gain (K p ), integral time
(Tj), and derivative time (T d ) — are set to 6.0, 0.5 min, 0.5 mg/L, 12.5 min, and
6.0 min, respectively. The control parameters of PI and PID controllers were
tuned so that fluctuation of pH was less than 6.0 ± 0.5. The design algorithm of
the cascade controller is as follows.
1. Design the whole structure of the cascade controller.
2. Select type of controller, e.g., PI, PID, or more advanced controller for
precompensators.
3. Tune up controller parameters until you get the satisfactory control result.
3.3.4. Typical Results
The time course of a mixed culture of L. lactis and K. marxianus is shown in
Fig. 4. The pH set point was 6.0. The DO set point was not obtained auto-
matically but manually changed in this case for the first trial. The lactate con-
centration was kept at almost zero throughout the experiment. After 2 h, the
DO level was increased and the v L was enhanced because the pH decreased
slightly from the set point of 6.0. The cascade control of pH succeeded. Both
L. lactis and K. marxianus were growing exponentially and ended at 1 1 h. The
nisin production reached a maximum of 98 mg/L.
Figure 5 shows the automatic cascade control results for the coupling of pH
with DO control in the mixed culture. Because RDO(0) was set to 1.0 mg/L,
408
Shioya and Shimizu
[xlO 9 ]
«
tzi
8d0.6
sgOA
.2 & 0.2
C*3
<D
o
o
u
5
■*■ — ■ /
W)
<D
N *— '
ts
4-»
•4— »
2
cS
«
r— <
o
j<
10-
[xl(T]
4 6 8
Time (h)
-1.5 ^
•s si
"-^ X) »— '
w
Fig. 4. Nisin production in a mixed culture of L. lactis and K. marxianus. The pH
was controlled at 6.0 by the cascade controller.
the actual value of DO decreased rapidly at the beginning of the experiment
and returned to the set point within 2 h. When the pH decreased below the set
point at around 3 h, the RDO increased according to Eq. 13. As a result, the v L
was recovered and pH increased again to around 4 h due to the decreasing the
lactate concentration. By changing the RDO, the pH was reliably and accu-
rately controlled at the set point of 6.0.
4. Concluding Remarks
In order to control the pH in an antimicrobial peptide (nisin) production
process by a LAB, L. lactis subsp. lactis (ATCC11454), a novel method was
described, in which neither addition of alkali nor a separation system such as
ceramic membrane filter and electrodialyzer was adopted. A mixed culture of
L. lactis with K. marxianus, which was isolated from kefir grains, was utilized
Bacteriocin Production Process
409
i
O
Q
r 2-
12
Time (h)
Set point of DO
Fig. 5. Control of pH and DO by the cascade controller without addition of NaOH
in the mixed culture system.
in the system. Because the pH of the medium could be controlled by the lactate
consumption of K. marxianus and the specific lactate consumption rate of
K. marxianus could be controlled by changing the dissolved oxygen (DO)
concentration, a cascade pH controller coupled with DO control was described.
As a result, pH and lactate were kept at low levels and nisin accumulated in the
medium to a high level, compared with other pH control strategies such as
processes without pH control and with pH control by addition of alkali. It
should be stressed that by careful selection of the system, the principle
presented here can be made available for use with another carbon source and
other combination of microorganisms for other bacteriocin production.
5. Nom
A
AGT(r)
DO(0
K p
MW A
MW L
L
P
PK A
PK L
RDO(f)
RpH
A;
T
enclature
acetate concentration (g/L)
agitation speed of impeller at time t (rpm)
dissolved oxygen concentration at time (mg/L)
proportional gain of PI or PID controller (rpm • L/mg) or (mg/L)
molecular weight of acetate
molecular weight of lactate
lactate concentration (g/L)
nisin concentration (mg/L)
pK value of acetate
pK value of lactate
set point of DO at time t for DO controller (mg/L)
set point of pH for pH controller (-)
sampling time (min)
temperature (°C)
410 Shioya and Shimizu
T t integral time of PI or PID controller (min)
T d derivative time of PID controller (min)
V culture volume (L)
^acid tot2L\ dissociated ion concentration of acid (mol/L)
^base total dissociated ion concentration of base (mol/L)
X K cell concentration of K. marxianus (g/L)
X L cell concentration of L. lactis (g/L)
\i K specific growth rate of K. marxianus (h _1 )
\i L specific growth rate of L. lactis (h _1 )
v L specific lactate consumption rate of K. marxianus (g-lactate/g-cell/h)
p A specific acetate production rate of L. lactis (g-acetate/g-cell/h)
p L specific lactate production rate of L. lactis (g-lactate/g-cell/h)
p^ specific nisin production rate of L. lactis (mg-nisin/g-cell/h)
References
1. Hoover, D. G. and Steenson, L. R. (1993) Bacteriocins of Lactic Acid Bacteria,
Academic Press, New York, pp. 1-2.
2. Hurst, A. (1981) Nisin. Adv. Appl. Microbiol. 27, 85-123.
3. Broughton, J. B. (1990) Nisin and its uses as a food preservative. Food Technol.
44, 100-117.
4. Ishizaki, A. and Vonktaveesuk, P. (1996) Optimization of substrate feed for
continuous production of lactic acid by Lactococcus lactis IO-l . Biotechnol. Lett.
18, 1113-1118.
5. Ryan, M. P., Rea, M. C, Hill, C, and Ross, R. P. (1996) An application in cheddar
cheese manufacture for a strain of Lactococcus lactis producing a novel broad- spec-
trum bacteriocin, lacticin 3147. Appl. Environ. Microbiol. 62, 612-619.
6. Thomas, L. V. and Wimpenny, J. W. T. (1996) Investigation of the effect of
combined variations in temperature, pH, and NaCl concentration on nisin inhibi-
tion of Listeria monocytogenes and Staphylococcus aureus. Appl. Environ.
Microbiol. 62, 2006-2012.
7. Beuchat, L. R., Clacero, M. R. S. C, and Jaquette, C. B. (1997) Effects of nisin
and temperature on survival, growth, and enterotoxin production characteristics
of psychrotrophic Bacillus cereus in beef gravy. Appl. Environ. Microbiol., 63,
1953-1958.
8. Yabannavar, V. M. and Wang, D. I. C. (1991) Extractive fermentation for lactic
acid production. Biotechnol. Bioeng. 37, 1095-1 100.
9. Honda, H., Toyama, Y., Takahashi, H., Nakazecko T., and Kobayashi, T. (1995).
Effective lactic acid production by two-stage extractive fermentation. /. Ferment.
Bioeng. 79, 589-593.
10. Ohara, H., Hiyama, K., and Yoshida. T. (1993) Lactic acid production by filter
bed-type reactor. /. Ferment. Bioeng. 76, 73-75.
11. Shi, Z., Shimizu, K., Iijima, S., Morisue, T., and Kobayashi, T. (1990) Adaptive
on- line optimizing control for lactic acid fermentation. /. Ferment. Bioeng. 70, 415^419.
Bacteriocin Production Process 4 11
12. Taniguchi, M., Hoshino, K., Urasaki, H., and Fujii, M. (1994) Continuous produc-
tion of an antibiotic polypeptide (nisin) by Lactococcus lactis using a bioreactor
coupled to a microfilteration module. /. Ferment. Bioeng. 11 ', 704-708.
13. Nomura, Y., Yamamoto, K., and Ishizaki. A. (1991) Factors affecting lactic acid
production rate in built-in electrodialysis fermentation, and approach to high speed
batch culture. /. Ferment. Bioeng. 71, 450-452.
14. Vonktaveesuk, P., Tonokawa, M., and Ishizaki, A. (1994) Stimulation of the rate
of L-lactate fermentation using Lactococcus lactis IO-l by periodic electrodialy-
sis. /. Ferment. Bioeng. 11, 508-512.
15. Shimizu, H., Mizuguchi, T., Tanaka, E., and Shioya, S. (1999) Nisin production
by a mixed-culture system consisting of Lactococcus lactis and Kluyveromyces
mar xianus. Appl. Environ. Microbiol. 65, 3134-3141.
16. Kultzman, C. P. and Fell, J. W. (1998). The Yeast, A Taxonomic Study, Elsevier,
Amsterdam, The Netherlands.
17. Stephanopoulos, G. (1984) Chemical Process Control, Prentice-Hall International
Inc., Englewood Cliffis, NJ.
18. Matsusaki, H., Endo, N., Sonomoto, K., and Ishizaki. A. (1995) Purification and
identification of a peptide antibiotics produced by Lactococcus lactis IO-l. /. Fac.
Agr., Kyushu Univ. 40, 73-85.
19. Borch, E. and Molin, G. (1989) The aerobic growth and product formation of
Lactobacillus , Leuconostoc, Brochothrix, and Carnobactrium in batch cultures.
Appl. Microbiol. Biotechnol. 30, 81-88.
VI
Reviews
43
Nutritional Status of Grape Juice
Bruce W. Zoecklein, Barry H. Gump, and Kenneth C. Fugelsang
1. Introduction
The chemical and physical environment of grape juice during fermentation,
coupled with competition from indigenous yeast and bacteria, can present sig-
nificant challenges to the growth of Saccharomyces cerevisiae. Individually or
collectively, these factors may impact both yeast growth and the conversion
rate of sugar to alcohol, leading not only to the formation of objectionable
odor- and flavor-active metabolites but, potentially, protracted, incomplete, or
"stuck" fermentations as well. Sluggish and stuck fermentations can be
described as those where the rate of sugar utilization is extremely slow,
especially near the end, and/or where residual fermentable sugar is left in the
wine. Such wines create significant management problems. Table wines
containing biologically available levels of sugar (>0.2% w/v glucose +
fructose) may undergo spontaneous refermentation. Further, unexpectedly
sweet wines may be an unacceptable departure from wine style.
Although the underlying causes of stuck fermentations may vary (see Fig. 1
and Production Notes in Chapter 32, this volume), metabolic failure ultimately
results from diminished and eventually blocked capacity of the yeast cell mem-
brane to transport glucose and fructose into the cell (1,2). Incorporation of both
sugars is accomplished by the action of a group of membrane-associated per-
meases, the hexose transport proteins (3,4). Continued operation requires
unimpeded mobility of the carrier proteins and sugars across the cell mem-
brane. Fermentative growth and a variety of environmental factors, including
decreasing availability of critical nutrients and increasing concentrations of
ethanol and other inhibitory metabolites, may significantly alter membrane flu-
idity, thereby lowering the incorporation of glucose and fructose (5,6).
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
415
416 Zoecklein, Gump, and Fugelsang
This review focuses primarily on yeast-assimilable nitrogen concentration,
one of the underlying causes of problem fermentations. However, as suggested
by Fig. 1, many factors may interactively contribute to protracted and/or
interrupted fermentation. An abridged review of the impact of each factor on
fermentation is presented in Chapter 32, this volume.
2. Total Nitrogen
Nitrogen compounds in grapes play important roles as nutrients for micro-
organisms involved in winemaking and wine spoilage and as aroma and aroma
precursors (7). Nitrogen is taken up by the vine roots as nitrate and reduced by
the nitrate reductases system to ammonia, transported and stored subsequently
as amino acids (7). Compared with fermentable carbon generally present in
grapes at >20% (w/v), total nitrogen levels range from 0.006% to 0.24%, of which
only 0.0021-0.08% is biologically available to fermenting yeasts (8). Thus, nitro-
gen may become an important growth-limiting constraint for microorganisms.
Fermentation rate (conversion of sugars to alcohol and carbon dioxide) is
directly related to biomass. Yeasts follow a classic growth profile beginning
with a lag phase followed by a period of rapid growth that culminates in the
stationary phase, where the population density remains relatively high.
Stationary-phase yeasts are responsible for the majority of alcoholic
fermentation (9). Eventually, depletion of carbon and nitrogen, coupled with
accumulation of toxic metabolites, leads to cell death and the decline phase.
During the stationary phase nitrogen uptake and utilization are directed toward
cell maintenance; for example, transporter proteins have a high turnover rate
during this stage of growth and thus require continued resynthesis (5).
The total nitrogen content of juice and wine consists of protein and
nonprotein fractions. Protein nitrogen comprises from 1% to 13% of the total
N (10), whereas polypeptides may account for more than 21%. Because
Saccharomyces sp. lacks both the extracellular proteases and transport enzymes
necessary for protein incorporation (11), neither fraction plays a significant
nutritional role. However, some native, non-Saccharomyces yeasts and bacteria
are capable of producing proteases (12). Whether protease activity is sufficient
to provide nitrogen to more than the species involved is unknown.
3. Assimilable Nitrogen
The nitrogenous components of grapes and juice that are metabolically avail-
able to yeasts are present as ammonium salts (NH 4 + ) and primary or "free
a-amino acids" (FAN). Combined, the two groups are referred to as Yeast-
Assimilable Nitrogenous Compounds or YANC (13). Thus, a complete
evaluation of the nutritional status of juice or must requires measurements of
both fractions.
Nutritional Status of Grape Juice 4 1 7
In grapes, NH 4 + ranges from near 30 to more than 400 mg/L (14,15), whereas
in wine, levels of less than 50 mg/L have been reported (16). Numerous studies
have demonstrated the priority of NH 4 + uptake by yeasts relative to amino
acids. Jiranek et al. (17) and Monk et al. (18) reported that NH 4 + was not only
incorporated preferentially to a-amino acids but also altered the established
pattern of amino acid uptake.
All of the 20 commonly occurring amino acids are found in grapes and wine.
Their total concentration ranges from 0.4 to 6.5 g/L (19). Of these, only the
a-amino acid FAN fraction is directly assimilable by yeasts. This fraction
includes arginine, serine, threonine, a-amino butyric, aspartic and glutamic
acids. Collectively, this group comprises 35^4-0% of the total N and 75-85% of
the total amino acids (19). Arginine is typically present at levels ranging from
5 to 10 times that of the other amino acids and represents 30-50% of the total
nitrogen utilization (20).
Minimum levels of FAN required for successful completion of alcoholic
fermentation range from 120 to 140 mg/L for musts with sugar concentrations of
160 to 240 g/L (21,22). FAN levels of 400-500 mg/L or greater are required for
maximum fermentation rate (20). During growth, yeast utilizes 1-2 g/L amino
acids (23). Depending on the particular amino acid, the yeast's stage of growth
and the presence and activity of necessary transport enzymes, amino acids may
be (1) directly incorporated into proteins, (2) degraded for either their nitrogen or
carbon components, or (3) stored in vacuoles for later utilization (24).
Amino acid uptake by Saccharomyces cerevisiae requires two amino acid
transport systems (20). During the early stages of growth, permeases specific
to individual L-amino acids (i.e., arginine permease) are active. Once the
concentration of NH 4 + has decreased and amino acids have been incorporated,
a general amino acid permease (GAP) is induced. Unlike specific permeases,
GAP is group specific, transporting both d and l isomers of basic (arginine,
histidine, lysine) and neutral (glutamine, alanine, serine, asparagine, threonine)
amino acids, with the exception of proline (25). GAP's role has been described
as that of a "nitrogen scavenger" that becomes operative in the latter stages of
fermentation upon depletion of the more available forms of nitrogen (26).
The patterns of amino acid incorporation from grape juice have been
reported by Castor (27) and others (18,28-32) and are known to vary depend-
ing on the presence or absence of ammonium salts (20). In the absence of NH 4 + ,
the first group of amino acids incorporated includes arginine, asparagine,
aspartate, glutamate, glutamine, serine, and threonine (group A), followed by
histidine, isoleucine, leucine, methionine, and valine (group B). Alanine,
phenylalanine, glycine, tryptophan, and threonine (group C) represent the last
amino acids to be incorporated. The presence of NH 4 + delays both the timing
and extent of amino acid incorporation.
418 Zoecklein, Gump, and Fugelsang
Not all amino acids are directly utilizable by yeast during fermentation
(20). Metabolic block(s) may be transitory or permanent. Proline is an
example of an amino acid whose utilization is linked to environmental condi-
tions. Proline is present in relatively high concentrations (700-800 mg/L)
but is not biologically available to Saccharomyces sp. before or during alco-
holic fermentation. Proline utilization requires two enzymes, a permease and
an oxidase. The permease, initially required for uptake, is inhibited by the
levels of NH 4 + present before and during the early stages of fermentation. By
the time permease inhibition is released, redox conditions have dropped and
the oxidase needed for ring cleavage is not functional (33). Where oxidative
conditions exist, proline becomes metabolically available, undergoing cleav-
age to glutamic acid and transamination to glutamate prior to entering bio-
synthetic pathways (34). The importance of proline to the cell is not restricted
directly to nutritional requirements. Along with glycine and the disaccharide
trehalose, proline has also been reported to help "protect" the cell against
osmotic stress (35).
Other amino acids that cannot be directly utilized as sole nitrogen sources
by Saccharomyces include lysine, cysteine, histidine, and glycine (36-38). In
the case of lysine, inhibition results from accumulation of the intermediate
a-amino adipate semialdehyde (37). Non-Saccharomyces yeasts are capable
of utilizing lysine as a sole carbon source. This technique may be employed for
identification in mixed cultures. As described by Zoecklein et al. (8), the sul-
fur-containing amino acid cysteine can be degraded to yield sulfide (H 2 S),
ammonium, and pyruvate via reverse operation cysteine synthetase (39). Cys-
teine accumulation, however, is inhibitory to Saccharomyces (40).
4. Production Considerations Influencing FAN
Most grape growing and winemaking decisions can influence FAN
concentration. These include grape variety (14,41,42) and rootstock selection
(43), climate, soil type (41,44), fertilization, and irrigation practices (45-47).
Arginine and proline are the main amino acids in the fruit if the fertilization of
the vine is low. With higher fertilization (>3 g N/plant), the amino acid amide
glutamine increases dramatically (7). Therefore, the nitrogen available for yeast
fermentation can be different in distinct wine growing regions of the world (7).
Grape maturity is also an important issue influencing the concentration of FAN,
in that underripe and overripe fruit may be low in FAN (23). Butzke (48)
evaluated the yeast-assimilable nitrogen status of Vitis vinifera musts from the
western United States in 1996. The concentration ranged from 40 to 559 mg
N/L, with an average of 213 mg N/L. Primary amino acid content ranged from
29 to 370 mg N/L (average, 135 mg N/L) whereas ammonium (NH 4 + ) ranged
from 5 to 325 mg N/L (average, 70 mg N/L).
Nutritional Status of Grape Juice 4 1 9
Microbiological deterioration of fruit can also influence initial FAN levels
(23,49). The growth of Botrytis cinerea may lower the concentration of amino
acids by up to 61% (7). Increasing interest in prefermentation maceration and
native fermentations (both yeasts and lactic acid bacteria) has lead to increased
concern regarding depletion of FAN required by Saccharomyces sp. Native
yeast and bacteria, present initially at relatively low population densities,
require significant amounts of FAN and vitamins to build biomass. By the time
Saccharomyces sp. populations become established, levels of available
nitrogen may be less than those required to achieve complete fermentation.
Winemaking practices such as whole-cluster pressing rather than con-
ventional crushing/stemming, coupled with juice clarification, are effective
techniques for reducing nonsoluble solids levels in white juice. Reduction of
nonsoluble solids concentrations may deprive yeasts of nutritionally important
substrates (50-52) and oxygen reservoirs during the early stages of fermenta-
tion (24). Fining agents may serve to further deplete vital nitrogen sources.
Guitart et al. (52) evaluated processing and several commonly utilized
prefermentation fining agents with regard to amino acid reduction. They
reported that silica gel additions removed the highest concentration of amino
acids, followed by enzyme treatment, cold-clarification, bentonite, and
centrifugation. Koch (53) reported reductions of total N in white juice of 10-15%,
following cold clarification. Where prefermentation bentonite additions were made,
reductions in total nitrogen of over 50% were observed. In terms of amino acid
reduction, Rapp (54) reported 15-30% reduction in amino acids following bento-
nite additions of 1 g/L.
5. Correcting Nitrogen Deficiency
Yeast-assimable nitrogenous compound deficiency in fermenting juice/must
is often corrected by the addition of assimilable nitrogen in the form of
diammonium phosphate, or DAP (25.8% NH 3 , 74.2% P0 4 w/w), and/or one of
several commercially available nitrogen supplements. Commercial nitrogen
supplements typically contain DAP (25-50% w/w) in addition to more complex
forms of nitrogen such as yeast extract, vitamins, and yeast hulls. Because the
concentration of nitrogen compounds may vary with the product, it is recom-
mended that winemakers consult the Material Safety Data Sheet (MSDS) for
formulation information prior to use.
Utilization of nitrogen supplements is regulated. In the United States and
among OIV nations, the maximum addition of ammonium salts (DAP) is 960
and 300 mg/L, respectively. In Australia, supplementation is linked to phosphate
levels in wine. The maximum level of inorganic phosphate (Pj) is 400 mg/L (20).
Traditionally, winemakers employing nitrogen supplementation add the
product along with yeasts at the start of fermentation. As noted, incorporation
420 Zoecklein, Gump, and Fugelsang
of ammonia and amino acids occurs primarily during the yeast's growth phase,
with limited uptake thereafter. Further, the presence of NH 4 + delays the uptake
of amino acids. Given this, a better plan is to supplement at a stage after the
yeast has incorporated available forms. This may take the form of incremental
additions starting at 48 h (for reds) and 72 h (for whites) postinoculation or a
single addition midcourse during the fermentation (see Chapter 32, this vol-
ume). Sablayroles (15) reported that a single addition made midway through
fermentation was as effective as a single addition at the start and circumvented
the issue of amino acid uptake. Nitrogen additions as low as 60 mg/L (as
ammonium phosphate) stimulated yeast activity within 1 h after addition (15).
6. Ethyl Carbamate Formation
Excessive amounts of nitrogen compounds in juice and wines can impact wine
aroma (55) and the formation of ethyl carbamate. Ethyl carbamate, or urethane, is
a carcinogen that occurs naturally in fermented foods, including wine, as a result of
the fermentative and assimilative activities of microorganisms. Toxicity studies
will be completed by the U.S. Food and Drug Administration by the year 2001
prior to recommending maximum acceptable levels (Gahagan, 2000, personal com-
munication). At present, the U.S. wine industry has established a voluntary target
level of <15 [ig/L (ppb) for table wines and <60 \ig/L for dessert wines.
Ethyl carbamate is produced from the reaction of urea and ethanol. Although
several precursors of urea and, subsequently, ethyl carbamate have been
identified (56), quantitatively the most important source is the amino acid
arginine. Upon incorporation, arginine is first converted to ornithine and urea,
which is directly utilizable by fermenting yeasts (34). In the presence of urea
and ethanol, formation of ethyl carbamate increases exponentially as a function
of temperature (57,58).
Formation of urea occurs during the early to midphase fermentation. This corre-
sponds to the point at which the fermentation of dessert-style wines (such as Port
style) are typically arrested by additions of alcohol. Yeast strains exhibit variability
in terms of urea uptake and excretion during fermentation (59).
Grapes from high-vigor vines and/or heavily fertilized vineyards have high
levels of arginine (>400 mg/L). Modifying vineyard fertilization practices,
utilizing yeast strains that release less urea, and timing the fortification of dessert
wines when urea concentrations are low may reduce ethyl carbamate formation
(58). Commercial ureases produced from Lactobacillus fermentation are avail-
able for postfermentation treatment of wines (60).
7. Conclusions
Several studies have highlighted the importance of nitrogen for successful
fermentations (61-65). There is a strong positive correlation between must N
Nutritional Status of Grape Juice 421
and wine aroma and flavor intensity. Specifically, wines produced from high-
N musts have a higher concentration of esters and lower concentration of fusel
alcohols. Both are positive factors contributing to wine quality. Successful
management of nitrogen deficiency requires that the winemaker identify the
potential for problems early in the winemaking process. Routine and easily
performed estimates of assimilable nitrogen (FAN + NH 4 + ) during juice and
must processing would be a valuable tool for the winemaker. Historically,
several analytical methods have been proposed to measure total nitrogen. These
have included ninhydrin (66) and the trinitrobenzene sulfonic (TNBS) method
described by Crowell et al. (67). Utilization of TNBS has largely been
discontinued because of difficulties in obtaining the chemical as well as waste-
management issues. Further, these methods yield erroneously high results
because of the inclusion of variable concentrations of protein and peptide
nitrogen, proline, and other amino acids, which are not readily incorporated by
Saccharomyces. A new spectrometric procedure utilizing ortho-phthalaldehyde
derivatives of the a-amino acids is now available. Component analysis of indi-
vidual amino acids provides insight into the potential for problem fermenta-
tions but is expensive and slow. A useful method is described in Chapter 32,
this volume.
References
1. Salmon, J. M. (1989) Effect of sugar transportation inactivation in Saccharomy-
ces cerevisiae on sluggish and stuck enological fermentations. Appl. Environ.
Microbiology 55, 9536-9538.
2. Lagunas, R. (1993) Sugar transport in Saccharomyces cerevisiae. FEMS
Microbiol. Rev. 104, 229-242.
3. Cirillo, V. P. (1962) Mechanism of glucose transport across the yeast cell
membrane. /. Bacteriol. 84, 485-491.
4. Salmon, J. M. (1997) Enological fermentation: kinetics of an isogenic ploidy series
derived from an industrial Saccharomyces cerevisiae strain. /. Ferm. Bioeng. 83,
253-260.
5. Lafon-Lafourcade, S. and Ribereau-Gayon, P. (1984) Developments in the
microbiology of wine production. Prog. hid. Microbiol. 19, 1-45.
6. Fleet, G. H. and Heard, G. M. (1993) Yeasts — growth during fermentation in Wine
Microbiology and Biotechnology (Fleet, G. H., ed.), Harwood Academic, Austra-
lia, pp. 27-54.
7. Sponholz, W. R. (1991) Nitrogen compounds in grapes, must, and wine in
International Symposium on Nitrogen in Grapes and Wine (Rantz, J., ed.)
American Society for Enology and Viticulture, Davis, CA, pp.67-77.
8. Zoecklein, B. W., Fugelsang, K. C., Gump, B. H., and Nury, F. S. (1995) Wine
Analysis and Production. Chapman & Hall, New York.
9. Monk, P. R. (1986) Rehydration and propagation of active dry wine yeasts.
Austral. Wine bid. J. 1(1), 3-5.
422 Zoecklein, Gump, and Fugelsang
10. Correa, I., Polo, M. C, Amigo, L., and Ramos, M. (1988) Separation des proteines
des mouts de raison au moyen de techniques electrophoretiques. Bull. OIV. 39,
1475-1489.
11. Rosi, I., Costamagna, L., and Bertuccioli, M. (1987) Screening for extracellular
acid protease(s) production by wine yeasts. /. Inst. Brew. 93, 322-224.
12. Lagace, L. S. and Bisson, L. F. (1990) Survey of yeast acid proteases for
effectiveness of wine haze reduction. Am. J. Enol. Vitic. 41, 1246-1249.
13. Dukes, B. C. and Butzke, C. E. (1998) Rapid determination of primary amino
acids in grape juice using an o-phthaldiadehyde/Af-acetyl-L-cysteine
spectrophotometric assay. Am. J. Enol. Vitic. 49, 125-134.
14. Henick-Kling, T., Edinger, W. D., and Larsson-Kovach, I. -M. (1996) Survey of
available nitrogen for yeast growth in New York grape musts. Wein-Wissensch.
51(3), 169-174.
15. Sablayroles, J. M. (1996) Sluggish and stuck fermentations. Effectiveness of
ammonium nitrogen and oxygen additions. Wein-Wissensch 51(3), 147-151.
16. Ough, C. S. (1969) Substances extracted during skin contact with white must. I.
General wine composition and quality changes with contact time. Am. J. Enol.
Vitic. 20, 93-100.
17. Jiranek, V., Langridge, P., and Henschke, P. A. (1990) Nitrogen requirement of
yeast during wine fermentation in Proceedings of the Seventh Australian Wine
Industry Technical Conference (Williams, P. J., Davidson, D. M., and Lee, T. H.,
eds.), Australian Industrial Publishers, Adelaide, pp. 166-171.
18. Monk, P.R., Hook, D., and Freeman, B. M. (1987) Amino acid metabolism by
yeast in Proceedings of the Sixth Australian Wine Industry Technical Conference
(Lee, T. H., ed.) Australian Industrial Publishers, Adelaide, pp. 129-133.
19. Wurdig, G. and Woller, R. (1989) Chemie des Weines. Handbuch der
Lebensmittel-technologie. Ulmer, Stuttgart.
20. Henschke, P. A. and Jiranek, V. (1993) Metabolism of nitrogen compounds in
Wine Microbiology and Biotechnology (Fleet, G. H., ed.) Harwood Academic,
St. Leonards NSW, Australia, pp. 27-54.
21. Bely, M., Sablayrolles, J-M., and Barre, P. (1990) Automatic detection of
assimilable nitrogen deficiencies during alcoholic fermentation in oenological
conditions. /. Ferment. Bioeng. 70(4), 246-252.
22. Bely, M., Sablayrolles, J. M., and Barre, P. (1991) Automatic detection and
correction of assimilable nitrogen deficiencies during alcoholic fermentation in
enological conditions in Proceedings of the International Symposium on Nitrogen
in Grapes and Wine (Rantz, J., ed.) American Society for Enology and Viticulture,
Davis, CA, pp. 211-214.
23. Dittrich, H. H. (1987) Mikrobiologie des Weines. Handbuch der Lebensmit-
teltechnologie, 2nd ed. Ulmer, Stuttgart.
24. Fugelsang, K. C. (1996) Wine Microbiology. Chapman & Hall, New York.
25. Grenson, M., Hou, C, and Crabeel, M. (1970) Multiplicity of amino acid
permeases in Saccharomyces cerevisiae. IV. Evidence for a general amino acid
permease. /. Bacteriol. 103, 770-777.
Nutritional Status of Grape Juice 423
26. Woodward, J. R. and Cirillo, P. V. (1997) Amino acid transport and metabolism in
nitrogen-starved cells of Sac charomyces cerevisiae. J. Bacteriol. 130, 714-723.
27. Castor, J. G. B. (1953) The free amino acids of musts and wines. II. The fate of
amino acids of must during alcoholic fermentation. /. Food Res. 18, 146-151.
28. Ingledew, W. M. and Kunkee, R. E. (1985) Factors influencing sluggish
fermentations of grape juice. Am. J. Enol. Vitic. 36, 65-76.
29. Bisson, L. F. (1991) Influence of nitrogen on yeast and fermentation of grapes, in
Proceedings of the International Symposium on Nitrogen in Grapes and Wine
(Seattle) (Rantz, J., ed.), American Society for Enology and Viticulture, Davis,
CA, pp. 78-89.
30. Monteiro,F. F. and Bisson, L. F. (1991) Biological assay of nitrogen content of grape
juice and prediction of sluggish fermentations. Am. J. Enol. Vitic. 42(1), 47-57.
31 . Monteiro, F. F. and Bisson, L. F. (1992a) Nitrogen supplementation of grape juice. I.
Effect on amino acid utilization during fermentation. Am. J. Enol. Vitic. 43(1), 1-10.
32. Monteiro, F. F. and Bisson, L. F. (1992b) Nitrogen supplementation of grape juice.
II. Effect on amino acid and urea release following fermentation. Am. J. Enol.
Vitic. 43, 11-17.
33. Ough, C. S. (1968) Proline content of grapes and wine. Vitis 7, 321-331.
34. Ingledew, W. M. (1996) Nutrients, yeast hulls and proline in wine fermentation.
Wein-Wissensch. 51, 141-146.
35. Manginot, C. and Sablayrolles, J. M. (1997) Use of constant rate alcoholic
fermentations to compare the effectiveness of different nitrogen sources added
during the stationary phase. Enzyme Microbial. Tech. 20, 373-380.
36. Watson, T. G. (1976) Amino acid pool composition of Saccharomyces cerevisiae
as a function of growth rate and amino acid nitrogen source. /. Gen. Microbiol.
96, 263-268.
37. Cooper, T. G. (1982) Nitrogen metabolism in Saccharomyces cerevisiae in The
Molecular Biology of the Yeast Sacchromyces (Strathern, J. N., Jones, E. W., and
Broach, J. B., eds.), Cold Spring Harbor Laboratory, New York, pp. 39-99.
38. Large, P. J. (1986) Degradation of organic nitrogen compounds by yeasts. Yeastl, 1-34.
39. Tokuyama, T., Kuraishi, H., Aida, K., and Uemura, T. (1973) Hydrogen sulfide
evolution due to pantothenic acid deficiency in the yeast requiring this vitamin,
with special reference to the effect of adenosine triphosphate on yeast cysteine
desulfhydrase. /. Gen. Appl. Microbiol. 19, 439-466.
40. Maw, G. A. (1965) The role of sulfur in yeast growth and in brewing. Wallerstein
Lab. Commun. 21, 49-68.
41. Huang, Z. and Ough, C. S. (1989) Effect of vineyard location, varieties and
woodstocks on the juice amino acid composition of several cultivars. Am. J. Enol.
Vitic, 40, 135-139.
42. Huang, Z. and Ough, C. S. (1991) Amino acid profiles of commercial grape juices
and wines. Am. J. Enol. Vitic. 42, 261-267.
43. Ough, C. S. and Tabacman, H. (1979) Gas chromatographic determinations of
amino acid differences in Cabernet Sauvignon grapes and wines as affected by
rootstocks. Am. J. Enol. Vitic. 30, 306-31 1.
424 Zoecklein, Gump, and Fugelsang
44. Etievant, P., Schlich, P., Bouvier, J.-C, Symonds, P., and Bertrand, A. (1988)
Varietal and geographical classification of French red wines in terms of elements,
amino acids and aromatic alcohols. /. Scie. Food Agric. 45, 25-41.
45. Bell, S. J. (1991) The effect of nitrogen fertilization on growth, yield, and juice
composition of Vitis vinifera cv. Cabernet Suavignon grapevines in Proceedings
of the International Symposium on Nitrogen in Grapes and Wine (Seattle) (Rantz,
J., ed.), American Society for Enology and Viticulture, Davis, CA, pp. 206-210.
46. Bell, A. A., Ough, C. S., and Kliewer, W. M. (1979) Effects on must and wine compo-
sition, rates of fermentation and wine quality of nitrogen nitrogen fertilization of Vitis
vinifera var. Thompson seedless grapevines. Am. J. Enol. Vitic. 30, 124-129.
47. Ough, C. S. and Bell, A. A. (1980) Effects of nitrogen fertilization of grapevines
on amino acid metabolism and higher alcohol formation during grape juice
fermentation. Am. J. Enol. Vitic, 31, 122-123.
48. Butzke, C. E. (1998). Survey of yeast assimilable nitrogen status in musts from
California, Oregon and Washington. Am. J. Enol. Vitic. 49, 220-224.
49. Dittrich, H. H. and Sponholz, W. R. (1975) Die aminosaureabnahme in Botrytis-
infizierten Traubenbeeren und die bildung hoherer alhohole in deisen Mosten bei
ihrer vergarung. Wein-Wissensch. 30, 188-210.
50. Ferenczy, S. (1966) Etude des proteines et des substances azotees. Leur evolution
au cours des traitements oenologiques. Conditions de la stabilite proteique des
wins. Bull. OIV 39, 1311-1336.
51. Houtman, A. C. and duPleissis, C. S. (1981) The effect of juice clarity and several
conditions promoting yeast growth on fermentation rate, the production of aroma
components and wine quality. S. Afr. J. Enol. Vitic. 2, 71-81.
52. Guitart, A., Orte, P. H., and Cacho, J. (1998) Effect of different clarification treat-
ments on the amino acid content of Chardonnay musts and wines. Am. J. Enol.
Vitic. 49(4), 389-396.
53. Koch, J. (1963) Proteines des vins blancs. Traitements des precipitations proteiques
par chauffage et a l'aide de la bentonite. Ann. Technol. Agric. 12, 297-313.
54. Rapp, A. (1977) Uber den Gehalt der Aminosauren in Weinbeeren, Traubenmost
und Wein, BundesausschuB fur Weinforschung, Germany, pp. 136-151.
55. Rapp, A. and Versini, G. (1991) Influence of nitrogen compounds in grapes on
aroma compounds in wine in Proceedings of the International Symposium on
Nitrogen in Grapes and Wine (Rantz, J., ed.), American Society for Enology and
Viticulture, Davis, CA, pp. 156-164.
56. Monteiro, F. F., Trousdale, E. K., and Bisson, L. F. (1989) Ethyl carbamate
formation in wine: Use of radioactively labeled precursors to demonstrate the
involvement of urea. Am. J. Enol. Vitic. 40, 1-8.
57. Stevens, D. F. and Ough, C. S. (1993). Ethyl carbamate formation: reaction of
urea and citrulline with ethanol in wine under low to normal temperature condi-
tions. Am. J. Enol. Vitic. 44, 309-312.
58. Ough, C. S. (1993) Report on ethyl carbamate for the Wine Institute. Ethyl
carbamate/urease enzyme preparation. A compendium from June, 1993 seminars.
Nutritional Status of Grape Juice 425
59. An, D. and Ough, C. S. (1993) Urea excretion and uptake by various wine yeasts
as affected by various factors. Am. J. Enol. Vitic. 44, 35-40.
60. Yoshizawa, K. and Takahashi, K. (1988) Utilization of urease for decomposition
of urea in sake. /. Brew. Soc. Jpn. 83, 142-144.
61. Agenbach, W. A. (1977) A study of must nitrogen content in relation to incom-
plete fermentations, yeast production and fermentation activity, in Proceedings of
the South African Society for Enology and Viticulture (Cape Town), South African
Society for Enology and Viticulture, Stellenbosch, pp. 66-88.
62. Sablayrolles, J.-M. (1992) Importance de l'azote assimilable de l'oxygene sur le
deroulement de la fermentation alcoolique. Biol. Oggi 6, 155-160.
63. Sablayrolles, J.-M., and Dubois, C. (1996) Effectiveness of combined ammoniacal
nitrogen and oxygen additions for completion of sluggish and stuck fermenta-
tions. /. Ferm. Bioeng. 92, 377-381.
64. Schulze, U., and Liden, G. (1996) Physiological effects of nitrogen starvation in an
anaerobic batch culture of Saccharomyces cerevisiae. Microbiology 142, 2299-2310.
65. Bission, L. F. (1996). Yeast and biochemistry of ethanol formation, in Principles
and Practices ofW in e making, (Boulton, R. B., Singleton, V. L., Bisson, L. F., and
Kunkee, R. E., eds.), Chapman & Hall, New York, p. 140.
66. Lie, S. (1973) The EBC-Ninhydrin method for determination of free a//^//tf -amino
nitrogen (FAN). /. Inst. Brew. 79, 37-41.
67. Crowell, E. A., Ough, C. S., and Bakalinsky, A. (1985) Determination of alpha-amino
nitrogen in musts and wines by TNBS methods. Am. J. Enol. Vitic. 36(2), 175-177.
68. Dukes, B. C. and Butzke, C. E. (1998) Rapid determination of primary amino
acids in grape juice using an o-phthalaldehyde/N-acetyl-L-cysteine spectrophoto-
metric assay. Am. J. Enol. Vitic. 49, 125-134.
44
Problems with the Polymerase Chain Reaction
Inhibition, Facilitation, and Potential Errors in Molecular Methods
Ian G. Wilson
1. Introduction
This chapter discusses the findings of many studies in food, clinical and
environmental microbiology including approaches that have been used to over-
come inhibition and facilitate amplification for detection and typing.
Over 70,000 published papers involve the polymerase chain reaction (PCR)
(1), and few areas of biological science remain untouched by the invention of
this technique (2-4). Other methods for amplifying nucleic acids have been
described (5-7) such as Q(3 replicase (7), ligase chain reaction (LCR) (8,9),
single-stranded sequence replication (SSSR or 3SR) (10,11), strand
displacement amplification (SDA) (12,13) and nucleic acid sequence-based
amplification (NASBA) (14,15), but these have received less attention.
Problems may sometimes occur with PCR (16). These can be categorized as
follows:
1. False positives resulting from accidental contamination with nucleic acids
2. False negatives resulting from reaction inhibition or attenuation
3. Misleading identification or false categorization in typing procedures that involve
amplification or other genetic typing methods
Factors that inhibit the amplification of nucleic acids by PCR are present
with target DNA obtained from many sources. The inhibitors generally act at
one or more of three essential points in the reaction: interference with the cell
lysis necessary for extraction of DNA, nucleic acid degradation or capture,
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
427
428 Wilson
and inhibition of polymerase activity for amplification of target DNA.
Although a wide range of inhibitors is reported, the identity and mode of action
of many remain unclear. These effects may have important implications for
clinical and public health investigations, especially if they involve food and en-
vironmental screening. Common inhibitors include various components of body
fluids and reagents encountered in clinical and forensic science (e.g., hemoglo-
bin, urea, heparin), food constituents (e.g., organic and phenolic compounds,
glycogen, fats, Ca 2+ ) and environmental compounds (e.g., phenolic compounds,
humic acids, heavy metals). Other, more widespread, inhibitors include constitu-
ents of bacterial cells, nontarget DNA, and contaminants and laboratory items
such as pollen, glove powder, laboratory plastic ware, and cellulose.
This chapter lists and discusses the problems associated with PCR and
methods that can overcome them in food, clinical, and environmental
microbiology. Aspects of clinical and environmental microbiology are
important in this discussion because inhibitors from both these sources may be
present in foods derived from animals and plants. The text examines the
mechanical reasons for PCR problems, and the tables present information from
the literature according to the substrate being investigated, in chronological
order. It is beyond the scope of this chapter to discuss in detail the various
physical, enzymic, and chemical methods used in the extraction, purification,
and quantitation of nucleic acids. These are presented and discussed in
commercial literature and elsewhere (17-21). Subheading 4. in this chapter
also considers the problems that may lead to errors when using a variety of
methods for microbial identification and typing, not all of which involve PCR.
2. False Positives: Nucleic Acid Contamination
Despite early indications of great sensitivity, there are circumstances in which
the ability to detect minute quantities of DNA may also be a negative aspect of the
procedure. The most commonly reported problem of PCR is false-positive results
because of DNA cross -contamination (16,22). Contamination may arise from
impure cultures, contaminated reaction components including commercial poly-
merases (23), and laboratory contamination transferred by aerosol, gloves, pipets
or other means. It can be overcome by ultraviolet (UV) light (24), sodium
hypochlorite (25), and photochemical or enzymic methods (26-29). Compact flow
cabinets containing a UV light source are commercially available and provide a
suitable environment for working with open tubes and eliminating unwanted DNA.
Physical separation of preamplification and postamplification reactions in differ-
ent areas of the laboratory is an important aspect of minimizing stray nucleic acid
sequences. Negative control tubes should always be used to check for false-posi-
tive reactions. Some automated commercial systems utilize sealed reaction vessels
to reduce the risk of unwanted DNA entering.
Problems with the PCR 429
There are also problems of using amplification methods in clinical micro-
biology where the presence of an organism's DNA may not indicate its clinical
significance in causing disease. Even when detection is a true positive (i.e., not
a laboratory or clinical contaminant), this does not necessarily indicate viabil-
ity or causality.
3. False Negatives
False negatives resulting from reaction inhibition have been widely reported
and reviewed (30-32). Inhibition may be total or partial and can become apparent
as complete reaction failure or as reduced sensitivity of detection. In some cases,
inhibition may be the cause of false-negative reactions because workers have not
incorporated internal controls in each reaction tube. Early evidence of exquisite
sensitivity using mammalian cells (33) involving detection of a single molecule
of DNA from a hair was not followed by similar sensitivity when PCR was
applied to many microbial (and some mammalian) situations where poor
sensitivity, specificity, and reproducibility have been reported (21,34-38). As
discussed in detail in the following sections, there may also be potentially impor-
tant effects in PCR typing reactions (39), and difficulties can occur in post-PCR
manipulation (40). Although systematic study of inhibition has seldom been the
focus of published investigations, many workers have reported these effects in
the course of other studies (16,37,38,41-44). Considering the prevalence of this
problem, it is surprising that few systematic and mechanistic studies of PCR
inhibition have been reported. Rossen et al. (30) contributed a comprehensive
study of PCR inhibition, identifying inhibitory factors in foods, bacterial culture
media, and various chemical compounds. These included organic and inorganic
chemicals, detergents, antibiotics, buffers, enzymes, polysaccharides, fats, and
proteins. Subsequent reviews have surveyed the literature extensively and
provided much more information (31,32).
3. 7. Factors Affecting Detection Level
Cultural detection methods allow quantification of microorganisms with
considerable precision. This may be of importance in clinical, food, and
environmental investigations when distinguishing commensal organisms from
those causing disease. Quantification of PCR product cannot necessarily be
equated with number of organisms present in the original sample (16).
The minimum number of cells containing a single-copy target gene theoreti-
cally detectable in a 10-|iL sample aliquot added to a 90-[iL reaction mix is
one. This corresponds to 100 colony-forming units (CFU)/mL, a similar
sensitivity to plate counts, and, in practice, may be reduced through sampling
error. The random distribution of cells near the detection limit means that a
single cell or gene copy may not actually be present in some aliquots that have
430 Wilson
been calculated to contain such numbers. Food, clinical, and environmental
samples commonly reduce sensitivity through a wide range of inhibiting
substances. Complete failure and false-negative amplification reactions are
reported in many cases (45,46), but often sensitivity is merely reduced (47),
sometimes considerably (48). Typically, a variety of mechanisms reduce
sensitivity by several orders of magnitude. Wernars et al. (37) found the sensi-
tivity of detection was at least 10-fold poorer than the theoretical minimum,
varying between 10 3 and >10 8 CFU/0.5 g in different brands of soft cheeses.
Sensitivity was reduced 1000-fold in milk powder (38) where 10 5 CFU/mL
were required for detection of Staphylococcus aureus despite fewer than
10 cells being detectable in diluent. Protein-breakdown products in aged
cheeses caused sensitivity problems in the detection of lactic acid bacteria (49).
Ten plaque-forming units (PFU) per gram of enteroviruses in diluent were
detectable directly in an reverse-transcriptase (RT)-PCR assay (50), but only
10 3 PFU/g when extracted from oyster meat. Such sensitivity is typical of the
lower detection limits that are achieved in practice for clinical and environ-
mental samples and foods.
Dilution of samples, as with enrichment culture in the presence of potential
growth inhibitors such as spices and disinfectants, provides a simple method
that can facilitate amplification, albeit with reduced sensitivity. The sensitivity
of PCR can be exploited to amplify target DNA that is still present when
inhibitors have been diluted out (51-54).
Conversely, PCR detection of intracellular bacteria may be more sensitive
than expected because of multiple bacterial cells in each infected blood cell
(55). This may provide the opportunity to achieve greater sensitivity than that
suggested earlier. Amplification of short-lived multiple-copy RNA species may
provide increased sensitivity relative to DNA targets in some situations.
Authors sometimes are unclear about whether the number of cells detect-
able is per milliliter or per reaction volume (normally 100 jaL). There are
apparent contradictions in the published works that discuss inhibition. One
substance may be reported as being both an inhibitor and a facilitator in differ-
ent systems. At different concentrations, the same compound has been reported
to act as both facilitator and attenuator in the same system (56,57). Both
bacterial cells and nontarget DNA have been shown to be both inhibitory and
noninhibitory in different systems. Steffan and Atlas (58) were able to detect a
15-20 copy target sequence in Pseudomonas cepacia cells at 1 CFU/g against
10 11 nontarget organisms in samples of sediment. This represents detection
10 3 -fold more sensitive than probing nonamplified samples despite high
numbers of potentially inhibitory nontarget organisms. Andersen and
Omiecinski (59) found that >10 5 CFU of indigenous bacteria did not inhibit spe-
cific amplification of target DNA from enteroinvasive Escherichia coli (EIEC).
Problems with the PCR 431
Dickinson et al. (60) found that high background levels of bacterial DNA were
not inhibitory to specific amplification and that 10 2 -10 4 CFU/mL could be
detected in several food types. Sensitivity was lower for cheese than coleslaw
or chicken. These authors speculate that nontarget DNA may have improved
sensitivity by acting as a carrier for target DNA during precipitation. Nev-
ertheless, bacterial cells can have an inhibitory effect on PCR (44, 61-63). A
study of the efficiency of DNA extraction from soil and PCR inhibition by
humic compounds (63) showed that high levels of nontarget DNA could inhibit
PCR. Sensitivity may vary with the microbial species detected, using identical
extraction protocols, because recovery may be different between species
(63,64)- Alvarez et al. (51) found that 10 3 -10 4 CFU/m 3 of environmental
organisms interfered with detection of E. coli during bioaerosol sampling.
Freeze-thaw lysis and sample dilution allowed rapid and sensitive detection of
a single cell. The multiplex amplification of VT1, VT2, and each genes was
not diminished equally for all target sequences when nontarget cell populations
were added in a study of E. coli 157:H7 (65). The authors recommend caution
when interpreting negative PCR reactions when high concentrations of nontar-
get cells are suspected.
Where nonspecific bacterial effects inhibited an antigen-antibody reaction,
skim milk was found to overcome this (66). It also acts as a blocking agent
preventing the nonspecific adhesion of bacteria to immunomagnetic beads (66)
and is used to similar effect for blocking nonspecific reactions during
membrane hybridization. Skim and full cream milk have also been found to be
inhibitory to PCR (38,67,68), partly because of DNA loss during extraction
procedures and partly because of amplification inhibition. In PCR, milk
components may block DNA and shield it from access by polymerase.
Reaction conditions have long been recognized as important to sensitive
and reproducible amplification. Contamination also must be considered as a
possible cause of reaction failure.
3.2. Reaction Conditions
Suboptimal reaction conditions may arise for a number of reasons. The
primary ones are inappropriate primers, improper time or temperature conditions,
variable polymerase quality and incorrect Mg 2+ concentration. These factors
should be optimized by running several temperature profiles based on calculated
primer melting points and Mg 2+ dilution series reactions before relying on PCR
for sensitive and specific detection from a given medium.
Amplification Assistant, an Internet troubleshooting resource, is available
at www.promega.com/amplification/assistant. This site allows users to describe
the type of reaction they are trying to perform, describe the main problem, and
receive suggestions about the cause of the problem and its solution (69).
432 Wilson
Temperature inconsistencies across the block of a thermal cycler have been
found to be responsible for poor amplification (39,70) and this has been
overcome by the addition of formamide, which reduces the melting tempera-
ture of DNA (70). This is not an ideal solution and further studies could reveal
that the specificity of the reaction may suffer from this treatment. Excellent
thermal consistency is important for sensitive and specific testing and should
be considered when choosing between the many models of thermal cycler
available. The reproducibility of cycle time and temperature should be checked,
particularly when moving to a different machine or tubes with different thermal
transfer properties, and the sample block should be cleaned to ensure consis-
tent performance.
Physical modifications to the PCR reaction such as hot start may be help-
ful for improving the yield and specificity of reactions. Adding reactants
when the reaction has reached denaturation temperature is particularly use-
ful when detecting low-copy-number molecules amid a high background of
nontarget DNA because it reduces the formation of primer oligomers and
misprimed reactions that compete with the specific amplification of the tar-
geted sequence.
Dimethylsulfoxide (DMSO) has been shown to improve reaction yield during
RT-PCR (71). Sensitivity was improved up to 25-fold for some viral target
RNAs. This report involved the use of xTth polymerase, and no inhibitors were
mentioned. The optimal concentration of DMSO was dependent on the template
and facilitated both the reverse transcriptase and PCR reactions. It was suggested
that DMSO may enhance PCR by eliminating nonspecific amplification, alter-
ation of the thermal activity of the polymerase, or improve the annealing effi-
ciency of primers by destabilizing secondary structures within the template.
The Mg 2+ ions are a vital cofactor for Thermus aquaticus (Taq) polymerase
and their concentration will affect the success and specificity of amplification.
The sequestration of Mg 2+ ions by various compounds and interference by Ca 2+
ions may inhibit amplification (41,72). The Ca 2+ ions in milk may be a cause of
its inhibitory properties.
A number of DNA polymerases are now commercially available. These
originate from several extreme thermophiles and exhibit differences in
processivity and fidelity, making some more suitable than others for specific
tasks. Batches of polymerase may be pooled to overcome variability in en-
zyme quality. Production of PCR product may be improved in some situations
if mixtures of different polymerases are used. This may allow improved yield
because some enzymes may be less susceptible than others to specific
inhibitors and will permit amplification that would not otherwise occur.
Inhibitory effects may be minimized by optimizing the reaction conditions
and ensuring that appropriate quantities of all reactants are freely available
Problems with the PCR 433
within the reaction mixture by minimizing the presence of any contaminants
and known inhibitors.
3.3. Endogenous and Exogenous Contamination
and Other Factors
Contamination and other factors intimate to the reaction, even apparently
inert components, may cause inhibition at any of the points of molecular
interaction to be discussed. Their modes of action are not yet understood, but
there may be chemical or physical interference with the availability or activity
of an essential reaction component. Contamination may be endogenous to the
reaction components (e.g., sample, enzyme, tubes) or exogenous (e.g., bacteria,
dust, pollen).
The most obvious origin of PCR inhibitors in endogenous contamination is
compounds present in insufficiently purified target DNA. Inhibition can also
arise from other endogenous sources, including reaction components.
Commercial preparations of Tag polymerase, including a low-DNA product,
have been shown to be contaminated with eubacterial DNA that originates in
neither E. coli nor Taf(23). In particular, this may reduce the effective applica-
tion of PCR using broad-range eubacterial primers because of the production
of false-positive reactions. For more specifically targeted reactions, such
contamination generally is of little importance. This study demonstrated that
enzyme-contaminating sequences can be destroyed by UV irradiation. It also
showed that microcentrifuge tubes from different manufacturers gave greatly
different results. Strong inhibition has also been identified in some brands and
batches of PCR reaction tubes by other workers, but the cause could not be
discovered (73). Considerable variability in the performance of Taq polymerase
within batch, by concentration, and between suppliers has been documented in
a commentary that details many parameters affecting multiple arbitrary
amplicon profiling (39). In addition to reaction failure, enzyme contamination
may be manifested as spurious background bands during amplification-based
DNA fingerprinting using methods such as random amplified polymorphic
DNA (RAPD). By nature of their low stringency, such typing techniques rely
on both specific and nonspecific priming and combine the detection of artifac-
tual variation with true polymorphism. Contamination, concentration-depen-
dent effects, spurious bands, and inhibition may complicate the interpretation
of banding patterns and give rise to misleading results.
Like reaction tubes, other apparently inert components may be inhibitory.
Cellulose and nitrocellulose filters were found to inhibit PCR (74). In this
study, polycarbonate filters proved not to be inhibitory, perhaps because of
differences in binding properties for DNA or its contaminants relative to those
of cellulose-based filters. Mineral oil has been shown to have an inhibitory
434 Wilson
effect on PCR when irradiated with UV light (75). The inhibition is dependent
on the UV dose. Unirradiated mineral oil has been reported as a facilitator in
"oil-free" reactions containing high concentrations of nonionic detergents (76).
This author suggested that components of detergent preparations (monomers,
micelles, or impurities) could be responsible for adverse effects on the speci-
ficity of annealing. It is likely that detergents allow the greater solubilization
of inhibitors that might otherwise aggregate and precipitate during preparation
or in the reaction tube. Oil overlays may facilitate amplification by segregating
inhibitors at the oil-water interface and remain an option in thermal cyclers
designed for "oil-free" reactions.
Reaction failure may also be caused by exogenous contamination. This
differs from the other sources of inhibition discussed earlier that result from
compounds present in insufficiently purified DNA or from contaminants in
reaction components. However it may involve the same mechanisms of
inhibition. Inhibition may the result of even <10 grains of pollen that may
enzymically digest an essential reaction component (46), glove powder (45,77),
which may nonspecifically bind DNA, or other factors that enter reaction tubes
when hygienic conditions are not sufficiently controlled.
Contamination can be prevented by Good Laboratory Practice (GLP) and
scrupulous attention to aseptic technique that also serves to protect from cross-
contamination of target sequences, although these can be dealt with using UV
irradiation or uracil /z-glycosylase (UNG) (78). Restriction enzymes have been
shown to be inhibited, or their specificity altered, by multiple uracil substitu-
tions in restriction sites (79). This may also have implications for the fidelity of
PCR typing methods, as discussed later. Laminar-flow cabinets may be of use
in preventing airborne contamination and cabinets equipped with a UV light
source are available specifically to minimize contamination during PCR work.
Ironically, the good practice of changing gloves may in some cases actually
predispose reactions to failure. Powders from gloves were shown to have
variable inhibitory effects on PCR, depending on manufacturer (45). If it is
suspected that this is the source of problems, washing gloves and the selection
of nonpowdered brands may be helpful.
3 A. Mechanisms of Inhibition
The inhibition of amplification may be the result of a number of factors,
none of which has been investigated thoroughly. Details of the inhibitory
effects of some compounds that have been reported in food, clinical, and
environmental systems may be found in Tables 1-3. Inhibitors in clinical and
environmental are also relevant to food studies because of the animal and plant
origins of foods. Inhibition may originate from poorly controlled reaction
conditions, from the sample itself, from contaminants in reagents, containers,
Table 1
Inhibitors and Facilitators in Food Samples
Substrate
Target organism
Inhibitor
Facilitator
Ref.
Milk
Listeria monocytogenes
Unknown
Enzymatic digestion, membrane
solubilization
81
Skim milk
S. aureus
Thermonuclease, proteins,
debris
bacterial
NaOH, Nal, physico-chemical
extraction, nested PCR
38
Soft cheeses
L. monocytogenes
Brand-specific inhibitors, i
protein
denatured
Phenol extraction, Qiagen
column
37
Various foods
E. coli
Bean sprouts, oyster meat
Magic Minipreps
59
Foods and cultures
S. aureus, E. coli,
Salmonella spp
Lectin affinity chromatography
173
^ Various foods
L. monocytogenes
Various
30
°i Skim milk
S. aureus
Thermonuclease, proteins,
bacterial
NaOH, Nal, physico-chemical
44
debris
nested PCR
extraction,
Solution
S. aureus
Thermonuclease,
NaOH, Nal, physico-chemical
21
proteins, bacterial debris
nested PCR
extraction,
Oyster meat
Poliovirus l,Norwalk
virus, hepatitis A virus
Polysaccharides, glycogen
Organic flocculation, CTAB,
PEG extraction
177
Meat
Brochothrix
thermosphacta
Fetuin, meat components
Lectin binding
178
Milk
L. monocytogenes
Proteinase
BSA, proteinase inhibitors
116
Soft cheese
L. monocytogenes
Unknown
PEG/dextran extraction
179
Various foods
L. monocytogenes
Unknown
Enrichment, NASBA
15
Various foods
L. monocytogenes
Unknown
Nal/alcohol precipitation
180
Oysters
Enteroviruses
Unknown
Freon, PEG, chloroform, CTAB
181
Table 1 (cont.)
Inhibitors and Facilitators in Food Samples
Substrate
Target organism
Inhibitor
Facilitator
Ref.
•4\
Raw milk
Shellfish
Various foods
Oyster meat
Drinking water
Raw milk
Cold-smoked
salmon
Ground beef
Milk
Raspberries
Clostridium
tyrobutyricum
SRSVs
Various bacteria
Poliovirus, hepatitis
A virus, Norwalk virus
Enteroviruses,
hepatitis A virus
Brucella spp.
L. monocytogenes
E. coli
L. monocytogenes
Cyclospora sp. and
Eimeria spp.
Unknown
Unknown
Unknown
Acidic polysaccharides, glycogen
Humic acid/organic compounds
Milk proteins
Food components, sucrose,
ovalbumin, phenolic compounds
Food components
Ca 2+
Capture by fruit epidermal hairs
in raspberry wash sediment?,
humic or polyphenolic compounds?
Chemical extraction,
182
centrifugation
PEG, Freon, ultracentrifugation
183
Enzymic/physico-chemical
60
extraction
Freon, DMSO, glycerol,
50
PEG, Pro-Cipitate
ProCipitate, PEG, antibody
184
capture
Physico-chemical extraction,
68
nested PCR
Ether and column extraction,
86
Tween-20
Enrichment culture, Taqman™
185
Chelation, [Mg 2+ ]
41
Various treatments partially
85
effective
Table 2
Inhibitors and Facilitators in Clinical Samples
Substrate
Target organism
Inhibitor
Facilitator
Ref.
Feces
E. coli
>10 3 bacterial cells
Ion-exchange column
120
CSF
Treponema pallidum
Cellular debris causing nonspecific
amplification
Nested primers
109
Whole blood
Mammalian tissue
>4 ^iL blood/100 [iL
reaction (hemoglobin)
<1— 2% blood per reaction
112
Feces
Rotavirus
Unknown
Dilution, cellulose fiber
paper
186
Clinical specimens
Cytomegalovirus
Unidentified components
Glass bead extraction
97
Human blood
Human genes
DNA-binding proteins
Thermophilic protease
99
and tissue
from Thermus rt41A
Mammalian tissue genetics
Organic solvents, DMSO,
PEG, glycerol
187
Mammalian tissue
Thermal cycler inconsistencies
Formamide
70
genetics
Clinical specimens
T. pallidum
Various unknown factors
Various substrate-specific
physico-chemical methods
108
Many
Many
Many
30
Forensic semen
Interference of vaginal
Genotyping errors and
62
samples
microflora with sperm
selective or total PCR inhibition
Feces
genotyping
Salmonella
Various enteric viruses
by vaginal microorganisms
Various body fluids
Unknown
Immunomagnetic separation
Size-exclusion
chromatography,
physico-chemical extraction
111
188
Table 2 (cont.)
Inhibitors and Facilitators in Clinical Samples
Substrate
Target organism
Inhibitor
Facilitator
Ref.
Clinical specimens
Feces
Tissue culture
Suspensions, skin
biopsies
Clincal specimens
Formalin-fixed
paraffin tissue
extraction
Nasopharyngeal
aspirates and swabs
Human mononuclear
blood cells
Blood stain
Feces
Herpes simplex virus
E. coli
Cytomegalovirus, HIV
Mycobacterium leprae
M. tuberculosis
Mammalian tissue genetics
Hepatitis C virus
Bordetella pertussis
HIV 1
Human mitochondrial DNA
Vibrio cholerae
Endogenous inhibitors,
random effects
Nonspecifc inhibitors, urea,
hemoglobin, heparin, phenol, SDS
Glove powder
Mercury-based fixatives,
neutral buffered formalin
Unknown inhibitors in pus,
tissue biopsies, sputum, pleural fluid
Unknown contaminant of reverse
transcriptase
Ribonucleotide vanadyl complexes
Repurification, coamplified
positive control
Additional primers
and reaction cycles,
booster PCR
Reduced fixation times,
ethanol fixation
Physico-chemical extraction
Additional DNA
Phenol-chloroform
105
115
45
106
110
56
189
Unknown inhibitors
Phenol-chloroform
extraction
190
Detergents
Mineral oil
76
Unidentified heme compound,
Bovine serum albumin
104
hemin
Unknown contaminants
Dilution
191
Table 2 (cont.)
Inhibitors and Facilitators in Clinical Samples
Substrate
Target organism
Inhibitor
Facilitator
Ref.
Blood
Sputa
Human tissue
Clinical specimens
Bovine semen
Feces
Dental plaque
Ancient
mammalian
tissues
Sputum
Various
Mycoplasma pneumonia
HLA-DRB1 genotyping
M. tuberculosis
Bovine herpesvirus- 1
Salmonella
Many
Cytochrome-Z? gene
M. tuberculosis
Heparin
A/-acetyl-L-cysteine, dithiothreitol,
mucolytic agents
Pollen (<10 grains), glove
impure DNA, heparin,
powder, hemoglobin
Unknown inhibitors
Unknown
Hemoglobin degradation
products, bilirubin,
bile acids, faeces
Unknown
guanidium isothiocyanate,
ethanol, acetone
Unknown
Hemoglobin and others
Alternative polymerases
and buffers, Chelex,
spermine, [Mg 2+ ],
glycerol, BSA, heparinase
Competitive internal control
Dilution, adjustment of
ionic conditions
Immunomagnetic separation
Diatomaceous earth,
Ethidium bromide,
ammonium acetate
Anion-binding resin
72
192
46
193
54
107
36
95
194
Table 2 (cont.)
Inhibitors and Facilitators in Clinical Samples
Substrate
Target organism
Inhibitor
Facilitator
Ref.
Sputum and
M. tuberculosis
Unknown
195
bronchial samples
Endocervical specimens
Chlamydia trachomatis
Components of endocervical matrix
Q(3 replicase
196
Aqueous and
Viral nucleic acids
Unknown
Dilution, chloroform
extraction,
118
vitreous fluids
non-Taq polymerases
Bovine feces
Cryptosporidium
Unkown
Spin columns
197
Solution
Bacteroides
Heme; bilirubin; bile
BSA,gp32
117
Gastric mucosa,
feces, dental plaque,
oral rinses
Helicobacter pylori
salts; humic substances
(complex polyphenolics); EDTA;
SDS; Triton X-100; hemin, tannic,
fulvic and humic acids; bacterial
extracts; proteases
Feces, plaque
Nested primers
48
Table 3
Inhibitors and Facilitators in Environmental Samples
Substrate
Target organism
Inhibitor
Facilitator
Ref.
River sediment
Pseudomonas cepacia
None
Physicochemical
extraction
64
Suspension
S. typhimurium,
Listeria monocytogenes
Unknown
Lectin affinity
chromatography
172
Water
Various bacteria
Cellulose and nitrocellulose filters
PTFE filters
74
Sediments
E. coli
Humic substances
Gel filtration
53
Water
E. coli
Low sensitivity
Membrane filtration,
75 solid-phase PCR
cycles and radiometric detection
198
Soils and sediments
E. coli
Humic substances, iron
Dilution
52
Plant tissue
Plant tissue
Acidic plant polysaccharides
and buffer additives, SDS
Tween-20, DMSO,
PEG 400
199
Soil
P. cepacia
Humic compounds interfere
with lytic enzymes
Physicochemical extraction,
cation-exchange resin
187
Soil
Various
Humic compounds,
nontarget DNA
Ion-exchange
chromatography,
T4 gene 32 protein
63
Plant material
Concentration-dependent
Variable with concentration
94
inhibition
and facilitation by polyamines
(spermine and spermidine),
glycerol, formamide
Table 3 (cont.)
Inhibitors and Facilitators in Environmental Samples
Substrate
Target organism
Inhibitor
Facilitator
Ref.
Soil
Sediment
Sediment,
soil and water
Sludge and soil
Soil
Bioaerosols
Waters
Sewage/effluent
Environmental
samples
P . fluorescens
E. coli
P. putida
Hy poxy Ion truncatum
RNA from various species
Enteroviruses
Enteroviruses
E. coli
E. coli
Cryptosporidium
Cryptosporidium , Giardia
Various
Humic substances
Phenolic compounds,
poly(vinyl pyrrolidone)
Sediment, bacterial cells
RNA interferes with
amplification of
RAPD markers
Humiclike compounds
Unknown
Humic and fulvic
acids, heavy metals
Bacterial cells, nontarget DNA
>10 3 /CFUm bacterial
cells, nontarget DNA
Formaldehyde, potassium
dichromate, feces
Humic/fulvic acids
Humic substances
Physico-chemical extraction
Retardation of phenolic
poly(vinylpyrrolidone) agarose
gel electrophoresis
Physico-chemical
extraction, PVPP
RNAse
Lysozyme/hot phenol
extraction and gel filtration
Beef extract, size-
exclusion chromatography
Physical separation, solvent
extraction, size-exclusion/ion
chromatography, double
and seminested PCR
200
57
47
201
202
203
204
Dilution, filtration
51
Freeze-thaw lysis, dilution
61
Flow cytometry, magnetic
205
antibody capture
Percoll-sucrose centrifugation,
206
vortex flow filtration,
nested PCR
Sepharose and Sephadex
207
Problems with the PCR 443
or disposables, or from unintentional contamination during reaction prepa-
ration. Some sources of inhibition are well known to the biomedical com-
munity, but there is a dearth of systematic and biomechanistic studies that offer
greater insight into the physical causes of the problem. Such studies are essen-
tial for the advancement of the science and the improved application of this
powerful technology. Inhibition may involve multiple causes and complex
interactions that are difficult to distinguish.
Some compounds have been reported as both inhibitors and facilitators in
different studies and even in the same system (56,57). It is essential that these
problems are understood and resolved. An automated high-throughput filtration
assay for the identification of RNA polymerase inhibitors has recently been
described (135) and could be applied to RT-PCR inhibition. Other drug
discovery assays could be employed for rapid and quantitative screening of
many classes of inhibitor. The mechanisms of inhibition may be grouped into
three broad categories by their point of action in the reaction. These are
discussed in the following subsections. The categories are by no means absolute
because an inhibitor may act in more than one way and the relationships among
chemical, enzymic, and physical factors often cannot be distinguished given
the poor current knowledge on the subject. It is likely that many inhibitors act
through various physical and chemical means by interfering with the interac-
tion between DNA and polymerase. This functional framework could serve as
a focus for future systematic studies of the biomechanical origins of inhibition
and lead to simple technological improvements to facilitate the use of rapid
and sensitive DNA diagnostics.
3.4.1. Failure of Lysis
An elementary aspect of DNA amplification is that the failure to expose
nucleic acids as targets for amplification will result in reaction failure. Loss of
cell-wall integrity may not be enough to permit amplification of DNA, and
enzymic degradation of cellular debris will often be necessary (21). Protocols
exist that rely on some or all of physical, chemical, and enzymic methods for
cell lysis. Inadequate lysis may result from inadequate lysis reaction conditions,
enzyme inactivation, or lytic enzymes of poor quality or consistency.
Early evidence was presented that PCR could successfully take place on
unpurified DNA released from cells by boiling (80). Such an approach gives a
considerable time saving over more elaborate extraction protocols. Nevertheless, if
whole cells are loaded into the reaction tube and released DNA fails to be
sufficiently separated from structural and DNA-binding proteins by boiling, PCR
inhibition may result. Extraction by boiling alone has been noted to reduce
sensitivity, because of the above mechanism above or poor lysis efficiency, and
may give rise to spurious bands in some cases (136) or prevent amplification
444 Wilson
altogether (137). The high salt concentration in Listeria selective media was found
to be the reason for unlysed cells and false-negative reactions using the Accuprobe
DNA probe test (138), and PCR could be similarly affected. Scanning electron
microscope studies on coccidian parasites that contaminated raspberries suggested
that a possible cause of PCR inhibition was the capture of oocysts by a mat of fruit
epidermal hairs in raspberry wash sediment (93).
In work with S. aureus, I have found that lysis using lysostaphin may be
inconsistent. Subsequent observations in this laboratory showed that a
genetically engineered version of this enzyme that had become available
worked more reliably. Proteolytic enzymes and denaturants may degrade
enzymes used for lysis. Phenolic compounds (91) from the sample or carried
over from organic DNA purification procedures can inhibit the reaction by
denaturing the lytic enzymes (125) and failing to expose the DNA. It may be
that the stage of the growth cycle and nutrient conditions are important for the
susceptibility to lysis of some cells. These factors have been little studied.
3.4.2. Nucleic Acid Degradation and Capture
Degradation or sequestration of target or primer DNA can also be a cause of
failed reactions. Amplified DNA also may be degraded, and band smearing is
sometimes evident on running amplified products after storage (44). These effects
may occur by physical, chemical, or enzymic processes. The primary structure
of DNA is susceptible to instability and decay, mainly the result of hydrolysis,
nonenzymic methylation, oxidative damage and enzymic degradation (139).
Amplification of long DNA sequences becomes increasingly difficult as DNA
strands fragment after cell death. Nucleases may enter the reaction through
careless handling, from the sample material, from various bacteria in the sample,
and, in some cases, from the target organisms themselves (44,140). The DNA of
some Gram-negative bacteria is protected in nuclease-resistant vesicles that are
involved in the export of genetic material (141). Nonspecific autodegradation of
DNA can occur in the presence of restriction endonucleases (142). It was reported
(21 $ 8, 44) that staphylococcal thermonuclease was not destroyed during thermal
cycling and limited the sensitivity of PCR. Nucleases are produced by many
other bacteria, but staphylococcal DNase exhibits uncommon heat stability and
was able to hydrolyze genomic and primer DNA during amplification reactions.
DNAse activity was reported to prevent pulsed-field gel electrophoresis (PFGE)
typing of Lior biotype II (DNAse-positive) Campylobacter jejuni isolates. Treat-
ment in formaldehyde solution for 1 h neutralized the DNAse activity and
allowed typing of these strains to proceed (140).
Unavailability of target or primer DNA by nonspecific blocking or seques-
tration may inhibit amplification or cause misleading band variations during
Problems with the PCR 445
typing based on PCR. Bacterial cells or debris, proteins, and polysaccharides
that have caused inhibition in many studies may do so by physical effects such
as making the target DNA unavailable to the polymerase. Milk proteins were
reported as inhibitory (68) and may also act in this way by restraining DNA in
high-molecular-weight complexes. An extraction procedure using benzyl
chloride and the differential solubility and precipitation of DNA and polysac-
charides was shown effectively to overcome inhibition by the high-molecular-
weight polysaccharides from fungi that prevent enzymic DNA manipulation
(143). High concentrations of reverse transcriptase or an unidentified com-
pound associated with some preparations of the enzyme have been shown to
inhibit RT-PCR of RNA (56). The inhibitory effect was demonstrated to vary
between manufacturers and between batches. The addition of DNA overcame
inhibition and these authors believe that a contaminant of some enzyme prepa-
rations binds to DNA, thus blocking PCR.
In a study of how forensic sperm geno typing was undermined by inhibition or
allele dropout as a result of the presence of vaginal microorganisms, two possible
mechanisms were suggested (62). Efficient primer extension may be prevented by
small, sheared single-stranded lengths of microbial DNA binding to the target
sequence. Alternatively, the effective primer concentration could be reduced by
nonspecific binding to nontarget microbial DNA. In other studies (64), high
numbers of nontarget organisms were not found to be detrimental to PCR. This
may depend on the DNA sequences involved and on fragmentation size during
extraction. Also, it has been shown that chemical insults such as the spermicide
nonoxinol-9 do not prejudice the forensic examination of DNA (144).
It was speculated (126) that polyamines binding to DNA prevented
polymerases accessing the template. These workers found that the polyamines
spermine and spermidine, along with form amide and glycerol, had a concen-
tration-dependent effect on the yield and specificity of PCR. Spermidine had
previously been reported to facilitate amplification by precipitating inhibitors
(115). Formamide has also been reported to improve amplification in tissue
typing (70).
Airborne allergens from latex gloves frequently contaminate the laboratory
environment (96). Glove powder has been reported to inhibit amplification and
may do so by nonspecific DNA binding (45). Because the binding of DNA by
mineral compounds such as glass (98) and diatomaceous earth (17,36,146) is the
basis of a number of nucleic acid extraction methods, the unavailability of DNA
because of binding to potentially complex sample components such as sorption
to sediments in environmental samples is a rational explanation of inhibition.
Nucleic acid sequestration and degradation may be overcome by physi-
cochemical separation of target DNA from destructive compounds as soon as
possible after cell lysis. Heat (30) and proteases (99) may be of use for destroy-
446 Wilson
ing nucleases. If used, proteases must themselves be eliminated before
polymerase is added to prevent enzymic inactivation of the polymerase.
Humic compounds are the most commonly reported group of inhibitors in
environmental samples (Table 3) and appear to have deleterious effects on
several reaction components and their interaction (125). Public health and
ecological investigations that involve environmental sampling may be
hampered by inhibition from humic compounds. It was shown that as little as
1 [aL of humic-acid-like extract was enough to inhibit a 100-|iL reaction mix
and that this was unlikely to be the result of chelation of Mg 2+ by humic
compounds (52,53). Sephadex-spun columns helped facilitate PCR in this
work. In the extraction of DNA from ancient human bone, it was found that
5 ng of ancient DNA was inhibitory to the amplification of 1 ng of recent
DNA, because of coextraction with humic compounds or Maillard products
of reducing sugars (147). These workers found that solvent extraction, etha-
nol precipitation, the addition of bovine serum albumin (BSA), gelatin, and
high concentrations of Taq polymerase all failed to facilitate amplification,
although ion-exchange chromatography removed inhibitors. Young et al. (57)
explained the commonly reported inhibition by soil humic compounds as fol-
lows. The phenolic groups of humic compounds denature biological mol-
ecules by bonding to N-substituted amides or oxidize to form a quinone that
covalently bonds to DNA or proteins. The addition of poly (vinyl polypyr-
rolidone) (PVPP) or poly(vinyl polypyrrolidone) (PVP) overcame the inhi-
bition and allowed separation of humic compounds from DNA during agarose
gel electrophoresis. PCR yield was reduced by the addition of >0.5% PVP,
however.
Recent work on facilitating amplification in the presence of humic acids,
and perhaps other inhibitors, in soils involved introducing a component with
higher affinity for the inhibitor than that of the essential reaction component
that was inhibited (148). These workers consider inhibition to be the result of
interference in the interaction between polymerase and target DNA. Of nine
proteins tested, BSA proved the most effective in overcoming inhibition, as
had previously been indicated by other workers.
Minimum inhibitory concentrations (MICs) were calculated for effects of humic
acids on Taq polymerases (63). Up to an eightfold difference in MICs was found
depending on the source of the humic acid and the commercial producer of the
enzyme. The inhibitory effect was reduced by the addition of T4 gene 32 protein.
Humic acids inhibited not only lytic enzymes (125) and polymerase activity during
PCR but also DNA-DNA hybridization, restriction enzyme digestion of DNA,
and transformation of competent E. coli cells. In this study (63), high concentra-
tions of nontarget DNA were also identified as inhibitory to PCR. This may prevent
specific interaction between polymerase and target DNA.
Problems with the PCR 447
Post-PCR restriction analysis may be inhibited by excess PCR primers (149).
Primer extension during PCR may sometimes be terminated by single-base
mismatches between the primer and target DNA strands. This inhibitory effect
on enzymic extension has been exploited to assess oligonucleotide and target
sequence complementarity (150).
In clinical samples many substances may be present that cause inhibition by one
or more methods that are not understood (95 ,98 ,101 ,102 ,104 ,106 ,107 ,110 ,114) .
These may come from the body or from sample preparation. Blood was reported as
inhibitory if present at 4% or more of reaction volume. These workers
recommended keeping blood below 1-2% of the 100-|aL reaction volume to enable
amplification of sequences in blood (96). Serum proteins may act as blocking
agents and prevent access to target DNA by polymerases. Various components of
blood may cause inhibition, and the degree may possibly vary with their differen-
tial production during disease processes. Body fluid residues may be inhibitors in
tests of animal products.
3.4.3. Polymerase Inhibition
As discussed earlier, humic compounds are widely reported as causing
inhibition and some authors have identified this as being the result of interfer-
ence with lytic enzymes (125), binding to DNA and proteins (54), interfering
with the binding between target DNA and polymerase (63), and binding of
polymerase to clay particles with possible interference at the catalytic site (151).
Heat-mediated activation has been used to release Taq polymerase from affinity-
immobilized inhibition to enable hot-start PCR (152). Proteolytic enzymes and
denaturants may also inactivate polymerase and must be promptly inactivated if
used in cell lysis. Urea may cause inhibition by denaturing polymerases (105).
Phenolic compounds (91) from the sample or carried over from organic DNA
purification procedures can inhibit the reaction by binding to (57) or denaturing
the polymerase. Proteinases and denaturants used for cell lysis may be carried
over and inactivate polymerase if DNA purification is not adequate. Proteinase
was prevented from inhibiting amplification in one study (84) by the addition of
proteinase inhibitors and BSA. Kreader (121) also was able to restrict inhibition
by factors including proteases through the addition of BSA that provides an alter-
native substrate for catalysis by these enzymes. Cheese proteases were found to
inactivate Taq polymerase but could be removed by hot NaOH extraction (30).
Bile acids and salts may cause problems with both clinical samples and enteric
bacteria enriched in culture media containing these compounds. Bacterial pro-
teases and nucleases in feces, as well as cell debris, bile acids, and other factors
may prevent amplification by physico-chemical and enzymic effects.
Post-PCR restriction analysis may be inhibited by excess PCR primers (149).
Chain extension by polymerase may be interrupted by primer-target noncom-
448 Wilson
plemantarity. Primer extension during PCR may sometimes be terminated by
single-base mismatches between the primer and target DNA strands. This inhibitory
effect on enzymic extension has been exploited to assess oligonucleotide and tar-
get sequence complementarity (150). Careful consideration must be given to primer
design to avoid this form of premature termination.
Wiedbrauk et al. (119) reported that the detection of viral nucleic acids in
intraocular fluids was inhibited by a mechanism that was not primer-specific
and not the result of DNase activity or the chelation of Mg 2+ The unknown
inhibitor was resistant to boiling for 15 min and affected Taq polymerase but
not Tth or Tfl polymerases. Amplification was enabled by a single phenol-
chloroform extraction.
Physico-chemical separation or inactivation may be used to overcome
factors causing inhibition by these methods (37,94,153). Specific inhibitors of
inhibitors and competing substrates may also be of use (121). For many situa-
tions, dilution of inhibited samples provides a rapid and straightforward way
of permitting amplification. This dilution exploits the sensitivity of PCR by
reducing the concentration of inhibitors relative to target DNA and is analogous
to the dilution of substrates containing antimicrobial compounds prior to
culture. In a systematic study of inhibitory substrates, careful selection of poly-
merase has been show to assist in overcoming inhibition caused by many
classes of sample (154).
4. Misidentification, Bias, and Error in Molecular Methods
Molecular methods are increasingly relied upon for food and environmental
microbiology, for epidemiological investigations, and in medical and
veterinary microbiology (155-159). In some situations, these are used for rapid
diagnostic purposes. In others, they are used for investigating genetic function-
ality or for typing bacteria that have been isolated previously, and less stringent
quality criteria may sometimes be acceptable. Typing is seldom required for
the control of outbreaks, but, on occasions, prompt availability of such data
can be useful in outbreak management. Molecular typing methods are power-
fully discriminatory and their success has been widely discussed.
Questions have been raised about errors in molecular studies that allegedly
may affect 1-5% of these publications, scientific integrity, and the effective-
ness of the peer-review process to eliminate poor science (1). Very little
attention has focused on the limitations of molecular methods because of their
well-publicized successes and because of scientists' concerns about loss of
funding and publication if they question the confidence of molecular results
(1,160). Ecological studies and taxonomic decisions also are heavily dependent
on molecular characterization, and fundamental taxonomic errors are possible
if poor quality data are relied upon. Errors may occur at any stage of the
Problems with the PCR 449
investigation, from selection bias in culture and amplification reactions, poor
quality assurance, sequence infidelity, misleading electrophoresis and sequence
data, genetic mutations and rearrangements, and interpretation of the labora-
tory, ecological, and clinical significance of results. A large proportion of the
molecular tests conducted in clinical laboratories are for mycobacteria and HIV
and use commercially prepared kits that have been carefully validated and
require appropriate internal controls. Testing for food pathogens more often
relies on in-house methods, and more thought may be needed to ensure that
quality is adequately controlled and assured.
Sequence information has been widely published, and rapidly expanding
online databases of probes and primers make information available to workers
who may be less experienced in genetics than those who performed such work
in previous years (32,69,161 ,162). The expertise and expense necessary to
obtain sequence information will continue to decrease with the commercial
availability of new microfabricated DNA analytical instruments with costs
similar to a single diagnostic test (163 ,164). Although such developments are
to be welcomed, the popularization of powerful methods may lead to poor
results, misleading interpretations, and the entry of erroneous information into
databases that are relied upon by other workers. Misleading results can arise by
a number of mechanisms, and it is vital that scientists be aware of the pitfalls of
molecular identification and typing. High degrees of standardization and
reproducibility should be expected from methods used for critical diagnostic
tests. For some typing methods, lower standards may be acceptable.
Some authors have suggested that Koch's postulates are to be superseded on
the basis of genetic information (165,166). Despite the apparent attractiveness
of this approach, there are problems because the positivity of a sample can vary
with the specimen or tissue examined (167), and other workers have defended
against conclusively accepting PCR results without evidence of reinfectivity,
serology, and epidemiology (168). Sequence data and other aspects of analysis
require stringent quality assurance. Fundamental principles of quality
management for molecular amplification methods and typing interpretation
have been published, but are not as widely and consistently practiced as they
should be (39,169,170).
The consequences of failing to recognize the possible errors in molecular
diagnosis and epidemiology are potentially large. Food companies, hospitals, and
communities may be affected by misinformed outbreak management, individual
patients may suffer, and the scientific literature and databases may be burdened
with false information, leading to cumulative errors and the expense of wasted
time. There has been little study of many of these areas and little information is
available to enable assessment of these issues. This chapter is based on a review
that considers the challenges these problems pose to the wider and more certain use
450 Wilson
of molecular methods (160). Scientists and public health officials should be aware
of potential problems when investigating and controlling foodborne outbreaks of
disease. Laboratory scientists should be aware of these issues and implement
appropriate measures to ensure confidence in their results. Only by confronting the
challenge these issues present can the quality and confidence of laboratory results
be improved. This review identifies potential sources of error so that workers can
put in place controls that will assure the quality of data they generate.
Cultural methods introduce selection bias into the analysis of complex
microbial communities. The impact may be small in qualitative investigations
but is probably significant in many quantitative examinations. This problem in
the analysis of complex microflora has been reported previously (166) and
affects many areas, including the study of foods, the food processing environ-
ment, biofilms, and the microflora of the gastrointestinal tract. Other sources
of error that can affect both pure and polymicrobial cultures are discussed in
the following subsections. Examples of some reported sources of error are
listed in order of publication in Table 4.
4. 7. Sampling Errors, Differential Enrichment, and Recovery
During Culture
The outcomes of molecular methods are not dependent solely on molecular
aspects of the work. The quantity and quality of specific nucleic acids may be
affected by conditions prior to their isolation. Sampling methods that fail to
take account of nonuniform distribution of microorganisms, overgrowth by
competitors, transport and storage conditions, selective enrichment, and even
nonselective culture will not maintain microorganisms in the same proportions
as they existed in their original environment.
Cultural methods may select groups of cells on the basis of species, subtype,
or even metabolic state. This is particularly true of pre-enrichment and
selective-enrichment procedures used to detect low numbers of organisms
(178). Selective-enrichment culture introduces toxic and thermal stresses to
select the species of interest. Other species are generally prevented from
growing to high numbers, but the species of interest may be stressed also, and
the degree of stress may differ between strains.
Enrichment methods are used mainly in food and environmental
microbiology, but they are of increasing relevance to clinical microbiology for
organisms such as E. coli 0157:H7. For many of the most studied and best
understood microorganisms, these enrichment effects may be small, but for
some species, the bias may be considerable. Campylobacters are often cultured
using different media for food and fecal samples. This leads to potential bias in
typing and epidemiological studies conducted on isolates. The quantities and
Table 4
Reported Errors in Molecular Methods
Method
Source of error
Effect
Ref.
4^
Nested PCR for
Treponema pallidum
PCR for hepatitis C virus
Mixed human
and microbial DNA
Restriction endonuclease
digestion of PCR templates
RFLP analysis of
mycobacterial isolates
AP-PCR fingerprinting
False positives
Variations in yield
Sporadic bands
Poor discrimination and
difficulty interpreting
clinical significance
Cross-reactions
RAPD
DNA persistence in
CSF after antibiotic therapy
Primers too specific to
amplify mutant strains
Microbial DNA interfered
with human DNA typing
Inhibition of cleavage by point mutation
Clinical mixed infection, reading
error, laboratory cross-contamination
Colony age
Contaminated Taq polymerase
Differential efficacy of
amplification between strains.
Stochastic variations in
bacterial numbers in sample
Poor probe specificity/crossreaction
Inaccuracies in sequence/hybridization predictions
Melting-annealing
Positive PCR reaction
3 yr after therapy
False-negative test
Total inhibition and/or
dropout of the major human
amplification fragment-length
polymorphism allele
Erroneous genotyping
Different banding pattern
for each patient
Number, clarity,
and reproducibility of bands
decreases with colony age
98
208
62
209
210
211
212
Poor reproducibility
213
Table 4 (cont.)
Reported Errors in Molecular Methods
Method
Source of error
Effect
Ref.
•4\
PFGE
PCR of 16S rRNA
genes (SSU rDNAs)
Computational specificity
analysis of ribosomal small
subunit-derived signature
sequences
RAPD
Ribotyping
Review of AP-PCR, RAPD,
DNA amplification
fingerprinting
rep-PCR (ERIC)
temperature transition interval
during thermal cycling
Point mutation,
insertion and deletion
Gel interpretation
Differential gene amplification
in mixed cultures, dependent
on cycle number
Published sequences nonspecific,
ambiguous sites
Lack of standardization
Inherent
Primer concentration
Polymerase variation
Preferred synthesis of unrelated loci
Indentification of discriminatory and
Poor specificity and
reproducible primers
Various parameters
Various
Altered banding pattern
Misleading epidemiology
Quantitative errors
and sequence bias
Poor sensitivity, specificity,
resolution, and reliability
Poor reproducibility
Poor discrimination
Altered banding pattern
Differential product
amplification
Unrelated, comigrating
RAPD products,
biased phylogenetic analysis
reproducibility
Poor interlaboratory
reproducibility
Minimal amplification of
Gram-positive organisms
137
140
128
124
39
Table 4 (cont.)
Reported Errors in Molecular Methods
Method
Source of error
Effect
Ref.
4^
Soil bacteria: rep-PCR
fingerprinting
Review
Review of PCR-based
rRNA analysis
Taq polymerase contamination/specific activity
variation, pipetting volume variations
PCR temperature steps
Low annealing temperatures and
low template concentration;
ERIC primers generally unsuitable
for Gram-positive organisms
Use of unstandardized whole-cell preparations
Low primer concentration
High primer concentration
Primentemplate DNA ratio and number
of PCR cycles
Choice of primers
RNA contamination
Thermal cycler variations
Enrichment culture bias (cf. direct plating)
Various biases and errors
Sample collection, transportation
and handling
Cell lysis and DNA extraction
Background bands dependent on Taq
concentration and supplier
Number and intensity of bands,
strain specificity of amplification
Poor specificity, spurious bands
Spurious bands
Reduced number and intensity of bands
Mispriming, nonspecific amplification
Nonspecific amplification.
Must be optimized for
different species
Reproducibility
Mispriming
Poor reproducibility
Distorted evaluation of genomic
diversity
Various
Changes in microfloral composition
Selective DNA recovery and
misleading results
214
133
157
Table 4 (cont.)
Reported Errors in Molecular Methods
Method
Source of error
Effect
Ref.
4^
4^
PCR inhibition
Differential amplification
Formation of artefactual
PCR products — chimeras,
deletions, and point mutations
Base substitution errors
in early amplification cycles
Contamination
16S rRNA sequence variations
as a result of run
operon heterogeneity
Separation of amplified
16S rRNA genes
Analysis of sequence data
Rotavirus PCR typing Three-base mutation at 3'
end of primer binding site
Chimeric alignment of 16S Chimeric DNA from >1 species
False negatives
Biased reflection of microbial diversity
Misleading results
Accumulating sequence errors
and misleading results
False positives
Biased reflection of
microbial diversity
Coamplification of different
sequences of identical size if not
purified by cloning
DNA repair during cloning may
lead to formation of artificial
16 S rRNA genes
Absence of data for other species
Poor quality and misleading
sequences in databases
Natural and artificial chimeras
Typing failure
Misclassification of sequences
and species
162
215
Table 4 (cont.)
Reported Errors in Molecular Methods
Method
Source of error
Effect
Ref.
4^
rRNA artifacts;
computational methods
Computer matching of
AP-PCR fingerprints
PCR using universal
cold-shock protein primers
Amplification
SSCP for BRCA1 mutations
PFGE
Disagreement on presence-absence
scoring by different operators
Spurious amplification of
low-level contaminant organisms
Various
Primer concentration
Spontaneous genomic rearrangements
Ribotyping E. coli Frequent faint bands
RAPD-PCR of Aeromonas Comigration of different sequences
hydrophila
Incorrect matching of isolates
159
Spurious bands
216
Inhibition and other effects
31
Poor reproducibility
217
Variation in PFGE profiles and
145
misleading relationships in
epidemiological studies
Uncertain types
160
Misleading results and
155
phylogenetic relationships
456 Wilson
sequences of nucleic acids vary during the cell growth phases and may affect
the sensitivity and specificity of molecular methods.
In viral load assays conducted to predict the prognosis of patients with HIV
and hepatitis C virus, the expense of commercial test kits precludes monitoring
with the frequency that might be useful. The sample is a biased one, taken
perhaps every 3 months and may not be helpful for showing variations in viral
load in the period between samples. As quantitation is the vital aspect of viral
load monitoring, factors that alter the number of virions such as delays in trans-
port and processing may lead to errors in assessing this prognostic indicator.
Similar considerations apply when sampling shellfish beds for viruses. Repre-
sentative samples must be taken from the bed to allow for spatial variations,
quantity of virus will be affected by the species of shellfish and its filtration
rate, and transport and processing should be prompt and temperature controlled.
There is no clear solution to the problems of sampling and culture bias other
than to standardize methods as much as possible, to minimize delays, and to be
aware of the potential for error.
4.2. Selective Lysis of Bacteria
Bacteria have different susceptibilities to lysis. Some species require specific
treatments to lyse them effectively (e.g., S. aureus require lysostaphin).
Variability in lytic enzyme activity may be a source of poor results (31).
Clumping (188) and changes in cell-wall structure during growth will affect
susceptibility to lysis. In mixed populations, the predominant nucleic acid
recovered may not represent the most numerous microbial species present in
the sample. The species, metabolic state and position in the growth curve and
cell cycle are probably of importance. The amount of nucleic acid recovered
by different isolation methods varies substantially (189).
4.3. Preferential Amplification
The most numerous microorganisms in a sample may not be the most
strongly represented by PCR. Primers may have an unrecognized specificity
for a subgroup of nucleic acid sequences and amplify these preferentially. In
particular, this may relate to the %G-C, dilution, and the lengths of the primers
and amplicons (177). It has been reported that the amplification of the 16S
rRNA gene from one genome could be completely inhibited by the presence of
another genome (190). This may be of particular relevance in the examination
of samples containing mixed cultures using random or broad-range primers,
where the precise sequence match is not known and varies with conditions
(39). Preferential amplification has also been demonstrated in systems such as
16S rDNA investigations (191), and single-point mutations should not be
excluded as a cause. Highly biased amplification has been reported where 16S
Problems with the PCR 457
rDNA from one species out of four was preferentially amplified. Touchdown
PCR, denaturants, and cosolvents did not improve the situation. PCR of some
sequences was thought to be inhibited by template flanking DNA segments,
and the use of more than one primer set was recommended (192).
Overamplification of certain templates in complex mixtures has been
observed to relate to the G-C ratio of the template (193). High G-C ratios
encourage higher amplification efficiency. Other factors inherent to the
organisms, genomes, genes, and primers involved may affect the selectivity of
PCR (PCR selection). To some degree, these may be reproducible. Stochastic
variations in the early cycles of PCR give rise to errors that should not be
reproducible in replicate experiments (PCR drift). Such variations occur mainly
from pipetting errors and instrumental variations. These considerations are of
particular relevance in 16S studies using degenerate primers and to attempts at
reliable clinical diagnosis and epidemiological typing of unculturable organ-
isms (165,193). Measures to minimize these errors have been discussed and in-
clude the selection of specific universal primers that avoid degeneracies, use of
high template concentrations, combining several replicate reactions, and use of the
minimum number of cycles necessary (193). Currently, probing and in situ hybrid-
ization provide more informative quantitative data on microbial ecology, albeit
with lower sensitivity than PCR.
The sources of error just discussed affect mixed cultures. Additional, more
general, problems may affect methods used for either pure cultures or polymi-
crobial specimens. This spectrum of errors may arise from properties of the
organisms and specimens examined, the methods used, human factors, and any
combination of these. The points in the following subsections move sequen-
tially through the factors that relate to properties of the organisms, the reactions,
the analytical methodology, and interpretation. Many of these have been noted
with application to multiple arbitrary amplicon profiling (MAAP) methods
such as randomly amplified polymorphic DNA (RAPD) (39) and by other
workers in association with a broad range of molecular methods.
4.4. Spontaneous Genetic Changes in Organisms
Spontaneous intramolecular genomic arrangements such as point mutations,
insertions, and deletions may occur in organisms. This has been demonstrated
to affect PFGE profiles of C. coli strains and may mislead when evaluating
inters train relationships. Five out of six isolates changed PFGE profiles when
subcultured up to 50 times over a 6-month period irrespective of the restriction
enzyme used (185). Although this degree of repeated passage is unlikely in one
laboratory, the rate of genetic change in the laboratory and in the environment
may be different. Isolates recovered from samples that have passed through
various animals over a period of time may exhibit differences from earlier
458 Wilson
isolates to which they were once identical. This variation has the potential to
cause confusion in the investigation of long-term contamination in food facto-
ries, or infections in the population. The application of interpretative criteria is
important to prevent such mutations giving misleading results (170). Where
restriction sites occur in hypervariable regions, a lack of reproducibility should
be expected. One restriction site polymorphism should not be relied upon to
differentiate subspecies types, and several restriction enzymes should be used
to identify anomalies. Restriction may be inhibited at sites containing a high
proportion of uracil (79). Random mutations may change the electrophoretic
pattern during an outbreak. The effects of mutations have been discussed,
and at least 10 distinct fragments are necessary for reliable interpretation of
PFGE gels (170).
Small mutations at the 3' end of the primer binding site have been reported
as a cause of typing error (194). Genomic variability and the presence of several
virus types simultaneously in an infected host have been observed in highly
discriminatory molecular studies (195).
Point mutations may have downstream effects on DNA replication and can
induce compression of DNA. This could be misinterpreted as a true sequence
variation, particularly in more sensitive mutation-detection typing techniques.
Such errors should be suspected particularly where microdeletions and/or
insertions occur in association with an upstream point mutation (196).
Interpretation of molecular results therefore should not be restricted to the
minute details of typing, but should also consider the larger picture using
cultural and epidemiological methods.
4.5. Live or Dead?
The detection of nucleic acids from pathogens has been recognized as a
source of interpretative error in molecular investigations of food and environ-
mental samples. Pathogens detected may not be alive and may present no risk
to humans. The viable but nonculturable state into which some organisms such
as Vibrio, Salmonella, and Campylobacter can enter further complicates
interpretation. rRNA is an attractive target for detection because of its universal
and constituent expression and its high copy number. Its longevity is shorter
than DNA and some investigators have used this as a measure of whether the
organism detected is alive or dead, taking the detection of rRNA to indicate
viability or very recent death. However, it has been shown that this assumption
is only valid when cell death is caused by extreme conditions that also destroy
RNases and disrupt ribosomes. Under less extreme conditions such as UV
irradiation and most thermal food processes, rRNA is protected and degrades
more slowly. Detection under these conditions is a poor indicator of viability
(197). The live/dead consideration also affects clinical investigations (198) and
Problems with the PCR 459
is of particular relevance to putative pathogens whose role in disease is not well
understood. The importance of this factor is difficult to assess because of a lack of
information. The DNA of many organisms has been found in diseased tissues and
falsely implicated as the cause of a condition. Repeated positive samples and
plausible epidemiological and serological evidence of causation are needed before
the findings of PCR alone should be given credence (146,168).
4.6. Preferential Cloning of PCR Products
It should not be assumed that all of a pool of randomly amplified sequences
will be cloned with equal efficiency. Methods that rely on this approach to
provide quantities of specific sequences may be misleading in certain circum-
stances that allow some sequences to be cloned less efficiently than others.
PCR products from different sequences have been shown not be cloned with
equal efficiency (166). Where possible, it is necessary to assess the choice and
pretreatment of cloning vectors for the sequences that are being cloned. Native
restriction enzymes may selectively degrade certain DNA sequences. High
copy numbers of certain sequences may be lethal to the host cell, and this can
be a particular problem when working with virulence and pathogenesis
determinants. The size limitations and sticky or blunt end requirements of the
vector need to be considered. Large size variations and structural deformations
such as hairpin loops should be considered as possible causes of preferential
cloning and, in many cases, can be predicted. Point mutations should not be
excluded as sources of this bias.
4. 7. PCR-Mediated Chimeric Gene Amplification
Products of more than one base sequence can fuse and these chimeric
products may come to dominate accurate sequences in later cycles. Detection
of chimeras with high confidence is not straightforward, although methods
exist that will detect many of the more obvious occurrences in small-subunit
rRNA (SSU-rRNA) analysis of uncultivated organisms (199). If chimerization
occurs early in amplification, the dominant sequences will be entirely mis-
leading. Incorrect sequence records may be entered into databases if this is
not recognized. Detecting chimeras in closely related specimens is difficult.
4.8. Incorporation Errors Resulting from Enzyme Infidelity
Polymerases do not copy nucleic acid sequences perfectly. The error rates
of different enzymes are known to vary, and high-fidelity options are available.
Point mutations that occur early in amplification will produce erroneous
sequence information and may affect restriction site analysis. Newly synthe-
sized strands may not necessarily be perfect replicas of the original genetic
material. Any errors that occur in the earliest cycles will be amplified so that
460 Wilson
erroneous sequences will outnumber accurate sequences. It is estimated that
sequencing will not detect a mutation unless it represents >10% of PCR prod-
ucts in the reaction. This is only possible if less than five copies of template are
present and misincorporation occurs in the first cycle (200). Procedures such
as cloning that select strands may magnify misincorporation errors.
4.9. Sequencing Errors
Errors may occur during sequencing (169). Sequences may be chimeric
or of mixed strands. Primers may be suboptimal because of inaccurate or
inadequate information used in their design. Investigators may not be aware
of errata correcting errors in published sequences.
Artifacts may arise in enriched DNA libraries and be overlooked because
their homology is only partial. Probes based on these sequences will probably
fail to produce products, or merely a smear. Hybridization-based subtraction
of fragments of genomic DNA followed by cloning may be used to enrich
clones with new low-abundance marker sequences that are not available from
databases. This approach of enriching DNA libraries has been demonstrated to
be a more reliable and cost-effective means of identifying marker sequences (201).
4. 10. Concentration-Dependent Effects
Variations in the concentration of reaction components may produce spuri-
ous bands that are not meaningful or reproducible, or absent bands. The effect
of magnesium concentration and the duration of annealing and extension steps
on cross-species PCR has been investigated (202). The findings have implica-
tions for identification of unknown organisms using broad-range primers.
4.11. Comigration
Comigration of dissimilar sequences in gels has been identified as a source
of errors (187). These authors considered comigration to be particularly
important in phylogenetic studies and species typing. Nucleic acid species of
the same size move together through a gel, and specialized methods are needed
to resolve sequence and conformational differences. This has implications for
epidemiology because a single band consisting of several sequences where one
of these is similar to that from another isolate could mislead the researcher into
deducing a closer relationship than was the case. Denaturing polyacrylamide
gels have the resolving power to avoid comigration problems in most cases,
but agarose gels may not have sufficient resolution. Cloning and sequencing
multiple clones may be necessary to assure the results in these cases.
Differential-display PCR (ddPCR) is a powerful but demanding technique
that enables the identification and isolation of transcripts expressed at different
Problems with the PCR 461
times or sites in organisms. It is not generally used for typing purposes, but it
has potential application in the molecular detection of unrecognized pathogens
and the study of virulence and pathogenesis in research laboratories (165).
When comigrating species of the same size are assumed to have the same
sequence, false positives may arise because of reamplified cDNA species that
are not the originally selected transcript moving through the gel with the species
of interest. It is necessary to resolve fragments of different sequences prior to
cloning in order to avoid misleading results (203). High-resolution poly aery la-
mide gels, cloning, and sequencing will detect erroneous results.
4.72. Contamination
As discussed earlier in the context of DNA amplification, nucleic acids
originating outside the sample may also produce misleading results for typing
methods. This has also been widely discussed in the literature and solutions
described (31). It has been estimated that 1-5% of published PCR work has
been affected (1) .
In addition to false positives or reaction failure, enzyme contamination
may be manifested as spurious background bands during amplification-based
DNA fingerprinting using methods such as random amplified polymorphic
DNA (RAPD). By nature of their low stringency, such typing techniques rely on
both specific and nonspecific priming and combine the detection of artifactual
variation with true polymorphism (39).
4. 13. Poor Quality Assurance
Being aware of potential sources of error is useful in deciding on appropriate
procedures for quality assurance and control. It has been recommended that results
are compared from different DNA extractions, amplifications, and cloning experi-
ments to minimize the effects of the errors described. Probes against short-lived
16S rRNA sequences should be used to evaluate whether organisms detected by
molecular methods are living and relevant to the investigation (179).
The random distribution of microorganisms and the resulting variability of
microbiology should not be forgotten (204). This is especially important when
analyzing the small quantities of sample that are used in molecular methods.
The broad spread of enumeration results from different laboratories in national
external quality assurance schemes demonstrates that precise and accurate
results are not easy to obtain between laboratories. This is of particular impor-
tance when dealing with small sample volumes and low numbers of target cells
where potential variation is greatest.
Contamination, concentration-dependent effects, spurious bands, inhibition, and
other sources of error may complicate the interpretation of banding patterns and
give rise to false results. Misleading or absent bands may arise from factors such as
462 Wilson
variations in enzyme purity or activity. Variations between brands of devices such
as thermal cyclers and electrophoresis equipment and running conditions can
produce results that are inconsistent. For these reasons, it is important that positive
and negative controls are run with each test sample. Ten recommendations have
been made for improving the consistency of arbitrary PCR (39). These focus on
purity, quantification of reactants, and standardization of conditions. Guidance on
the interpretation of PFGE has been published (170). A wide-ranging and compre-
hensive discussion of quality issues also exists (169). It is beyond the scope of this
chapter to review in depth the procedures for good quality assurance (QA) and
quality control (QC) of molecular work. This has already been done, and it is
essential that scientists put in place the quality practices detailed in these articles.
4. 14. Reading and Interpretation Errors
Most molecular typing relies on reading patterns of bands on gels. Bands may
shift and distort with variations in the running conditions. Some bands may be
very faint and create uncertainty in reading. Photography is capable both of
improving appearance and increasing error, so intelligent use must be made
of camera and computer systems (182). Inconsistency and error in reading
gels can lead to false categorization of types. Frequent occurrence of faint bands
may negate the usefulness of a typing method (186).
Misinterpretation of typing may occur and it is important to focus on clinical
problem-solving rather than modern methods alone. Typing is not mystical. Its
goal is simply to provide evidence that epidemiologically related isolates are
also related genetically, represent the same strain, and thus may have a common
origin. In larger-scale studies, it may also suggest that genetically related
isolates have a common epidemiological source. This may be harder to prove
with certainty and gives potential for falsely positive associations that could
have costly implications for the agricultural and food industries if food products
are mistakenly implicated by overzealous investigators. An outbreak can occur
with more than one epidemic strain, and an outbreak is not excluded because of
strain heterogeneity (205). Hepatitis C viral quasispecies, heterogenous mixtures
of virus particles containing hypervariable regions, sequentially change during
the natural course of infection and the resulting diversity of types will complicate
epidemiological studies (195). Limited genetic diversity within a species may
result in indistinguishable genotypes between isolates that have no
epidemiological relationship. This could lead to false associations being made.
Epidemiological information is essential if typing data are to be correctly
interpreted (170). Some workers have been known to type rare serotypes of
Salmonella or E. coli when the epidemiology and serotyping alone are clearly
sufficient to implicate the isolates. Human DNA profiling also is not infallible
Problems with the PCR 463
and critical awareness should be maintained when interpreting typing results,
particularly in epidemiological, clinical, and forensic situations (180,206).
Epidemiological and taxonomic analysis can be compromised by misleading
and invalid phylogenetic trees. Problems with data handling and analysis have been
discussed (207). As genetic information becomes increasingly more important than
the biochemical and morphological observations that taxonomists have histori-
cally relied upon, it is important to ensure that errors do not arise in data recording,
editing, processing, and interpretation. Just as powerful statistical software can
mislead the uninformed user, so misuse of genetic software can allow errors to
arise that might be difficult for other scientists and clinicians to detect. Inexperi-
enced users may be unaware of errors caused by software algorithms that users
with more understanding would recognize as aberrant.
5. Hybridization Microarrays
Hybridization microarray biochips or "gene chips" are microfabricated arrays
of nucleic acids used for sequence identification by hybridization. They are
becoming available commercially and offer great potential for low-cost rapid and
specific mutation detection in the future, although the devices presently available
are far from inexpensive (208-210). Hybridization of target DNA to oligonucle-
otide probes is visualized in defined areas of fluorescence that can be read auto-
matically (211). Along with other microfabricated instruments such as PCR
microchips (212) and microfluidics analyzers (163), hybridization microarrays
have obvious application in rapid and automated microbiological identification
and typing. The potential for screening a food sample for a range of pathogens,
their virulence factors, and epidemiological markers is enormous if the high cost
can be reduced, as has happened with electronic microprocessors. However, six
important validation issues must be addressed before these methods can be relied
upon for diagnostic purposes (213).
5. 7. Standardization
Certified reference standards of nucleic acids must be available. Traceabil-
ity to these standards will become an important issue as the requirement for
laboratory accreditation becomes more widespread. Repeatability and
interlaboratory comparisons will also be vital issues if results are to be able to
withstand legal challenge.
5.2. Production
Arrays manufactured commercially or within laboratories must be capable
of interlaboratory comparison of the specificity and sensitivity of both equip-
ment and assay. Variations in thermal characteristics have been noted in PCR
464 Wilson
microchips, but these may be subject to control by calibration software (212).
Stability and shelf life must also be assured.
5.3. Hybridization
Considerable problems exist and often are not acknowledged regarding
hybridization kinetics and steric hindrance. Variability in the melting tempera-
tures of different sequences depending on their %G-C and secondary and
tertiary structures cause much variation in inters trand binding. Appropriate
ionic conditions and software may be important in generating and interpreting
the data correctly (214).
5.4. Detection
Internal quality standards must be used to ensure that fluorescence is
measured correctly. DNA hybridization and PCR were once expected to be the
ultimate identification methods. In practice, the sensitivity of these methods
was lower than had been anticipated, and their effective application has been
less universal than many had hoped. It is likely that the challenges of substrate
interference and lack of sensitivity will remain when examining food samples
with microarrays. Preliminary steps to ensure sufficient quantities of pure DNA
may be required.
5.5. Quantitation
The relationship between signal strength and gene expression is nonlinear.
Distorted results may appear when studying both large changes in expression
in abundant species of mRNA and during low-level expression, which may be
equally important. Accurate quantitation is important to the correct interpreta-
tion of results. As devices become increasingly small, probabilistic factors will
become increasingly important.
5.6. Data Interpretation
Large amounts of data are generated by microarray assays and pose
challenges for calibration and the organization, storage, distribution, and inter-
pretation of data. Quality assurance will be a vital issue when large amounts of
data are shared between workers who will rely heavily on information
generated by others.
Although such systems are capable of being made in laboratories, it is likely
that their full usefulness will only be realized by commercial production. It is
incumbent on the companies developing these systems that they ensure the
instruments can produce results that can be relied upon.
Problems with the PCR 465
6. Conclusions
Although DNA amplification technologies continue to provide useful tools
for the detection and investigation of microorganisms, their promise will not
be completely fulfilled until improved and automated amplification and
detection systems become available at affordable prices. This is most likely to
happen through miniaturization, which unfortunately places limits on
sensitivity and may require concentration steps.
Careful and well-organized laboratory work using chemical and physical
measures can overcome false positives caused contamination. For DNA
amplification technology to be widely applicable, methods must exist that allow
the rapid and efficient removal of inhibitors and attenuators of amplification.
Many reports have been made of different nucleic acid extraction methodolo-
gies. A range of techniques is being investigated, but it seems unlikely that a
single method will emerge that is suitable for all sample types. The separation
of cells from samples has been discussed using many techniques, including
multiplexed methods (20), general methods (19,122), lectins (81), phytohe-
magglutinin (215), free-flow electrophoresis (216), immunomagnetic separa-
tion (IMS) (102), electroelution (18), and electro fractionation (217).
A large number of commercial rapid extraction methods are available. These
mainly are based primarily on ion-exchange chromatography, size exclusion,
and sorption. Such methods are advertised particularly for the purification of
nucleic acids from relatively clean sources such as mammalian tissues, broths,
and purified cultures. They do not often feature in studies where DNA is
purified from more complex samples such as body fluids, food, soil, and surface
water. Although rapid extraction methods may be suitable for many purposes,
relatively few workers reporting inhibition have used such products as solutions
to the inhibition. This probably reflects a lack of confidence in the suitability
of such technology for these purposes, as most workers continue to prefer to
use methods based on phenol/chloroform extraction.
Experimentation may also have shown that the more laborious extraction
methods provide higher yields of purer DNA, particularly from complex
samples such as sediments and foods. This has been my experience with several
commercial systems. Immunomagnetic separation can be used for cells or
nucleic acids in cell lysate and perhaps more complex samples. Although
impaired by fats, it is perhaps the most promising general isolation method.
For some time, a confusing variety of methods will continue to be required
for investigations in different sample types. This review shows that many stud-
ies have demonstrated a range of inhibitory compounds and that they achieve
their effects at one or more of three sites. As better understanding of these
points of inhibition is achieved, simplified and improved extraction methods
466 Wilson
may become available for various sample types. Improved understanding of
the compounds and mechanisms of inhibition should enable the rationalization
of approaches to purification. A smaller range of effective facilitating
treatments may be developed that can be applied to nucleic acids from differ-
ent source materials. This should improve both the sensitivity and applicability
of these methods in every field.
The ease of PCR-based typing methods and the availability of sequence
information via the Internet has opened molecular identification and typing tech-
nologies to less specialized scientists. Laboratory directors must carefully ensure
that proper use is made of these techniques through stringent validation and quality
assurance procedures so that false conclusions are not reached by inexperienced
investigators. These could lead to expensive consequences in the food industry and
cumulative errors in the literature of microbial ecology. In clinical laboratories,
scientists and clinicians must guard against false conclusions that at best are time-
wasting and that potentially might be life-threatening.
Misleading identification and typing results may arise from a number of
sources. This is of particular importance if microorganisms are being identified
from clinical specimens to guide therapeutic choice. Like biochemical
microgallery tests, use of broad-range primers and sequencing gives an identi-
fication based on probabilities rather than certainty. The recent appearance of a
commercial kit and instrumentation for 1 6S sequence analysis should improve
standardization. It is important to assess the significance of findings in the
light of various potential errors and whether even correctly identified nucleic
acids indicate a true problem.
It is of particular importance that samples of clinical and epidemiological
significance are examined in a careful manner with full cognisance of the pitfalls
that may mislead the naive investigator and lead to poor clinical decisions. It is
also important that investigators are aware that ecological studies and database
records may contain errors for the reasons discussed. Although the sources of
error described are not all subject to direct control, the informed investigator can
put in place appropriate confirmatory tests to monitor and verify the correctness
of results. The data quality can therefore be better assured.
Molecular typing methods continue to be developed and to make a major
contribution to epidemiology and clinical problem-solving. This is evidence
that the problems described occur in a small proportion of cases where these
techniques are used. Nevertheless, it is wise to consider the potential sources
of errors so that anomalous results can be recognized. The eventual adoption of
biochip devices will not solve all of the problems discussed, and intelligent
consideration of quality issues and data interpretation will remain essential.
These controls are vital to prevent potentially serious clinical and epidemio-
logical misjudgements, as well as cumulative errors entering databases.
Problems with the PCR 467
References
1. Cohen, P. (1998) Ghosts in the machine. New Sci. August 18-19.
2. Erlich, H. A., Gelfand, D., and Sninsky, J. J. (1991) Recent advances in the
polymerase chain reaction. Science 252, 1643-1651.
3. Mullis, K. P. and Faloona, F. F. (1987) Specific synthesis of DNA in vitro via a
polymerase-catalysed chain reaction, in Recombinant DNA, Methods in Enzy-
mology, vol. 155 (Wu, R., ed.), Academic Press, London, pp. 335-351.
4. Saiki, R. K., Gelfand, D. H., Stoeffel, S., Scharf, S. J., Higuchi, R., Horn, G. T.,
et al. (1988) Primer-directed enzymic amplification of DNA with a thermo-
stable DNA polymerase. Science 239, 487-491.
5. Lizardi,P. and Kramer, F. R. (1991) Exponential amplification of nucleic acids:
new diagnostics using DNA polymerases and RNA replicases. Trends
Biotechnol. 9, 53-58.
6. Vaneechoutte, M. and Van Eldere, J. (1997) The possibilities and limitations of
nucleic acid amplification technology in diagnostic microbiology. /. Med.
Microbiol. 46, 188-194.
7. Cahill, P., Foster, K., and Mahan, D. E. (1991). Polymerase chain reaction and
Q(3 replicase amplification. Clin. Chem. 37, 1482-1485.
8. Birkenmeyer, L. and Armstrong, A. S. (1992) Preliminary evaluation of the
ligase chain reaction for specific detection of Neisseria gonorrhoeae. J. Clin.
Microbiol. 30, 3089-3094.
9. Weiss, R. (1991) Hot prospect for new gene amplifier. Science 254, 1292-1293.
10. Bush, C. E., Donovan, R. M., Peterson, W. R., Jennings, M. B., Bolton, V.,
Sherman, D. G., et al. (1992) Detection of human immunodeficiency virus type
1 RNA in plasma samples from high-risk pediatric patients by using the self-
sustaining sequence replication reaction. /. Clin. Microbiol. 30, 281-286.
11. Guatelli, J. C., Whitefield, K. M., Kwoh, D. Y., Barringer, K. J., Richman, D.
D., and Gingeras, T. R. (1990) Isothermal, in vitro amplification of nucleic
acids by a multienzyme reaction modeled after retroviral replication. Proc. Natl.
Sci. USA $7, 1874-1878.
12. Walker, G. T., Little, M. C., Nadeau, J. G., and Shank, D. D. (1992) Isothermal
in vitro amplification of DNA by a restriction enzyme/DNA polymerase sys-
tem. Proc. Natl. Acad. Sci. USA 89, 392-396.
13. Walker, G. T., Nadeau, J. G., Linn, C. P., Devlin, R. F., and Dandliker, W. B.
(1996) Strand displacement amplification (SDA) and transient-state fluorescence
polarization detection of Mycobacterium tuberculosis DNA. Clin. Chem. 42, 9-13.
1 4 . Compton, J. ( 1 99 1 ) Nucleic acid sequence-based amplification. Nature 350, 9 1-94.
15. Uyttendaele, M., Schukkink, R., Gemen, B. V., and Debevere, J. (1996)
Comparison of the nucleic acid amplification system NASBA and agar isola-
tion for detection of pathogenic Campylobacters in naturally contaminated poul-
try. /. Food Protect. 59, 683-687.
16. Van Brunt, J. (1990) Amplifying genes: PCR and its alternatives. Biotechnol.
8,291-294.
468 Wilson
17. Boom, R., Sol, C. J. A., Heijtink, R., Wertheim-van Dillen, P. M. E., and van
der Noordaa, J. ( 1 99 1 ) Rapid purification of hepatitis B virus DNA from serum.
/. Clin. Microbiol. 29, 1804-1811.
18. Rochelle, P. A. and Olson, B. H. (1991) A simple technique for electroelution
of DNA from environmental samples. BioTechniques 11, 724-728.
19. Roman, M. and Brown, P. R. (1992) Separation techniques for biotechnology
in the 1990s. /. Chromatogr. 592, 3-12.
20. Sharpe, A. N. (1991) On multiplexed separations in quick detection of micro-
organisms in foods. Food Microbiol. 8, 167-170.
21. Wilson, I. G., Gilmour, A., and Cooper, J. E. (1993) Detection of
enterotoxigenic microorganisms in foods by PCR, in New Techniques in Food
and Beverage Microbiology (Kroll, R. G., Gilmour, A., and Sussman, M. eds.),
Society for Applied Bacteriology/Blackwell, Oxford.
22. Rys, P. N. and Persing, D. H (1993) Preventing false positives: quantitative
evaluation of three protocols for inactivation of polymerase chain reaction
amplification products. /. Clin. Microbiol. 31, 2356-2360.
23. Hughes, M. S., Beck, L.-A., and Skuce, R. A. (1994) Identification and elimi-
nation of DNA sequences in Taq DNA polymerase. /. Clin. Microbiol. 32,
2007-2008.
24. Sarkar, G. and Sommer, S. S. (1990) Shedding light on PCR contamination.
Nature 343, 27.
25. Prince, A. M. and Andrus, L. (1992) PCR: how to kill unwanted DNA.
BioTechniques 12, 358-360.
26. DeFilippes, F. M. (1991) Decontaminating the polymerase chain reaction.
BioTechniques 10, 26-30.
27. Espy, M. J., Smith, T. F., and Persing, D. H. (1993) Dependence of polymerase
chain reaction product inactivation protocols on amplicon length and sequence
composition. /. Clin. Chem. 31, 2361-2365.
28. Furrer, B., Candrian, U., Wieland, P., and Liithy, J. (1990) Improving PCR
efficiency. Nature 346, 324.
29. Meier, A., Persing, D. H., Finken, M., and Bottger, E. C. (1993) Elimination of
contaminating DNA within polymerase chain reaction reagents: implications
for a general approach to detection of uncultured pathogens. /. Clin. Microbiol.
31, 646-652.
30. Rossen, L., Norskov, P., Holmstrom, K., and Rasmussen, O. F. (1992) Inhibi-
tion of PCR by components of food samples, microbial diagnostic assays and
DNA-extraction solutions. Int. J. Food Microbiol. 17, 37-45.
31. Wilson, I. G. (1997) Inhibition and facilitation of nucleic acid amplification.
Appl. Environ. Microbiol. 63, 3741-3751.
32. Scheu, P. M., Berghof, K., and Stahl, U. (1998) Detection of pathogenic and
spoilage micro-organisms in food with the polymerase chain reaction. Food
Microbiol. 15, 13-31.
33. Higuchi, R., von Beroldingen, C. H,. Sensabaugh, G. F., and Erlich, H. A.
(1988) DNA typing from single hairs. Nature 332, 543-546.
Problems with the PCR 469
34. Busch, M. P, Henrard, D. R., Hewlett, I. K., Mehaffey, W. F., Epstein, J. S.,
Allain, J-P., et al. and the Transfusion Safety Study Group (1992) Poor sensi-
tivity, specificity and reproducibility of detection of HIV-1 DNA in serum by
polymerase chain reaction. /. Aquirea I Immune Defic. Syndrome 5, 872-877.
35. Nitschke, L., Kopf, M., and Lamers, M. C. (1993) Quick nested PCR screening
of ES cell clones for gene targeting events. BioTechniques 16, 914-916.
36. Parrish, K. D. and Greenberg E. P. (1995) A rapid method for extraction and puri-
fication of DNA from dental plaque. Appl. Environ. Microbiol. 61, 4120^-123.
37. Wernars, K., Heuvelman, C. J., Chakraborty, T., and Notermans, S. H. W.
(1991) Use of the polymerase chain reaction for direct detection of Listeria
monocytogenes in soft cheese. /. Appl. Bacteriol. 70, 121-126.
38. Wilson, I. G., Cooper, J. E., and Gilmour, A. (1991) Detection of enterotoxigenic
Staphylococcus aureus in dried skimmed milk: use of the polymerase chain reaction
for amplification and detection of staphylococcal enterotoxin genes entB and entCl
the the thermonuclease gene nuc.Appl. Environ. Microbiol. 57, 1793-1798.
39. Tyler, K. D., Wang, G., Tyler D., and Johnson, W. M. (1997) Factors affecting
reliability and reproducibility of amplification-based DNA fingerprinting of
representative bacterial pathogens. /. Clin. Microbiol. 35, 339-346.
40. Kanungo, J. and Pandey, K. N. (1993) Kinasing PCR products for efficient
blunt-end cloning and linker addition. BioTechniques 6, 912-913.
4 1 . Bickley , J., Short, J. K., McDowell, D. G., and Parkes, H. C. (1996) Polymerase chain
reaction (PCR) detection of Listeria monocytogenes in diluted milk and reversal of
PCR inhibition caused by calcium ions. Lett. Appl. Microbiol. 22, 153-158.
42. Chaudhry, G. R., Toranzos, G. A., and Bhatt, A. R. (1989) Novel method of
monitoring genetically engineered microorganisms in the environment. Appl.
Environ. Microbiol. 55, 1301-1304.
43. Chou, S. (1991). Optimizing polymerase chain reaction technology for clinical
diagnosis. Clin. Chem. 37, 1893-1894.
44. Wilson, I. G., Cooper, J. E., and Gilmour, A. (1994) Some factors inhibiting
amplification of the Staphylococcus aureus enterotoxin C { (sec + ) by PCR. Int.
J. Food Microbiol. 22, 55-62.
45. De Lomas, J. G., Sunzeri, F. J., and Busch, M. P. (1992) False-negative results
by polymerase chain reaction due to contamination by glove powder. Transfu-
sion 32, 83-85.
46. Starbuck, M. A. B., Hill, P. J., and Stewart, G. S. A. B. (1992) Ultra sensitive
detection of Listeria monocytogenes in milk by the poymerase chain reaction.
Lett. Appl. Microbiol. 15, 248-252.
47. Herrick, J. B., Madsen, E. U., Batt, C. A., and Ghiorse, W. C. (1993) Poly-
merase chain reaction amplification of naphthalene-catabolic and 16S rRNA
gene sequences from indigenous sediment bacteria. Appl. Environ. Microbiol.
59, 687-694.
48. Bamford, K. B., Lutton, D. A., O'Loughlin, B., Coulter, W. A., and Collins,
J. S. A. (1998) Nested primers improve sensitivity in the detection of
Helicobacter pylori by the polymerase chain reaction. /. Infect. 36, 105-1 10.
470 Wilson
49. Drake, M., Small, C. L., Spence, K. D., and Swanson, B. G. (1996) Rapid
detection and identification of Lactobacillus spp. in dairy products by using the
polymerase chain reaction. /. Food Protect. 59, 1031-1036.
50. Jaykus, L.-A., De Leon, R., and Sobsey, M. D. (1996) A virion concentration
method for detection of human enteric viruses in oysters by PCR and oligoprobe
hybridization. Appl. Environ. Microbiol. 62, 2074-2080.
51. Alvarez, A. J., Buttner, M. P., Toranzos, G. A., Dvorsky, E. A., Toro, A.,
Heikes, T. B., et al. (1994) Use of solid-phase PCR for enhanced detection of
airborne microorganisms. Appl. Environ. Microbiol. 60, 374-376.
52. Tsai, Y. and Olson, B. H. (1992. Detection of low numbers of bacterial cells in soils
and sediments by polymerase chain reaction. Appl. Environ. Microbiol. 58, 754-757 '.
53. Tsai, Y. and Olson, B. H. (1992) Rapid method for separation of bacterial DNA
from humic substances in sediments for polymerase chain reaction. Appl.
Environ. Microbiol. 58, 2292-2295.
54. Xia, J. Q., Yason, C. V., and Kibenge, F. S. B. (1995) Comparison of dot blot
hybridization, polymerase chain reaction, and virus isolation for detection of
bovine herpesvirus- 1 (BHV-1) in artificially infected bovine semen. Can. J.
Vet. Res. 59, 102-109.
55. Long, G. W., Oprandy, J. J., Narayanan, R. B., Fortier A. H., Porter, K. R., and
Nacy, C. A. (1993) Detection of Francis ella tularensis in blood by polymerase
chain reaction. /. Clin. Microbiol. 31, 152-154.
56. Fehlmann, C, Krapf, R., and Solioz, M. (1993) Reverse transcriptase can block
polymerase chain reaction. Clin. Chem. 39, 368-369.
57. Young, C, Burghoff, R. L., Keim, L. G., Minak-Bernero, V., Lute, J. R., and
Hinton, S. M. (1993) Polyvinylpyrrolidone-agarose gel electrophoresis purifi-
cation of polymerase chain reaction-amplifiable DNA from soils. Appl.
Environ. Microbiol. 59, 1972-1974.
58. Steffan, R. J. and Atlas, R. M. (1988) DNA amplification to enhance detection
of genetically engineered bacteria in environmental samples. Appl. Environ.
Microbiol. 54, 2185-2191.
59. Andersen, M. R. and Omiecinski, C. J. (1992) Direct extraction of bacterial
plasmids from food for polymerase chain reaction amplification. Appl. Environ.
Microbiol. 58, 4080-4082.
60. Dickinson, J. H., Kroll, R. G., and Grant, K. A. (1995) The direct application of
the polymerase chain reaction to DNA extracted from foods. Lett. Appl.
Microbiol. 20, 212-216.
6 1 . Alvarez, A. J., Buttner, M. P., and Stetzenbach, L. D. (1995) PCR for bioaerosol
monitoring: sensitivity and environmental interference. Appl. Environ.
Microbiol. 61, 3639-3644.
62. Lienert, K. and Fowler, J. C. (1992) Analysis of mixed human/microbial DNA
samples: a validation study of two PCR AMP-FLP typing methods.
BioTechniques 13, 276-281.
63. Tebbe, C. C. and Vahjen W. (1993) Interference of humic acids and DNA extracted
directly from soil in detection and transformation of recombinant DNA from bacte-
ria and a yeast. Appl. Environ. Microbiol. 59, 2657-2665.
Problems with the PCR 471
64. St. Pierre, B. S., Neustock, P., Schramm, U., Wilhelm, D., Kirchner, H., and Bein,
G. (1994) Seasonal breakdown of polymerase chain reaction. Lancet 343, 673.
65. Weaver, J. W. and Rowe, M. T. (1997) Effect of non-target cells on the sensitiv-
ity of the PCR for Escherichia coli 0157:H7. Lett. Appl. Microbiol. 25, 109-1 12.
66. Vermunt, A. E. M., Franken, A. A. J. M., and Beumer, R. R. (1992) Isolation of
salmonellas by immunomagnetic separation. /. Appl. Bacteriol. 72, 1 12-118.
67. Jackson, C. J., Fox, A. J., and Jones, D. M. (1996) A novel polymerase chain
reaction assay for the dectection and speciation of thermophilic Campylobacter
spp. /. Appl. Bacteriol. 81, 467-473.
68. Rijpens, N. P., Jannes, G., Van Asbroeck, M., Rossau, R., and Herman, L. M.
F. (1996) Direct detection of Brucella spp. in raw milk by PCR and reverse
hybridisation with 16S-23S rRNA spacer probes. Appl. Environ. Microbiol.
62, 1683-1688.
69. Mezei, L., Storts, D., Erickson D., Peyruchaud, S., and Smith, R. (1998) Web
support with Amplification Assistant PCR troubleshooting program. Promega
Notes 66, 10-13.
70. Comey, C. T., Jung, J. M., and Budowle, B. (1991) Use of formamide to
improve amplification of HLA DQa sequences. BioTechniques 10, 60-61.
71. Sidhu, M. K., Liao,M., and Rashidbaigi, A. (1996) Dimethyl sulfoxide improves
RNA amplification. BioTechniques 21, 44—47.
72. Satsangi, J., Jewell, D. P., Welsh, K., Bunce, M., and Bell, J. I. (1994) Effect of
heparin on polymerase chain reaction. Lancet 343, 1509-1510.
73. Chen, Z., Swisshelm, K., and Sager, R. (1994) A cautionary note on reaction
tubes for differential display and cDNA amplification in thermal cycling.
BioTechniques 16, 1002-1006.
74. Bej, A. K., Mahbubani, M. H., Dicesare, J. L., and Atlas, R. M. (1991)
Polymerase chain reaction-gene probe detection of microorganisms by using
filter-concentrated samples. Appl. Environ. Microbiol. 57, 3529-3534.
75. Dohner D. E., Dehner, M. S., and Gelb, L. D. (1995) Inhibition of PCR by mineral
oil exposed to UV irradiation for prolonged periods. BioTechniques 18, 964-967.
76. Katzman, M. (1993) Use of oil overlays in "oil-free" PCR technology.
BioTechniques 14, 36-40.
77. Truscott, W. M. (1997) Glove associated cytotoxicity. HES Supplement August,
13-14.
78. Persing, D. H. (1991) Polymerase chain reaction: trenches to benches. /. Clin.
Microbiol. 29, 1281-1285.
79. Glenn, T. C, Waller, D. R., and Braun, M. J. (1994) Increasing proportions of
uracil in DNA substrates increases inhibition of restriction enzyme digests.
BioTechniques 17, 1086-1090.
80. Wu, P., Daniel-Issakani, S., LaMarco, K., and Strulovici, B. (1997) An
automated high throughput filtration assay: application to polymerase inhibitor
identification. Anal. Biochem. 245, 226-230.
81. Starnbach, M. N., Falkow, S., and Tomkins, L. S. (1989) Species-specific
detection of Legionella pneumophila in water by DNA amplification and
hybridization./. Clin. Microbiol. 27, 1257-1261.
472 Wilson
82. Gannon, V. P. J., King, R. K., Kim, J. Y., and Goldsteyn Thomas, E. J. (1992)
Rapid and sensitive method for detection of shiga-like toxin-producing Escheri-
chia coli in ground beef using the polymerase chain reaction. Appl. Environ.
Microbiol 58, 3809-3815.
83. Todd, D., Mawhinney, K. A., and McNulty, M. S. (1992) Detection and differ-
entiation of chicken anemia virus isolates by using the polymerase chain reac-
tion. /. Clin. Microbiol. 30, 1661-1666.
84. Partis, L., Newton, K., Murby, J., and Wells, R. J. (1994) Inhibitory effects of
enrichment media on the Accuprobe test for Listeria monocytogenes. Appl.
Environ. Microbiol. 60, 1693-1694.
85. Jinneman, K. C, Wetherington, J. H., Hill, W. E., Adams, A. M., Johnson,
J. M., Tenge, B. J., et al. (1998) Template preparation for the detection and
identification of Cyclospora sp. and Eimeria spp. oocysts directly from rasp-
berries. /. Food Protect. 61, 1497-1503.
86. Simon, M. C, Gray, D. I., and Cook, N. (1996) DNA extraction and PCR
methods for the detection of Listeria monocytogenes in cold-smoked salmon.
Appl. Environ. Microbiol. 62, 822-824.
87. Jacobsen, C. S. and Rasmussen, O. F. (1992) Development and application of a
new method to extract bacterial DNA from soil based on separation of bacteria
from soil with cation-exchange resin. Appl. Environ. Microbiol. 58, 2458-2462.
88. Lindahl, T. (1993) Instability and decay of the primary structure of DNA.
Nature 362, 709-715.
89. Gibson, J. R., Sutherland, K., and Owen, R. J. (1994) Inhibition of DNAse
activity in PFGE analysis of DNA from Campylobacter jejuni. Lett. Appl.
Microbiol. 19, 357-358.
90. Dorward, D. W. and Garon., C. F. (1990) DNA is packaged within membrane-
derived vesicles of Gram-negative but not Gram-positive bacteria. Appl.
Environ. Microbiol. 56, 1960-1962.
91. Alonso,R., Nicholson, P. S., and Pitt, T. L. (1993) Rapid extraction of high purity
chromosomal DNA from Serratia marcescens. Lett. Appl. Microbiol. 16, 77-79.
92. Raina, K. and Chandlee, J. M. (1996) Recovery of genomic DNA from a fun-
gus (Sclerotinia homoeocarpa) with high polysaccharide content.
BioTechniques 21, 1030-1032.
93. Hochmeister, M. N., Budowle, B., Borer, U. V., and Dirnhofer, R. (1993)
Effects of nonoxinol-9 on the ability to obtain DNA profiles from postcoital
vaginal swabs. /. Forensic Sci. 38, 442-447.
94. Ahokas, H. and Erkkila, M. J. (1993) Interference of PCR amplification by the
polyamines, spermine and spermidine. PCR Methods Applic. 3, 65-68.
95. Hall, L. M., Slee, E., and Jones, D. S. (1995) Overcoming polymerase chain
reaction inhibition in old animal tissue samples using ethidium bromide. Anal.
Biochem. 225, 169-172.
96. Fendler, E. J., Dolan, M. J., and Williams, R. A. (1998) Handwashing and
gloving for food protection. Part I: examination of the evidence. Dairy Food
Environ. Sanit. 18, 814-823.
Problems with the PCR 473
97. Buffone,G. J.,Demmler,G. J., Schimbor, C. M., and Greer, J. (1991) Improved
amplification of cytomegalovirus DNA from urine after purification of DNA
with glass beads. Clin. Chem. 37, 1945-1949.
98. Noordhoek, G. T., Wolters, E. C., de Jonge, M. E. J., and Van Embden, J. D. A.
(1991) Detection by polymerase chain reaction of Treponema pallidum DNA
in cerebrospinal fluid from neurosyphilis patients before and after antibiotic
treatment./. Clin. Microbiol. 29, 1976-1984.
99. Mayer, C. L. and Palmer, C. J. (1996). Evaluation of PCR, nested PCR, and
fluorescent antibodies for detection of Giardia and Cryptosporidium species in
wastewater. Appl. Environ. Microbiol. 62, 2081-2085.
100. Goodyear, P. D., MacLaughlin-Black, S., and Mason, I. J. (1994) A reliable
method for the removal of co-purifying PCR inhibitors from ancient DNA.
BioTechniques 16, 232-235.
101. Makino, S.-L, Okada, Y., and Maruyama, T. (1995) A new method for direct
detection of Listeria monocytogenes from foods by PCR. Appl. Environ.
Microbiol. 61, 3745-3747.
102. Abrol, S. and Chaudhary, V. K. (1993) Excess PCR primers inhibit DNA cleav-
age by some restriction endonucleases. BioTechniques 15, 630-632.
103. Arbuthnot, P. and Fitschen, W. (1992) Inhibition of primer extension by single
mismatches during asymmetric re-amplification. Biochem. J. 288, 1073-1074.
104. Akane, A., Matsubara, K., Nakamura, H., Takahashi, S., and Kimura, K. (1994)
Identification of the heme compound copurified with deoxyribonucleic acid
(DNA) from bloodstains, a major inhibitor of polymerase chain reaction (PCR)
amplification. /. Forensic Sci. 39, 362-372.
105. Cone, R. W., Hobson, A. C, and Huang, M. W. (1992) Coamplified positive
control detects inhibition of polymerase chain reactions. /. Clin. Microbiol. 30,
3185-3189.
106. Fiallo, P., Williams, D. L., Chan, G. P., and Gillis, T. P. (1992) Effects of fixa-
tion on polymerase chain reaction detection of Mycobacterium leprae. J. Clin.
Microbiol. 30, 3095-3098.
107. Fluit, A. C, Widjojoatmodjo, M. N., and Verhoef, J. (1995) Detection of Sal-
monella species in fecal samples by immunomagnetic separation and PCR.
/. Clin. Microbiol. 33, 1046-1047.
108. Grimprel, E., Sanchez, P. J., Wendel, G. D., Burstain, J. M., McCracken, G. H.,
Jr., Radolf, J. D., et al. (1991) Use of polymerase chain reaction and rabbit
infectivity testing to detect Treponema pallidum in amniotic fluid, fetal and
neonatal sera, and cerebrospinal fluid. /. Clin. Microbiol. 29, 1711-1718.
109. Hay, P. E., Clarke, J. R., Strugnell, R. A., Taylor-Robinson, D., and Goldmeier, D.
(1990) Use of the polymerase chain reaction to detect DNA sequences specific to
pathogenic treponemes in cerebrospinal fluid. FEMS Microbiol. Lett. 68, 233-238.
110. Kolk, A. H. J., Schuitema, A. R. J., Kuijper, S., van Leeuwen, J., Hermans,
P. W. M., van Embden, J. D. A., et al. (1992) Detection of Mycobacterium
tuberculosis in clinical samples by using polymerase chain reaction and a non-
radioactive detection system. /. Clin. Microbiol. 30, 2567-2575.
474 Wilson
111. Widjojoatmodjo, M. N., Fluit, A. C, Torensma, R., Verdonk, G. P. H. T., and
Verhoef, J. (1992) The magnetic immuno polymerase chain reaction assay for
direct detection of salmonellae in fecal samples. /. Clin. Microbiol. 30, 3 195-3 199.
112. Mercier, B., Gaucher, C., Feugeas, O., and Mazurier, C. (1990) Direct PCR
from whole blood, without DNA extraction. Nucleic Acids Res. 18, 5908.
113. Vettori, C., Paffetti, D., Pietramellara, G., Stotzky, G., and Gallon, E. (1996)
Amplification of bacterial DNA bound on clay minerals by the random amplified
polymorphic DNA (RAPD) technique. FEMS Microbiol. Ecol. 20, 251-260.
114. Nilsson, H.-O., Aleljung, A., Nilsson, I., Tyszkiewicz, T., and Wadstrym, T.
(1997) Immunomagnetic bead enrichment and PCR detection of Helicobacter
pylori in human stools. /. Microbiol. Methods 27, 73-79.
115. Saulnier, P. and Andremont, A. (1992) Detection of genes in feces by booster
polymerase chain reaction. /. Clin. Microbiol. 30, 2080-2083.
1 16. Powell, H. A., Gooding, C. M., Garrett, S. D., Lund, B. M., and McKee, R. A.
(1994) Proteinase indibition of the detection of Listeria monocytogenes in milk
using the polymerase chain reaction. Lett. Appl. Microbiol. 18, 59-61.
117. Kreader, C. A. (1996) Relief of amplification inhibition in PCR with bovine serum
albumin or T4 gene 32 protein. Appl. Environ. Microbiol. 62, 1 102-1 106.
118. Wiedbrauk, D. L., Werner, J. C, and Drevon, A. M. (1995) Inhibition of PCR
by aqueous and vitreous fluids. /. Clin. Microbiol. 33, 2643-2646.
1 19. Lantz, P.-G., Matsson, M., Wadstrim, T., and RUdstrym, P. (1997) Removal of PCR
inhibitors from human faecal samples through the use of an aqueous two-phase system
for sample preparation prior to PCR. /. Microbiol. Methods 28, 159-167.
120. Olive, D. M. (1989) Detection of enterotoxigenic Escherichia coli after poly-
merase chain reaction amplification with a thermostable DNA polymerase.
/. Clin. Microbiol. 27, 261-265.
121. Al-Soud, W. A. and Rudstrom, P. (1998) Capacity of nine thermostable DNA
polymerases to mediate DNA amplification in the presence of PCR-inhibiting
samples. Appl. Environ. Microbiol. 64, 3748-3753.
122. Clewley, J. P. (1995) Which amplification method? PHLS Microbiol. Digest
12, 186.
123. Cotton, R. G. H. (1997) Slowly but surely towards better scanning for muta-
tions. Trends Genet. 13, 43-46.
124. Farber, J. M. (1996) An introduction to the hows and whys of molecular typing.
/. Food Protect. 59, 1091-1101.
125. Tang, Y.-W., Procop, G. W., and Persing, D. H. (1997) Molecular diagnostics
of infectious disease. Clin. Cheni. 43, 2021-2038.
126. Threlfall, J. E., Ridley, A. M., and Hampton, M. D. (1996) Technical advances
in the bacteriological laboratory: methods for DNA analysis. PHLS Microbiol.
Dig. 13, 138-141.
127. Wilson, I. G. Potential errors in molecular methods. Unpublished data.
128. Gendel, S. M. (1996) Computational analysis of the specificity of 16S rRNA-
derived signature sequences for identifying food-related microbes. Food
Microbiol. 13, 1-15.
Problems with the PCR 475
129. Wang, R.-F., Cao, W.-W., and Cerniglia, C. E. (1997) A universal protocol for
PCR detection of 13 species of foodborne pathogens in foods. /. Appl.
Microbiol 83, 727-736.
130. Burns, M. A., Johnson, B. N., Brahmasandra, S. N., Handique, K., Webster, J.
R., Krishnan, M., et al. (1998) An integrated nanoliter DNA analysis device.
Science 282, 484-487.
131. Kricka, L. J. (1998) Miniaturization of analytical systems. Clin. Chem. 44,
2008-2014.
132. Baiter, M. (1998) Molecular methods fire up the hunt for emerging pathogens.
Science 2%2,2\9-22\.
133. Wilson, M. J., Weightman, A. J., and Wade, W. G. (1997) Applications of
molecular ecology in the characterization of uncultured microorganisms asso-
ciated with human disease. Rev. Med. Microbiol. 8, 91-101.
134. Van Zwet, A. A., Thijs, J. C, Kooistra-Smid, A. M., Schirm, J., and Snijder,
J. A. (1994) Use of PCR with feces for detection of Helicobacter pylori infec-
tions in patients. /. Clin. Microbiol. 32, 1346-1348.
135. Kingsley, G. (1997) Microbial DNA in the synovium — a role in aetiology or a
mere bystander? Lancet 349, 1038-1039.
136. Neumaier, M., Braun, A., and Wagener C. (1998) Fundamentals of quality
assessment of molecular amplification methods in clinical diagnostics. Clin.
Chem. 44, 12-26.
137. Tenover, F. C, Arbeit, R. D., Goering, R. V., Mickelsen, P. A., Murray, B. E.,
Persing, D. H., et al. (1995) Interpreting chromosomal DNA restriction pat-
terns produced by pulsed-field gel electrophoresis: criteria for bacterial strain
typing. /. Clin. Microbiol. 33, 2233-2239.
138. Grant, I. R. (1998) Does Mycobacterium paratuberculosis survive pasteuriza-
tion conditions? Appl. Environ. Microbiol. 64, 2760-2761.
139. de Kok, J. B., Hendricks, J. C. M., van Solinge, W. W., Willems, H. L.,
Mensink, E. J., and Swinkels, D. W. (1998) Use of real-time quantitative PCR
to compare isolation methods. Clin. Chem. 44, 2201-2204.
140. Suzuki, M. T. and Giovannoni, S. J. (1996) Bias caused by template annealing
in the amplfication of mixtures of 16S rRNA genes by PCR. Appl. Environ.
Microbiol. 62, 625-630.
141. Wang, G. C-Y., and Wang, Y. (1998) Frequency of formation of chimeric
molecules as a consequence of PCR coamplification of 16S rRNA genes from
mixed bacterial genomes. Appl. Environ. Microbiol. 63, 4645-4650.
142. Zoetendal, E. G., Akkermanns, A. D. L., and de Vos, W. M. (1998) Tempera-
ture gradient gel electrophoresis analysis of 16S rRNA from human fecal
samples reveals stable host-specific communities of active bacteria. Appl.
Environ. Microbiol. 64, 3854-3859.
143. Christian Hansen, M., Tolker-Nielsen, T., Givskov, M., and Molin, S. (1998)
Biased 16S rDNA PCR amplification caused by interference from DNA flank-
ing the template region. FEMS Microbiol. Ecol. 26, 141-149.
144. Polz, M. F. and Cavanaugh, C. M. (1998) Bias in template-to-product ratios in
multitemplate PCR. Appl. Environ. Microbiol. 64, 3724-3730.
476 Wilson
145. On, S. L. (1998) In vitro genotypic variation of Campylobacter coli documented
by pulsed-field gel electrophoresis DNA profiling: implications for epidemio-
logical studies. FEMS Microbiol. Lett. 165, 341-346.
146. Adah, M. I., Rohwedder, A., Olaleyle, O. D., and Werchau, H. (1997) Nigerian
rotavirus serotype G8 could not be typed by PCR due to nucleotide mutation at
the 3' end of the primer binding site. Arch. Virol. 142, 1881-1887.
147. Kerr, J. R. and Curran, M. D. (1996) Application of polymerase chain reaction-
single stranded conformational polymorphism to microbiology. Clin. Mol.
Pathol. 49, 315-320.
148. Weinshenker, B. G., Hebrink, D. D., Gacy, A. M., and McMurray, C. T.
(1998) DNA compression caused by an upstream point mutation.
BioTechniques 25, 68-72.
149. McKillop, J. L., Jaykus, L.-A., and Drake, M. (1998) rRNA stability in heat-
killed and UV-irradiated enterotoxigenic Staphylococcus aureus and Escheri-
chia coli 0157:H7. Appl. Environ. Microbiol. 64, 4264-4268.
150. Barer, M. R., Gribbon, L. T., Harwood, C. R., and Nwoguh, C. E. (1993) The
viable but non-culturable hypothesis and medical bacteriology. Rev. Med.
Microbiol. 4, 183-191.
151. Kopczynski, E. C., Bateson, M., and Ward, D. M. (1994) Recognition of
chimeric small-subunit ribosomal DNAs composed of genes from uncultivated
micro-organisms. Appl. Environ. Microbiol. 60, 746-748.
152. Anonymous (1998) QIA-hints. QIAGEN News 5, 25.
153. Koblizikova, A., Dolezel, J., and Macas, J. (1998) Subtraction with 3' modified
oligonucleotides eliminates amplification artifacts in DNA libraries enriched
for micro satellites. BioTechniques 25, 32-38.
154. Ely, J. J., Reeves-Daniel, A., Campbell, M. L., Kohler, S., and Stone, W. H.
(1998) Influence of magnesium ion concentration and PCR amplification con-
ditions on cross-species PCR. BioTechniques 25, 38-42.
155. Oakey, H. J., Gibson, L. F., and George, A. M. (1998) Co-migration of RAPD-
PCR amplicons from Aeromonas hydrophila. FEMS Microbiol. Lett. 164, 35-38.
156. Miele, G., MacRae, L., McBride, D., Manson, J., and Clinton, M. (1998) Elimi-
nation of false positives generated through PCR re-amplification of differential
display cDNA. BioTechniques 25, 138-144.
157. Wintzingerode, F., Gobel, U. B., and Stachebrandt, E. (1997) Determination of
microbial diversity in environmental samples: pitfalls of PCR-based rRNA
analysis. FEMS Microbiol. Rev. 21, 213-229.
158. Tillet, H. E. and Lightfoot, N. E. (1995) Quality control in environmental
microbiology compared with chemistry: what is homogenous and what is ran-
dom? Water Sci. Technol. 31, 471-477.
159. Burr, M. D. and Pepper, I. L. (1997) Variability in presence-absence scoring of AP
PCR fingerprints affects computer matching of bacterial isolates. /. Microbiol.
Methods 29, 63-68.
160. Machado, J., Grimond, F., and Grimond, P. A. (1998) Computer identification of
Escherichia coli rRNA gene restriction patterns. Res. Microbiol. 149, 1 19-35.
Problems with the PCR 477
161. Cimolai, N., Trombley, C, Wensley, D., and LeBlanc, J. (1997) Heterogenous
Serratia marcescens genotypes from a nosocomial paediatric outbreak. Chest
111, 194-197.
162. Singh, D. (1995) DNA profiling: "insurmountable proof" or exaggeration? Med.
Law 14, 445-45 1 .
163. Welch, H. G. and Burke, W. (1998) Uncertainties in genetic testing for chronic
disease. JAMA 280, 1525-1527.
164. Clewley, J. P. (1998) A user's guide to producing and interpreting tree dia-
grams in taxonomy and phylogenetics. Part 4: practice. Commun. Dis. Public
Health 1, 285-287.
165. Angrist, M. (1997) Does Phaster mean better? Clin. Chem. 43, 424-426.
166. Lipshutz, R. J., Morris, D., Chee, M., Hubbell, E., Kozal, M. J., Shah, N., et al.
(1995) Using oligonucleotide probe arrays to assess genetic diversity.
BioTechniques 19, 442-447.
167. Service, R. F. (1998) Microchip arrays put DNA on the spot. Science 282, 396-399.
168. Hacia, J. G., Brody, L. C., Chee, M. S., Fodor, S. P. A., and Collins, F. S. (1996)
Detection of heterozygous mutations in BRCA1 using high density oligo-
nucleotide arrays and two-colour fluorescence analysis. Nat. Genet. 14, 441^-47.
169. Belgrader, P., Bennet, W., Hadley, D., Long, G., Raymond, M., Milanovich, F.,
et al. (1998) Rapid pathogen detection using a microchip PCR array instru-
ment. Clin. Chem. 44, 2191-2194.
170. Parkes, H. (1998) DNA chips — a taste of the future. VAM Bull. No. 19
(Autumn), 14-18.
171. Guschin, D. Y., Mobarry, B. K., Prouodnikov, D., Stahl, D. A., Rittman, B. E.,
and Mirzabekov, A. D. (1997) Oligonucleotide microchips as genosensors for
determinative and environmental studies in microbiology. Appl. Environ.
Microbiol. 63, 2397-2402.
172. Patchett, R. A., Kelly, A. F., and Kroll, R. G. (1991) The adsorption of bacteria
to immobilized lectins. /. Appl. Bacteriol. 71, 277-284.
173. Payne, M. J., Campbell, S., Patchett, R. A., and Kroll, R. G. (1992) The use of
immobilized lectins in the separation of Staphylococcus aureus, Escherichia
coli, Listeria and Salmonella spp. from pure cultures and foods. /. Appl.
Bacteriol. 73, 41-52.
174. Ehrlich-Kautzky, E., Shinomiya, N., and Marsh, D. G. (1991) Simplified
method for isolation of white cells from whole blood suitable for direct poly-
merase chain reaction. BioTechniques 10, 39-40.
175. Hannig, K. (1971) Free-flow electrophoresis (a technique for continuous
preparative and analytical separation). Methods Microbiol. 58, 513-548.
176. Shain, D. H., Yoo, J., Slaughter, R. G., Hayes, S. E., and Ji, T. H. (1992)
Electrofractionation: a technique for detecting and recovering biomolecules.
Anal. Biochem. 200, 47-51.
177. Atmar, R. L., Metcalf, T. G., Neill, F. H., and Estes, M. K. (1993) Detection of
enteric viruses in oysters by using the polymerase chain reaction. Appl. Environ.
Microbiol. 59,631-635.
478 Wilson
178. Grant, K. A., Dickinson, J. H., Payne, M. J., Campbell, S., Collins, M. D., and
Kroll, R. G. (1993) Use of the polymerase chain reaction and 16S rRNA
sequences for the rapid detection of Brochothrix spp. in foods. /. Appl.
Bacteriol. 74, 260-267.
179. Lantz, P., Tjerneld, F., Borch, E., Hahn-Hagerdal, B., and, Radstrom, P. (1994)
Enhanced sensitivity in PCR detection of Listeria monocytogenes in soft cheese
through use of an aqueous two-phase system as a sample preparation method.
Appl. Environ. Microbiol. 60, 3416-3418.
180. McGregor, D. P.,Forster, S., Steven, J., Adair, J., Leary, S. E. C, Leslie, D.L.,et
al. (1996) Simultaneous detection of microorganisms in soil suspension based on
PCR amplification of bacterial 16S rRNA fragments. Biotechniques 21,
463-471.
181. Jaykus, L-A., De Leon, R., and Sobsey, M. D. (1995) Development of a mo-
lecular method for the detection of enteric viruses in oysters. /. Food Protect.
58, 1357-1362.
182. Herman, L. M. F., De Block, J. H. G. E., and Waes, G. M. A. V. J. (1995) A
direct PCR detection method for Clostridium tyrobutyricum spores in up to 100
milliliters of raw milk. Appl. Environ. Microbiol. 61, 4141-4146.
183. Lees, D. N., Henshilwood, K., Green, J., Gallimore, C. I., and Brown, D. W. G.
(1995) Detection of small round structured viruses in shellfish by reverse
transcription-PCR. Appl. Environ. Microbiol. 61, 4418-4424.
184. Schwab, K. J., De Leon, R., and Sobsey, M. D. (1996) Immunoaffinity concen-
tration of waterborne enteric viruses for detection by reverse transcriptase PCR.
Appl. Environ. Microbiol. 62, 2086-2094.
185. Witham, P. K., Yamashiro, C. T., Livak, K. J., and Batt, C. A. (1996) A PCR-
based assay for the detection of Escherichia coli shiga-like toxin genes in
ground beef. Appl. Environ. Microbiol. 62, 1347-1353.
186. Wilde, J., Eiden, J., and Yolken, R. (1990) Removal of inhibitory substances
from human fecal specimens for detection of group A rotaviruses by reverse tran-
scriptase and polymerase chain reactions. /. Clin. Microbiol. 28, 1300-1307.
187. Pomp, D. and Medrano, J. F. (1991) Organic solvents as facilitators of
polymerase chain reaction. BioTechniques 10, 58-59.
188. De Leon, R., Matsui, S. M., Baric, R. S., Herrmann, J. E., Blacklow, N. R.,
Greenberg, H. B., and Sobsey, M. D. (1992) Detection of Norwalk virus in
stool specimens by reverse transcriptase-polymerase chain reaction and nonra-
dioactive oligoprobes. /. Clin. Microbiol. 30, 3151-3157.
1 89. Lau, J. Y. N., Qian, K., Wu, P. C, and Davis, G. L. (1993) Ribonucleotide vanadyl
complexes inhibit polymerase chain reaction. Nucleic Acids Res. 21, 2777.
190. Schlapfer, G., Senn, H. P., Berger, R., and Just, M. (1993) Use of the polymerase
chain reaction to detect Bordetella pertussis in patients with mild or atypical
symptoms of infection. Eur. J. Clin. Microbiol. Infect. Dis. 12, 459-463.
191. Varela, P., Pollevick, G. D., Rivas, M., Chinen, I., Binsztein, N., Frasch, A. C,
et al. (1994) Direct detection of Vibrio cholerae in stool samples. /. Clin.
Microbiol. 32, 1246-1248.
Problems with the PCR 479
192. Deneer, H. G. and Knight, I. (1994) Inhibition of the polymerase chain reaction
by mucolytic agents. Clin. Chem. 40, 171-172.
193. Kolk, A. H. J., Noordhoek, G. T., De Leeuw, O., Kuijper, S., and Van Emb-
den, J. D. A. (1994) Mycobacterium smegmatis strain for detection of Myco-
bacterium tuberculosis by PCR used as internal control of inhibition of
amplification and for quantification of bacteria. /. Clin. Microbiol. 32,
1354-1356.
194. Amicosante, M., Richeldi, L., Trenti, G., Paone, G., Campa, M., Bisetti, A.,
and Saltini, C. (1995) Inactivation of polymerase inhibitors fox Mycobacterium
tuberculosis DNA amplification in sputum by using capture resin. /. Clin.
Microbiol 33, 629-630.
195. Schirm, J., Oostendorp, L. A. B., and Mulder, J. G. (1995) Comparison of
Amplicor, in-house PCR, and conventional culture for detection of Mycobacte-
rium tuberculosis in clinical samples. /. Clin. Microbiol. 33, 3221-3224.
196. An, Q., Liu, J, O'Brien, W., Radcliffe, G., Buxton D., Popoff, S., King, W., et
al. (1995) Comparison of Q(3 replicase-amplified assay with competitive PCR
assay for Chlamydia trachomatis . J. Clin. Microbiol. 33, 58-63.
197. Leng, X., Mosier, D. A., and Oberst, R. D. (1996) Simplified method for recov-
ery and PCR detection of Cryptosporidium DNA from bovine faeces. Appl.
Environ. Microbiol. 62, 643-647.
198. Toranzos, G. A. and Alvarez, A. J. (1992) Solid-phase polymerase chain reac-
tion: applications for direct detection of enteric pathogens in waters. Can. J.
Microbiol. 38, 365-369.
199. Demeke, T. and Adams, R. P. (1992) The effects of plant polysaccharides and
buffer additives on PCR. BioTechniques 12, 332-334.
200. Smalla, K., Cresswell, N., Mendonca-Hagler, L. C, Wolters, A., and van Elsas,
J. D. (1993) Rapid DNA extraction protocol from soil for polymerase chain
reaction-mediated amplification. /. Appl. Bacteriol. 74, 78-85.
201. Yoon, C. and Glawe, D. A. (1993) Pretreatment with RNase to improve PCR
amplification of DNA using 10-mer primers. BioTechniques 6, 908-910.
202. Moran, M. A., Torsvik, V. L., Torsvik, T., and Hodson, R. E. (1993) Direct
extraction and purification of rRNA for ecological studies. Appl. Environ.
Microbiol. 59,915-918.
203. Straub, T. M., Pepper, I. L., Abbaszadegan, M., and Gerba, C. P. (1994) A
method to detect enteroviruses in sewage sludge-amended soil using the PCR.
Appl. Environ. Microbiol. 60, 1014-1017.
204. Straub, T. M., Pepper, I. L., and Gerba, C. P. (1995) Removal of PCR inhibiting
substances in sewage sludge amended soil. Water Sci. Technol. 31, 311-315.
205. Johnson, D. W., Pieniazek, N. J., Griffin, D. W., Misener, L., and Rose, J. B. (1995)
Development of a PCR protocol for sensitive detection of Cryptosporidium oocysts
in water samples. Appl. Environ. Microbiol. 61, 3849-3855.
206. McHale, R. H., Stapleton, P. M., and Bergquist, P. L. (1991) Rapid preparation
of blood and tissue samples for polymerase chain reaction. BioTechniques 10,
20-22.
480 Wilson
207. Jackson, C. R., Harper, J. P., Willoughby, D., Roden, E. E., and Churchill, P.
(1997) A simple, efficient method for the separation of humic substances and
DNA from environmental samples. Appl. Environ. Microbiol. 63, 4993-4995.
208. Irving, W. L., Day, S., Eglin, R. P., Bennett, D. P., Jones, D. A., Nuttall, P., et
al. (1992) HCV and PCR negativity. Lancet 339, 1425.
209. Klein, D., Grody, W. W., Tabor, D. E., and Cederbaum, S. D. (1992) Pitfalls of
restriction endonuclease digestion of point mutations. Clin. Che/n. 38, 1392-1394.
210. Das, S., Chan, S. L., Allen, B. W., Mitchison, D. A., and Lowrie, D. B. (1993)
Application of DNA fingerprinting with IS986 to sequential mycobacterial
isolates obtained from pulmonary tuberculosis patients in Hong Kong before,
during and after short-course chemotherapy. Tuberc. Lung Dis. 74, 47-51.
21 1. Coutinho, H. L. C, Handley, B. A., Kay, H. E., Stevenson, L., and Beringer,
J. E. (1993) The effect of colony age on PCR fingerprinting. Lett. Appl.
Microbiol. 17, 282-284.
212. Greisen, K., Loeffelholz, M., Purohit, A., and Leong, D. (1994) PCR prim-
ers and probes for the 16S rRNA gene of most species of pathogenic bacte-
ria, including bacteria found in cerebrospinal fluid. /. Clin. Microbiol. 32,
335-351.
213. Schweder, M. E., Shatters, R. G., West S. H., and Smith, R. L. (1995) Effect of
transition interval between melting and annealing temperatures on RAPD analy-
ses. BioTechniques 19, 38-42.
214. Dunbar, J., White, S., and Forney, L. (1997) Genetic diversity through the look-
ing glass: effect of enrichment bias. Appl. Environ. Microbiol. 63, 1326-1331.
215. Komatsoulis, G. A. and Waterman, M. S. (1997) A new computational method
for detection of chimeric 16S rRNA artifacts generated by PCR amplification
from mixed bacterial populations. Appl. Environ. Microbiol. 63, 2338-2346.
216. Francis, K. P. and Stewart, G. S. A. B. (1997) Detection and speciation of bac-
teria through PCR using universal major cold-shock protein primer oligomers.
/. bid. Microbiol. Technol. 19, 286-293.
217. Hennessy, L. K. Teare, J., and Ko., C. (1998) PCR condtions and DNA dena-
turants affect reproducibility of single-strand conformation polymorphism pat-
terns for BRCA1 mutations. Clin. Chem. 44, 879-882.
45
Problems with Genetically Modified Foods
Jose Manuel Bruno-Barcena, M. Andrea Azcarate-Peril,
and Faustino Siheriz
During the last few years we have seen a public debate, involving every social
statement, concerning food products and ingredients (1). The appearance in the
market of the first food products, or organisms, which have been improved by
recombinant DNA technologies (rDNA), has been received by society in a negative
manner. We are referring specifically to genetically modified (GM) food products.
Several definitions can explain the concept of GM products or, in a general way,
the imprecise word transgenic, a concept that comes from the seventies, even when
the terms were not the same. Since then, scientists are capable of constructing
recombinant DNA molecules and precisely moving them to another organism or to
the original one, by direct genetic manipulation. People understand "transgenic" as
food products or their ingredients, resulting from this kind of modification. In
other words, "either add a gene (or a set of them) from a donor genome to a recipi-
ent one" and you will obtain it (2).
However, the development and use of GM products in the pharmaceutical
industry remains out of this debate. People do not question the application of
DNA technologies in the medical field, but the public perception of what is a
transgenic food is associated either with menace or disease, conditioning the
final acceptance of these applications.
Certain products of animal or vegetable origin must be transformed by
microbes to obtain the final food. In an empirical way, man has produced
fermented food for thousands of years: production of yogurt, bread, and beer
are examples of processes known since then. The microorganisms used for
these products were extensively studied decades ago, and this knowledge
allowed the controlled manufacture of fermented foods using "starters." The
From: Methods in Biotechnology, Vol. 14: Food Microbiology Protocols
Edited by: J. F. T. Spencer and A. L. Ragout de Spencer © Humana Press Inc., Totowa, NJ
481
482 Bruno-Barcena, Azcarate-Peril, and Sineriz
comprehension of the microorganisms acting in the production allowed the
rationalization of the production avoiding the variability problems, and hence a
controlled quality. The incorporation of useful characteristics in these microor-
ganisms by means of recombinant technology will allow us to obtain foods with
better flavor, taste, and quality.
The first nonpharmaceutical, genetically modified products from microor-
ganisms to be commercialized were chymosin (used to replace rennet in cheese
manufacture) and bovine somatotrophin (which increasees milk production)
(3). In 1994, the first genetically modified, whole foodstuff, was placed on the
market: a tomato with a long shelf life. The introduction of these products
caused a public reaction and their hazards were evaluated and finally accepted
by the Food and Drug Administration, after their safety was confirmed. The
agency decided that this GM food is no more toxic, allergenic or any less "sub-
stantially equivalent" than its standard counterpart.
Because of the foregoing, several issues must be considered (in the develop-
ment of GM food products). The first step to obtain an acceptable product in the
market is the application (and the evaluation) of an adequate scheme, which should
include first the benefits for the consumer, which determine the public acceptance
and, hence, the success of the developed product. To introduce a desirable trait to
a useful strain, an adequate scheme should consider the benefits of the genetic
modification of the product: the technical aspects of the application of recom-
binant technology, the regulation of the application, and the public acceptance.
The first aspect to be considered is the application of the improvement (i.e.,
the real benefits of the incorporation of new genetic material into the cell). The
answer to this question comes from the actual problems in the industry. This is
the case of the problems caused by the infection of starters by bacteriophages
in the dairy industry. Bacteriophage infection of starter cultures is considered
to be one of the most important factors resulting in slow acid production in
large-scale dairy fermentations. Several strains of lactic acid bacteria contain
resistance mechanisms against phages (4-6) and these systems have been iso-
lated and characterized (7,8). The incorporation of the genes encoding these
defense mechanisms to starters along with rotation strategies would allow the
solution of some of the problems caused by phages.
The application of rDNA methods requires the evaluation of the potential
risk following a set of criteria such as those described by Verrips and van den
Berg (9), which must include the host (animal, plant, or microorganism that
must be generally recognized as safe), the characteristics of the final product
(i.e., will it contain rDNA? If it does, will this rDNA be present in living cells?
If it does not, must this product be labeled as a transgenic or GM product?),
and the position in the host of the new characteristic (interpreted as the
molecular techniques used to integrate a gene in the chromosome, to maintain
Problems with Genetically Modified Foods 483
it in a plasmid, or to remove it from the chosen host). The transformation of the
cell (by electroporation, conjugation, transduction, or microinjection) to intro-
duce new genetic material that carries the gene encoding the protein of interest,
or the DNA that will give the cell some advantage or to eliminate a catalytic
feature, should evaluate a possible environmental risk (10). The possibility of
the occurrence of gene transfer in the environment to nonsecure organisms
should influence the selection of the characteristic to be introduced in the host.
Environmental concerns are important from another point of view because trans-
fer of DNA occurs among microorganisms present in the digestive tract of human
beings and this phenomenon has been used as an argument against genetically
modified organisms (GMO). The food products that we consume are of an animal
or vegetable origin and, therefore, their cell components contain lipids, carbohy-
drates, proteins, and genetic material. It is most probable that the DNA included in
food is digested and cannot be taken up by the intestinal cells. However, this
assumption cannot be proved. If the DNA that we consume in food is not totally
digested, genes encoding antibiotic resistance used as markers in GMO could be
transferred to the normal (or to opportunistic) flora present in the human intestine,
creating health problems. Consequently, it is necessary to eliminate the antibiotic
resistance genes from the product after the research phase. There are two types of
strategies to solve this problem, either the used vectors named "food-grade," which
do not carry this kind of selection marker, or vectors that allow the elimination of
these markers in one step after GMO commercialization.
The commercial use of genetically modified organisms involves social and
ethical consequences, because rDNA in living cells is implicated. This is the third
aspect to be considered in the development of genetically improved food products.
Gaskell et al. (11) compared the public perceptions of applications of biotechnol-
ogy and confirmed the existing differences between Europe and the United States.
People on both continents encouraged the applications in the medicinal field, which
means that they supported the use of genetically modified medicines, but there was
a notable contrast in the case of food. Europeans consider "unnatural" and even
dangerous the consumption of GM food. The responsibility for this conjecture
may be the information that is given to the public, since there are a growing num-
ber of articles in the popular press that use exaggerated language (such as
"Frankenfoods") or introduce unintentional errors. Sasson (3) described a set of
criteria that seem to be necessary to achieve public acceptance of GM products.
The most important item is the regulation of the genetically engineered product.
Such regulation should be solidly scientifically based, promoting an understand-
ing between the regulatory agency and the food industry and avoiding the creation
of artificial barriers that could result in the presentation of equivocal informa-
tion to the consumer. However, at the moment, that is not the case if we consider
only the few fortunate results of the present regulations from the European Union
484 Bruno-Barcena, Azcarate-Peril, and Sineriz
that affect labeling (12). In spite of this, we will still have hard work to persuade
people and authorities about potential benefits of GM products.
Acknowledgments
The authors thank Dr. Daniel Ramon, Department of Biotechnology, Instituto
de Agroquimica y Tecnologia de Alimentos (IATA) Valencia, Spain, for provid-
ing information and for critically reading the manuscript. We are indebted to Dr.
John F. T. Spencer, coeditor of this book, for his continuous help throughout the
preparation of this manuscript. FS wishes to thank the Alexander von Humboldt
Stiftung (Bonn) for its continuing support.
References
1 . Frewer, L. ( 1 999) Bioenhancement or playing God? Biotechnology and the future
of food. TIBTECH 17, 182-183.
2. Ramon, D. (1999) Los Genes que Comemos. La Manipulation Genetica de los
Alimentos. ALGAR, Valencia, Spain.
3. Sasson, A. (1998) Public acceptance in Plant Biotechnology-Derived Products:
Market-Value Estimates and Public Acceptance. IX International Congress on
Plant Tissue and Cell Culture (International Association for Plant Tissue Culture,
IAPTC, Jerusalem, Israel). Kluwer Academic, Amsterdam.
4. Sanders, M. E. and Klaenhammer, T. R. (1980) Restriction and modification in
group N Streptococci: effect of heat on development of modified lytic bacterioph-
age. Appl. Environ. Microbiol. 40, 500-506.
5. Klaenhammer, T. R. and Sanozky, R. B. (1985) Conjugal transfer from Strepto-
coccus lactis ME2 of plasmids encoding phage resistance and lactose-fermenting
ability: evidence for a frequency conjugative plasmid responsible for abortive
infection of virulent bacteriophage. /. Gen. Microbiol. 131, 1531-1541.
6. Auad, L., Azcarate Peril, M. A., Ruiz Holgado, A. P., and Raya, R. R. (1998)
Evidence of a restriction/modification system in Lactobacillus delbrueckii subsp.
lactis CNRZ326. Curr. Microbiol. 36, 271-273.
7. Hill, C., Pierce, K., and Klaenhammer, T. R. (1989) The conjugative plasmid
pTR2030 encodes two bacteriophage defense mechanisms in lactococci, restriction
modification and abortive infection. Appl. Environ. Microbiol. 55, 2416-2419.
8. Ives, C, Sohail, A., and Brooks, J. E. (1995) The regulatory C proteins from different
restriction-modification systems can cross-complement. /. Bacteriol. Ill, 63 13-63 15.
9. Verrips, C. T. and van den Berg, D. J. C. (1996) Barriers to application of geneti-
cally modified lactic acid bacteria. Antonie van Leeuwenhoek 70, 299-316.
10. Schuler, T. H., Poppy, G. M., Kerry, B. R., and Denholm, I. (1999). Potential side
effects of insect-resistant transgenic plants an arthropod natural enemies.
TIBTECH 17, 210-215.
11. Gaskell, G., Bauer, M. W., Durant, J., and Allum, N. C. (1999) Worlds apart? The
reception of genetically modified foods in Europe and the U.S. Science 285, 384-387.
12. Ramon, D., Calvo, M. D., and Peris, J. (1998) The new regulation for labeling
genetically modified foods: a solution or a problem? Nat. Biotechnol. 16, 889.
Index
APS (Ammonium persulfate), 192
Acetate, 191,398,401
Acetic acid, 198,292
Acetic acid, tolerance, 209.223
Acetyl methyl carbinol, 21, 35
Achromobacter, 4
Acinetobacier, 4
Acriflavine HC1, 128,129, 131
Actomyosin, 261
Aesculin, 126, 128
Agar plate methods, 6,7
Agarose, 249, 250, 251, 254, 275,
278, 279,280
Agglutination tests, 89
Agitator, agitation, 397, 404, 406
Agrobacterium aurantiacum, 260
Alcohol, 288, 291, 292, 302, 303,
336,355-367
Alignment program, 39, 41
Alpha-aminobutyric acid,4I7
Amino acids, free (FAN), 283,287
Amino-N, 285-288
Ammonia N, 285, 416, 417
Ammonium citrate, 198
Ampicillin, 310
Amplicons, 76, 78, 82
Amplification of DNA, 40, 41,
75,76, 81, 102,109, 110,
245, 249
Amylases, amylolytic yeasts, 309
Aneuploidy, 274
Antibiotics, 27, 119, 129
See Penicillin, streptomycin,
chloramphenicol,
chlortetracyclin,
oxytetracyclin, vancomycin,
trimethoprim,
cyucloheximide, nalidixic
acid
Antibody, 103
Antisera, 65,
See Campylobacter
Apocarotenic acid (ethyl ester),
259,260,263-265, 267, 268
Arginine ,294
Arthroconidia, 212
Ascending velocity, 324, 327
Ascospore morphology, 252
Aspartic acid, 417
Aspergillus oryzae, 227
A. niger, Aspergillus spp.
Assimilation,263
Galactose, melibiosc, trehalose
Astaxanthin, 259-261, 263, 264,
266-268
A ureobasisium pullulans, 310, 315
B
Bacillus thruingensis, 1 07
BGBL Broth; medium, 18, 19
Bacillus cereus, 11, 14,18, 23,
107,197,227,228,395
Bacterial growth, 164, 384
485
486
Index
Bacteriocins, 141-146, 143,395
Bacteriophage, 203™207, 482
Baird-Parker test, agar, IS, 22
Barium chloride, 283, 284
Barium sulfate, 293
Basidiomycetous yeasts, 262, 264
Beer, 481
Bentonite, 290
Beta-l,3-laminaripentaohydrolase,
345
Beta-carotene, 260, 265, 266, 267,
269, 270
Beta-glucuronidase, 61, 64
Beta-mercaptoethanol, 198,199
Bile salts, 12, 13,90
Bilirubin, 90
Biochemical tests, 246, 250, 253
Biomass, 263, 290, 357, 359, 361,
363, 364
Biotin-Strepatvidin, 107-109
Bixin, Bixa orellana 261, 262,
269
Bhakesleeana trispora, 259
Botrytis sp., 4
Botrytis cinerea, 285, 419
Bovine serum albumin (BSA), 231
Brain— heart infusion,! 7, 22
Bread, 481
Brilliant Green, 13,62, 114
Buffers and solutions, 370, 372-381
Buoyant density centrifugation, 99
Buttermilk,210
Butylated hydroxytoluene, 270
CAMP test 127, 129
CHEF, 254. 275, 280
C0 2 , 222, 291,416
Calculations, 7-9
Campylobacter jejuni, 95—106, 1 19,
120, 122 '
Campylobacter spp., 95-106, 99,
101, 103
Campylobacter; Campy-Cefex agar,
119-123, 122
Candida krusei, 252
Candida holmii, 43,
Candida milled + 209
Candida parapsilosis, 2 1 1
Candida utilis
Candida vinaria, 398
Candida vini, 252
Candida cinnabarinus, 259
Canthaxanthin, 269, 260, 263, 264,
266-268, 270
Capsaxanthin, 262
Capsorubin, 262
Carotcnoids, 259-271,260
Carrots, 259
Cascade controller, 406-408
Casein, 228, 229, 231
Cassava (Manihot esculenta), 307,
308,313,316
Catalase, 1 19, 129, 130, 375, 392
Cefoxime, 86
Cefotan, 128, 129
Ceftazidine, 128
Cell lysis, 100
Cheese, 90, 141, 183, 197
Chemostat, 321,326, 327
Chicken rinse preparation, 100,101
Chloramphenicol, 3 1
Chloroform, 206, 261
Chromogenic Salmonella esterase
agar, 14,23
Chromogenic peptide (S-Ala), 197
Chromosomal DNA, 243, 245, 246,
249, 255
Index
487
Chromosomal size markers, 246
Chromosomes, chromosomal
polymorphism, 274, 275, 277
Chymosin, 482
Clark-Lubs medium, 15, 16, 18
Clostridium sp,, 4
Coagulase test, 21,22
Coliform bacteria, 18-21, 29-36
Coliphage lambda, 203
ColistinS0 4 , 127, 129
Colony-forming units, 27
Containment (known pathogens), 92
Coomassie Brilliant Blue, 150, 192
Creams, 1 1
Creatinine, 16
Crocus sativus, 262
Crytptococcus spp., 252—255
Crystal violet tetrazolium agar,5, 9
Cultivation, 163-171, 193
Cycloheximide, 223
Cysteine, 199
D
DAP1 (4,6-diamino-2-phenylindole),
336, 343
DMSO (dimethyl sulfoxide), 198,
263-269
DNA polymerase, 38, 64, 67, 98,
108, 110
DNA synthesizer, 38
DNA template, 1 09
DNS solution, 361,362
DNase test, DNase test agar, 16, 21,
22
Data analysis, 387
Dehatyomyces spp., 252, 255
Dekkera spp (Brettanomyces spp.),
255
Dendogram, 44, 390
Deoxynucleotide triphosphate
(dNTP), 38
Diluents and dilutions, 3, 5, 6
Dilution (methods), 3-6
Dinotrosalicylic acid, 361
Diphenyl (for control of molds), 251
Dipodascas spp., 210
Dithiothreitol (DTT), 311
Double layer plaque assay, 204, 205
Drigalsky spatula, 8, 14, 16, 21
dTNP, 38,40
Drosophila spp., 369
Dynabeads, 87, 88
E
ECP buffer, 275, 278, 279
EDTA, 245, 246, 250, 251,278
ESP buffer. 275
Eggs, 11, 12
Electromorphs, 369, 387, 392
Electrophoresis, 137, 149, 155,191,
193, 196,246,250,251,254,
280
Electrophoretic karyotyping, 246,
247,251,277,278,279
Embedded cells or spheroplasts,
278, 279
Enrichment, selective, 113,
114, 116
Enterobacter aerogenes, 22
Enterococci, 111, 112
Enterococci, media, 1 1 1
Enterohaemorrhagic strains, 12, 61
Enterotoxins, 12, 22, 23
Enzymes, 92
Eos in Y, 15
Ergosterol, 289
Erythritol, 233
Erythromycin, 310
488
Index
Escherichia coli, esp. strain
0157:117,61-66,85,94,96
Ethanol, alcoholic fermentation,
244, 245, 248, 285, 292,
Ethyl 4-dimethylamylobenzoate, 14
Ethyl acetate, 262
Ethyl carbamate, 420
Ethylamine hydrochloride, 222
FITC-casein assay, 199-201
FITC fluorescein isothiocyamanate,
197,335,344
False negatives, 429
False positives, 428
Fat, interference by, 90
Fecal coliforms, 29, 32
Fermented foods, 135-140, 141-
162, 163-172, 173-182
Ficoll, 311,314
Filamentous fungi, 31 1, 313, 314
Fish farming, 269
Flamingo, 269
Flavobacterium, 4
Floccuiation, 300-302, 349
Flotation assay, yeast, 335, 337, 328
Flow cytometry, 335, 337,338
Fluorescein, 197,201
Fluorescein isothiocyanate, 197,199,
200, 344
Fluorescence labeling, 335—340,
341-347,337,344
Foam, 349-352
Folin-Ciocalteau reagent, 229, 231
Formaldehyde, 283, 284,
Formate, 191,398
Formol method, 283-296
Fosfomycin (phosphomycin), 128
Freeze-thawing, 389
Fungi, 308, 310, 316
Fungizone. 228
Fusion (Fungal nuclei with
protoplasts, 313-315
G
yeast
GYEP broth, 216
Galactomyces sp., 211,213
Gas chromatography, 398
Gastroenteritis, 30
Gel mold, 371,382, 383
Gelatinase reactioon medium, 15, 18
Genes (£. coli), 89-92
Geotrichum, 4
Giant colonies, 252
Glass beads, 389
Glucose, 222, 397,415
Glucuronidase, 86, 89,
Gluten, 227
Glycerol, 233, 234, 237, 356
GlyceroI-3-phosphate
dehydrogenase, 356
Glycine, glycine-hydrazine buffer,
322, 326
Grapes, grape must, 243, 273, 275,
283-296, 297-306, 415-415-
425
Growth media, 210
Growth temperature, 223
H
H 2 S, 299-304
HPLC, 237-239, 262, 266-268
Haelll Cfol &n3A, 2
Haemaiococcus pluvialis, 260, 263,
265, 267, 269
Hamburger, 1 1
Hanseniaspora spp (Kloeckero
spp.), 255, 273. 283, 286
Index
489
Helicase, 275
Hemocytometer, 276
Hemolysin, 276
High cell density, 362
Homogenize!*, homogenization
(blender), 4, 25, 62
Homothallism, 274
Hybrids, hybridization, 109, 338,
345
Hydrophobicity, 350, 352
I
IMVIC test, 29, 30
ITS reagent, 40
Identification, 46, 63
Immobilized cells, 321, 322
Immunoassay, 67
Immunomagnetic separation, 85-94
Indole, 19,20,22
Induction, 203-206
Inhibitors, of amplification, 427-
429
Inoculum, 95, 310, 362, 405
Intraspecific differences, 253
Invertase, 356
Iodine, 13,262
fsobutanol, 196
Isolation, 244, 247, 251
Isolation and enumeration, yeasts,
243-257
Isopropanol, 245, 248
Issatchenkia oriental is, 209
K
KH 2 P0 4 (NaH 2 P0 4 ), 198
Kefir, 396
Killer factor (yeasts), 298-300, 303
Kluyveeromyces spp.,21 1, 215, 253,
255, 273
Ko vac's reagent, 16, 31, 35
L
Lactic acid fermentation, 419, 420
Lactobacillus casei, 206
Lactobacillus delbrueckii ssp
bulgaricus, 206
Lactobacillus helvetieus, 207
Lactobacillus, lactobaciIli/135, 141,
147, 167-171, 173, 183, 197,
203-207
Lactococcus lactis, 135, 303, 395,
396, 399, 402, 405, 407, 408
Lactose, 12-15,31,89, 113-115,
398
Lance fie Id Group D Streptoccoccus
spp., Ill
Lauryl sarcosine, 108, 246, 251
Lauryl sulfate broth (LST), 29,30
Least squares method, 398, 400, 401
Lecithin, 18,20
Levine agar, 15, 31
Lipids, 289
Listeria monocytogenes, 53—57, 67—
83, 125-131, 126, 127,395
Lithium CI, 16, 126, 129
Low-temperature incubator, 5
Lutein, 266
Lycopene, 264, 267, 269
Lysogeny, 203
Lysozyme, 369
Lytic enzymes, 275, 279
Lyticase, 254
M
M-FC broth, 29
MEE (multilocus enzyme
electrophoresis),
369-393
490
Index
MPN (most probable number), 20,
24
MRS broth (For growing
lactobacilli), 198-201
Magnetic capture, 86-88, 107-1 10
Maintenance (lactic acid bacteria),
163-171
Maize, 209
Malachite Green, 15
Maltose, 396-398
Mannitol, 14, 23
Margarine, 396
Material balance equations, 401
Mating, 336
Mayonnaise, 1 1
McClary's agar (sporulation of
yeasts), 245
MeOsuc-Arg-Pro-Tyr-p-
nitroanilide, 201
Meat extract, 1 98
Meats (cold or raw), 53, 125, 329
Media; selective and nonselective,
13, 14, 16,17,27, 119,204,
336, 342, 360
Media, differential, 114, 115
Meiosis, 277
Membrane filter, 361
Mcrcaptocthanol, 237, 343
Mesophilic microorganisms, 25, 26
Methanol, 198
Methyl red, 15,20,31,35
Methylene blue, 15, 301, 361, 362
Methyumbelliferyl-beta-
glucuronide, 64
Metschnikowia pulcherrima, 252,
255
MgS0 4 7H 2 0, 198
Micromanipulator, 276
Micropipets 39, 41
Milk, flavored dairy products, 1 1,
85, 95, 396
Mitochondrial DNA, 243
Mitomycin C, 203—206
Mixed culture systems, 195—41 1,
402, 405
MnS0 4 .4H 2 0, 198
Molasses, 360
Mold, 27, 28, 285.292
Morphological characteristics,
yeasts, 212, 244
Mossel agar, 14, 18, 23 x
Most probable number (MPN), 20,
23,34
Motility, 127, 129
Mucor spp., 227
Muller valve, 301
Multilocus Enzyme electrophoresis,
369-393
Multiplex PCR, 62, 63, 86, 89, 91
Must (grape), 287, 288
Mutation, 355
Mycobacterium paratuberculosis t
107
Mycotoxins, 285
N
N-succinyl-Ala-Ala-Pro-Phe-
p-nitroanilide 198
NSBA (nucleic acid-based
amplification), 67—83
NaCl, 12-17,396
Nalidixic acid, 120-126
Ninhydrin, 421
Nisin, 395, 396-411
Nitrate, 311,416
Nitrogen, 284. 285-288
Nonsoluble solids, 290
Novobiocin, 14, 114
Index
491
Novozym, 245, 278
Nuclear magnetic resonance (NMR),
26 1 , 270
Nuclei, 313, 314, 316
Nucleic acid preparation, 313, 314
Nutrient addition — timing, 288
OPA method, 151, 157,198, 199
Oligonucleotides, 79, 80
Oligonucleotide synthesizer, 62-64,
72,79
Olives, 224
o-phthaldialdehyde (OPA), 197,
198, 199
Osmotic buffer, 237, 342
Osmotic stabilizer, 237, 342, 345
Osmotolerant yeasts, 233, 241
Oxford agar, 129
Oxgall-Brilliant Green, 30
Oxygen/S0 2 , 238, 240, 289
Oxytetracyclin, 27, 251
P
PAGE, SDS-PAGE, 191, 193, 312
PALCAM agar (for Listeria), 128,
129 '
PALCAM media, 125, 128
PCR (polymerase chain reaction),
37, 61, 427 et seq
Amplification, rDNA, 102, 103,
245, 246, 249, 250
Buffers, 245, 246
RFLP, 73-75, 89, 101-104, 427-
480
Sampling errors, differential
i enrixhment, recovery
duriing culture, 24, 450, 456
Comigration, 460
Concentration effect 460
Conclusions, 464-466
Contamination, 461
Data interpretation, 464
Detection, 464
Endogenous and exogenous
contamination, 433
Factors affecting detection,
429
Failure of lysis, 443
Hybridization, 463
Incorporation errors resulting
from enzyme infidelity,
469
Inhibitors and facilitators in
food and clinical samples,
434^440
Inhibitors and facilitators in
environmental samples,
441,442
Live or dead?, 458
Misidentificaction, bias and
error in molecular
methods 448-450
Nucleic acid degradation and
capture, 444-447
Mediated chimeric gene
amplification, 459
Poor quality assuraance, 461
Preferential amplification, 456
Production, 463
Quantitation, 464
Reading and interpretation
error, 462
Reported errors in molecular
methods, 45 1—456
Selective lysis of bacteria, 456
Sequencing errors, 460
Standardization, 463
492
Index
Hybridization microarrays, 463
Mechanisms of inhibition, 434-
448
Reaction conditions, 431
p-anisaldehyde, 266, 269
Packed-bed system, 327
p-nitroanilide (pNA), 200, 201
Paprika, 282
Paradimethyl-aminobenzaldehyde,
15
Parameters, 323
Penicillium sp.,4
Peptone, 3, 5, 6, 12-14, 16-18, 25,
26
Pesticides and fungicides, 293
PH290
Phaffia rhodozyma
(Xanthophyllomyces
„ dendrothous) 259,260,263-
269
Phages, 203-207,482
Phenol red, 23
Phenylmethylsulfonyl fluoride
(PMSF), 229,231,311
Phosphate buffer, 1 98
Phosphoramidate, 38
Phycomyces hlakesleeanus, 26 1,
287, 269
Phyogenetic tree, 43, 44
Phylogeny inference, 39, 45
Physiological tests, 246, 250
Pichia (Hansenula) anomalo, 252,
254, 256
Pichia memhranaefaciens, 252
Plate count agar, 5, 10
Plating, selective, 1 14, 116
Polyethylene glycol (PEG), 236,
237,311
Polyethyleneimtne, 327
Polyhydroxy alcohols, 233-241
Polymyxin B, 15, 128
Polypeptone, 198, 396
Pomace, 289
Porosity, 323
Potassium acetate, 245, 248
Potassium nitrate, 222
Poultry, 4, 11,98,99, 101, 119, 125
Presumptive test, col i forms, 1 1 1
Pretreatment solution, 31 1, 314
Primers, 39, 64, 72, 73, 79, 80, 82,
88, 97, 98, 245
L. momwcytogenes,
Campylobacter spp. , 87, 95,
119 r
Proline, 199,283,294,416
Propionic acid, 360, 363
Proteases (Acid, neutral, alkaline),
227-229,231
Protein, 191, 193, 195, 196
Proteinase K, 246, 251,279
Proteolysis, 197-202
Proteus spp., 197
Protoplast, protoplasting, 309, 311,
313,314,336,342-344
Pseudomonas spp., 4, 197
Psychrotrophic organisms, 3, 4, 7, 8
Pulsed field gel electrophoresis
(PFGE), 250,251,275,277,
278, 280
Pyruvate, 1 1 9
R
RNA polymerase. 6S
Rnase A, 245
Reactor configuration, 321—328,
323, 324. 326
Reducing sugar, 362, 364
Regeneration, 345
Index
493
Rennet, 482
Restriction analysis, 249
Restriction enzymes, Hael, C/bl,
Mspl.Rsal, 252
Reverse transcriptase, 68, 96
Rhodamine B, 6G, 336, 343
Rhodococcus equi, 125
Rhodosporidium, 252
Rhodotorula sp., 211, 252, 255, 261,
Ribonuclease H, 68
Ribosomal DNA, 244, 245, 249
Rose Bengal, 228, 360
S
S0 2 , 298, 299, 301,303
SS agar, Shigella, 13, 17,23
Saccharomyces bayanus, 252
Saccharomyces cerevisiae, 44—46,
239,243,251,255,286,292,
297,309,355,361
Saccharomyces diastaticus, 356
Saccharomyces exiguus^ 43, 209,
212
Saccharofnyces pastorianus, 45
Saccharomycodes ludwigii, 256
Safranin, 1 5, 23
Salmonella sp., 12, 13, 17, 18,22,
23, 66,
Sampling, 228
Schizosaccharomyces spp., 46, 254,
256
Seafood, 125
Selenite broth, 13. 17
Septicaemia, 125
Sequence analysis, 37, 67
Serine, 294
Sheep, cattle, chickens, 125
Shiga-Iikc toxinsSLTl, SLT [I, 61,
' 65
Silage, 209,236
Simmons citrate agar, 16
Skim milk, 198
Sodium acetate, 136, 142, 164, 174,
192, 198,204
Sodium citrate test, 20, 21
Sodium dodecyl sulfate (SDS) , 198
Sodium hydroxide (NaOH), 283,
284
Sodium tetraborate (borax), 198
Soluble starch, 219-221
Somatotropin, 482
Sonicator, 369, 384
Solvents, 263, 264
Sorbitol, 64, 235
Soybeans, 228
Spheroplasts, 245, 275, 278, 279
Spiking, 101
Spoilage yeasts, 37-51
Spores, sporulation, 274, 275, 276
Sporidiobolus spp. ,252, 254, 256
Sporobolomyces spp.,252
Sporulation media, 245, 275
Spreaders (colonies), 8
Stability, 275, 277, 279
Slacking gel, 194, 195
Staining tray, 371
Stains, staining, 371, 381
Standard plate count, 4, 5, 7, 8
Staphylococci, 16, 107, 395
Staphylococcus aureus, 16, 21, 22,
125, 129, 130,395,430
Starch, starch gel, 307-317, 384,
385,389,391
Sterols. 289
Stomacher, stomacher bags, 3, 62,
145
Streptavidin, 108, 109
Streptococcus sp.,4, 111, 112
494
Index
Stgreptococcus viridosporus, 327
Streptomycin, 397
Stuck fermentations, 286, 289,292,
415
Suc-Ala-Glu-Pro-Phe-p-nitroanilide,
201
Succinate, 191
Sucrose, 356
Sudan Black (stain), 5, 23
Sugar cane syrup, 358, 360, 362-
364
Sulfur dioxide SO, 283,289
*■%
Suuport materials-384, 389
Supports, 322, 327Surface spread
plate, 7, 8
Symba process, 308
T
TAE buffer, 245, 249
TBE buffer, 245, 276
TE buffer, 245, 249
TEMED
(Tetramethylethy lenediarn i ne,
192, 195
TRITC (tetramethyl rhodamine
isothiocyanate), 335
Taq polymerase, 245—249
Temperature, temperature shock,
290, 356-367, 363, 364
Terminator cycle sequencing kit, 38
Tetrathioate broth, 12, 17
Thermal cycler, 38, 62, 64, 68, 72
Thermoduric organisms, 1 1
Thermonuclease test, 22
Thermophilic Campylobacter sp.,
95-106, 103
Thermotolerance, in yeast, 356-367
Thin-layer chromatography, 236,
262, 264, 268, 269
Threonine, 294,417
Toluidine Blue, 22
Tomato, 482
Torulaspora sp.,44, 235, 239
Toxicity, 291,292
Toxins, 61, 62, 64
Toxins (killer factors), 292, 298,
300, 303
Transduction, 203
Transilluminator, 23 1
Trichloroacetic acid (TCA), 198,
199
Trichosporon spp.,212, 213, 221
Triolein, 269
Tris-hydroxymethyl-aminomcthane,
198, 199,201
Trypticase soy broth, 86, 87,
Tryptone, tryptone water, 14, 15,
16, 19,87,223
Tryptophan, 199
Tween-80, 198
Tyrosine, 232
U
Urease, urea, 222, 223
V
Verotoxin, VTEC, VT genes, 85,
86, 92
Viability, 276
Vibrio sp., 66
Vineyard, 284
Vitamins, 210, 222, 288, 289
Vitis vinifera, 418
Voges-Proskauer test, 20, 21
Volume, of reactor, 323
W
Witliopsis saiurnus, 46
Wilson-Blair medium. 13, 17,23
Index
495
Wine, 243-257, 297-306, 307-317,
335-350,341-347,416,418,
420
X
Xanthophylls, 259, 261, 262
Xylitol, 234, 236, 239
Y
YEPD medium, 301
YM agar, broth, 310
Yeast nitrogen base,210
Yeast extract, 164, 174, 192, 198,
210,204,311
Yeast hulls.289
Yeast species, 27, 28, 37-5 1,211,
216,235,243-257,309
Yeasts and fermented foods, 211,
212
Yeasts (other)
Debaryomyces hansenii* 252
D, hansenii, 252
D. udenii, 252
D, vanrijii, 252
Kloeckera apiculata, 273,
286,288 292
Kluyveromyces lactis, 253
Pichia canadensis, 254
Saccharomyces bayanus> 252
S. pastorianus, 252
Saccharomyces sensu stricty, 254,
256
Saccharomyces spp.,286, 288
Schizosaccharomyces pomhe,
251,253,254
Tondaspora delbrneckii, 252,
253
T. pretoriensis, 253
Zygosaccharomyces
microellipsoides, 253
Z bailil 252, 253
Z bisporus, 253
Z. rouxii, 252, 253,
Yogurt, 209
Z
Zymomonas mobilis, 314, 315
Live Music Archive
Librivox Free Audio
Metropolitan Museum
Cleveland Museum of Art
Internet Arcade
Console Living Room
Books to Borrow
Open Library
TV News
Understanding 9/11