Skip to main content

Full text of "كتب في علم الميكروبيولوجي"

See other formats

Series Editor: Ajit Varma 

Volumes published in the series 

Volume 1 

Applied Bioremediation and Phytoremediation (2004) 

A. Singh, O.P. Ward (Editors) 

Volume 2 

Biodegradation and Bioremediation (2004) 

A. Singh, O.P. Ward (Editors) 

Volume 3 

Microorganisms in Soils: Roles in Genesis and Functions (2005) 

F. Buscot, A. Varma (Editors) 

Volume 4 

In Vitro Culture of Mycorrhizas (2005) 

S. Declerck, D.-G. Strullu, J.A. Fortin (Editors) 

Volume 5 

Manual for Soil Analysis - Monitoring and Assessing Soil Bioremediation 

R. Margesin, F. Schinner (Editors) 

Volume 6 

Intestinal Microorganisms of Termites and Other Invertebrates (2006) 

H. Konig, A. Varma (Editors) 

Volume 7 

Microbial Activity in the Rhizosphere (2006) 

K.G. Mukerji, C. Manoharachary, J. Singh (Editors) 

Volume 8 

Nucleic Acids and Proteins in Soil (2006) 

P. Nannipieri, K. Smalla (Editors) 

Volume 9 

Microbial Root Endophytes (2006) 

B.J.E. Schulz, C.J.C. Boyle, T.N. Sieber (Editors) 

Volume 10 

Nutrient Cycling in Terrestrial Ecosystems (2007) 

P. Marschner, Z. Rengel (Editors) 

Ajit Varma 

Ralf Oelmuller (Eds.) 

in Soil Microbiology 

With 94 Figures, 2 in Color 

4y Sprin 

Prof. Dr. Ajit Varma 

Director, Amity Institute of Microbial Sciences 

Vice Chairman (International), Amity Sciences Technology Foundation 

Amity University Uttar Pradesh 

Sector- 1 25, Noida 201303 

E-mail: ajitvarma@aihmr. amity. edu 

Prof. Dr. Ralf Oelmuller 

Friedrich-Schiller- University Jena 

Institute of General Botany and Plant Physiology 

Dornburger Str. 159 

07743 Jena 

E-mail: b7oera@rz. uni-jena. de 

Library of Congress Control Number: 2007921585 

ISSN 1613-3382 

ISBN-978-3-540-70864-3 Springer- Verlag Berlin Heidelberg New York 

This work is subject to copyright. All rights are reserved, whether the whole or part of the 
material is concerned, specifically the rights of translation, reprinting, reuse of illustrations, 
recitation, broadcasting, reproduction on microfilm or in any other way, and storage in data 
banks. Duplication of this publication or parts thereof is permitted only under the provisions 
of the German Copyright Law of September 9, 1965, in its current version, and permissions 
for use must always be obtained from Springer- Verlag. Violations are liable for prosecution 
under the German Copyright Law. 

Springer- Verlag is a part of Springer Science+Business Media 

© Springer- Verlag Berlin Heidelberg 2007 

The use of general descriptive names, registered names, trademarks, etc. in this publication 
does not imply, even in the absence of a specific statement, that such names are exempt from 
the relevant protective laws and regulations and therefore free for general use. 

Editor: Dr. Dieter Czeschlik, Heidelberg, Germany 

Desk Editor: Dr. Jutta Lindenborn, Heidelberg, Germany 

Cover design: WMXDesign GmhH, Heidelberg, Germany 

Typesetting and production: LE-TgX Jelonek, Schmidt & Vdckler GbR, Leipzig, Germany 

Printed on acid-free paper SPIN 11543862 31/3100 YL 5 4 3 2 10 

P r ef a ce 

There is general belief and admission that important, innovative and novel ideas 
emerge over a cup of 'Indian Darjeeling tea or a glass of 'German beer'. The 
editors of this book were sipping a cup of tea on the lush green garden lawns 
of North Maharastra University, Jalgaon, India. The weather was congenial and 
most suitable for materializations of original ideas. The genesis of this book un- 
derlines the concept developed in 2006. 

The field of microbiology began concurrently with the discovery of micro- 
organisms by two Fellows of The Royal Society, Robert Hooke and Antony van 
Leeuwenhoek, during the period 1665-1683. Later, during the golden era of mi- 
crobiology, noted scientists Louis Pasteur and Robert Koch laid a sound foun- 
dation for the modern microbiology. The study of microorganisms has became 
a valuable science in the last 100 years as it has provided both the means to 
control a number of infectious diseases and the experimental systems for the 
development of molecular biology. New developments in biotechnology and 
environmental microbiology signify that microbiology will continue to be an 
exciting field of study in the future. Various modern tools and techniques are 
required for a proper understanding of the roles of microbes in the causation 
of infectious diseases and the recycling of chemical elements in the biosphere. 
Assorted laboratory experiments not only motivate researchers and students by 
stimulating interest and enjoyment but also enhance the acquisition of scientific 
knowledge along with the development of 'scientific attitudes', such as open- 
mindedness and objectivity. 

There are numerous textbooks and review papers dealing with state-of-the- 
art of various aspects of molecular biology of microorganisms. However, the 
readers get lost in initiating the experiments due to lack of suitable and easy 
protocols. They have to search for diverse methods and techniques in a variety 
of literature and journals and still do not obtain the complete information deal- 
ing with the protocols in a concise manner. This book is an attempt to overcome 
the inherent cumbersome search process. Every effort was made to present the 
protocols in a very simple manner for easy understanding of undergraduate, 
graduates, postgraduates, post doctorates, active scientists and researchers. 

Soil, the main contributor to plant nourishment, is the top layer of the Earths 
surface and consists of rock and mineral particles mixed with organic matter. 
Soil microbiology is the study of the microorganisms in soil, their functions, 

and the consequences of their activities on the nature of the soil and the effect 
on the growth and health of plant life. Just a few grams of soil, less than a tea- 
spoonful, may contain hundreds of millions to billions of microbes. Not only 
is the total number of microorganisms in fertile soil quite high, but also, to- 
gether, they weigh a lot. Soil microbial biomass can range from several hundred 
to thousands of pounds per acre. 

The most plentiful microbes in soil are one-celled bacteria and fungi, which 
produce long, slender strings of cells called filaments or hyphae. The actinomy- 
cetes come between these two organisms. It is the actinomycetes that give soil its 
characteristic earthy smell. In this volume, the editors have accumulated various 
advanced molecular approaches for studying the different soil microorganisms 
for the benefit of humankind. Different techniques for measuring microbial 
biomass and activity in soil have been developed. Primers in Random Ampli- 
fied Polymorphic DNA (RAPD) techniques for species identification and other 
forgotten tools like quantitative histochemistry are discussed in details in this 
book with the hope that this would promote the understanding of microbes by 
students and advanced researchers alike. 

The editors have brought together the diverse topics related to various aspects 
of molecular approaches to the detection of soil microbes, namely assessing and 
detecting soil micro -fungal diversity and providing insight into their feasibil- 
ity. Various problems associated with the dilution plating technique, impor- 
tance of the rDNA gene in fungal systematics, the reliability of other molecu- 
lar approaches (especially Denaturing Gradient Gel Electrophoresis) and their 
drawbacks are discussed. Various modern tools and techniques like automated 
fluorescent DNA sequencing strategy, mRNA quantitation using real time PCR, 
RNAi technology, transcriptome analysis and immuno -techniques are handled 
by subject experts of these specific fields for clear and easy understanding for 
all. Different widely used methods like fatty acid methylester (FAME), phos- 
pholipid fatty acid (PLFA) analyses and denaturing gradient gel electrophoresis 
(DGGE) are elucidated with their advantages and limitations outlined. DGGE 
and RISA protocols for microbial community analysis in soil are also one of the 
highlights of this book. 

The soil zone located in and around the active roots is called the rhizosphere. 
This zone has high microbial activity. Materials released from roots, called exu- 
dates, create a food-rich environment for the growth of microorganisms. Rhi- 
zosphere microorganisms in turn help plants by fixing nitrogen from the soil 
air, dissolving soil minerals and decomposing organic matter, all of which al- 
low roots to obtain essential nutrients. Plant-Growth-Promoting Rhizobacteria 
(PGPRs) generate a variety of chemicals that stimulate plant growth. The bacte- 
ria grow and persist in the rhizosphere of non-woody roots. Various screening 
methods for PGPRs are described in this book. 

A special kind of fungus called mycorrhizae also associates with higher plants. 
By colonizing large areas of roots and reaching out into the soil, mycorrhizae as- 
sist in transport of soil nutrients and water into the plant. The latest methods 
for conducting experiments and research in mycorrhiza have been described. 

Cultivation of a group of mycorrhiza-like fungi belonging to family Sebacinales 
is enumerated. One of the members of Sebacinales which provides stress toler- 
ance activity against heavy metals and induced pathogen resistance in cereals is 

Authors have brought forth diverse approaches and methods to study the 
mechanisms behind the observed pathogen resistance induced by Piriformos- 
pora indica. 

Model organism A. thaliana was used as the plant partner to understand the 
molecular basis for beneficial plant/microbe interactions and this is also dis- 
cussed in this edition. Several other techniques like ion cyclotron resonance 
Fourier transform mass spectrometry (ICR-FT/MS) for non-targeted metabo- 
lomics of molecular interactions in the rhizosphere are presented. Immuno- 
technology for the localization of acid phosphatase using native gel bands in 
P. indica and other soil microorganism are elaborated in this volume of the Soil 
Biology series. 

We are grateful to the many people who helped to bring this volume to light. 
We wish to thank Dr. Dieter Czeschlik and Dr. Jutta Lindenborn, Springer 
Heidelberg, for generous assistance and patience in finalizing the volume. Fi- 
nally, specific thanks go to our families, immediate, and extended, not forget- 
ting those who have passed away, for their support or their incentives in putting 
everything together. Ajit Varma in particular is very thankful to Dr. Ashok K. 
Chauhan, Founder President of the Ritnand Balved Education Foundation (an 
umbrella organization of Amity Institutions), New Delhi, for the kind support 
and constant encouragement received. Special thanks are due to my esteemed 
friend and well-wisher Professor Dr. Sunil Saran, Director General, Amity In- 
stitute of Biotechnology and Adviser to Founder President, Amity Universe, 
all faculty colleagues Drs. Amit C. Kharkwal, Harsha Kharkwal, Shwet Kamal, 
Neeraj Verma, Atimanav Gaur and Debkumari Sharma and my Ph.D. students 
Ms. Aparajita Das, Mr. Ram Prasad, Ms. Manisha Sharma, Ms. Sreelekha Chat- 
terjee, Ms. Swati Tripathi, Mr. Vipin Mohan Dan and Ms. Geetanjali Chauhan. 
The technical support received from Mr. Anil Chandra Bahukhandi is highly 

New Delhi, India 
Jena, Germany 
March 2007 

Ajit Varma 
Ralf Oelmuller 

There is no doubt that biotechnology is one of the leading disciplines in mod- 
ern biology. Concerning its ever-growing impact on the development of new 
products, its importance cannot be overestimated; in terms of generating new 
jobs and industries it is certainly that section of biology which is responsible for 
the largest financial volume and the highest degree of application of biological 
knowledge. Interestingly, biotechnology is also the most interdisciplinary sci- 
ence as it uses efficiently the various biological disciplines which were often sep- 
arated in the past and which even kept their own characteristics at the expense 
of neighboring disciplines. In biotechnology the product counts more than the 
origin, and the frontiers between animal, plant and bacterial cells are of minor 
importance. Today, the central role of the new genes dominates a good part of 
biotechnology; it creates new products; however, the cellular environment must 
obey the laws of efficiency, practicability and production costs. 

For the above reasons it is important to assemble the ever-improving meth- 
ods of modern biotechnology in a book under these new guidelines, i.e. practi- 
cal aspects and immediate use in the laboratory and beyond. These methods 
involve all the essential methods of molecular biology, immunology, microbiol- 
ogy and structural biology; the complexity of the systems involved ranges from 
individual molecules to the eukaryotic organisms themselves, with a focus on 
bacteria, fungi and higher plants. As it is extremely difficult to cover even the 
most important state-of-the-art methods from the whole field, a comprehen- 
sive book with selected authors and methods such as this is extremely useful: it 
encourages students to look at biology in a different focus, assembling methods 
with a clear aim at a product, and it tells the experienced researcher about the 
leading laboratories and the most promising strategies. 

The 26 chapters of this book are indeed an excellent and outstanding contri- 
bution towards this end. 

Mattthias Rogner 

Ruhr Universitat Bochum, Germany 

Govindjee University of Illinois at Urban a -Champaign, USA 

1 Detection and Diversity of Fungi from Environmental Samples: 

Traditional Versus Molecular Approaches 1 

R. Jeewon and K.D. Hyde 

1.1 Introduction 1 

1.2 Microscopy and Culture-Based Methods 2 

1.3 Molecular-Based Methods 4 

1.4 The Nuclear-Encoded Ribosomal DNA Gene: 

Phylogenetic and Systematic Value 5 

1.5 Denaturing Gradient Gel Electrophoresis: 

Applicability, Usefulness and Bias 7 

1.6 Conclusions and Future Directions 11 

2 Functional Genomic Approaches for Mycorrhizal Research 17 

A. K. Pandey, H. White, and G.K. Podila 

2.1 Introduction 17 

2.2 Yeast Two Hybrid: An Approach 

for Understanding Signaling Pathways 18 

2.3 Agrobacterium -Mediated Transformation in Laccaria bicolor ... 22 

2.4 Materials and Methods 24 

2.4.1 Interaction Studies of Laccaria bicolor with Aspen 

(Populus tremuloides) Seedlings 24 

2.4.2 Yeast Two-Hybrid Protocol 26 

2.4.3 Agrobacterium -Mediated Transformation in Laccaria 

bicolor 28 

3 Automated Fluoroscence Sequencing and Troubleshooting 35 

S. Gochhaity D. Malhotra, E. Rai, and R.N.K. Bamezai 

3.1 Introduction 35 

3.2 Evolution of the Method 36 

3.2.1 Manual Sequencing 36 

3.2.2 Automated Sequencing 37 

3.2.3 Pyrosequencing 39 

3.3 Methods 39 

3.3.1 Template Preparation 39 

3.3.2. Reaction Setup (BigDye Terminator Cycle Sequencing) 40 

3.3.3 Performing Cycle Sequencing 41 

3.3.4 Preparing Extension Products for Electrophoresis 42 

3.4 Trouble Shooting 43 

3.4.1 Problem: Flat Line or "Dead On Analysis" 43 

3.4.2 Problem: Noisy Data (Background) 45 

3.4.3 Problem: Reading Near the Primer 46 

3.4.4 Problem: Strong Terminator Peaks 46 

3.4.5 Problem: Low Intensity of Shorter Products 48 

3.4.6 Problem: Longer Fragments Missing 49 

3.4.7 Problem: Presence of Spikes 49 

3.4.8 Problem: Weaker Signals 49 

References 50 

4 mRNA Quantitation Using Real Time PCR 53 

S. Gochhait, S.I. Bukhari, and R.N. K. Bamezai 

4.1 Introduction 53 

4.2 Methods 54 

4.2.1 Chemistry and Primer/Probe Design 54 

4.2.2 RNA Isolation from the Sample 57 

4.2.3 Reverse Transcription 58 

4.2.4 Real Time PCR Set Up 59 

4.2.5 Instrumentation 61 

4.2.6 Data Analysis 67 

4.3 Notes 68 

5 Laboratory Practice for the Production of Polyclonal 

and Monoclonal Antibodies 73 

S. Khurana, S. Bhaskar, and A. Mukhopadhyay 

5.1 Introduction 73 

5.2 Production of Polyclonal Antibodies 74 

5.2.1 Choice of Animal and Method of Immunization 74 

5.2.2 Preparation for Immunization 75 

5.2.3 Production of Polyclonal Antibodies 76 

5.2.4 Materials and Equipment 77 

5.3 Production of Monoclonal Antibodies 77 

5.3.1 Immunization of Mice or Rats 77 

5.3.2 Myeloma Cell Culture 78 

5.3.3 Setup for Fusion of Myeloma with Spleen Cells 79 

5.3.4 Selection and Cloning of Hybridoma 79 

5.3.5 Production of Monoclonal Antibodies 80 

5.3.6 Materials and Equipment 81 

5.4 Purification of Antibody 82 

5.4.1 Purification of IgG by Precipitation with Ammonium 

Sulfate 83 

5.4.2 Purification of IgG by DEAE-Sepharose 

Chromatography 83 

5.4.3 Purification of IgG Using Immobilized Protein A 84 

5.5 Analysis of Purity of IgG by Electrophoresis 86 

5.5.1 Materials and Equipment 88 

5.6 Enzyme-Linked Immunosorbent Assay 88 

5.6.1 Materials and Equipment 90 

5.7 Conclusion 90 

References 90 

6 Modern Techniques for Analyzing Immunological Responses 93 

Satish Khurana, Sangeeta Bhaskar, and Asok Mukhopdhyay 

6.1 Introduction 93 

6.2 Type of Immune Responses 93 

6.2.1 Innate Immune Response 94 

6.2.2 Adaptive Immune Response 94 

6.3 Adaptive Immune System 94 

6.3.1 Humoral Immune System 95 

6.3.2 Cellular Immune System 96 

6.4 Different Assay Systems to Study the Adaptive Immune 

Response 96 

6.4.1 Mixed Lymphocyte Proliferation Assays 96 

6.4.2 Detection of Type of T Helper Responses (Thl/Th2) . . 98 

6.4.3 Cytotoxic T Lymphocyte Activity 99 

6.5 Flow Cytometric Analysis of Immune Cells 102 

6.5.1 Materials and Equipment 105 

6.6 Magnetic Activated Cell Sorting 105 

6.6.1 Materials and Equipment 107 

6.7 Isolation of Mononuclear Cells from Peripheral Blood 107 

6.7.1 Materials and Equipment 108 

6.8 Conclusions 108 

7 Transcriptome Analysis 

S.K. YadaVy S.L. Singla-Pareek, and A. Pareek 

7.1 Introduction Ill 

7.2 RNA Preparation 113 

7.3 Northern Analysis 113 

7.3.1 Principle 113 

7.3.2 Procedure 114 

7.3.3 Applications 116 

7.4 In Situ Hybridization 116 

7.4.1 Principle 116 

7.4.2 Procedure 117 

7.4.3 Applications 119 

7.5 Dot Blot and Slot Blot 120 

7.5.1 Principle 120 

7.5.2 Procedure 120 

7.5.3 Applications 123 

7.6 Reverse Transcriptase-Polymerase Chain Reaction 123 

7.6.1 Principle 123 

7.6.2 Procedure 124 

7.6.3 Application of RT-PCR 125 

7.7 DNA Microarray 126 

7.7.1 Principle 126 

7.7.2 Procedure 127 

7.7.3 Applications 129 

7.8 Conclusions 129 

8 RNAi Technology: a Tool for Functional Validation of Novel Genes 133 

R. Karan, S. Kumar i, S.K. Yadav, and A. Pareek 

8.1 Introduction 133 

8.2 Machinery Involved in RNAi 134 

8.2.1 Inducer 135 

8.2.2 Dicer 135 

8.2.3 RNA-Dependent RNA Polymerase 135 

8.2.4 RNA-Induced Silencing Complex 135 

8.2.5 miRNA and siRNA 136 

8.3 RNAi as a Tool of Functional Genomics 136 

8.3.1 Production of dsRNA 137 

8.3.2 Constitutive and Inducible RNAi 138 

8.3.3 Antisense RNA and RNAi 140 

8.4 Potential Areas of Application 140 

8.5 Conclusions 142 

9 Molecular Matchmaking: Techniques for Biomolecular 

Interactions 145 

R. Oberoi, P. Kumar y and S.K. Lai 

9.1 Introduction 145 

9.2 Tools for the Study of Protein-Protein Interactions 145 

9.2.1 The Two-Hybrid System 147 

9.2.2 The Split-Ubiquitin System 148 

9.2.3 Reverse Two-Hybrid System 148 

9.2.4 Sos Recruitment System 

(Cyto Trap Yeast Two-Hybrid System) 148 

9.2.5 Yeast One-Hybrid System 149 

9.2.6 Double Interaction Screen 149 

9.2.7 Yeast Three-Hybrid or Tri-Hybrid System 150 

9.3 Procedure 150 

9.3.1 Reagents, Materials, and Equipment 151 

9.3.2 Notes and Points to Watch 152 

10 Environmental Proteomics: Extraction and Identification 

of Protein in Soil 155 

Z. Solaiman, M. A. Kashem and I. Matsumoto 

10.1 Introduction 155 

10.2 Sample Preparations 156 

10.3 Protocols for Protein Extraction from Soil 157 

10.3.1 Extraction of Extracellular Protein 157 

10.3.2 Extraction of Whole-Cell Protein 157 

10.4 Protein Loading 158 

10.5 Protein Expression Analyses 158 

10.5.1 SDS-PAGE 158 

10.5.2 Two-Dimension SDS-PAGE Analysis 158 

10.6. Gel Staining 161 

10.6.1 Coomassie Brilliant Blue Staining Protocol 

(For Mini Gels) 162 

10.6.2 Silver Staining Protocol 162 

10.7 Image Analysis 163 

10.8 Spot Cut 163 

10.9 Protein Digestion 163 

10.10 Mass Spectrometry Analysis 164 

10.1 1 Spectral Analysis 164 

10.12 N-Terminal Amino Acid Sequencing 165 

10.13 Conclusions 165 

1 1 DGGE and RISA Protocols for Microbial Community Analysis 

in Soil 167 

Z. Solaiman and P. Marschner 

11.1 Introduction 167 

11.2 Soil DNA Extraction 168 

11.2.1 Equipment 168 

11.2.2 Chemicals 168 

11.2.3 DNA Extraction Protocol 168 

11.3 Polymerase Chain Reaction Protocol for DGGE 170 

11.3.1 First Round PCR 170 

11.3.2 GC Clamp 16S PCR (Second Round PCR) 171 

11.4 DGGE Techniques 172 

11.4.1 Equipment 172 

1 1 .4.2 Chemicals 1 73 

1 1.4.3 Assembling the Gel Chamber 173 

11.4.4 Casting the Gel 174 

11.4.5 Loading of the Samples 175 

11.4.6 Staining and Imaging of the Gels 175 

1 1.5 Ribosomal Intergenic Spacer Analysis 175 

11.5.1 Equipment 176 

1 1 .5.2 Chemicals 1 76 

11.5.3 PCR Protocol 176 

11.5.4 Gel Preparation and Loading 177 

11.5.5 Gel Running 178 

11.5.6 Staining and Imaging of the Gels 178 

11.6 Data Analysis 178 

11.7 Conclusions 1 79 

12 Soil Microbial Community Structureand Function Assessed 

by FAME, PLFA and DGGE - Advantages and Limitations 181 

P. Marschner 

12.1 Introduction 

12.2 Microbial Community Structure Based on Fatty Acid Patterns 182 

12.2.1 FAME Extraction and Data Analysis 183 

12.2.2 PLFA Analysis 185 

12.2.3 Advantages and Limitations of Fatty Acid Patterns 188 

12.3 Denaturing Gradient Gel Electrophoresis 189 

12.3.1 DNA Extraction from Soil 189 

12.3.2 Polymerase Chain Reaction 190 

12.3.3 DGGE Procedures 192 

12.4 Conclusions 

13 Measurement of Microbial Biomass and Activity in Soil 201 

Z. Solaiman 

13.1 Introduction 201 

13.2 Protocols for Microbial Biomass Determination 202 

13.2.1 Chloroform Fumigation-Extraction Method 

for Microbial Biomass C and N 202 

13.2.2 Hexanol Extraction Method for Microbial P 205 

13.3 Protocol for Total Microbial Activity Determination 207 

13.3.1 Equipment 207 

13.3.2 Reagents 207 

13.3.3 Protocol for Extraction 208 

13.4 Protocol for Soil Dehydrogenase Enzyme Analysis 208 

13.4.1 Equipment 209 

13.4.2 Reagents 209 

13.4.3 Protocol for Extraction 209 

13.5 Conclusions 209 

References 210 

14 Immuno-Technology for the Localization of Acid Phosphatase 
Using Native Gel Bands in Piriformospora indica and Other Soil 

Microorganisms 213 

R. Mallciy U. Pokharel, R. Prasad, R. Oelmuller, and A. Varma 

14.1 Introduction 213 

14.1.1 Taxonomic Status 213 

14.1.2 Phosphatases 214 

14.2 Immunotechnology for the Detection and Localization 

of Acid Phosphatase in P. indica 216 

14.2.1 Extraction of Protein and Enzyme Assay 216 

14.2.2 Purification of Protein by Column Chromatography . . 217 

14.2.3 Purification of Protein by Ion Exchange 

Chromatography 217 

14.2.4 Native Polyacrylamide Gel Electrophoresis 219 

14.2.5 Detection of Enzyme in Native PAGE 220 

14.2.6 Isolation of Acid Phosphatase for Raising Antibody . . . 222 

14.2.7 Production of Antibodies using Acid Phosphatase 

in Native Gel 222 

14.2.8 Antiserum Preparation 224 

14.2.9 Purification of Immunoglobulin from Serum 225 

14.2.10 Western Blot 226 

14.2.1 1 Immuno-Fluorescence 228 

14.2.12 Localization of ACPase by Immunogold Technique . . . 228 

14.3 Troubleshooting 232 

14.4 Conclusions 232 

15 Use of Short Oligonucleotide Primers in Random Amplified 

Polymorphic DNA Techniques for Species Identification 237 

R. Malla and A. Varma 

15.1 Introduction 237 

15.2 Polymorphism between Piriformospora indica and Sebacina 

vermifera. Members of the Order Sebacinales 239 

15.3 General Protocol for RAPD Technique 

to Show Polymorphism 241 

15.3.1 Experimental Procedures 242 

15.4 Troubleshooting 244 

15.5 Conclusions 244 

16 Co- Cultivation with Sebacinales 247 

A.C. Kharkwal R. Prasad, H. Kharkwal A. Das, 

K. Bhatnagar, I. Sherameti, R. Oelmuller, and A. Varma 

16.1 Introduction 247 

16.2 Sebacinaceae - Novel Fungi 248 

16.3 Host Spectrum 249 

16.4 Functions of the Sebacinaceae 251 

16.5 Eco-Functional Identity 252 

16.6 Axenic Co -Cultivation of Sebacinaceae 254 

16.6.1 Procedure 254 

16.6.2 Protocol 256 

16.7 Media Compositions 256 

16.8 Seed Surface Sterilization and Germination 261 

16.8.1 Protocol for Seed Surface Sterilization 262 

16.8.2 Inoculum Placement in the Pots 262 

16.8.3 Results 262 

16.9 Comparative Study on Plant Growth with Treated 

Endosymbionts 264 

16.10 In Vivo Co -Cultivation of Sebacinales 264 

16.1 1 Conclusions 266 

References 267 

17 Quantitative Histochemistry: a Forgotten Tool 

with New Applications 271 

R. Hampp and S. Haag 

17.1 Introduction 271 

17.2 Sample Preparation and Handling 272 

17.3 Microphotometry 274 

17.4 Biochemical Analysis: Real Time Microassays 276 

17.5 Spatial Resolution of Basic Steps 

of Fungal Trehalose Metabolism in Symbiosis 277 

References 279 

18 Ion Cyclotron Resonance Fourier Transform Mass Spectrometry 
for Non-Targeted Metabolomics of Molecular Interactions 
in the Rhizosphere 281 

R Schmitt-Kopplin, N. Hertkorn, M. Frommberger, 
M. LuciOy M. Englmann, A. Fekete, and I. Gebefugi 

18.1 Introduction 281 

18.2 The Chemical Biology Approach 282 

18.3 Complementary Analytical Approaches 283 

18.3.1 Targeted Analysis 284 

18.3.2 Metabolite Profiling 285 

18.3.3 Non-Targeted Analysis 285 

18.4 Resolving Structural Information from Molecular Complexity 

with ICR-FT/MS 286 

18.4.1 Top-Down Approach: From ICR-FT/MS-Profiling 

Analysis to Structural Hypothesis 288 

18.4.2 Complementary Analytical Tools 290 

18.4.3 Bottom-Up Approach: From Hypothesis-Driven 

Experiments Upwards to ICR-FT/MS 290 

18.5 Conclusion 292 

19 Application of Terminal-Restriction Fragment Length 
Polymorphism for Molecular Analysis of Soil Bacterial 

Communities 295 

A. Mengoni, E. Giuntini, and M. Bazzicalupo 

19.1 Introduction 295 

19.2 A General Protocol for Taxonomic T-RFLP Profiling of Soil 

Bacterial Communities 297 

19.2.1 Materials 297 

19.2.2 Experimental Procedure 298 

19.2.3 Troubleshooting 299 

19.3 Standardization of T-RFLP Profiles 299 

19.4 Other Applications of T-RFLP to Soil Bacterial Communities 301 

19.5 Conclusions 302 

20 Molecular Symbiotic Analysis Between Arabiopsis thaliana 

and Piriformospora indica 307 

B. Shahollari, K. Bhatnagar, I. Sherameti, A. Varma, and R. Oelmuller 

20.1 Introduction 307 

20.2 Beneficial Interaction Between Plants and Fungi: 

Piriformospora indica and Arabidopsis thaliana 

as a Model System 308 

20.3 Co -Cultivation of P. indica and Arabidopsis under Standardized 

Growth Conditions 309 

20.4 Map-Based Cloning of a Mutated Gene 312 

20.5 Rapid DNA Extraction 313 

20.6 Confirmation of a Mutated Phenotype of an EMS Mutant 

by the Analysis of an Independent T-DNA Insertion Line 313 

20.7 Differntial Display to Identify Genes which are Regulated 

in Response to P. indica 314 

20.8 Activation Tagged Lines 315 

20.9 Identification of Biochemical Pathways 

in A. thaliana which are Regulated by P. indica 317 

References 317 

21 Biophysical Phenomics Reveals Functional Building Blocks 
of Plants Systems Biology: a Case Study for the Evaluation 
of the Impact of Mycorrhization with Piriformospora indica 319 

R.J. Strasser, M. Tsimilli-Michael, D. Dangre, and M. Rai 

21.1 Introduction 319 

21.2 Biophysical Phenomics of the Fast Fluorescence Rise O-J-I-P 320 

21.2.1 The Energy Cascade in the Photosynthetic Apparatus 320 

21.2.2 Microstates - Functional Building Blocks 

of Photosynthesis 320 

21.2.3 Measuring Fluorescence Transients with PEA, 

Handy-PEA and FIM- Fluorimeters 322 

21.2.4 How Fluorescence Kinetics Provide an Insight 

to the Microstates - Functional Blocks of PSII 323 

21.3 Case Study 332 

21.3.1 Mycorrhization and the Advantages of Piriformospora 

indica, an Emerging Growth Booster 332 

21.3.2 Phenomics of the O-J-I-P Fluorescence Transient 

for the Study of Cadmium Stress on Chick Peas 
(Cicer arietinum L. Chafa variety) With and Without 
Symbiosis With Glomus mosseae, G. caledonium 

and Piriformospora indica 333 

21.3.3 Correlation of Physiological with Biophysical 

Parameters 337 

21.4 Conclusions 338 

References 338 

22 Analysis of the Plant Protective Potential of the Root Endophytic 

Fungus Piriformospora indica in Cereals 343 

F. Waller, B. Achatz, and K.-H. Kogel 

22.1 Introduction 343 

22.2 Plant Responses and Resistance to Pathogens 344 

22.2.1 Local Reactions 344 

22.2.2 Systemic Reactions and Resistance in Cereals 344 

22.2.3 Beneficial Microbial Endophytes Protecting Cereals 

from Pathogens 345 

22.3 Interaction of P. indica with Cereals 345 

22.3.1 P. indica Colonizes Root Cortical Cells in Barley 346 

22.3.2 P. indica Enhances Biomass and Yield in Barley 346 

22.4 Approaches to Study the Mechanism 

of P. indica-lnduced Pathogen Resistance 347 

22.4.1 P. indica Induces Disease Resistance Against Root 

Pathogens 347 

22.4.2 P. indica Induces Systemic Disease Resistance 348 

22.4.3 Assessment of the Antioxidant Capacity of J! indica- 

Infested Roots 350 

22.4.4 Gene Expression Induced by P. indica in Barley Leaves 351 
22.5 Conclusions 351 

23 Members of Sebacinales Confer Resistance Against Heavy Metal 

Stress in Plants 355 

N. Hahn y A. Varma, R. Oelmuller y and I. Sherameti 

23.1 Introduction 355 

23.2 Scientific Background 355 

23.3 Differential Display to Understand Cd 2+ Resistance 

Mediated by Endophytic Fungi 357 

23.4 Studies on Protein Level 357 

23.4.1 Two-Dimensional Gel Electrophoresis, 

Preparation of Proteins 359 

23.4.2 Mass Spectrometry Preparation of Samples 

by Tryptic Digestion 359 

References 360 

24 Screening of Plant Growth-Promoting Rhizobacteria 363 

C.S. Nautiyal and S.M. DasGupta 

24.1 Introduction 363 

24.2 Candidature for Being a Rhizobacteria 364 

24.3 Screening Methods 365 

24.3.1 Criteria for Screening 365 

24.3.2 Selection of Screening Methods 365 

24.3.3 Classic Methods 366 

24.3.4 Modern Methods 368 

24.3.5 Molecular Methods 370 

24.4 Metagenomics 371 

24.5 Tracking of GEMs 372 

24.6 Conclusions 372 

25 Research Methods in Arbuscular Mycorrhizal Fungi 377 

A. Gaur and A. Varma 

25.1 Introduction 377 

25.2 Assessment of AM Fungal Propagules in Soil 378 

25.2.1 Soil Sampling 378 

25.2.2 Spore Extraction 378 

25.2.3 Quantification of Spore Numbers 379 

25.2.4 Infectivity Assays 379 

25.2.5 Identification of AM Fungi 380 

25.2.6 Use of Fatty Acids for Identification of AM Fungi 381 

25.3 Quantification of AM Fungal Root Colonization in Root 382 

25.3.1 Clearing and Staining Roots 382 

25.3.2 Modifications of Staining Procedure 383 

25.3.3 Measurement of Root Colonization by AM Fungi 384 

25.4 Extraction and Quantification of Extra-Radical Mycelium 

of AM Fungi in Soils 384 

25.5 Assessment of Growth Response of Effective Isolates 385 

25.6 Inoculum Production of AM Fungi 386 

25.6.1 On-Farm Production of AM Fungi 386 

25.6.2 Traditional Culture Methods 387 

25.6.3 AM Fungal Culture Using Aeroponic and Hydroponic 

Culture 388 

25.6.4 Monoaxenic Culture of AM Fungi 389 

25.6.5 Storage of AM Fungal Inoculum 390 

25.7 Conclusions 390 

26 Field Trials of Bioinoculants 

J. Orta§ and A. Varma 

26.1 Introduction 397 

26.2 Effect of Mycorrhizal Infection on Nutrient Uptake 398 

26.3 Effect of Soil Fumigation and Mycorrhizal 

Inoculation on Plant Growth Under Field Conditions 399 

26.4 Effect of Mycorrhizal Inoculation on Plant Growth 

and Nutrient Uptake under Non-Sterile Field Conditions 403 

26.5 Soil and Crop Management System 408 

26.6 Inoculation Techniques 409 

26.7 Conclusion 411 

References 412 

Subject Index 415 

Achatz, Beate 

Institute of Phytopathology and Applied Zoology (IPAZ), Justus-Liebig- 

Universitat Giefien, Heinrich-Buff-Ring 26-32, D-35392 Giefien, Germany 

Institute for Vegetables and Ornamental Crops, D- 14979 Grofibeeren, 

Bamezai, R.N.K. 

National Centre of Applied Human Genetics, School of Life Sciences, Jawaharlal 

Nehru University (JNU), New Delhi- 1 10067, India 

Bazzicalupo, Marco 

Dipartimento di Biologia Animale e Genetica 'Leo Pardf, Via Romana 17, 

1-50125, Firenze, Italy 

Bhaskar, Sangeeta 

National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi-1 10067, 

Bhatnagar, Kamya 

Amity Institute of Microbial Sciences, Amity University Uttar Pradesh, Sector 

125, Noida, 201303, India 

Bukhari, S.I. 

National Centre of Applied Human Genetics, School of Life Sciences, Jawaharlal 

Nehru University (JNU), New Delhi-1 10067, India 

Dangre, Devanand 

Department of Biotechnology, SGB Amravati University, Amravati-444602, 

Maharashtra, India 

Das, Aparajita 

Amity Institute of Microbial Sciences, Amity University Uttar Pradesh, Sector 

125, Noida, 201303, India 

DasGupta, Sangeeta Mehta 

Amity Institute of Microbial Sciences, Amity University Uttar Pradesh, Sector 

125, Noida, 201303, India 

Englmann, M. 

GSF - Research Center for Environment and Health, Institute of Ecological 
Chemistry, Molecular BioGeoanalysis / BioGeomics, Ingolstadter Landstrafie 1, 
D -85764 Neuherberg, Germany 

Fekete, A. 

GSF - Research Center for Environment and Health, Institute of Ecological 
Chemistry, Molecular BioGeoanalysis / BioGeomics, Ingolstadter Landstrafie 1, 
D -85764 Neuherberg, Germany 

Frommberger, M. 

GSF - Research Center for Environment and Health, Institute of Ecological 
Chemistry, Molecular BioGeoanalysis / BioGeomics, Ingolstadter Landstrafie 1, 
D -85764 Neuherberg, Germany 

Gaur, A. 

Amity Institute of Microbial Sciences, Amity University Uttar Pradesh, Sector 

125, Noida, 201303, India 

Gebefugi, I. 

GSF - Research Center for Environment and Health, Institute of Ecological 
Chemistry, Molecular BioGeoanalysis / BioGeomics, Ingolstadter Landstrafie 1, 
D -85764 Neuherberg, Germany 

Giuntini, E. 

Dipartimento di Biologia Animale e Genetica 'Leo Pardf, Via Romana 17, 

1-50125, Firenze, Italy 

Gochhait, S. 

National Centre of Applied Human Genetics, School of Life Sciences, Jawaharlal 

Nehru University (JNU), New Delhi-1 10067, India 

Haag, S. 

University of Tubingen, Physiological Ecology of Plants, Auf der Morgenstelle 1, 

72076 Tubingen, Germany 

Hahn, Nadin 

Institute of General Botany, Department of Environmental Sciences, University 

of Jena, Dornburger Strafie 159, D-07743 Jena, Germany 

Hampp, Rudiger 

University of Tubingen, Physiological Ecology of Plants, Auf der Morgenstelle 1, 

72076 Tubingen, Germany 

Hertkorn, N. 

GSF - Research Center for Environment and Health, Institute of Ecological 
Chemistry, Molecular BioGeoanalysis / BioGeomics, Ingolstadter Landstrafie 1, 
D -85764 Neuherberg, Germany 

Hyde, K. D. 

Department of Ecology and Biodiversity, University of Hong Kong, Pok Fu Lam 

Road, Hong Kong 

Jeewon, R. 

Department of Ecology and Biodiversity, University of Hong Kong, Pok Fu Lam 

Road, Hong Kong 

Karan, Ratna 

School of Life Sciences, Jawaharlal Nehru University, New Delhi, India 

Kashem, Abul 

Proteomics Laboratory of Pathology, School of Medical Science, Blackburn 

Building (D06), University of Sydney, NSW 2006, Australia 

Kharkwal, Amit C. 

Amity Institute of Microbial Sciences, Amity University Uttar Pradesh, Sector 

125, Noida, 201303, India 

Kharkwal, Harsha 

Amity Institute of Microbial Sciences, Amity University Uttar Pradesh, Sector 

125, Noida, 201303, India 

Khurana, Satish 

National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi-1 10067, 

Kogel, Karl-Heinz 

Institute of Phytopathology and Applied Zoology (IPAZ), Justus-Liebig- 

Universitat Giefien, Heinrich-Buff-Ring 26-32, D -35392 Giefien, Germany 

Kumar, P. 

Virology Group, International Centre for Genetic Engineering & Biotechnology 

(ICGEB), New Delhi, India 

Kumari, Sumita 

School of Life Sciences, Jawaharlal Nehru University, New Delhi, India 

Lai, S. K. 

Virology Group, International Centre for Genetic Engineering & Biotechnology 

(ICGEB), New Delhi, India 

Lucio, M. 

GSF - Research Center for Environment and Health, Institute of Ecological 
Chemistry, Molecular BioGeoanalysis / BioGeomics, Ingolstadter Landstrafie 1, 
D -85764 Neuherberg, Germany 

Malhotra, D. 

National Centre of Applied Human Genetics, School of Life Sciences, Jawaharlal 

Nehru University (JNU), New Delhi- 1 10067, India 

Marschner, Petra 

School of Earth and Environmental Sciences, The University of Adelaide, DP 

636, SA 5005, Australia 

Mengoni, A. 

Dipartimento di Biologia Animale e Genetica 'Leo Pardf, Via Romana 17, 

1-50125, Firenze, Italy 

Mukhopadhyay, As ok 

National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi-1 10067, 

Nautiyal, C. Shekhar 

Plant-Microbe Interaction Laboratory, National Botanical Research Institute, 

Rana Pratap Marg, Lucknow, 226001 

Oberoi, R. 

Virology Group, International Centre for Genetic Engineering & Biotechnology 

(ICGEB), New Delhi, India 

OelmuHer, Ralf 

Institute of General Botany and Plant Physiology, University of Jena, Dornburger 

Strafie 159, D07743, Jena, Germany 

Ortas, Ibrahim 

University of Qukurova, Faculty of Agriculture, Department of Soil Science, 

01330 Balcali, Adana, Turkey 

Pandey, A. 

Department of Biological Sciences, The University of Alabama in Huntsville, 

Huntsville, AL 35899, USA 

Pareek, Ashwani 

Stress Physiology and Molecular Biology Laboratory, School of Life Science, 

Jawaharlal Nehru University, Aruna Asaf Ali Marg, New Delhi- 110067, India 

Podila, G. K. 

Department of Biological Sciences, The University of Alabama in Huntsville, 

Huntsville, AL 35899, USA 

Pokharel, Utprekshya 

Department of Microbiology, Punjab University, Chandigarh, India 

Prasad, Ram 

Amity Institute of Microbial Sciences, Amity University Uttar Pradesh, Sector 

125, Noida, 201303, India 

Rai, E. 

National Centre of Applied Human Genetics, School of Life Sciences, Jawaharlal 

Nehru University (JNU), New Delhi- 1 10067, India 

Rai, Mahendra 

Department of Biotechnology, SGB Amravati University, Amravati-444602, 

Maharashtra, India 

Rajani Malla 

Department of Microbiology, Tri-Chandra Campus, Tribhuvan University, 

Kathmandu, Nepal 

Schmitt-Kopplin, Philippe 

GSF - Research Center for Environment and Health, Institute of Ecological 
Chemistry, Molecular BioGeoanalysis / BioGeomics, Ingolstadter Landstrafie 1, 
D -85764 Neuherberg, Germany 

Shahollari, Bationa 

Institute of General Botany and Plant Physiology, University of Jena, Dornburger 

Strafie 159, D -07743 Jena, Germany 

Sherameti, Irena 

Institute of General Botany and Plant Physiology, University of Jena, Dornburger 

Strafie 159, D -07743 Jena, Germany 

Singla-Pareek, Sneh L. 

Plant Molecular Biology, International Centre for Genetic Engineering and 

Biotechnology, Aruna Asaf Ali Marg New Delhi-1 10067, India 

Solaiman, Zakaria 

School of Earth and Geographical Sciences, The University of Western Australia, 

Crawley, WA 6009, Australia 

Strasser, Reto J. 

Laboratory of Bioenergetics, University of Geneva, Chemin des Embrouchis 10, 

CH-1254 Jussy-Geneva, Switzerland 

Tsimilli-Michael, Merope 

Laboratory of Bioenergetics, University of Geneva, Chemin des Embrouchis 10, 

CH-1254 Jussy-Geneva, Switzerland 

Varma, Ajit 

Amity Institute of Microbial Sciences, Amity University Uttar Pradesh, Sector 

125, Noida, 201303, India 

Waller, Frank 

Institute of Phytopathology and Applied Zoology (IPAZ), Justus-Liebig- 

Universitat Giefien, Heinrich-Buff-Ring 26-32, D -35392 Giefien, Germany 

White, H. 

Department of Biological Sciences, The University of Alabama in Huntsville, 

Huntsville, AL 35899, USA 

Yadav, Sudesh Kumar 

Biotechnology Division, Institute of Himalayan Bioresource Technology, CSIR, 

Palampur- 176061 (HP), India 

Detection and Diversity of Fungi 
from Environmental Samples: 
Traditional Versus Molecular Approaches 

R. Jeewon and K.D. Hyde 

Microbial life within the soil ecosystem is a fascinating aspect of soil biology, 
and has recently caught the attention of microbiologists. Many fungi grow in the 
soil and some have evolved to thrive in harsh conditions, such as those found in 
acidic or alkaline soils. These microorganisms can be considered as "highly de- 
veloped" as they flourish and reproduce in these ecological niches and unusual 
habitats and have successfully made use of soil and its nutrients for their energy 
sources. Fungi are an important component of the soil microbiota, they medi- 
ate important ecological processes such as nutrient recycling, and they main- 
tain important symbiotic relationships with plants and bacteria (Garrett 1981; 
Parkinson 1983; Yu et al. 2005). Many fungi are pathogenic (e.g Jaworski et al. 
1978; Cahill and Mohr 2004) and some may be useful in bio -exploitation (e.g 
Vinokurova et al. 2003). The realms of soil mycota are possibly the largest on the 

A diverse range of fungi are present in soil ecosystems and include ascomyce- 
tes, basidiomycetes, some being ectomycorrhizal fungi, anamorphic fungi and 
arbuscular mycorrhizal fungi (AMF). At present, there is no clear morphologi- 
cal, phylogenetic or ecological definition of soil fungi. Any definitions based 
on these concepts are very difficult to implement because the soil ecosystem 
harbours a plethora of fungi with great morphological, genetic and functional 
diversity and lacks geographic boundaries. Perhaps the best definition of soil 
fungi should be encapsulated in the word itself (fungi from soil!). Most of our 
current knowledge of soil mycota is based on traditional systematics, which does 
not reflect any real sense of evolutionary relationships. The interaction between 

Department of Ecology and Biodiversity, University of Hong Kong, 

Pok Fu Lam Road, Hong Kong, email:; 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

R. Jeewon and K.D. Hyde 

these fungi with plant roots and other biotic or abiotic factors within the soil 
constitutes a challenge to soil microbiologists. Obviously there must have been a 
long evolutionary history of adaptation and competition that permitted fungi to 
evolve in diverse forms and interact with other organisms. 

In this chapter we explore the limits of conventional and molecular tech- 
niques used to assess and detect soil microfungal diversity and provide insights 
into their feasibility. In particular we address the problems associated with the 
dilution plating technique, importance of the rDNA gene in fungal systematics, 
the reliability of other molecular approaches (especially denaturing gradient gel 
electrophoresis; DGGE) and their drawbacks. 

Microscopy and Culture-Based Methods 

Traditional methods to assess fungal diversity in soil environment rely mainly 
on the dilution -plating technique (coupled with the use of selective media) and 
microscopy to identify sporulating fungal bodies. Davet and Rouxel (1997) have 
already detailed all the experimental procedures commonly used in the dilu- 
tion plate method and direct comparison. Both methods are direct isolation 
techniques; and the dilution -plating method involves a combination of gentle 
dispersion, soil dilution and serial dilution, small amounts of which are ulti- 
mately plated on artificial media and incubated. The direct comparison method 
involves sprinkling of a known amount of soil onto a medium, which is then in- 
cubated (Davet and Rouxel 1997). Both methods provide a reasonably sensitive 
recognition of soil fungi and have been widely used in diversity studies in dif- 
ferent habitats (e.g. Elmholt et al. 1999; Cho et al. 2001; Cabello and Arambarri 
2002). Cultural methods, coupled with morphological details from microscopy, 
are among the earliest techniques used and allow one to detect exactly which 
taxon is present (identification). They have also commonly been used because 
of their simplicity, low cost and the fact that they are easy to conduct. Williams 
et al. (1965) has already detailed the efficiency of the soil washing technique, 
its applicability and potential for studying soil microhabitats and these are not 
detailed here. While these methodologies are easy, fast and reliable in finding 
the dominant culturable fungal taxa, they have a number of limitations which 
impede a proper diversity assessment. 

Davet and Rouxel (1997) mentioned that the traditional methods outlined 
above tend to overestimate species that sporulate in soil, while those in mycelial 
state or those that have slow growth in culture are largely overlooked. In 
addition, most of these methods result in isolation of only the most common 
and abundant fungi (often referred to as "generalists"), such as the asexual 
ascomycetes Fusarium, Penicillium and Trichoderma and oomycetes (Pythium). 
These cultivated organisms are those that can utilise the energy source under 

1 Detection and Diversity of Fungi from Environmental Samples 3 

the physical and chemical limitations of the growth medium. The continuous 
isolation of similar fungi following these traditional approaches clearly indicates 
that many others do not respond readily to cultural techniques. Therefore, the 
diversity data cannot be considered as accurate (Bridge and Spooner 2003). 
Although these unculturable fungi play a vital role in the soil ecosystem, they 
were not previously thought to be central part of any biological processes in 
soil. Altered and optimised growth medium, coupled with 16S rRNA gene 
comparative analysis, has demonstrated that a larger proportion of uncultured 
bacteria (above the 5% level postulated) and belonging to novel bacterial lineages 
could be isolated and identified (Janssen et al. 2002). Similar strategies are 
required for fungi. However, there is insufficient knowledge on the nutritional 
and environmental demands of soil fungi and these present methodological 
drawbacks in providing a clear assessment of fungal communities associated 
with soil. 

Another major complication with cultural studies is that a large number of 
other fungi existing as mycelial (vegetative) propagules or dormant spores can 
be numerically dominant populations in their natural environment but never 
grow in culture. These organisms will escape normal isolation-based detection 
procedures and therefore provide bias data regarding fungal diversity. Even for 
fungi that sporulate and can be cultured, it is not always easy to correctly iden- 
tify them with certainty. Our knowledge regarding the taxonomy and classifica- 
tion of these fungi are still limited. In addition, there are being many species 
that appear to be similar under cultural conditions and exhibit similar morphol- 
ogy, but are in fact different species. It is thought that only a small fraction (0.1% 
to 10.0%) of microorganisms existing in the nature can be cultured artificially 
(e.g. Muyzer et al. 1993; Torsvik and 0vreas 2002). Hawskworth and Rossman 
(1997) suggested that commonly used methods have probably only recovered 
17% of known fungal population and the majority of them await discovery. 
Even if morphological assessment of some taxa is possible, nothing conclusive 
regarding the viability, percentage occurrence, physiologic and phylogenetic in- 
formation can be accrued. 

Processing of cultures can be time-consuming and laborious when a large 
number of isolates has to be handled. During these processes, the risk of cul- 
ture contamination is always high and in most cases the fast-growing fungi will 
overgrow others and occupy the whole medium (even when Rose Bengal solu- 
tion is used). Many fungi assume different life forms (e.g. existence as vegetative 
hyphae or dormant spores) depending upon environmental or seasonal factors. 
Therefore it is highly probably that many fungi are only either collected in forms 
that: (1) do not allow them grow in artificial media or (2) preclude their iden- 
tification via microscopy. Given that fungal diversity may be quite high in soil 
and each population or species may occupy a specific niche, there is no single 
method that is appropriate to target all of them efficiently. 

Garbeva et al. (2004) and Buckley and Schmidt (2002) have reviewed the ef- 
fects of factors, such as plant type, soil type, soil management regime, micro - 
environment and disturbance, on soil microbial diversity, from single soil ag- 

R. Jeewon and K.D. Hyde 

gregates to entire landscapes. These are not detailed here. Generally it appears 
that both cultural and direct morphological methods have specific bias, as data 
generated is largely dependent upon the methodologies involved. 

Molecular-Based Methods 

The drawbacks associated with culture-dependent methods for the detection and 
identification of fungi in soil samples prompted the development of alternative 
methods which largely circumvent cultivation of target organisms. Molecular 
techniques have been employed, basically involving the application of hybridi- 
sation probes, PCR amplification of rDNA genes and other DNA fingerprinting 
techniques. These include terminal restriction fragment length polymorphism 
(T-RFLP), amplified rDNA restriction analysis (ARDRA), amplified random 
intergeneric spacer analysis (ARISA), denaturing gradient gel electrophoresis 
(DGGE), temperature gradient gel electrophoresis (TGGE), oligonucleotide 
fingerprinting of rRNA genes or single-stranded conformation polymorphism 
(SSCP) and have been used frequently in combination with traditional tech- 
niques to analyse fungal community composition (e.g. Egger 1995; van Elsas et 
al. 2000; Lowell and Klein 2001; Maarit-Niemi et al. 2001; Ranjard et al. 2001; 
Kirk et al. 2004). Several freshwater fungi have successfully been identified with 
fluorescence in situ oligonucleotide hybridisation (FISH) (Baschien et al. 2001). 
Another important PCR-based fingerprinting technique recently applied to as- 
sess fungal diversity is oligonucleotide fingerprinting of ribosomal RNA genes 
(ORFG), a new method which sorts arrayed ribosomal RNA gene clones into 
taxonomic clusters through a series of hybridisation experiments (Valinsky et 
al. 2002). These DNA-based techniques can provide a comprehensive measure 
of the diversity and composition of fungal communities, since they survey both 
the cultured and often-predominant non-culturable members of a community 
(Muyzer et al. 1993; van Elsas et al. 2000; Borneman and Hartin 2000; Lande- 
weert et al. 2001; May et al. 2001; Kirk et al. 2004). 

The implications of PCR-based methodologies have altered our views about 
the way we used to think about soil fungal diversity. For instance, Baek and 
Kenerley (1998) assessed the feasibility of quantitative competitive PCR in the 
detection and quantification of a genetically modified strain of Trichoderma vi- 
xens. They found that the detection limit of PCR was 10-1000 times lower when 
compared with traditional dilution plating. By using a combination of culture- 
dependent and culture-independent approaches (PCR-RFLP), Viaud et al. 
(2000) found that the latter was an efficient molecular tool for ecological studies 
and for assessing unexplored fungal diversity. These methods have also been ex- 
tremely useful in assessing the diversity of fungi that are difficult to isolate from 
soil, such as basidiomycete and arbuscular mycorrhizal fungi (AMF: Bougoure 

1 Detection and Diversity of Fungi from Environmental Samples 5 

and Cairney 2005; Kouichi et al. 2005). Other methods relevant to these aspects 
are outlined by Akkermans et al. (1995). 

The Nuclear-Encoded Ribosomal DNA Gene: 
Phylogeneticand Systematic Value 

Morphological characters provide the basis of current fungal systematics. They 
provide a wealth of information to distinguish taxa and have been used exten- 
sively at different hierarchies. In some cases, however, morphological criteria 
present some problems and fail to resolve taxonomic relationships. This is true 
in cases where morphological characters are inadequate, convergent, reduced, 
missing or overlapping. As a consequence, many taxonomists have combined 
available morphological characters with biochemical or molecular characters to 
clarify taxonomic relationships, as well as to infer phylogenies among fungal 
species. Various molecular techniques that have been applied successfully in 
fungal systematics and the application of DNA sequencing coupled with phylo- 
genetic analysis have greatly expanded, owing to the ever-increasing amount of 
sequence data available from a myriad of organisms. Molecular characters offer 
considerable potential, as they not only close the gap between the traditional 
and molecular methods, but also may determine relationships between uncul- 
tured and cultured fungi. 

For several decades, the nuclear-encoded ribosomal DNA (rDNA) gene has 
been the gene of choice to assess phylogenetic relationships and resolve taxo- 
nomic questions at different taxonomic levels (Gouy and Li 1989; Bruns et al. 
1991; Spatafora 1995; Liew et al. 2000; Jeewon et al. 2002, 2003a, b, 2004; Duong 
et al. 2004; Cai et al. 2005). Genes of eukaryotic rDNA are organised in a clus- 
ter that includes a small subunit gene (18S), a large subunit gene (28S) and the 
5.8S gene that lies in between two internal transcribed spacers (ITS; White et 
al. 1990). The region that separates the cluster of three genes along the chromo- 
some is called the non-transcribed spacer (NTS) and prior to where the 18S 
gene is transcribed, there is another small spacer region called the externally 
transcribed spacer (ETS). Together the ETS and NTS regions comprise the in- 
tergeneric spacer region (IGS; Fig. 1.1). These components are repeated in a tan- 
dem array but they evolve as a single unit and vary in length around 3000-4500 
base pairs (Mitchell et al. 1995). 

The ribosomal DNA has attracted increased attention among fungal system- 
atists, especially those interested in applying DNA sequencing analysis to study 
taxonomic relationships and genetic variation in fungi. The most remarkable 
feature of the rDNA is the overall sequence homogeneity among repeat units 
of the gene family (Hillis and Dixon 1991, Dixon and Hillis 1993). This gene 
shares the same function in all organisms and evolves at approximately the same 

R. Jeewon and K.D. Hyde 

1 1 

1 1 

1 1 

«5 ! 

1 oo ■ 

1 fS 1 

* is 

o c^ ^ 

1) c3 U 

a g o 

O Oh 

8 ^ ^ 

u Ph O 

ti £ co 

■S3 S^ 

bo a) 5 

u P4 

^3 O 

o ^ 

x 8 

u _ ^ 

fin t3 y 

^ "53 ^ 
5/3 G N 

o G ^ 

Gh.G h3 
w rv 5 

£ o 

to - 

8 ON 

O ^ 

c3 -^ 

- 5 ^ 

co <u 

2 o 

■g § 

Ph Ctf 

^ a 

-J— » -i-H 

1 Detection and Diversity of Fungi from Environmental Samples 7 

rate. However, the three different regions (structural genes, transcribed spacers, 
NTS) evolve at different rates, thus yielding informative data to reconstruct the 
phylogeny at different taxonomic levels. The 18S rDNA (small subunit; SSU), 
which evolves relatively slowly and is quite conserved, has been used to provide 
insights into the phylogeny of distantly related organisms, particularly at the 
ordinal and family level. The 28S (large subunit; LSU) is moderately conserved 
but provides sufficient variation to study relationships at the generic as well as 
species level. The ITS and IGS regions evolve faster and are highly variable and 
therefore valuable for comparing fungal species at the intraspecific level. Se- 
quence comparisons of selected regions within the rDNA have been useful for 
inferring phylogenetic relationships among fungi for several reasons. Universal 
single primers that are complementary to several regions within this gene are 
ready available (Vilgalys and Hester 1990; White et al. 1990). The region is short 
and its multicopy nature makes it easy to amplify. It is easily accessible and a 
large number of sequences are available for comparison. It has a high nucleotide 
variability, which makes it feasible to estimate genetic distances as well as inves- 
tigating systematics. 

Denaturing Gradient Gel Electrophoresis: 
Applicability, Usefulness and Bias 

While rDNA has been the most widely used gene for systematics studies, DGGE 
has been the most useful genetic fingerprinting technique to investigate com- 
plex microbial communities from a diversity of environmental samples. Basi- 
cally this method involves separation of individual sequences (with different 
base composition and melting properties) from a mixture. DNA extracted from 
environmental samples is amplified with a primer pair (specific to the groups 
of organisms under investigation and one of them attached to a GC clamp) and 
then purified PCR samples are separated electrophoretically through a gradi- 
ent of increasing chemical gradient (urea: formamide). Based on the melting 
behaviour, different sequences migrate at different positions, producing differ- 
ent banding patterns where each presumably represents a microbial taxon. The 
bands can then be excised from the gel and processed (either by construction 
of clone libraries and screening clones, or reamplified and sequenced) to obtain 
phylogenetic sequence information on individual microbial members of the mi- 
crobial community. DGGE has been used to profile fungal microbial communi- 
ties from many diverse environments (Kowalchuk et al. 1997; Smit et al. 1999; 
Omar and Ampe 2000; Gurtner et al. 2001; May et al. 2001; Mohlenhoff et al. 
2001; Nikolcheva et al. 2003; Nikolcheva and Barlocher 2005). 

In view of the fact that so little is known about the distribution and abun- 
dance of fungi in soil environments, DGGE coupled with phylogenetics has 

R. Jeewon and K.D. Hyde 

been successfully applied to assess fungal diversity in soil samples and, in most 
cases, it has been reported that soil possibly consists of a much more diverse 
micromycota than that observed, van Elsas et al. (2000) assessed the efficiency 
of two DNA extraction protocols from soil microcosms, the applicability of the 
NS2f/Fung5r primer pair, and the persistence of Trichoderma harzianum and 
Arthrobotrys oligospora in response to petrol treatment. DGGE fingerprints of 
total DNA from tropical soil and rhizosphere revealed that there was a rela- 
tionship between fungal community composition and rhizosphere development 
(Gomes et al. 2003). In the same study, phylogenies revealed that fungal taxa 
from the order Pleosporales (Ascomycetes) and basidiomycetons yeast were the 
most dominant phylotypes. Fungal community diversity from organic soil was 
investigated by PCR-DGGE followed by sequence analyses of ITS fragments 
(Anderson et al. 2003a). DGGE profiles revealed a clear shift in fungal com- 
munity composition along a moorland pine forest environment gradient. In ad- 
dition, phylogenies indicated that the majority of phylotypes (sequence types) 
were ascomycetes, especially Helotiales, and that the fungal communities were 
different from those derived using cultural methods. 

DGGE is the preferred environmental fingerprinting approach as it: (1) enables 
large and multiple samples to be analysed simultaneously, (2) overcomes diver- 
sity bias from traditional approaches (e.g. cultural methods), (3) can successfully 
monitor community shifts and succession over time, (4) allows the profiling of 
communities under different environmental conditions (especially in degraded/ 
polluted ecosystems), (5) makes it possible to acquire taxonomic information via 
phylogenetic analyses, and (6) gives an indication about the possible biological 
role of specific microorganisms in the sample (e.g. those that can be involved in 
the decomposition of organic matter or degradation of pollutants). 

Nevertheless there are limitations. The lysis of cells to release DNA in the 
external environment is the most crucial step. Given that soil is a heterogeneous 
environment, there can be abundant fungi that are free-living and not localised 
and are therefore easily extracted. In contrast, those that are less abundant and 
localised in microhabitats (e.g. inside soil particles, in water-filled spaces) are 
difficult to extract (van Elsas and van Overbeck 1993). There is always a pos- 
sibility that fungi that do not release their DNA will not contribute to diversity 
or that vigorous extraction procedures can result in highly fragmented DNA, 
producing chimeric PCR products (Wintzingerode et al. 1997). In addition, dif- 
ferent fungal structures (spores, mycelia) have different lysing efficiency; and 
an inappropriate extraction method can potentially give a biased estimate of 
diversity (Prosser 2002). There are no specific protocols for soil fungi, although 
there has been considerable improvement in the procedures involved, for in- 
stance the addition of PVPP to precipitate PCR inhibitors (Wintzingerode et 
al. 1997; Prosser 2002; Anderson and Cairney 2004; Kirk et al. 2004). Caution 
is required because, in bacterial diversity studies, it has been shown that dif- 
ferent DNA protocols and purification methods yield different DGGE profiles 
(Maarit-Niemi et al. 2001). The efficiency of different DNA extraction protocols 

1 Detection and Diversity of Fungi from Environmental Samples 9 

and the effect of different soil types have partially been dealt with (Laurent et al. 
2001; Ranjard et al. 2001; Anderson and Cairney 2004). 

PCR is the basis of most molecular methods involved in diversity estimates. 
However, DNA from environmental samples contains PCR inhibitors and con- 
taminants that interfere with PCR reactions (e.g. humic acid from soil). In many 
cases, there can be differential amplification, loss of DNA following purification, 
production of PCR artefacts, and contamination (Wintzingerode et al. 1997). 
PCR amplification of chimeric sequences is not uncommon. Sequence analy- 
ses of these usually indicate that they are not phylogenetically related to other 
known fungi, as they occupy unique position in the phylogenetic tree. In these 
cases, one will erroneously assume that these sequences represent novel taxa 
that escape microscopic or cultural detection. Most of the gene regions targeted 
in community analyses are from the conserved 1 8S rDNA gene and are less than 
600 base pairs, so that a reasonable DGGE resolution can be achieved. This is, 
however, to the detriment of accurate systematics and phylogeny. In many cases, 
the primer pairs used are specific to a group of fungi, while some at the same 
time can amplify DNA from totally unrelated organisms. Our laboratory has 
undertaken diversity studies on leaves of Magnolia Liliifera (Duong et al. 2006) 
and pine needles using NS1 and GCfung primers as described by May et al. 
(2001). In both studies based on DGGE, we recovered only ascomycetous fungi, 
especially those from Dothideales, Helotiales, Hypocreales, Pleosporales, Rhys- 
timatales and Xylariales, but no basidiomycetous taxa. Anderson et al. (2003b) 
and Anderson and Cairney (2004) have already demonstrated the potential bias 
of rDNA in estimating fungal diversity in soil and aspects pertaining to primer 
design and these are not discussed here. 

Although DGGE is a promising tool, it can still underestimate fungal diver- 
sity (Nikolcheva et al. 2003, 2005). The number of bands depends on the resolu- 
tion of the gels; this takes time to optimise and is difficult to reproduce (Fromin 
et al. 2002). The quality of sequence data recovered can be highly variable due 
to contaminating background sequences. We have repeatedly encountered this 
phenomenon when sequencing purified PCR-DGGE bands. It is not necessarily 
true that one "phylotype" or "operational taxonomic unit" or "sequence type" 
generated from an environmental sample is representative of an individual or- 
ganism. As the amount of nucleic acid extracted does not necessarily reflect all 
the species/populations within one sample, interpretation of bands can be dif- 
ficult. Often, dominant bands might mask more than one species, resulting in 
an underestimation of diversity. Another ambiguity we have noticed with leaf 
and pine needle samples is that co-migrating bands (similar melting behaviour) 
can actually represent taxa that are phylogenetically unrelated. The reverse also 
holds true. This is not surprising as it has already been demonstrated in previ- 
ous studies that phylogenetically distant taxa can have co -migrating bands and 
that one band does not necessarily mean one unique phylotype (Rosado et al. 
1998; MacNaughton et al. 1999; Sekiguchi et al. 2001). Therefore careful inter- 
pretation is essential. 

R. Jeewon and K.D. Hyde 

Sequences obtained from DGGE bands are quite difficult to analyse as they 
are usually from different orders and classes. Our taxonomic knowledge is still 
poor and, phylogenetically, most of the sequence types do not fit clearly within 
any known family/genera or species, although their ordinal classification seems 
to be reliable. Definitive species identification is very difficult unless a large 
number of representatives are available from databases and a sufficiently vari- 
able gene region is analysed. Another important question is: which genes and 
what features of that genetic sequence are crucial, useful and reliable to identify 
uncultured fungi? Most of the available sequences and phylogenies are derived 
from the rDNA gene, but classification and taxonomic schemes based on this 
gene alone are inadequate, subject to debate and need to be re-evaluated. Al- 
though rDNA provides sufficient variability for evolutionary and phylogenetic 
inferences, should more genes be sampled? 

The degree of similarities/differences of sequence types obtained from en- 
vironmental samples also poses a problem. It is commonly assumed that, for 
bacteria, >97% sequence identity can be regarded as different species (Stacke- 
brandt and Goebel 1994). However, there is no report for such concepts in fun- 
gal taxonomy. Another important concern is that the number of novel phyloge- 
netic lineages and new phylotypes is on the rise. In a recent paper published in 
Science, a combination of microbiological and molecular techniques revealed 
three novel phylogenetic clades that constitute three major new groups of fungi 
(Schadt et al. 2003). As mentioned before, many sequence types cannot be con- 
fidently assigned to any particular genus or family and these have been referred 
to as novel taxa or lineages. Berney et al. (2004) analysed 484 environmental 18S 
rRNA gene sequences, including 81 new sequences, to test the potential techni- 
cal and analytical pitfalls and limitations of eukaryotic environmental DNA sur- 
veys. Based on phylogenetic analyses, they suggested that the number of novel 
higher-level taxa revealed by previously published environmental DNA surveys 
was overestimated possibly due to: (1) the presence of undetected chimeric se- 
quences, (2) the misplacement of several fast-evolving sequences, and (3) the 
incomplete sampling of described, but yet unsequenced eukaryotes. It is highly 
possible that a similar situation exist in fungal studies. 

In addition, a number of studies involving the use of DNA fingerprinting 
techniques did not address the evolutionary history and affinities of fungal taxa 
based on phylogenetic analyses. This is partly because DNA fingerprinting tech- 
niques do not provide any real quantitative data regarding community function; 
it is time-consuming and requires expertise. It is also far easier to generate a pu- 
tative uncultured sequence than to understand its biological significance from 
a practical standpoint. Most of the molecular techniques involved do not dis- 
criminate between active and inactive stages. This hampers a proper interpreta- 
tion of the genetic/phylogenetic diversity with respect to ecology and function. 
For instance, DGGE analyses from pine needles in our laboratory revealed sev- 
eral dominant phylotypes associated with decay stages, but it is still speculative 
which ones are actively involved in decomposition. 

1 Detection and Diversity of Fungi from Environmental Samples 11 

Conclusions and Future Directions 

Current knowledge pertaining to the diversity, detection and distribution of 
soil fungi and the dynamics of soil ecosystem is still rudimentary. Obviously 
improvement in traditional approaches combined with other biochemical/se- 
rological methods and incorporation of various molecular techniques (DNA- 
based) has provided new data on these aspects but, for a clearer picture and a 
better understanding, a combination of all approaches (polyphasic) is essential. 
There is a need to unravel the taxonomic diversity of speciose groups. Diversity 
of nematode-trapping fungi from soil (either terrestrial, estuarine or marine) is 
purely based on morphology and cultural studies and the most common species 
isolated are from Arthrobotrys, Dactylaria and Monacrosporium. To date, there 
are no reports on the feasibility of specific primers targeting other nematode- 
trapping fungi (most importantly those that are possibly unculturable). Given 
their relative pathological and biotechnological importance, molecular tools 
should be employed to assess their genotypic diversity in soil. Fungal diversity 
studies in soil have previously been carried out mainly in terrestrial habitats, es- 
pecially those around plant roots. Future studies should target different habitats 
such as freshwater, estuarine or marine environments. 

Our knowledge is extremely limited and we are a long way from realising the 
components of the soil mycota. 

Akkermans ADL, Elsas van JD, Bruijn de FJ (1995) Molecular microbial ecology manual. 
Kluwer, Dordrecht, pp 1-488 

Anderson IC, Cairney JWG (2004) Diversity and ecology of soil fungal communities: in- 
creased understanding through the application of molecular techniques. Environ Mi- 
crobiol 6:796-779 

Anderson IC, Campbell CD, Prosser JI (2003a) Potential bias of fungal 18S rDNA and inter- 
nal transcribed spacer polymerase chain reaction primers for estimating fungal biodi- 
versity in soil. Environ Microbiol 5:36-47 

Anderson IC, Campbell CD, Prosser JI (2003b) Diversity of fungi in organic soils under a 
moorland-Scots pine (Pinus sylvestris L) gradient. Environ Microbiol 5:1121-1132 

Baek JM, Kenerley CM (1998) Detection and enumeration of a genetically modified fungus 
in soil environments by quantitative competitive polymerase chain reaction. FEMS Mi- 
crobiol Ecol 25:419-428 

Baschien C, Manz W, Neu RN, Szewzyk U (2001) Fluorescence in situ hybridization of fresh- 
water fungi. Int Rev Hydrobiol 86:371-381 

Berney C, Fahrni J, Pawlowski J (2004) How many novel eukaryotic kingdoms? Pitfalls and 
limitations of environmental DNA surveys. BMC Biol 2:13 

Borneman J, Hartin RJ (2000) PCR primers that amplify fungal rRNA genes from environ- 
mental samples. Appl Environ Microbiol 66:4356-4360 

R. Jeewon and K.D. Hyde 

Bougoure DS, Cairney JWG (2005) Fungi associated with hair roots of Rhododendron lochiae 
(Ericaceae) in an Australian tropical cloud forest revealed by culturing and culture-inde- 
pendent molecular methods. Environ Microbiol 7:1743-1754 

Bridge P, Spooner B (2003) Soil fungi: diversity and detection. Plant Soil 232:147-154 

Bruns TD, White TJ, Taylor JW (1991) Fungal molecular systematics. Annu Rev Ecol Syst 

Buckley DH, Schmidt TM (2002) Exploring the diversity of soil - a microbial rain forest. In: 
Staley JT, Reysenbach Al (eds) Biodiversity of microbial life: foundation of Earths bio- 
sphere. Wiley, New York, pp 183-208 

Cabello M, Arambarri A (2002) Diversity in soil fungi from undisturbed and disturbed Celtis 
tola and Scutia buxifolia forests in the eastern Buenos Aires province. Argentina, Micro- 
biol Res 157:115-125 

Cahill D, Mohr P (2004) Plant-pathogen interactions (Plant biology 2004: abstracts of the 
annual meeting of the American Society of Plant Biologists). American Society of Plant 
Biologists, New York, p 1 34 

Cai L, Jeewon R, Hyde KD (2005) Phylogenetic evaluation and taxonomic revision of Schizo- 
thecium based on ribosomal DNA and protein coding genes. Fungal Divers 19:1-17 

Cho JH, Rupe JC, Cummings MS, Gubur EE (2001) Isolation and identification of F solani f 
sp From soil and modified Nash and Syders medium. Plant Dis 85:256-260 

Davet P, Rouxel F (1997) Detection et isolement des champignons du sol. INRA, Paris, p 203 

Dixon MT, Hillis DM (1993) Ribosomal RNA secondary structure: compensatory mutations 
and implications for phylogenetic analysis. Mol Biol Evol 10:256-267 

Duong LM, Lumyong S, Hyde KD, Jeewon R (2004) Emarcea castanopsicola gen. et sp. nov 
from Thailand, a new xylariaceous taxon based on morphology and DNA sequences. 
Stud Mycol 50:253-260 

Duong LM, Lumyong S, Jeewon R, Hyde KD (2006) DGGE coupled with ribosomal DNA 
phylogenies reveal uncharacterized fungal phylotypes on living leaves of Magnolia lili- 
ifera. Fungal Divers 23:121-138 

Egger KN (1995) Molecular analysis of ectomycorrhizal fungal communities. Can J Bot 

Elmholt S, Labouriau R, Hestbjerg H, Nielsen LM (1999) Detection and estimation of co- 
nidial abundance of Penicillium verrucosum in soil by dilution plating on a selective and 
diagnostic agar medium (DYSG). Mycol Res 103:887-895 

Elsas van JD, Overbeck van LS (1993) Bacterial responses to soil stimuli. In: Kjelleberg S (ed) 
Starvation in bacteria. Plenum, New York, pp 55-79 

Elsas van JD, Duarte GF, Keijzer-Wolters A, Smit E (2000) Analysis of the dynamics of fungal 
communities in soil via fungal- specific PCR of soil DNA followed by denaturing gradi- 
ent gel electrophoresis. J Microbiol Methods 43:133-151 

Fromin N, Hamelin J, Tarnawski S, Roesti D, Miserez KJ, Forestier N (2002) Statistical analy- 
sis of denaturing gel electrophoresis (DGGE) fingerprinting patterns. Environ Microbiol 

Garbeva P, Veen van JA, Elsas van JD (2004) Microbial diversity in soil: selection of microbial 
populations by plant and soil type and implications for disease suppressiveness. Annu 
Rev Phytopathol 42:243-270 

Garrett, SD (1981) Soil fungi and soil fertility: an introduction to soil mycology. Pergamon, 
Oxford, pp 141-145 

Gomes NCM, Fagbola O, Costa R, Rumjanek NG, Buchner A, Mendona-Hagler L, Smalla K 
(2003) Dynamics of fungal communities in bulk and maize rhizosphere soil in the trop- 
ics. Appl Environ Microbiol 69:3758-3766 

Gouy M, Li WH (1989) Molecular phylogeny of the kingdoms Animalia, Plantae and Fungi. 
Mol Biol Evol 6:109-122 

1 Detection and Diversity of Fungi from Environmental Samples 13 

Gurtner SC, Pinar G, Lubitz W, Rolleke S (2001) Analysis of fungal communities on historical 
church window glass by denaturing gradient gel electrophoresis and phylogenetic 18S 
rDNA sequence analysis. J Microbiol Methods 47:345-354 

Hawskworth DL, Rossman AY (1997) Where are all the undescribed fungi? Phytopathology 

Hillis DM, Dixon MT (1991) Ribosomal DNA: molecular evolution and phylogenetic infer- 
ence. Q Rev Biol 66:411-453 

Janssen PH, Yates PS, Grinton BE, Taylor PM, Sait M (2002) Improved culturability of soil 
bacteria and isolation in pure culture of novel members of the divisions Acidobacte- 
ria, Actinobacteria, Proteobacteria, and Verrucomicrobia. Appl Environ Microbiol 

Jaworski CA, McCarter SM, Johnson AW, Williamson RE (1978) Response of onions grown 
for transplants to soil fumigation. J Am Soc Hortic Sci 103:385-388 

Jeewon R, Liew ECY, Hyde KD (2002) Phylogenetic relationships of Pestalotiopsis and al- 
lied genera inferred from ribosomal DNA sequences and morphological characters. Mol 
Phylogenet Evol 25:378-392 

Jeewon R, Liew ECY, Simpson JA, Hodgkiss IJ, Hyde KD (2003a) Phylogenetic significance 
of morphological characters in the taxonomy of Pestalotiopsis species. Molecular Phylo- 
genet Evol 27:372-383 

Jeewon R, Liew ECY, Hyde KD (2003b) Molecular systematics of the Amphisphaeriaceae 
based on cladistic analyses of partial LSU rDNA sequences. Mycol Res 107:1392-1402 

Jeewon R, Liew ECY, Hyde KD (2004) Phylogenetic evaluation of species nomenclature of 
Pestalotiopsis in relation to host association. Fungal Divers 17:39-55 

Kirk JL, Beaudette LA, Hart M, Moutoglis P (2004) Methods of studying soil microbial diver- 
sity. J Microbiol Methods 58:169-188 

Kouichi S, Yoshihisa S, Masanori S, Kazuo S (2005) A new primer for discrimination of ar- 
buscular mycorrhizal fungi with polymerase chain reaction- denature gradient gel elec- 
trophoresis. Grassl Sci 51:179-181 

Kowalchuk GA, Gerards S, Woldendorp JW (1997) Detection and characterization of fungal 
infections of Ammophila arenaria (Marram grass) roots by denaturing gradient gel elec- 
trophoresis of specifically amplified 18s rDNA. Appl Environ Microbiol 63:3858-3865 

Landeweert R, Hoffland E, Finlay RD, Kuyper TW, Breemen van N (2001) Linking plants 
to rocks: ectomycorrhizal fungi mobilise nutrients from minerals. Trends Ecol Evol 

Laurent FM, Philippot L, Hallet S, Chaussod R, Germon JC, Soulas G, Catroux G (2001) 
DNA extraction from soils: old bias for new microbial diversity analysis methods. Appl 
Environ Microbiol 67:2354-2359 

Liew ECY, Aptroot A, Hyde KD (2000) Phylogenetic significance of the pseudoparaphyses in 
loculoascomycete taxonomy. Mol Phylogenet Evol 16:392-402 

Lowell JL, Klein DA (2001) Comparative single-strand conformation polymorphism (SSCP) 
and microscopy-based analysis of nitrogen cultivation interactive effects on the fungal 
community of a semiarid steppe soil. FEMS Microbiol Ecol 1239:1-8 

Maarit-Niemi R, Heiskanen I, Wallenius K, Lindstrom K (2001) Extraction and purification 
of DNA in rhizosphere soil samplesfor PCR-DGGE analysis of bacterial consortia. J Mi- 
crobiol Methods 45:155-165 

MacNaughton SJ, Stephen JR, Venosa AD, Davis GA, Chang YJ, White DC (1999) Microbial 
population changes during bioremediation of an experimental oil spill. Appl Environ 
Microbiol 65:3566-3574 

May LA, Smiley B, Schmidt MG (2001) Comparative denaturing gradient gel electrophore- 
sis analyses of fungal communities associated with whole plant corn silage. Can J Bot 

R. Jeewon and K.D. Hyde 

Mitchell JI, Roberts PJ, Moss ST (1995) Sequence or structure? A short review on the applica- 
tion of nucleic acid sequence information to fungal taxonomy. Mycologist 9:67-75 

Mohlenhoff P, Muller L, Gorbushina A A, Petersen K (2001) Molecular approach to the char- 
acterisation of fungal communities: methods for DNA extraction, PCR amplification 
and DGGE analysis of painted art objects. FEMS Microbiol Lett 195:169-173 

Muyzer G, Waal de EC, Uitterlinden AG (1993) Profiling of complex microbial populations 
by denaturing gradient gel electrophoresis analyses of polymerase chain reaction- ampli- 
fied genes coding for 16S rDNA. Appl Environ Microbiol 59:695-700 

Nikolcheva LG, Barlocher F (2005) Molecular approaches to estimate fungal diversity. II. De- 
naturing gradient gel electrophoresis (DGGE). In: Graca MAS, Barlocher F, Gessner MO 
(eds) Methods to study litter decomposition. Springer, Berlin Heidelberg New York, pp 

Nikolcheva LG, Cockshutt AM, Barlocher F (2003) Determining diversity of freshwater fungi 
on decaying leaves: comparison of traditional and molecular approaches. Appl Environ 
Microbiol 69:2548-2554 

Nikolcheva LG, Bourque T, Barlocher F (2005) Fungal diversity during initial stages of leaf 
decomposition in a stream. Mycol Res 109:246-253 

Omar B, Ampe NF (2000) Microbial community dynamics during production of the Mexi- 
can fermented maize dough pozol. Appl Environ Microbiol 66:3664-3673 

Parkinson D (1983) Functional relationships between soil organisms. Proc Int Colloq Soil 
Zool 8:153-165 

Prosser JI (2002) Molecular and functional diversity in soil microorganisms. Plant Sci 

Ranjard L, Poly F, Lata JC, Mougel C, Thioulouse J, Nazaret S (2001) Characterization of 
bacterial and fungal soil communities by automated ribosomal intergenic spacer anal- 
yses fingerprints: biological and methodological variability. Appl Environ Microbiol 

Rosado AS, Duarte GF, Seldin L, Elsas van JD (1998) Genetic diversity of nifH gene se- 
quences in Paenibacillus azotofixans strains and soil samples analyzed by denaturing 
gradient gel electrophoresis of PCR- amplified gene fragments. Appl Environ Microbiol 

Schadt CW, Martin AP, Lipson DA, Steven K (2003) Seasonal dynamics of previously un- 
known fungal lineages in Tundra soils. Science 301:1359-1361 

Sekiguchi H, Tomioka N, Nakahara T, Uchiyama H (2001) A single band does not always 
represent single bacterial strains in denaturing gradient gel electrophoresis. Biotechnol 
Lett 23:1205-1208 

Smit E, Leeflang P, Glandorf B, Elsas van JD, Wernars K (1999) Analyses of fungal diversity in 
the wheat rhizosphere by sequencing of cloned PCR- amplified genes encoding 18S rRNA 
and temperature gradient gel electrophoresis. Appl Environ Microbiol 65:2614-2621 

Spatafora JW (1995) Ascomal evolution of filamentous ascomycetes: evidence from molecu- 
lar data. Can J Bot 73:S811-S815 

Stackebrandt E, Goebel BM (1994) A place for DNA-DNA reassociation and 16S ribosomal- 
RNA sequence analyses in the present species definition in bacteriology. Int J Syst Bac- 
terid 44:846-849 

Torsvik V, 0vreas L (2002) Microbial diversity and function in soil: from genes to ecosystems. 
Curr Opin Microbiol 5:240-245 

Valinsky L, Vedova GD, Jiang T, Borneman J (2002) Oligonucleotide fingerprinting of 
rRNA genes for analyses of fungal community composition. Appl Environ Microbiol 

Viaud M, Pasquier A, Brygoo Y (2000) Diversity of soil fungi studied by PCR-RFLP of ITS. 
Mycol Res 104:1027-1032 

1 Detection and Diversity of Fungi from Environmental Samples 15 

Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically am- 
plified ribosomal DNA from several Cryptococcus species. J Bacteriol 172:4238-4246 

Vinokurova NG, Khmel'nitskaya II, Baskunov BP, Arinbasarov MU (2003) Occurrence of 
indole alkaloids among secondary metabolites of soil Aspergillus spp. Appl Biochem Mi- 
crobiol 39:192-196 

White TJ, Bruns TL, Lee S, Taylor JW (1990) Amplication and direct sequencing of fun- 
gal ribosomal RNA genes for phylogenetics. In: Innis M (ed) PCR protocols, a guide to 
methods and applications, Academic, San Diego, pp 315-322 

Williams ST, Parkinson D, Burges NB (1965) An examination of the soil washing technique 
by its application to several soils. Plant Soil 22:167-186 

Wintzingerode FV, Gobel UB, Stackebrandt E (1997) Determination of microbial diversity 
in environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiol Rev 

Yu X, Cheng J, Wong MH (2005) Earthworm- mycorrhiza interaction on Cd uptake and 
growth of ryegrass. Soil Biol Biochem 37:195-201 

Functional Genomic Approaches 
for Mycorrhizal Research 

A. K. Pandey, H. White, and G.K. Podila 

Mycorrhizal fungi are important and significant biological components of the 
rhizosphere. These fungi interact with the roots of more than 80% of land plants 
and form symbiotic associations called mycorrhizas or mycorrhizae (Smith and 
Read 1997). On the basis of the colonization pattern of host cells, two major 
types of mycorrhizas can be identified: ectomycorrhizas and arbuscular mycor- 
rhizas. In the ectomycorrhizas the fungus does not penetrate the host cells, but 
forms a sheath around the roots and only traverses the cortical layers of the 
roots in the intercellular spaces, forming an interface called the "Hartig Net". 
However, in endomycorrhizas the fungal hyphae penetrate cells and form intra- 
cellular structures like coils or arbuscules (Smith and Read 1997). Mycorrhizal 
fungi provide improved access to limited soil resources such as minerals and 
nitrogen to the host plant. In contrast, mycorrhizal fungi receive carbon com- 
pounds from host plants to sustain their metabolism and complete the life cycle 
and also receive protection from other microbes in the rhizosphere. 

While the ecology and physiology of mycorrhizal fungi and their uses is well 
studied, knowledge about cellular and molecular aspects leading to the growth 
and the development of a mycorrhizal fungi as well as the establishment of a 
functioning symbiosis is still limited (Harrison 1999; Martin et al. 2001; Po- 
dila et al. 2002; Duplessis et al. 2005; Wright et al. 2005). The development of 
molecular techniques and the recent progress made in the first sequencing of 
mycorrhizal genomes (Martin et al. 2004) has made it possible to begin to ask 
important biological questions on the development of symbiotic interactions 
and the formation of mycorrhizae. 

Department of Biological Sciences, The University of Alabama in Huntsville, 
Huntsville, AL 35899, USA, email: 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmuller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

A. Pandey, et al. 

An appropriate approach to the study of mycorrhizal fungi is to understand the 
molecular process leading to the host recognition, development and functioning 
of mycorrhizae through the analysis of expressed genes. With the advent of 
many high throughput techniques that have been successfully applied to the 
functional analysis of genes from many organisms, it is now possible to apply 
similar strategies to study the various aspects of the mycorrhizal symbiosis. In 
this chapter, we describe protocols applied to study of ectomycorrhizal symbiosis 
leading to: (1) Yeast two -hybrid methods to determine the interactions of 
signaling proteins and signaling cascades and (2) transformation system for gene 
replacement and functional genomic analysis of ectomycorrhizal symbiosis. 

Yeast Two Hybrid: An Approach 

for Understanding Signaling Pathways 

Ectomycorrhiza encompasses a series of complex and overlapping ontogenic 
process in symbionts, which includes the switching-off of fungal growth mode, 
initiation of lateral roots, aggregation of hyphae, arrest of cell division in en- 
sheathed roots, and radial elongation of epidermal cells (Feugey et al. 1999). 
Early events in the interactions are crucial and result in the activation of a cas- 
cade of molecular events in each partner. Understanding the process involved 
during the interaction of plant root with fungal mycelium might provide an in- 
sight into the highly complex developmental process of mycorrhiza formation. 
One of the key points is to study the early induction of signaling genes, which 
are activated when they perceive signals from each other, leading to their rec- 
ognition. This process further determines the symbiotic compatibility of fungus 
towards plant host. 

There have been considerable reports of signaling genes and gene response 
events between the two partners during ectomycorrhizal symbiosis (Barker et al. 
1998; Kim et al. 1998; Martin and Tagu 1999; Tagu et al. 2000; Martin et al. 2001; 
Sundaram et al. 2001). One of the ways to understand the signaling process is 
to study interactions between the early- induced signaling genes. Novel interact- 
ing genes coding for proteins can be screened using signaling genes as bait. For 
example, cloning and studying the regulation of G protein-coupled receptors 
(GPCRs) and RAS, which are early induced during the interaction phase, might 
help in providing some insight into ectomycorrhizal symbiosis. Utilizing yeast 
two hybrid in many other systems led to the identification of many genes cod- 
ing for interacting proteins (Fields and Song 1989; Chein et al. 1991; Bartel et 
al. 1993; Fields 1993; Bendixen et al. 1994; Fields and Strenglanz 1994; Hao et 
al. 1999) and such a technique has proven to be quite useful. In the yeast two- 
hybrid assay two fusion proteins are created: the protein of interest "X" which is 
constructed to have a DNA binding domain attached to its N -terminus, and its 
potential binding partner "Y" which is fused to an activation domain. If protein 

2. Functional Genomic Approaches for Mycorrhizal Research 

X interacts with protein Y, the binding of these two forms an intact and func- 
tional transcriptional activator (Fields and Song 1989). This newly formed tran- 
scriptional activator then goes on to transcribe a reporter gene, which is simply 
a gene whose protein product can be easily detected and measured. In this way, 
the amount of the reporter produced can be used as a measure of interaction 
between our protein of interest and its potential partner (Fig. 2.1). 

DNA binding domain hybrid 

Fig. 2.1 Yeast two-hybrid 
transcription. The yeast two- 
hybrid technique measures 
protein-protein interactions 
by measuring the transcrip- 
tion of a reporter gene. If pro- 
tein X and protein Y interact, 
then their DNA binding do- 
main and activation domain 
combine to form a functional 
transcriptional activator (TA). 
The TA then proceeds to tran- 
scribe the reporter gene that is 
paired with its promoter 

Activation domain hybrid encoded by library 

* Reported gene expressed 

Interaction between DNA-binding domain hybrid 
and hybrid from library 

A. Pandey, et al. 

The LbRas gene cloned from Laccaria bicolor has been shown to be regulated 
during the early stage of the fungal ectomycorrhizal interaction with Pinus resin- 
osa (Sundaram et al. 2001). The RAS gene is also expressed in mycorrhizal tissue 
when compared with free -living fungal mycelium. Such differential expression 
clearly suggests that LbRas plays a key role during ectomycorrhiza formation. 
Using LbRas as a bait and performing yeast two -hybrid interactions with tissue 
from early stages of L. bicolor-R resinosa led to the isolation of a novel line of 
Ras-interacting yeast two-hybrid ectomycorrhizal clones (Rhythm; Sundaram et 
al. 2004). One of the important Ras interacting clones showed considerable se- 
quence homology to other eukaryotic clones coding for an AP180-like protein 
(RhythmA; -50%). The predicted amino acid sequence of RhythmA shows the 
presence of an Asn-Pro-Phe (NPF) motif, which is characteristic of all known 
AP180 proteins (De Camilli et al. 1996; Paoluzi et al. 1998). NPF motifs have 
been shown to be involved in protein-protein interactions (Paoluzi et al. 1998). 
API 80 proteins have been shown to play roles in the assembly of clathrin- coated 
vesicles through protein-protein interactions (Hao et al. 1999). Previously it 
has been shown the API 80 is also involved in cargo sorting in coated vesicles 
through its interaction with GTPase (De Camilli et al. 1996). Since establish- 
ment of mycorrhizal association is also related to exchange of signals, ligands, 
and nutrient, one could observe such turnover of vesicles and vesicular traf- 
ficking during ectomycorrhizal phenomena. Such regulations were previously 
reported during the interaction of L. bicolor-P. resinosa (Kim et al. 1999). 

Similarly performing yeast two -hybrid analysis of pre-infection stage interac- 
tions of L. bicolor with aspen (Populus tremuloides) seedlings led to the isolation 
of other RAS interacting clones (Table 2.1). Screening the cDNA library pre- 
pared from the interaction of L. bicolor with P. tremuloides led to the isolation of 
some important RAS interacting clones, including a GPCR, cyclophilin, vacu- 
olar protein sorting (VPR), and biogenesis related protein. 

GPCR proteins are a very important group of genes and are one of the largest 
protein families in human and other animal genomes (Pin et al. 2005). However, 
in most fungal genomes, the number of GPCRs identified is very low (Kulkarni 

Table 2.1 Interacting partners of Lbras. Yeast two-hybrid interactions were performed with tissue 
from early stages of L. bicolor-P. tremuloides using LbRas as bait. The table describes some of the 
interacting clones and their potential function 

Description Putative role 

Cyclophilin Phosphorylation 

(peptidylprolyl isomerase-like 2 isoform) and dephosphorylation process 

Vacuolar protein sorting and organiza- Transport, signaling 

tion and biogenesis related protein 

Cullin- 1 Protein targeting, 

processing, and degradation 

GPCR - STE3 like Receptor and signaling 

2. Functional Genomic Approaches for Mycorrhizal Research 

et al. 2005). GPCRs are involved in a variety of signaling mechanisms of vari- 
ous organisms and are known to be associated with critical biological functions. 
In fungi, GPCRs have been shown to be involved in signaling (Riquelme et al. 
2005), including pheromone signaling, receptors involved in host recognition 
(Marsh and Herskowitz 1988), and pathogenicity (Kulkarni et al. 2005). 

Cyclophilin have peptidyl-prolyl cis-trans isomerase (PPIase) and are chap- 
erones and folding catalysts with the ability to catalyze the cis-trans isomeriza- 
tion of prolyl bonds, a rate-limiting step in protein folding. Cyclophilin were 
shown to be involved in different phosphorylation processes of RAF/RAS, thus 
regulating the signaling events (Dougherty et al. 2005). Northern analysis of 
cyclophilin showed they are induced at the very early stages of interaction and 
are present until the time of interaction (Fig. 2.2). 

Another Lbras interacting clone showed a high match with VPS. Vacuolar 
protein sorting genes encode proteins that are involved in protein sorting to 
the vacuole. A region of vacuolar protein sorting Vps9p from yeast is related to 
human proteins (Rinl, JC265) that were shown to negatively regulate Ras-me- 
diating signaling in S. cerevisiae (Han and Colicelli 1995). In fact Rinl has been 
shown to bind directly to RAS in a manner that competes with the binding of 
RAF (a downstream effector of RAS). This suggests that an effector domain of 
RAS is a principal binding site for Rinl and that Rinl may act as a downstream 
effector of RAS. There have been previous reports of vesicular traffic protein 
regulation during ectomycorrhizal interaction and vesicular turnover in ecto- 
mycorrhiza (Cole et al. 1998; Kim et al. 1999). Though such functional evidence 
is lacking to show their role during ectomycorrhiza formation, the involvement 
of vacuolar sorting proteins in signaling and transport of signals/information 
cannot be ruled out. 

Cloning of the signaling genes like GPCRs, Raf, and Rho and testing their in- 
tensity of interaction with each other to build a protein-protein interaction net- 
work model could provide us evidence during the upstream and downstream 
signaling process in ectomycorrhiza formation. 

96 hrs 

1.5 Kb 

Fig. 2.2 Temporal regulation of mRNA expression for cyclophilin-like protein during the early 
stages of interaction between L. bicolor and P. tremuloides. Northern analysis with 10 ug of total 
RNA samples from L. bicolor subjected to interaction with P. tremuloides for 6, 12, 24, 48, 72, 96 h 
was carried out as described in the Materials and Methods. Ethidium bromide staining of rRNA 
was used to verify the loaded amount of total RNA 

A. Pandey, et al. 

Transformation in Laccaria bicolor 

Agrobacterium tumefaciens is a well known bacterium that causes crown galls 
on plants by transferring part of a tumor-inducing plasmid into their genomes. 
Such Agrobacterium -mediated transformation has been well developed for gene 
transfer in plant systems (Tinland 1996) and also in variety of other organisms 
like yeast, filamentous fungi, and human cells (Bundock et al. 1995; de Groot 
et al. 1998; Kunik et al. 2001). To date Agrobacterium-mediated transforma- 
tion has been reported in many fungal species, like Botrytis cinerea, Aspergillus 
awamoru Magnaporthe grisea, Fusarium oxysporum (Gouka et al. 1999; Rolland 
et al. 2003; Khang et al. 2005). Methods of molecular and genetic analysis have 
progressed more slowly for ectomycorrhizal fungi than for higher fungi. Still, 
successful transformation has been reported in Suillus bovinus, Agaricus bispo- 
rus, Paxillus involutus, Hebeloma cylindrosporum, and Laccaria bicolor (Pardo et 
al. 2002, 2005; Hanif et al. 2002; Combier et al. 2003). But the functional aspects 
and utilization of such a technique for insertional mutagenesis or genetic trans- 
formation are largely missing. 

Recently, Agrobacterium -mediated transformation was used for insertional 
mutagenesis in the symbiotic ectomycorrhizal fungus Hebeloma cylindrospo- 
rum (Combier et al. 2003). Though there can be single or multiple insertions, 
the frequency of single insertions can be controlled by treating bacteria with 
acetosyringone (AS) prior to co -cultivation, an experimental condition which 
slightly reduces transformation efficiency. In fact, a higher percentage (60%) of 
single insertion was obtained in H. cylindrosporum using AS -treated bacteria 
when compared with protoplast-based transformation, which generally led to 
an unpredictable number of plasmid integration per genome (Marmeisse et al. 
1992; Amey et al. 2002). Kemppainen et al. (2005) obtained successful trans- 
formation of L. bicolor S238N with an efficiency of 55% using the AGL-1 strain. 

Using this transformation procedure, a non-mycorrhizal mutant of H. cylin- 
drosporum was obtained (Combier et al. 2003). Further, it will be interesting to 
study the key regulatory steps of mycorrhizal functioning by directing precise 
silencing of symbiosis-regulated genes using siRNA/RNA interference technol- 
ogy. Though such techniques are well developed in phytopathogens (Fitzgerald 
et al. 2004), they are still lacking in mycorrhizal fungi. 

We have used Agrobacterium -mediated transformation of L. bicolor strain 
S238N with a vector for the selection and expression of green fluorescent pro- 
tein (GFP) reporter gene (Fig. 2.3). In addition, we have also obtained gene re- 
placement for the PF6.2 gene earlier found to be induced very early in interac- 
tion between L. bicolor and red pine (Kim et al. 1998). This is the first instance 
of gene replacement in mycorrhizal fungi. Figure 2.4 shows the replacement of 
the PF6.2 gene in L. bicolor transformants. One of these transformants has been 
tested in its ability to form mycorrhizae on P. tremuloides seedlings. The trans- 

2. Functional Genomic Approaches for Mycorrhizal Research 

Selection Plate 

21.2 - 

0.5 — 

Fig. 2.3 Agrobacterium -mediated transformation of L. bicolor and expression of selection marker 
and reporter gene GFR Panel a shows L. bicolor wild type (C) and transformants grown on non-se- 
lective MMN medium (left dish). The right dish shows the selection of transformants on 300 ug/ml 
hygromycin. Panel b shows colony PCR of transformants selected on hygromycin. The arrow points 
to the GFP PCR product. Lane 1 DNA molecular weight marker, lanes 2, 3, 4 transformant DNA 
samples, lane 5 blank, lane 6 positive control from pBGgHg plasmid. Panel c shows the expression 
of GFP protein in the transformants and the DAPI staining of nuclei, compared with a non-trans- 
formed control L. bicolor 

A. Pandey, et al. 

9 kb 
8 kb 
6 kb 

Fig. 2.4 Southern analysis of PF6.2 gene 
displacement in L. bicolor. Genomic DNA 
samples (10 [ig each) from L. bicolor were 
digested with BamHl. Hybridization was 
done with a 32 P-labeled PF6.2 cDNA frag- 
ment as described by Kim et al. (1998). 
Molecular weight markers are indicated in 
kilobasepairs. Lane 1 Wild-type L. bicolor, 
lanes 2-4 L. bicolor transformants 1, 2, 3, 
respectively Arrows point to the deletion 
of one copy of PF6.2 in transformant 1 and 
displacement in transformants 3 and 4 

formant was able to form mycorrhizal roots, but was defective in stopping the 
formation of root hairs on mycorrhizal roots (Fig. 2.5), which is a common fea- 
ture under normal conditions. This suggests that the displacement in PF6.2 in 
the L. bicolor genome and reduction in its copy number impacted the symbiosis 
process. These results also corroborate the earlier hypothesis that PF6.2 from 
L. bicolor may be involved in a signaling process (Kim et al. 1998). Thus, the 
Agrobacterium-mediated gene transformation methods open up the possibility 
of using gene silencing or ectopic expression techniques in mycorrhizal fungi to 
study the process of symbiosis. 

Materials and Methods 

Interaction Studies of Laccaria bicolor 
with Aspen [Populus tremuloides) Seedlings 

To construct the cDNA library of L. bicolor undergoing interaction with P. trem- 
uloides, aspen seeds were incubated overnight at 4 °C and were surface-steril- 
ized using 10% hydrogen peroxide. The sterilized seeds were transferred to Petri 
dishes (diam. 75 mm) containing woody plant medium (WPM) agar (Sigma, 
Mo., USA) and was incubated for 1 week at 25 °C. Five seedlings of aspen were 

2. Functional Genomic Approaches for Mycorrhizal Research 

Fig. 2.5 Phenotypic changes in the mycorrhi- 
zae formed by L. bicolor PF6.2 transformant. U 
Un-inoculated roots. C Roots inoculated with 
control L. bicolor. T Roots inoculated with 
transformant 3 showing mantle formation but 
no loss of root hairs. The loss of root hairs is a 
hallmark of ectomycorrhizal development 

A. Pandey, et al. 

transferred to each magenta box containing WMP media overlaid with a cello- 
phane sheet. The seedlings were incubated in a growth chamber with a cycle of 
16 h light and 8 h dark at 25 °C for 4-5 weeks. The L. bicolor culture was main- 
tained on MMN medium (Podila et al. 2002) in MMN-filled Petri dishes (diam. 
150 mm) at 22 °C. The fungal culture for inoculation of aspen roots was grown 
from agar plugs of mycelium placed on cellophane-covered MMN medium. 
Mycelial strips of approximately 15x5 mm were excised from the edge of the 
culture. Strips were then placed on the cellophane just above the root and were 
grown for different time intervals (viz. 0, 6, 12, 24, 48, 72, 96 h). This allowed for 
diffusion of root signals, but prevented physical contact between the roots and 
the mycelium to study the gene expression before physical contact was made 
between the fungus and the roots. 

Yeast Two- Hybrid Protocol 

The yeast two-hybrid experiment was performed using BD Matchmaker library 
construction and screening kits and protocols (BD Biosciences, Clontech, Calif., 

cDNA Synthesis and Bait Construction 

All RNA samples were treated with RNase-free DNase at 37 °C for 30 min using 
the DNA-free kit (Ambion, Austin, Tex.) prior to cDNA synthesis, to ensure that 
the amplicon template originated from RNA and not DNA. Two micrograms of 
DNA-free RNA was used for first-strand cDNA synthesis for all samples belong- 
ing to interaction time points, carried out simultaneously using the BD Smart 
cDNA synthesis kit. Lbras was used to construct a DNA-BD fusion vector using a 
BD -cloning vector (pGBKT7). The GAL4AD fusion library was constructed us- 
ing vector pGADT7-Rec and the constructed interaction library. The GAL4AD 
fusion library samples along with the bait (BD vector) were co -transformed in 
yeast strain AH 109 (as described in the BD Biosciences protocol). 

Preparation of Competent Yeast Cells - LiAc Method 

1. Inoculate fresh yeast strain AH 109 (<4 weeks old, 2-3 mm diam.) into 3 ml 
of YPDA medium and incubate at 30 °C with shaking for 8 h. 

2. Functional Genomic Approaches for Mycorrhizal Research 27 

2. Transfer 5 ul of the culture to a 250-ml flask containing 50 ml of YPDA. In- 
cubate at 30 °C with shaking at 230-250 rpm for 16-20 h. The OD 600 should 
reach 0.15-0.2. 

3. Centrifuge the cells at 700 g for 5 min at room temperature. Discard the su- 
pernatant and resuspend the cell pellet in 100 ml of YPDA. 

4. Incubate at 30 °C for 3-5 h (OD 600 = 0.4-0.5). Centrifuge the cells at 700 g for 
5 min at room temperature. 

5. Discard the supernatant and resuspend the cell pellet in 60 ml of sterile, de- 
ionized H 2 0. Centrifuge the cells at 700 g for 5 min at room temperature. 

6. Discard the supernatant and resuspend the cells in 3 ml of 1.1 x TE/LiAc so- 

7. Divide the resuspension between two 1.5-ml microcentrifuge tubes (1.5 ml 
per tube). 

8. Centrifuge each tube at high speed for 15 s. Discard the supernatant and re- 
suspend each pellet in 600 \d of l.lx TE/LiAc solution. 

Competent cells should be used for transformation immediately following 
preparation; however, if necessary they can be stored at room temperature for a 
few hours without significantly affecting the competency. 

Transformation of Yeast Strain AH109 with dscDNA and pGADT7-Rec 

1 . In a sterile, prechilled, 1 5 -ml tube combine the following: 20 \d dscDNA (from 
protocol Section IX.I, step 16), 6 (il pGADT7-Rec (0.5 |ig/|il), 5 \ig GBKT7/ 
bait plasmid DNA, 20 ul herring testes carrier DNA, denatured*. (* Trans- 
fer -50 |il of herring DNA to a microcentrifuge tube and heat at 100 °C for 
5 min. Then, immediately chill the DNA by placing the tube in an ice bath. 
Repeat once more before adding the DNA to the 15-ml reaction tube.) 

2. Add 600 |il of competent cells to the DNA. Gently mix by vortexing. Add 
2.5 ml PEG/LiAc Solution. Gently mix by vortexing. Incubate at 30 °C for 
45 min. Mix cells every 15 min. 

3. Add 160 ul DMSO, mix, and then place the tube in a 42 °C water bath for 
20 min. Mix cells every 10 min. Centrifuge at 700xgfor 5 min. 

4. Discard the supernatant and resuspend in 3 ml of YPD plus liquid medium. 

5. Incubate at 30 °C with shaking for 90 min. Centrifuge at 700xg for 5 min. 
Discard the supernatant and resuspend in 6 ml of NaCl solution (0.9%). 

6. Spread the co -transformation mixture on selection media. Transformants ex- 
pressing interacting proteins were selected on triple dropout medium: SD/- 
His/-Leu/-Trp and quadruple dropout medium: SD/-Ade/-His/-Leu/-Trp. 

Colonies become visible after 2-3 days, but plates should be incubated 5 days 
to allow slower growing colonies to appear. 

A. Pandey, et al. 

To identify the gene responsible for a positive two-hybrid interaction, rescue 
the gene by plasmid isolation or by PCR colony-screening. 

Further, AD/library cDNA insert can be sequenced using the AD LD -insert 
screening amplimer set, a T7 sequencing primer, or the 3' AD sequencing primer 
provided with the BD Matchmaker two-hybrid kit (Clontech, Calif., USA). 

Northern Analysis 

Total RNA from L. bicolor, subjected to interaction with P. tremuloides seedling 
roots for 6, 12, 24, 48, 72, 96 h, respectively, was electrophoresed on formalde- 
hyde-agarose gels and transferred to Hybond-N membranes (Amersham Phar- 
macia Biotech, Piscataway, N.J., USA), as described by Kim et al. (1998). Total 
RNA from free-living L. bicolor was used as control. A 10-(ig sample of RNA was 
loaded in each lane; and gels were stained with ethidium bromide (Sigma, USA) 
to determine equal loadings and intensity of RNA. The cDNA fragment coding 
for cyclophilin-like protein was labeled with 32 P-dCTP with the Rediprime DNA 
labeling kit (Amersham Pharmacia Biotech) and used as a probe in the hybri- 
dization analyses of the membrane-bound nucleic acids, as described previously 
(Sambrook et al. 1989; Kim et al. 1999). 

Agrobacterium-Mediated Transformation 
in Laccaria bicolor 

Preparation of Fungal Material 

Laccaria bicolor mycelium was freshly cultured on a cellophane sheet overlaid 
on low glucose-MMN (2% glucose) agar medium at 22 °C for 1 week, as de- 
scribed by Balasubramanian et al. (2002). 

Induction of Agrobacterium 

Agrobacterium tumefaciens strain AGL1 containing plasmid pBGgHg or pBG- 
6.2 was grown overnight in 4 ml of minimal medium containing kanamycin at 
50 |ig/ml at 29 °C (until the cell density reached OD = 0.2). 

2. Functional Genomic Approaches for Mycorrhizal Research 29 

Bacterial cells were collected by centrifugation (3000 g at 4 °C for 5 min) and 
resuspended in induction medium (200 \xM AS plus kanamycin at 50 |ig/ml) 
and grown for 6 h at 29 °C. 

Transformation, Co-Cultivation, and Selection 

After the fungal colonies reached 0.5 cm diameter, which took 7 days, the mem- 
branes with colonies were transferred to induction media plates with or without 
200 uM AS. 

Laccaria mycelium was then inoculated with 50 \il of induced Agrobacterium. 
The co -cultivation plates were incubated at 22 °C for 5 days in the dark. 

The membrane with mycelia colonies were then transferred to MMN or 
Moser 6 selection plates (pH 7.5; containing antibiotics mix and hygromycin 
300 |ig/ml). The plates were incubated at 4 °C overnight and then shifted to 
22 °C for 10 days in the dark. 

After 2 weeks, the growing colonies were repeatedly subcultured on the selec- 
tion plates containing antibiotics and tested to make sure no residual agrobac- 
teria were present. 

DNA isolation was performed from the putative transformant colonies grow- 
ing on cellophane membrane using the methods described by Kim et al. (1998). 
The positive transformants were selected using primers which specifically am- 
plify hygromycin (hph) or modified EGFP gene. 

Further analyses of T-DNA integration were done by Southern analysis, as 
described by Kim et al. (1998). 

1. Minimal medium: K 2 HP0 4 10.5 g, KH 2 P0 4 4.0 g, (NH 4 ) 2 S0 4 1.0 g, Na 3 -ci- 
trate 2H 2 0.5 g, MgS0 4 .7H 2 0.2 g, thiamine-HCl 1.0 mg, glucose 2.0 g, 
plus 50 ug/ml kanamycin. 

2. Induction medium: minimal medium, plus 40 mM MES and 0.5% glycerol, 
pH 5.3. 

3. Induction agar: induction medium, plus 2% agar. 

4. Antibiotics mix: cefotaxime (Sigma, USA) 100 |ig/ml, ampicillin (Amresco, 
USA) 100 |ig/ml, tetracyclin (Amresco, USA) 125 (ig/ml, hygromycin (Roche, 
USA) 300 ug/ml. 

Fungal DAPI Staining and Visualization of GFP Expression 

Actively growing fungal hyphae from the edges of the colony were collected and 
transferred on the slides using a sterile needle or the forceps. Using the blunt 
end of forceps the cover slip was tapped gently to spread the mycelia uniformly. 

A. Pandey, et al. 

Fungal mycelia were mounted in Vectashield plus 4,6-diamidino-2-phenyl- 
indole (DAPI) as per the manufacturers instructions (Molecular Probes, USA). 
Hyphae were observed under a Nikon E600 microscope equipped with a Qi- 
Cam digital camera (Q Imaging, USA). 

The GFP fluorescence was observed under the Nikon E600 microscope. 
The filters used were B2A (excitation filter wavelength: 450-490 nm) for green 
fluorescence and UV-2A (excitation filter wavelength: 330-380 nm) for DAPI 

stain at lOOx magnification. 

Fungal DNA PCR 

DNA was extracted from the mycelia actively growing on selection medium 
containing hygromycin. 

DNA was diluted to 10% and hot start PCR was performed using EGFP prim- 
ers (Clontech, Calif., USA). 

PCR consisted of 30 cycles of amplification on an Eppendorf Mastercycler 
gradient PCR machine. Each cycle consisted of 1 min of melting at 94 °C, 30 s 
of annealing at 55 °C, and 1 min of extension at 72 °C. Prior to the first cycle, 
the samples were heated to 94 °C for 3 min. The last cycle was followed by a final 
extension at 72 °C for 5 min. 

Amplification products were detected by electrophoresis on 1.2 % agarose 
gels that were stained with ethidium bromide and were visualized with a UV 
trans-illuminator. The identity of PCR products was further confirmed by DNA 
sequence analysis. 

Part of the work presented here is supported by NSF grant MCB to G.K.P. 

Amey RC, Athey-Pollard A, Burns C, Mills PR, Bailey A, Foster GD (2002) PEG-mediated 
and Agrobacterium-mediated transformation in the mycopathogen Verticillium fungi- 
cola. Mycol Res 106:4-11 

Balasubramanian S, Kim SJ, Podila GK (2002) Metabolism in early stages of mycorrhizal 
symbiosis - Lb-MS, a differentially regulated malate synthase from the ectomycorrhizal 
fungus Laccaria bicolor. New Phytol 154:517-527 

Barker SJ, Tagu D, Delp G (1998) Regulation of root and fungal morphogenesis in mycorrhi- 
zal symbiosis. Plant Physiol 116:1201-1207 

2. Functional Genomic Approaches for Mycorrhizal Research 31 

Bartel PL, Chein CT, Strenglanz R, Fields S (1993) Using the two-hybrid system to detect 
protein-protein interactions. In: Hartley DA (ed) Cellular interactions in development: 
a practical approach. Oxford University Press, Oxford, pp 153-179 

Bendixen C, Gangloff S, Rothstein R (1994) A yeast mating-selection scheme for detection of 
protein-protein interactions. Nucleic Acids Res 22:1778-1779 

Bundock P, Dulk-Ras A, Beijersbergen A, Hooykaas PJJ (1995) Trans-kingdom T-DNA trans- 
fer from Agrobacterium tumefaciens to Saccharomyces cerevisiae. EMBO J 14:3206-3214 

Chein CT, Bartel PL, Strenglanz R, Fields S (1991) The two-hybrid system: a method to iden- 
tify and clone genes for proteins that interact with a protein of interest. Proc Natl Acad 
Sci USA 88:9578-9582 

Cole L, Orlovich DA, Ashford AE (1998) Structure, function, and motility of vacuoles in 
filamentous fungi. Fungal Genet Biol 24:86-100 

Combier JP, Melayah D, Raffier C, Gay G, Marmeisse R (2003) Agrobacterium tumefaciens- 
mediated transformation as a tool for insertional mutagenesis in the symbiotic ectomy- 
corrhizal fungus Hebeloma cylindrosporum. FEMS Microbiol Lett 220:141-148 

De Camilli P, Emr SD, McPherson PS, Novick P (1996) Phosphoinositides as regulators in 
membrane traffic. Science 271:1533-1539 

Dougherty MK, Muller J, Ritt DA, Zhou M, Zhou XZ, Copeland TD, Conrads TP, Veenstra 
TD, Lu KP, Morrison DK (2005) Regulation of Raf-1 by direct feedback phosphoryla- 
tion. Mol Cell 17:215-224 

Duplessis S, Courty PE, Tagu D, Martin F (2005) Transcript patterns associated with ecto- 
mycorrhiza development in Eucalyptus globulus and Pisolithus microcarpus. New Phytol 

Feugey L, Strullu DG, Poupard O, Simoneau P (1999) Induced defense response limit Hartig 
net formation in ectomycorrhizal birch roots. New Phytol 144:541-547 

Fields S (1993) The two-hybrid system to detect protein-protein interactions methods: a 
comparison. Methods Enzymol 5:116-124 

Fields S, Song OK (1989) A novel genetic system to detect protein-protein interactions. Na- 
ture 340:245-246 

Fields S, Strenglanz R (1994) The two-hybrid system: an assay for protein-protein interac- 
tions. Trends Genet 10: 286-292 

Fitzgerald DJ, DeLuca C, Berger I, Gaillard H, Sigrist R, Schimmele K, Richmond TJ (2004) 
Reaction cycle of the yeast Isw2 chromatin remodeling complex. EMBO J 23:3836-3843 

Gouka RJ, Gerk C, Hooykaas PJJ, Bundock P, Musters W, Verrips CT, Groot de MJA (1999) 
Transformation of Aspergillus awamori by Agrobacterium tumefaciens-mediated homol- 
ogous recombination. Nat Biotechnol 17:598-601 

Groot de MJA, Bundock P, Hooykaas PJJ, Beirjesbrgen AGM (1998) Agrobacterium tumefa- 
dercs- mediated transformation of filamentous fungi. Nat Biotechnol 16:839-842 

Han L, Colicelli J (1995) A human protein selected for interference with Ras function inter- 
acts directly with Ras and competes with Rafl. Mol Cell Biol 15:1318-1323 

Hanif M, Pardo AG, Gorfer M, Raudaskoski M (2002) T-DNA transfer and integration in the 
ectomycorrhizal fungus Suillus bovinus using hygromycin B as a selectable marker. Curr 
Genet 41:183-188 

Hao W, Luo Z, Zheng L, Prasad K, Lafer EM (1999) API 80 and AP-2 interact directly in a 
complex that cooperatively assembles clathrin. J Biol Chem 274:22785-22794 

Harrison MJ (1999) Molecular and cellular aspects of the arbuscular mycorrhizal symbiosis. 
Annu Rev Plant Phys 50:361-389 

Kemppainen M, Circosta A, Tagu D, Martin F, Pardo AG (2005) Agrobacterium-mediated 
transformation of the ectomycorrhizal symbiont Laccaria bicolor S238N. Mycorrhiza 

A. Pandey, et al. 

Khang CH, Park SY, Lee YH, Kang S (2005) A dual selection based, targeted gene replacement 
tool for Magnaporthe grisea and Fusarium oxysporum. Fungal Genet Biol 42:483-492 

Kim SJ, Zheng J, Hiremath ST, Podila GK (1998) Cloning and characterization of a symbiosis- 
related gene from an ectomycorrhizal fungus Laccaria bicolor. Gene 222:203-212 

Kim SJ, Bernreuther D, Thumm M, Podila GK (1999) LB-AUT7, a novel symbiosis-regulated 
gene from an ectomycorrhizal fungus, Laccaria bicolor, is functionally related to vesicu- 
lar transport and autophagocytosis. J Bacteriol 181:1963-1967 

Kulkarni RD, Thon MR, Pan H, Dean RA (2005) Novel G-protein-coupled receptor-like pro- 
teins in the plant pathogenic fungus Magnaporthe grisea. Genome Biol 6:24 

Kunik T, Tzfira T, Kapulnik Y, Gafni Y, Dingwall C, Citovsky V (2001) Genetic transforma- 
tion of HeLa cells by Agrobacterium. Proc Natl Acad Sci USA 98:1871-1876 

Marmeisse R, Gay G, Debaud JC, Casselton LA (1992) Genetic transformation of the symbi- 
otic basidiomycete fungus Hebeloma cylindrosporum. Curr Genet 22:41-45 

Marsh L, Herskowitz I (1988) STE2 protein of Saccharomyces kluyveri is a member of the rho- 
dopsin/beta-adrenergic receptor family and is responsible for recognition of the peptide 
ligand alpha factor. Proc Natl Acad Sci USA 85:3855-3859 

Martin F, Tagu D (1999) Developmental biology of a plant-fungus symbiosis: the ectomycor- 
rhiza. In: Varma AK, Hock B (eds) Mycorrhiza: structure, function, molecular biology 
and biotechnology, 2nd edn. Springer, Berlin Heidelberg New York, pp 51-73 

Martin F, Duplessis S, Ditengou F, Lagrange H, Vioblet C, Lapeyrie F (2001) Development 
cross talking in the ectomycorrhizal symbiosis: signals and communication genes. New 
Phytol 151:145-154 

Martin F, Tuskan GA, Difazio SP, Lammers P, Newcombe G, Podila GK (2004) Symbiotic 
sequencing for the Populus mesocosm. New Phytol 161:330-335 

Paoluzi S, Castagnoli L, Lauro I, Salcini AE, Coda L, Fre S, Confalonieri S, Pelicci PG, Di 
Fiore PP, Cesareni G (1998) Recognition specificity of individual EH domains of mam- 
mals and yeast. EMBO J 17:6541-6550 

Pardo AG, Hanif M, Raudaskoski M, Gorfer M (2002) Genetic transformation of ectomycor- 
rhizal fungi mediated by Agrobacterium tumefaciens. Mycol Res 106:132-137 

Pardo AG, Kemppainen M, Valdemoros D, Duplessis S, Martin F, Tagu D (2005) T-DNA 
transfer from Agrobacterium tumefaciens to the ectomycorrhizal fungus Pisolithus mi- 
crocarpus. Rev Argent Microbiol 37:69-72 

Pin JP, Kniazeff J, Liu J, Binet V, Goudet C, Rondard P, Prezeau L (2005) Allosteric function- 
ing of dimeric class C G-protein-coupled Receptors. FEBS J 272: 2947-2955 

Podila GK, Zheng J, Balasubramanian S, Sundaram S, Hiremath S, Brand J, Hymes M (2002) 
Molecular interactions in ectomycorrhizas: identification of fungal genes involved in early 
symbiotic interactions between Laccaria bicolor and red pine. Plant Soil 244:117-128 

Riquelme M, Challen MP, Casselton LA, Brown AJ (2005) The origin of multiple B mating 
specificities in Coprinus cinereus. Genetics 170:1105-1119 

Rolland S, Jobic C, Fevre M, Bruel C (2003) Agrobacterium-mediated transformation of 
Botrytis cinerea, simple purification of monokaryotic transformants and rapid conidia- 
based identification of the transfer-DNA host genomic DNA flanking sequences. Curr 
Genet 44:164-171 

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold 
Spring Harbor Laboratory, Cold Spring Harbor 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis, 2nd edn. Academic, London 

Sundaram S, Kim SJ, Suzuki H, Mcquattie CJ, Hiremath ST, Podila GK (2001) Isolation and 
characterization of a symbiosis-regulated ras from the ectomycorrhizal fungus Laccaria 
bicolor. Mol Plant Microbe Interact 14:618-628 

2. Functional Genomic Approaches for Mycorrhizal Research 33 

Sundaram S, Brand JH, Hymes MJ, Hiremath ST, Podila GK (2004) Isolation and analysis 
of a symbiosis-regulated and Ras-interacting vesicular assembly protein gene from the 
ectomycorrhizal fungus Laccaria bicolor. New Phytol 161:529-538 

Tagu D, Lapeyrie F, Ditengu F, Lag H, Larent P, Missoum N, Nehls K, Martin F (2000) Mo- 
lecular aspects of ectomycorrhiza development. In: Podila GK, Douds DD (eds) Cur- 
rent advances in mycorrhiza research. American Phytopathological Society, St. Paul, pp 

Tinland B (1996) The integration of T-DNA in plant genomes. Trends Plant Sci 1:178-184 

Wright DP, Johansson T, Le Quere A, Soderstrom B, Tunlid A (2005) Spatial patterns of gene 
expression in the extramatrical mycelium and mycorrhizal root tips formed by the ec- 
tomycorrhizal fungus Paxillus involutus in association with birch (Betula pendula) seed- 
lings in soil microcosms. New Phytol 167:579-596 

Automated Fluoroscence 
Sequencing and Troubleshooting 

S. Gochhait, D. Malhotra, E. Rai, and R.N.K. Bamezai 

A major step towards understanding the genetic basis of an organism is the 
complete sequence determination of all the genes in its genome (Sterky and 
Lundeberg 2000). On 26 June 2000, a landmark achievement was announced: 
the compilation of a working draft of the human genome by the Human Ge- 
nome Project, with the first assembly (by Celera Genomics, Rockville, Md.) of a 
complete human genome sequence (Macilwain 2000). Three major milestones 
played a prominent role in achieving such a goal: the invention of sequencing 
reactions (Maxam and Gilbert 1997; Sanger et al. 1977), the polymerase chain 
reaction (PCR; Mullis et al. 1986; Mullis and Faloona 1987), and automated flu- 
orescent DNA sequencers (Smith et al. 1985, 1986; Hood et al. 1987; Hunkapil- 
lar et al. 1991), which made it possible to streamline and automate most of the 
processes required for DNA analysis. The DNA sequencing technique can be 
helpful in routine molecular biology work to confirm recombinant plasmids, 
authenticate the orientation of the cloned fragment, and assess the success of the 
site-directed mutagenesis experiment. It has further enabled the highest resolu- 
tion of the blueprint of an organism and facilitated the characterization of a 
given sequence in terms of polymorphisms (Malhotra et al. 2005), germline/ 
somatic mutation detection (Mir et al. 2005); (Fig. 3.1a, b), and insertions-de- 
letions. This has helped in establishing an association with simple or complex 
diseases and in understanding genetic diversity and evolution through com- 
parative genomics and forensic sciences. This chapter discusses the evolution 
of the method of DNA sequencing from a manual process to the development 

National Centre of Applied Human Genetics, School of Life Sciences, 

Jawaharlal Nehru University (JNU), New Delhi- 1 10067, India, 

Fax: +9 1-0 11 -26 1032 11, email:; 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmuller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

S. Gochhait, et al, 

Fig. 3.1 Detection of 
somatic mutation in 
tumour samples (a) and 
polymorphism using 
automated fluorescence 
sequencing (b) 

t ccce CCCTCC 

of automated fluorescent DNA sequencing strategy, and the troubleshooting, 
which encompasses common problems, associated with the technique. 

Evolution of the Method 

Manual Sequencing 

One of the major methods of DNA sequencing is the chain termination dide- 
oxynucleotide method by Sanger and coworkers. 

Dideoxynucleotidetriphosphates (ddNTPs) lack a hydroxy (OH) group at the 
3' position. This position is normally where one nucleotide attaches to another 
to form a chain. If there is no OH group in the 3' position, additional nucleo- 
tides cannot be added to the chain, thus interrupting chain elongation. It is an 
elegantly simple process and involves the following steps: 
1. Reaction setup: the reaction takes place in four different tubes, each of which 
contains a different ddNTP. It also includes the following components: 

a. Template - whose DNA sequence needs to be determined. It may be a 
PCR product or a cloned fragment. 

b. Primer - which is a short fragment of DNA with an annealing site in the 
template which initiates DNA synthesis. The primer determines the start- 

3. Automated Fluoroscence Sequencing and Troubleshooting 37 

ing point of the sequence being read and the direction of the sequencing 

c. Deoxynucleotidetriphosphates (dNTPs) - which extend the primer, 
forming a DNA chain. All four nucleotides (A, T, G, C in deoxynucleotide 
form) are added to the sequencing reaction. 

d. DNA polymerase - incorporates the nucleotides and dideoxynucleotides 
into the growing DNA chain in a 5' to 3' direction. 

e. Buffer - a solution that stabilizes the reagents and the products in the 
sequencing reaction. 

2. The reaction is denatured at 95 °C for 10 s, primer is allowed to anneal the tem- 
plate at 50 °C for 5 s and finally extension is carried out by DNA polymerase 
at 60 °C for 4 min. This temperature cycle is repeated 25 times. Many copies 
of the template DNA are made by primer extension (adding nucleotides on to 
the primer). All copies have the same nucleotide sequence but vary in length 
because the ddNTPs incorporate randomly and stop extension. Thus the tube 
that contains ddATP has fragments that all terminate at an adenosine (A), the 
tube with ddGTP has fragments that end with a guanine (G), and so on. 

3. The extension products from the four tubes are then purified and run in par- 
allel lanes of a polyacrylamide gel. 

4. The gel separates the sequencing products based on size; smaller fragments 
travel through the gel faster then longer fragments. The electrophoresed prod- 
ucts of DNA sequencing can be visualized because the primer is tagged with 
a radioactive label (dATP, 35-s or 33-p). When exposed to X-ray film, the 
radioactivity shows up as a dark band. If the first lane contains the products 
from reaction containing ddCTP, every band that shows up in that lane rep- 
resents a sequencing product that terminates at a C. The four lanes are read 
together in a horizontal hierarchy from bottom (smallest) to top (largest). 

Automated Sequencing 

The reaction in automated sequencing is essentially the same as in manual 
sequencing. There are two main differences: the labeling and reading. In au- 
tomated sequencing, each ddNTP used is labeled with a different fluorescent 
dye; thus the products are fluorescently labeled rather than radio actively. Each 
fluorescent dye used, corresponding to a different ddNTP, emits a characteristic 
wavelength upon excitation: ddATP = green, ddTTP = red, ddCTP = blue, and 
ddGTP = yellow. Thus each fragment has a different color at its end depending 
on which is the terminating nucleotide (ddNTP). This allows the sequencing 
reaction to be put in a single tube and hence products of sequencing to be run 
on a single lane of a gel rather than in four parallel lanes. In addition, the se- 

S. Gochhait, et al. 

quencing of nucleotides is determined by the computer, rather than being read 
manually by a technician. As the samples pass through the gel, a laser excites the 
fluorescent labels and the emission wavelength of each fragment is detected by 
a charge-coupled device (CCD) camera. The data is compiled into a gel image, 
analyzed by specific computer software and the resulting sequence is written 
into a text file and a chromatogram file, in an automated fashion which is much 
faster and more efficient than manual sequencing. 

Until recently, the most commonly used format was a horizontal or vertical 
slab gel. The ABI Prism 377 DNA sequencer from Applied Biosystems (Foster 
City, Calif.; uses multicolor fluorescence 
labeling technology with four dyes and one-lane detection (Smith et al. 1985). 
A CCD camera is used for sequencing rates up to 200 bases per sample per 
hour. It can run 18, 36, 64, or 96 samples simultaneously per vertical gel. Gel 
plates come in four different lengths to optimize run times and sample resolu- 
tion. Other gel-based sequencers which were developed as a result of a quest 
for better technology include ALFexpress (Amersham Pharmacia Biotech, Pis- 
cataway, N.J.), ASTRAL (O'Brien et al. 1998), ARAKIS (European Molecular 
Biology Laboratory, Heidelberg, Germany), 4200 (IR 2 ) (Li-COR, Lincoln, Neb.), 
BaseStation (GeneSys Technologies, Sauk City, Wis.), etc. 

Years of research on capillary sequencers have yielded several recent com- 
mercial systems that significantly increase the throughput and decrease the 
time required to sequence. CEQ 2000 (Beckman Coulter, Fullerton, Calif.), the 
multicapillary electrophoresis (MCE) device (Max-Planck-Institute for Molecu- 
lar Genetics, Berlin, Germany), and MegaBACE 1000 (Molecular Dynamics, 
Sunnyvale, Calif.) were some of the early capillary sequencers developed. Us- 
ing experience gained with the ABI prism 310 genetic analyzer single capillary 
instrument, Applied Biosystems developed the ABI Prism 3700 DNA analyzer 
with 96 primary capillaries and eight reserve capillaries. It has a turnaround 
time of 2.5 h. for an average read length of 550 base pairs with single base reso- 
lution. Samples are automatically loaded from 96- or 3 84- well microplates by 
electrokinetic injection into 96 capillaries. At the detection end of the capillar- 
ies, the samples flow through a sheath flow cuvette detector (Swerdlow et al. 
1991; Zhang et al. 1995; Service 1998) to eliminate capillary wall scattering and 
to provide continuous excitation and detection. Uncoated capillaries are used 
and are dynamically coated with a polymer such as POP 6 to control electro- 
osmotic flow. The system uses two-dimensional CCD imaging and is capable of 
using five dyes. It has a signal-to-noise ratio that is ten times better than the ABI 
Prism 377 sequencer. The Applied Biosystems 3700 uses four dyes, one-lane si- 
multaneous detection of 96 samples, and can run for 24 h unattended. The Ap- 
plied Biosystems ABI Prism 3100 genetic analyzer, based on the ABI Prism 310 
genetic analyzer and 3700 DNA analyzer, was recently introduced to support 
applications such as comparative sequencing and DNA fragment analysis. It has 
16 capillaries, uses either POP 4 or POP 6 as the separation matrix, and can run 
unattended for 24 h too. 

3. Automated Fluoroscence Sequencing and Troubleshooting 39 

Recently, pyrosequencing emerged as a new sequencing methodology. This tech- 
nique is a widely applicable, alternative technology for the detailed characteriza- 
tion of nucleic acids. Pyrosequencing has the potential advantages of accuracy, 
flexibility, and parallel processing; and it can be easily automated. Furthermore, 
the technique dispenses with the need for labeled primers, labeled nucleotides, 
and gel electrophoresis (Ronaghi 2001). This method takes advantage of four 
enzymes cooperating in a single tube to determine the nucleotide composition 
of a DNA fragment in real time. Detection is based on the amount of visible 
light produced by coupling the pyrophosphate that is released during nucleo- 
tide incorporation with the enzymes sulfurylase and luciferase. Unincorporated 
nucleotides are degraded in the reaction mixture by the enzyme apyrase. A fully 
automated instrument called the PSQ96 System has been developed primarily 
for SNP analysis by Pyrosequencing AB (Uppsala, Sweden). 

We would like to share our experience of handling the ABI Prism 3100 Avant 
genetic analyzer for sequencing, which involves the following basic steps: 

Template Preparation 

PCR products, cloned fragments in single-/double-stranded vectors, cosmids, 
BAC clones, and bacterial genomic DNA can be sequenced. PCR should be 
standardized so as to get a single band and high amplification with minimal 
dNTPs and primers. However, unused primers and dNTPs in the PCR reac- 
tion can be removed to some extent by Exo I (0.25 units/reaction) and Antarctic 
Phosphatase (0.50 units/reaction) treatment for 2 h at 37 °C followed by dena- 
turation of enzymes at 72 °C for 15 min. High-quality plasmids are required for 
sequencing and thus should be isolated from fresh culture (grown for not more 
than 14 h) using commercially available kits (Sigma Aldrich, Qiagene have the 
tested kits). Table 3.1 below shows the quantity of different types of templates 
required for sequencing. 

S. Gochhait, et al, 

Table 3.1 Quantity of different types of templates required for sequencing 

Template Template quantity 
PCR product: 

100-200 bp 1-3 ng 

200-500 bp 3-10 ng 

500-1000 bp 5-20 ng 

1000-2000 bp 10-40 ng 

>2000bp 40-100 ng 

Single-stranded 50-100 ng 

Double-stranded 200-500 ng 

Cosmid,BAC 0.5-1.0 ug 

Bacterial genomic DNA 2-3 ug 

Reaction Setup (BigDye Terminator Cycle Sequencing) 

One of the main components of the sequencing reaction is the BigDye (Ap- 
plied Biosystems), which consists of modified Taq DNA polymerase (AmpliTaq 
Gold), dNTPs, and fluorescence dye-labeled ddNTPs in buffer. Taq DNA poly- 
merase enzyme functions at high temperatures, due to which it can be specially 
useful when dealing with GC-rich templates or templates that have extensive 
secondary structures. The thermostability of Taq polymerase also allows cycle 
sequencing to be used. This approach is similar to PCR (except only a single 
primer is used and is thus called cycle sequencing reaction or cyclization in- 
stead of PCR) and uses a high temperature to denature the duplex DNA strands. 
The primer is then annealed and extension performed. This allows starting with 
fewer templates of DNA. Modification of Taq DNA polymerase that enables it 
to incorporate the dye-labeled terminators more evenly, resulting in less pro- 
nounced peak height variability and consistently high accuracy, have made 
this the most commonly used automated sequencing method. Fresh aliquots 
of primer having annealing site in the template should be used. Table 3.2 shows 
separate cycle sequencing reactions setup for PCR products and plasmids. Also 
listed are recommended (ABI) and standardized (in our laboratory) protocols. 

Mix well and spin briefly all reagents before proceeding to perform cycle se- 
quencing reaction. 

To prepare high-sensitivity BigDye-terminator reactions and further process- 
ing for BACs, PACs, YACs, cosmids, and bacterial genomic DNA, one can refer 
the Sequencing Chemistry Guide by Applied Biosystems. 

3. Automated Fluoroscence Sequencing and Troubleshooting 

Table 3.2 Sequencing reaction setup for PCR products and plasmids 

PCR products 

Recommended Standardized 

Recommended Standardized 

Dye (2.5x) 

Buffer (5x) 

0.5ul(0.125x) 8.00ul(lx) 

3.2 pmol 

1.75 ul 
3.2 pmol 

3.2 pmol 

Performing Cycle Sequencing 

1.00 ul (0.25x) 

1.50 ul 
3.2 pmol 

Refer to 

Refer to 

Refer to 

Refer to 

Table 3.1 

Table 3.1 

Table 3.1 

Table 3.1 

Total volume 

20 ul 

10 ul 

20 ul 

10 ul 

The following are the universal cycle sequencing conditions used for PCR and 
single-/double-stranded vector templates. These are applicable to all primers. 

First, place the plate in a thermal cycler (the GeneAmp PCR system 9700 has 
a rapid thermal ramp of 1 °C/s) and set the volume as required. 

Next, repeat the following for 25 cycles: (a) rapid thermal ramp to 96 °C, (b) 
hold at 96 °C for 10 s (denaturation), (c) rapid thermal ramp to 50 °C, (d) hold 
at 50 °C for 5 s (primer annealing), (e) rapid thermal ramp to 60 °C, and finally 
(f) hold at 60 °C for 4 min (primer extension). 

Then, rapid thermal ramp to 4 °C, spin down the contents of the plate, and 
store at 4 °C until ready to purify. 

For short PCR products, a reduced numbers of cycles can be used (e.g., 20 
cycles for a 300-bp or smaller fragment). 

If the T m of a primer is <50 °C, increase the annealing time to 30 s or decrease 
the annealing temperature to 48 °C. 

For templates with high GC content (>70%), heat the tubes at 98 °C for 5 min 
before cycling, to help denature the samples. 

For primers having annealing temperature higher than 60 °C, the annealing 
step can be eliminated. 

Further processing should not be delayed, as the signal becomes weak with 

S. Gochhait, et al, 

Preparing Extension Products for Electrophoresis 

Unincorporated dye-terminators must be completely removed before the sam- 
ples can be analyzed by electrophoresis. Excess dye-terminators in sequencing 
reactions obscure data in the early part of the sequence and can interfere with 
base calling. Commercially available 96-well spin columns or ethanol precipi- 
tation methods can be used. The ethanol precipitation method given below is 
cheaper, but is more likely to leave unincorporated dye-labeled terminators that 
can obscure data at the beginning of the sequence. 

1. Add 10 (J.1 deionized water to the reaction, followed by 2 (il each of sodium 
acetate (3 M, pH 5.2) and EDTA (125 mM, pH 8.0). 

2. Add 70 |il non-denatured 95% ethanol (the final ethanol concentration 
should be 60±3%). 

3. Cover the plate with a rubber seal and invert the plate a few times to mix. 
Leave the plate at room temperature (23-25 °C) for 10-15 min to precipitate 
the extension products. Precipitation times <15 min result in the loss of very 
short extension products. Precipitation times >24 h increase the precipita- 
tion of unincorporated dye -terminators. 

4. Place the plate in a table-top centrifuge with plate adaptor and spin for 
25 min. at 3300 rpm at room temperature (23-25 °C). Proceed to the next 
step immediately. If not possible, then spin the plate for 2 min more imme- 
diately before performing the next step. 

5. Without disturbing the precipitates, remove the rubber seal and discard the 
supernatant by inverting the plate onto a paper towel. Remove as much su- 
pernatant as possible. 

6. Place the inverted plate with the paper towel in the table-top centrifuge and 
spin at 1000 rpm for 1 min. 

7. Add 100 |il of 70% ethanol to each well. Cover the plate with a rubber seal 
and invert the plate a few times to mix. 

8. Place the plate in a table-top centrifuge and spin for 10 min at 3300 rpm at 
room temperature. 

9. Repeat the ethanol wash (steps 5-8). At this step, plates should not be in- 
verted to mix after addition of 100 \A of 70% ethanol. 

10. Remove the plate and discard the paper towel. Add 10 \A Hi-Di formamide 
(Applied Biosystems) followed by a brief spin to settle down the contents. 
Pellets may or may not be visible. Vacuum drying of the samples is not nec- 

1 1 . Heat the contents at 95 °C for 4 min followed by snapchilling at 4 °C or it can 
be kept in ice and then loaded onto the autosampler. The sample file with ap- 
propriate dye set, mobility file, run and analysis module should be filled up. 
Also care should be taken to note the presence of the required amount of 
polymer in the reserve polymer syringe. Buffer and wash tanks should be 
filled with fresh lx running buffer and deionized water, respectively. Before 

3. Automated Fluoroscence Sequencing and Troubleshooting 43 

placing the plates on the autosampler, one must centrifuge them to bring the 
samples down to the bottom of the tubes. 

Trouble Shooting 

Problem: Flat Line or"Dead On Analysis 

Reasons and remedies (Fig. 3.2): 

1. Template - poor quality, poor concentration. 

Impurities like phenol, ethanol (>10%) or salt are undesirable and can inhibit 
the reaction completely. The processivity of Taq DNA polymerase is reduced 
by high salt concentration of sodium or potassium chloride, which will have 
a more severe effect than sodium acetate. However, a sodium acetate concen- 
tration >20 mM also severely inhibits the reaction. We have personal experi- 
ence that classic methods of plasmid isolation like alkaline lysis, or boiling 
failed to give any sequencing results because of the poor quality of plasmids 
isolated by the above methods. Moreover strains like HB101 contain large 
amounts of carbohydrates and possess the endA locus, which produces an 
endonuclease, which might inhibit the reaction. Hence DH5a is the preferred 
host. Finally, it is essential that the template DNA be accurately quantified 
and the quality be checked by running on an agarose gel against a DNA of 
known concentration. 

2. Poor primer annealing - T m too high, primer concentration low, no primer- 
binding site. 

We highly recommend that a computer program be used during primer de- 
sign in order to check for certain fatal design flaws. Numerous programs are 
capable of performing this analysis. We generally use "Oligo" (National Bio- 
sciences, Plymouth, Minn.), a program for the Macintosh that has produced 
excellent results in our hands. Two other programs one might consider are 
Mac Vector (Kodak/IBI) and the GCG suite of sequence analysis programs, 
but many others are available as well. The following are some guidelines for 
primer designing: 

a. The primers should be 20-30 bp long. 

b. T m should be in the range 55-65 °C. 

c. GC content should be within the range of 50-55%. 

d. Long runs of single bases should be avoided, especially if that occurs at 
the 3' end. 

e. G or C at the 3' end is preferable so as to stabilize this end of the primer. 

S. Gochhait, et al. 

f. Discard candidate primers that show undesirable self-hybridization or 
forms secondary structures. 

Verify the site-specificity of the primer by BLAST analysis. One should 
also check for duplicated regions, as this could lead to anomalous results 
from polymorphism study (Malhotra et al. 2005). 

h. Primers should be dissolved in sterile-deionized water. The main stock 
should be stored at -80 °C while the working stock should be stored at 
-20 °C. Both main and working stock should be thawed on ice when nec- 
essary and care should be taken that they are not thawed repeatedly as 
this may degrade the primers. 
3. Template base composition - GC-rich templates because of their tendency 

to form stable secondary structures. Try putting the reaction with 5-10% 

DMSO or formamide. Increase denaturing time. 

2m 5664 

, w . 

IjjI . 1 

Til , 

Mm ' ^T \ tMJ MM M 

1520. 1600, 
j I i I i L 

.2C 130 14C ISO 

Fig. 3.2 Raw data (a) and 
corresponding electro - 
pherogram (b) of a good 
sequencing reaction. Peaks 
should be sharp, well 
denned, and scaled high in 
the first several panels, (c) 
represents raw data for a 
failed sequencing reaction 

3. Automated Fluoroscence Sequencing and Troubleshooting 

Problem: Noisy Data (Background) 

Reasons and remedies: although base calling is easiest for the analysis software 
when the signal strength is high, a good signal strength does not always go 
hand-in-hand with high-quality data. Background noise can obscure the true 
sequence data. 

1. Mixed templates - two or more different DNA are present in the reaction (a 
mixed template) and all possess a primer annealing site. Sequence data from 
each are superimposed in the electropherograms, giving a confused peak pat- 
tern (Fig. 3.3). It is a good idea to check each template preparation by aga- 
rose gel electrophoresis to determine its purity. When purifying recombinant 
plasmids in bacteria, plate out the transformants to obtain isolated colonies. 
Then select a single colony and restreak out on a plate to again select the 
colony for growth in cultures. 

2. Enzyme slippage - this can occur in homopolymer regions, thus skipping a 
base or incorporating an additional one. The sequence beyond the homopol- 
ymer region may then be shifted by one or more bases, giving the appearance 
of multiple overlapping sequences in the electropherograms. 

130 140 150 II 

J I I I i L 

1600- 1680, 
4 I t I i L 

Fig. 3.3 Noisy data char- 
acterized by overlapping 
peaks due to non-specific 
amplification, b shows the 
sequencing reactions cor- 
rected for the problems 

30 140 

150 160 

S. Gochhait, et al. 

3. Multiple priming events - n-\ primers, contaminated primers, single primer 
annealing to more than one site. Truncated primers caused by poor synthesis 
or storage conditions have common 3' ends and different 5' ends. The prod- 
ucts of sequencing reactions using such primers yield sequencing results con- 
taining a background "pre-read" where a small peak is seen before each cor- 
rect peak. Repeated freeze-thaw of the primers should be avoided as it can 
lead to its degradation. It is advisable to use fresh aliquots of diluted primers 
for sequencing. 

4. Quality of template - discussed above. 

5. Primer concentration - the presence of primers used to amplify the PCR 
product results in excessive background due to sequence products generated 
by these primers. The PCR product should be treated with Exo I, which re- 
moves unused primers in the PCR reaction. Agarose gel extraction of the 
product or use of a size exclusion membrane are other alternatives. 

Problem: Reading Near the Primer 

Reasons and remedies: with any sequencing strategy there is a limit to how near 
to the primer it is possible to read. With standard dye-terminator reactions 
reading closer than 20-30 bases is not usually possible due to the presence of 
contaminating dye -terminator molecules that have not been incorporated into 
the extension products. 

The terminators are present due to the method used to separate them from 
the extension products. The precipitation step is a differential precipitation and 
relies on precipitating the extension products while leaving the dye-terminators 
in the solution. For this reason, the precipitation and centrifugation steps are 
performed at room temperature, since this favors retention of the terminators 
in the supernatant (centrifugation at lower temperatures can cause excessive 
amounts of dye -terminators to be present in the sample; Fig. 3.4). To remove the 
dye -terminators more efficiently spin columns can be used but this increases the 
operational cost. In general, using a primer that is 50 bases or so away from the 
area where one wishes to start from is a safer and easier option. 

Problem: Strong Terminator Peaks 

Reasons and remedies: as mentioned above, the presence of terminator peaks can 
cause problems when the ability to read sequence near the primer is important 
(especially if the sequence signal is low). Additional problems that are associ- 

3. Automated Fluoroscence Sequencing and Troubleshooting 

■: j 

i i 

i L 

' r 

— -m 

' 4 

1 f) 

' J 

• »-H 

J2 o 

^ o 
13 o 

:— 43 

S. Gochhait, et al. 

ated with excessively strong terminator peaks (which are usually a result of inef- 
ficient washing after ethanol precipitation or precipitation under conditions that 
promote terminator precipitation) are generally low apparent signal strength 
and base "drop out". 

To understand why these situations occur it is necessary to know a little about 
how the analysis program works. The sequence analysis program takes the output 
from the data collection program and attempts to extract sequence information. 
This process requires several distinct steps. Firstly, the program looks for where 
it thinks the sequence starts. This is the first significant fluorescent signal 
detected and is usually the dye -terminator peak that migrates fastest through 
the gel. Once the program has located this position, it then checks all the data 
points from there to the end of the run for fluorescence intensity and scales all 
the signals with respect to the strongest signal for each channel being detected. 
Usually the strongest fluorescence is associated with the dye -terminator peaks 
and so these are the signals to which all others are scaled. Excessively strong 
terminator signal causes the sequence peaks to be scaled down, thereby reducing 
their intensity and possibly resulting in inaccurate data. The obvious way around 
this is to ensure that excess dye -terminators are removed from the sequence 
sample before it is loaded on the gel. Proper ethanol precipitation conditions are 
the key factors here. 

Once all the peaks are scaled proportionately, the base-calling program at- 
tempts to assign each peak a base value based on a number of criteria. Without 
going into specifics, this is principally achieved by assessing peak intensity (with 
respect to any minor peak at the same location) and peak shape. One problem 
that excess terminator peaks can cause is the loss of specific base signal, usually 

C". This is caused by uneven recovery of terminators. As stated above, the sig- 
nals are all scaled relative to the strongest signal for each channel. Hence, if an 
excess of "C" terminators is present, all the C signals are scaled down more than 
the other signals. This results in a loss of C signal strength. Fortunately this is 
easily rectified by reanalyzing the data from after the terminator peaks, thereby 
removing the artifacts. 

Problem: Low Intensity of Shorter Products 

Reasons and remedies: 

1. Excess dNTPs from the PCR reaction promote longer extension products and 
lead to a reduction in intensity of shorter products. Treatment of PCR product 
by shrimp alkaline phosphatase (SAP) solves the problem. Agarose gel extrac- 
tion of the product or use of size-exclusion membrane are other alternatives. 

2. The precipitation step was not long enough, leading to the precipitation of 
only a small amount of these fragments. 

3. Automated Fluoroscence Sequencing and Troubleshooting 49 

Problem: Longer Fragments Missing 

Reasons and remedies: 

1 . Primer dimer-this can be caused by a self-binding primer or a primer bind- 
ing to other primers present in the template mixture. Short fragments are 
predominantly amplified. There may or may not be any sequencing following 
such an artifact. 

2. High template DNA-the peaks at the start of the sample (first two panels) are 
all off-scale and then the data suddenly drops down in strength, finally dying 
off only 300-400 bases in to a run (ski-jump profile). 

3. Presence of salt inhibits the reaction and gives raw data as if a high template 
was used. (Although this is usually not associated with the peaks that are 
off-scale at the start of the trace). The higher the salt concentration the fewer 
the data produced. DNA eluted in high salt buffer or not washed off properly 
either during the template preparation step or ethanol precipitation (during 
washing) may give rise to such a situation. 

4. Homopolymer regions - Taq polymerase enzyme prematurely drops off or 
stops. Try using T7 DNA polymerase. 

5. Long templates. 

Problem: Presence of Spikes 

Reasons and remedies: 

Spikes can be present in between the data. This is characterized by sharp 
peaks of A and C followed by G and T. This can happen if the polymer has been 
in the syringes for a long time or if the polymer has passed its expiry date and 
crystallizes at 4 °C. Washing and refilling of fresh polymer should be done every 
10 days. 

Problem: Weaker Signals 

Reasons and remedies: 

1. Samples once resuspended in Hi-Di formamide should not be kept exposed 
to the air for long as Hi-Di formamide absorbs water from the atmosphere, 
which reacts slowly with formamide to form acid. The ionic products of their 
reaction can cause two problems - first, they compete significantly with the 

S. Gochhait, et al. 

larger DNA ions for injection into the capillary, resulting in weaker signals, 
and second, they react with the DNA, causing degradation of the sample. A 
pure form of Hi-Di formamide should be used and kept in aliquots to avoid 
repeated freeze- thawing. The samples resuspended in Hi-Di formamide 
should be kept sealed before loading onto the autosampler for sequencing. 

2. Sample used is low in quantity. Increase the sample or increase the sample 
injection time from (15 s to 20 s in a 36-cm capillary). One should not change 
the sample injection voltage, as this affects the resolution across the array. 

3. Spatial calibration - dislodge of the capillary should be followed by the spa- 
tial calibration. Peak intensity values of 15 000 and above with defined peaks 
and equal spacing between each capillary should be taken as a successful cali- 
bration run and selected for. 

Hood LE, Hunkapillar MW, Smith LM (1987) Automayed DNA sequencing and analysis of 
the human genome. Genomics 1:201-212 

Hunkapillar T, Kaiser RJ, Koop BK, Hood L (1991) Large-scale and automated DNA sequence 
determination. Science 254:59-67 

Macilwain C (2000) World leaders heap praise on human genome landmark. Nature 

Malhotra D, Relhan V, Reddy BS, Bamezai R (2005) TLR2 Arg677Trp polymorphism in lep- 
rosy: revisited. Hum Genet 116:413-415 

Maxam AM, Gilbert W (1977) A new method for sequencing DNA. Proc Natl Acad Sci 

Mir MM, Dar NA, Gochhait S, Zargar SA, Ahangar AG, Bamezai R (2005) p53 mutation pro- 
file of squamous cell carcinomas of the esophagus in Kashmir (India) - a high incidence 
area. Int J Cancer 116:62-68 

Mullis KB, Faloona FA (1987) Specific synthesis od DNA in vitro via a polymerase-catalyzed 
chain reaction. Methods Enzymol 155:335-350 

Mullis KB, Faloona FA, Scharf SJ, Saiki RK, Horn GT, Erlich HA (1986) Specific enzymatic 
amplification of DNA in vitro: the polymerase chain reaction. Cold Spring Harb Symp 
Quant Biol 51:263-273 

O'Brien KM, Wren J, Dave VK, Bai D, Anderson RD, Rayner S, Evans GA, Dabiri AE, 
Garner HR (1998) ASTRAL, a hyperspectral imaging DNA sequencing. Rev Sci Instr 

Ronaghi M (2001) Pyrosequencing sheds light on DNA sequencing. Genome Res 11:3-11 

Sanger F, Nicklen S, Coulson AR (1977) DNA sequencing with chain- termination inhibitors. 
Proc Natl Acad Sci 74:5463-5467 

Service RF (1998) Picking up the pace of sequencing. Science 280:995 

Smith LM, Fung S, Hunkapillar MW, Hunkapillar TJ, Hood L (1985) The synthesis of oligo- 
nucleotides containing an aliphatic amino group at the 5' terminus: synthesis of fluores- 
cent DNA primers for use in DNA sequence analysis. Nucleic Acids Res 13:2399-2412 

Smith LM, Sanders JZ, Kaiser RJ, Hughes P, Dodd C, Conell CR, Heiner C, Kent SBH, 
Hood LE (1986) Fluorescence detection in automated DNA sequence analysis. Nature 

3. Automated Fluoroscence Sequencing and Troubleshooting 51 

Sterky F, Lundeberg J (2000) Sequencing genes and genomes. J Bacteriol 76:1-31 

Swerdlow H, Zhang JZ, Chen DY, Harke HR, Grey R, Wu S, Fuller C, Dovichi NJ (1991) 

Three DNA sequencing methods using capillary gel electrophoresis and laser-induced 

fluorescence. Anal Chem 63:2835-2841 
Zhang JZ, Fang Y, Hou JY, Ren HJ, Jiang R, Roos P, Dovichi NJ (1995) Use of non-cross linked 

polyacrylamide for four-colour DNA sequencing by capillary electrophoresis separation 

of fragments up to 640 bases in length in two hours. Anal Chem 67:4589-4593 

mRNA Quantitation Using Real Time PCR 

S. Gochhait, S.I. Bukhari, and R.N.K. Bamezai 

Many cellular decisions concerning survival, growth, and differentiation are re- 
flected in altered patterns of gene expression; and the ability to quantitate tran- 
scription levels of specific genes has always been central to any research to un- 
derstand gene function (Zamorano et al. 1996). In the recent past, the use of real 
time PCR has become an important tool in determining the expression of drug 
resistance markers in tumor cells (Ramachandran and Melnick 1999), monitor- 
ing responses to chemotherapy (Desjardin et al. 1999), providing a molecular 
assessment of tumor stage (Bustin and Dorudi 1998), and detecting bacterial 
(Hill 1996) and viral pathogens (Holodniy 1994; Jothikumar et al. 2005), sug- 
gesting its wide range of applications in clinical diagnostics. 

There are four methods commonly used for quantification of transcrip- 
tion: Northern blotting and in situ hybridization (Parker and Barnes 1999), 
RNAse protection assays (Hod 1992; Saccomanno et al. 1992), and the reverse 
transcription-polymerase chain reaction (RT-PCR; Weis et al. 1992). A fifth 
method, cDNA arrays, is of limited use because of cost considerations. Of all 
these, RT-PCR is the most sensitive. It involves an in vitro method for enzy- 
matically amplifying defined sequences of RNA (Rappolee et al. 1988), which 
after gel electrophoresis allows target quantitation by comparison of the intensi- 
ties of ethidium bromide stained control and target bands (Raeymaekers 1999). 
Conventional RT-PCR provides an endpoint detection method, but it is fraught 
with limitations. Poor precision, low resolution, non-automated, labor-inten- 
sive, involves post-PCR processing are some of the limitations which makes it 

National Centre of Applied Human Genetics, School of Life Sciences, 

Jawaharlal Nehru University (JNU), New Delhi-1 10067, India, Fax: +91-011-26103211, 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmuller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

S. Gochhait, et al. 

unsuitable for routine use, especially when several targets from many samples 
require quantification. 

Constant efforts to enhance the accuracy of quantitation of transcription 
level led to the development of real time quantitative PCR, which allows cycle- 
by-cycle detection of accumulated PCR products by combining thermal cycling, 
fluorescence detection, and application-specific software. The seminal papers 
describing real time PCR were published in the year 1996 (Gibson et al. 1996; 
Heid et al. 1996). Today a search in Pubmed (NCBI data base) with the key- 
word "real time PCR" alone shows thousands of publications, suggesting the 
widespread acceptability that this method enjoys. However, obtaining accurate 
and reproducible information about the use of real time PCR for gene expres- 
sion studies requires a thorough understanding of the nuances of the technique 
and the probable pitfalls associated with it. In the present chapter we discuss 
the basic steps involved in real time PCR assay development along with some 
important considerations for experimental design and data analysis. 

Chemistry and Primer/Probe Design 

Based on the fluorescent reporter molecule used for detection, real time PCR 
can be categorized into two types: (i) non-specific detection, using DNA bind- 
ing dyes, e.g. Syber green, (ii) specific detection, using target specific probes, e.g. 
molecular beacons, FRET hybridization probes, Taqman probes and Scorpion 
probes. We describe here the most commonly used real time PCR chemistry, 
the "Taqman assay" (Fig. 4.1). This utilizes the 5' nuclease activity of the DNA 
polymerase to hydrolyze a hybridization probe bound to its target amplicon. Af- 
ter the reverse transcription step, successful quantification requires the anneal- 
ing of three oligonucleotides to the DNA. Two template-specific primers define 
the endpoints of the amplicon and provide the first level of specificity. The ad- 
ditional specificity of this assay is provided by the use of a third oligonucleotide 
probe that hybridizes to the amplicon during the annealing/ extension phase of 
the PCR. The probe is labeled at its 5' end with a fluorescent reporter dye and 
at the 3' end with a quencher molecule that can be either fluorescent or non- 
fluorescent. Although the labels do not necessarily have to be on the 5' and 3' 
nucleotides, this is the most common and effective probe design. To prevent the 
probe from acting as a primer in the PCR, the 3' end of the oligonucleotide is 
blocked with a phosphate group instead of a 3' hydroxyl group. When the probe 
is in solution and single-stranded, it is able to adopt conformations whereby the 

4. mRNA Quantitation Using Real Time PCR 

Polymerization f R J 

Forward Primer > w \ Probe 

Strand displacement 

Polymerization completed 

Reverse Primer 

Fig. 4.1 Stepwise representation of the forklike structure-dependent, polymerization-associated, 5' 
to 3' nuclease activity of Taq DNA polymerase activity on a fluorogenic probe during one extension 
phase of PCR 

5' and 3' dyes are very close together. When the probe is in these conditions, 
any light absorbed by the reporter dye is transferred by fluorescence resonance 
energy transfer (FRET) to the quencher dye. If the quencher is a fluorescent 
molecule, then the transferred energy is released as light of a longer wavelength, 
whereas non-fluorescent quenchers dissipate the energy as heat. In either case, 
the shorter wavelength fluorescence that would typically be emitted by the re- 
porter dye is quenched when the probe is intact and single-stranded. At the be- 
ginning of a PCR reaction, there is very little specific probe target present, and 
therefore almost all the probe molecules are single-stranded and quenched. As 
the PCR proceeds, target sequences are amplified and accumulate exponentially. 
During the annealing/ extension phase of each cycle, probe molecules bind to the 
homologous strand of the target sequences and form short stretches of double- 
stranded (ds)DNA. The polymerase extends the primers until it reaches the hy- 
bridized probe, where it displaces its 5' end to hold it in a forked structure. The 
enzyme continues to move from the free end to the bifurcation of the duplex, 

S. Gochhait, et al. 

where cleavage takes place (Lyamichev et al. 1993). This separates the reporter 
and quencher dyes and releases quenching of reporter fluorescence emission. 
This process repeats until the remaining probe is too short to remain hybrid- 
ized and dissociates from the target sequence, allowing the polymerization to 
be completed. Thus, when excited by light of an appropriate wavelength, it emits 
fluorescence that can be detected and distinguished from quencher dyes fluo- 
rescence based on its different emission wavelength. In this way, reporter dye 
fluorescence increases at each cycle in a cumulative fashion and is therefore pro- 
portional to the amount of PCR product generated. It is this increase in reporter 
dye fluorescence that is used to generate the PCR amplification plots. 

Primer and probe selection is based on estimated T m , the desire for a small 
amplicon size and the location of the primer/probe. The Taqman system provides 
its own primer/probe design program, Primer Express. The current version usu- 
ally generates appropriate primer/probe sets, but it contains several bugs that 
can make primer design difficult, and it requires manual fine-tuning. There are 
several alternative software tools available: Oligo (Molecular Biology Insights, 
Cascade, Colo., USA; and the Beacon Designer are some of 
them. Applied Biosystems also provides a standardized 20x primer/probe mix 
as Assay On Demand (AOD) gene expression systems for a wide range of target 
genes. The following are some guidelines for primer/probe design. 

1 . Amplicon size 

Maximum amplicon size should not exceed 150 bases. Shorter amplicons 
amplify more efficiently than longer ones and are more tolerant to reaction 
conditions. As the extension rate of Taq polymerase is between 30-70 bases/ 
s, it also means that a polymerization time as short as 15 s is sufficient to rep- 
licate the amplicon, making the amplification of genomic DNA contaminants 
less likely and reducing the time it takes to complete the assay. 

2. Primer design 

Primer length should be 15-30 bp with 30-80% GC content and a melting 

temperature (T m ) of 58-60 °C. The T m of both the primers should be equal or 

the difference in T m should be <2 °C. 

Runs of four or more consecutive identical bases, e.g. four Gs should be 

The five 3' bases of the primers should consist of no more than two or three G 

or C residues. This helps to reduce non-specific priming. 

3. Probe design 

Length of the probe should be of 9-40 bases with 30-80% GC content and 
a T m 10 °C above those of the primers (68-70 °C). As amplification primers 
are extended as soon as they bind to their targets, the hybridization target se- 
quence is rapidly masked with newly synthesized DNA. Therefore, the T m of 
the probes must be significantly greater than that of the primers to ensure that 
they hybridize before the primers. The fluorescence of exonuclease probes is 
correlated with probe hydrolysis, and they must be available for cleavage dur- 
ing the polymerization step, to allow fluorescence measurement. 

4. mRNA Quantitation Using Real Time PCR 57_ 

It is better to position the probe closer, i.e. within 1-4 bases, if possible, to the 

forward primer. 

Runs of four or more consecutive identical bases, e.g. four Gs should be 

The presence of more Cs than Gs is desirable and a G at the 5' end should be 

avoided, because such an arrangement quenches reporter fluorescence, even 

after cleavage. 

4. False-positive results are obtained due to amplification of contaminating ge- 
nomic DNA, if primer/probe are designed in exons only. Thus, it is prefer- 
able to have primer/probe spanning exon-exon junctions (Godfrey and Kelly 

5. For each primer and probe sequence, run a separate Blast search as well as a 
search with the whole PCR amplicon, to rule out any homology with a non- 
specific sequence. 

6. In the relative gene expression study, variations in the quality and quantity 
of RNA used in the reaction as well as those introduced by the reverse tran- 
scription step can lead to a considerable amount of error in the final gene 
expression profiles of the target genes. To minimize such an error, the ex- 
pression of the target genes need to be normalized with the expression of an 
endogenous control, which ideally should not vary from sample to sample, or 
in experimental conditions (see note 7, Section 4.3). This is analogous to the 
use of Actin or GAPDH as a control for loading and transfer for Western and 
Northern analysis. An appropriate gene should be selected to serve as control 
for the experiments and primer/probe for the same should also be designed. 

RNA Isolation from the Sample 

Several total RNA isolation methods in the form of kits/reagents are available 
from suppliers, and the appropriate selection of method depends on the us- 
ers' laboratory set up. TRIzol reagent (Invitrogen, Sigma) or kits from Qiagen, 
Sigma work well in our experience. RNA isolation is a critical step in the whole 
process and it is essential that the quantity and quality of the RNA preparation 
be checked by UV spectroscopy and 1% agarose gel electrophoresis (Fig. 4.2). A 
peak at 270 nm indicates phenol contamination while that of protein is reflected 
in low 260/280 ratios (<1.8). The pH of the RNA solutions may significantly af- 
fect the 260/280 ratio, therefore measurements should be taken in 10 mM TE 
buffer, pH 7.5. Mix 0.5-2.0 ug total RNA in denaturing sample loading buffer. 
Denature at 65 °C for 2 min. Then, briefly spin and place on ice before load- 
ing onto the native agarose gel. An RNA ladder is loaded as a marker. The ap- 
pearance of sharp 28s and 18s rRNA which migrate at approximately 5 kb and 
1.9 kb markers, respectively, relative to a single stranded RNA ladder indicates 

S. Gochhait, et al, 

Fig. 4.2 Gel analysis of 
total RNA prepared from 
a HeLa cell line. The 
smears in wells 2 and 3 
indicate degraded RNA, 
while the distinct bands 
of 28s and 18s in wells 1 
and 4 show good-quality 
RNA. Low-mobility 
bands found in wells 
1 , 2 and 3 show gDNA 
contamination in these 

the integrity of the isolated RNA; whereas diffused and smeared bands are an 
indication of serious degradation. Low molecular weight 5s rRNA and tRNA 
may sometimes appear as faster migrating diffuse bands. The appearance of 
sharp and distinct high molecular weight bands running much slower than the 
28s rRNA band is indicative of possible DNA contamination. The following are 
some points to be considered during RNA isolation to avoid commonly faced 

1 . All materials and reagents must be RNase free. 

2. RNA pellet should be completely resuspended by heating it at 55-60 °C for 
10 min. 

3. A low UV 260/280 ratio indicates phenol or protein contamination. It re- 
quires an additional phenol/chloroform/ethanol step. 

4. Follow the manufacturer s recommendations strictly. 

5. gDNA contamination can be avoided by careful separation of the aqueous 
phase and by not disturbing the interphase containing DNA. If DNA con- 
tamination still persists then the RNA should be subjected to DNase I diges- 
tion (Sigma, USA) followed by re-precipitation of RNA. 

Reverse Transcription 

1. Using the positive control RNA, set up on ice an RT and a no-RT control as 
shown in Table 4.1. 

2. For the no-RT reaction, use water in place of Omniscript reverse trancriptase 

3. In the thermal cycler, incubate the reaction at 37 °C for 60 min and hold at 

4. mRNA Quantitation Using Real Time PCR 

Table 4.1 Reaction set up for reverse transcription 

Final concentration 

Master mix 

1 Ox buffer RT 

dNTP mix (5 mM 
each dNTP) 

RNase inhibi- 
tor (40 units/ ul) 

Omniscript reverse tran 
scriptase (4 units/ ul) 

RNase-free water 

Template RNA 

Total volume 

2.00 ul 
2.00 ul 

Random hexamer ( 1 00 uM) 2.00 ul 

0.25 ul 

1.00 ul 

20.00 ul 

0.5 mM each dNTP 

10 uM 

10 units per 20 (il reaction 

4 units per 20 ul reaction 

Up to 2 ug per 20 ul reaction 

4. Store cDNA at 4 °C or -20 °C if long-term storage is required with infrequent 

5. If using oligo-dT, then final concentration should not be less than 1 \xM and 
optimization is required when specific primer are used (see note 6). 

Real Time PCR Set Up 

Before proceeding to this step, one should have an idea about the array of ex- 
perimental designs that the process can be subjected to. The following are some 
important considerations for experimental designs: 

1. If the assays on demand (AOD) primer/probe mix (Applied Biosystems, 
USA) is not used then one has to optimize the PCR, check the efficiency of 
the primer/probe (Godfrey and Kelly 2005). 

2. One can follow the standard curve method or comparative C T method (see 
Sections 4.2.5, 4.2.6; PE Applied Biosystems 1997; Livak and Schmittgen 
2001), each of which again can be put in a single tube or multiplexed. 

3. Running the target and the endogenous control amplification in separate 
tubes and using the standard curve method of analysis requires the least 
amount of optimization and validation. 

4. To use the comparative C T method, a validation experiment must be run to 
show that the efficiencies of the target and endogenous control amplification 
are approximately equal. A sensitive method for assessing this is to look at 

S. Gochhait, et al. 

how AC T (target gene C T - endogenous control gene C T ) varies with template 
dilution (see Sections 4.2.5, 4.2.6). The absolute value of the slope of log input 
amount of RNA vs AC T should be <0.1 (Benoy et al. 2004). The advantage of 
the comparative C T method lies in eliminating the need for a standard curve. 
This increases throughput because wells no longer need to be used for stan- 
dard curve samples. Moreover, while using the single-tube comparative C T 
method, the same amount of cDNA should be used for amplifying the target 
gene and endogenous control. 
5. To amplify the target and endogenous control in the same tube, limiting 
primer concentrations (see note 8) must be identified and shown not to affect 
the C T value. By running the two reactions in the same tube, the throughput 
is increased and the effects of pipetting errors are reduced. A drawback of us- 
ing the multiplex PCR is in introducing some errors into the final results due 
to multicomponenting. 

Table 4.2 shows the reaction set up for single-tube PCR amplification using 
ABI reagents. 

Spin down the reaction to avoid air bubbles. Seal the tubes with caps and 
perform PCR in the ABI 7000 sequence detection system (Applied Biosystems, 
USA) following conditions provided in Table 4.3. Ensure that sample details 
(e.g. name, position, detector, total volume of reaction) are appropriately pro- 
vided to the machine before starting the run. 

Table 4.2 Reaction set up for single-tube PCR amplification using ABI reagents 

Component Volume/reaction Final concentration 

Universal Taqman PCR 12.50 ul lx 
master mix (2x) 

AOD primer/probe 1.25 ul lx 
mix (20x) 

Primer (forward) 1.25 ul 900 nM 

Primer (reverse) 1.25 ul 900 nM 

Probe 0.5 ul 250 nM 

cDNA target 5.00 ul 

Water q.s. 

Total volume 25.00 ul 

4. mRNA Quantitation Using Real Time PCR 61 

Table 4.3 Cyclization conditions used in real time PCR (ABI 7000) 

Initial steps Each of 40 cycles 

Anneal/ extension 

Hold Cycle 

50 °C for 2 min a 95 °C for 95 °C for 1 5 s 

10min b 

60 °C for 1 min 

a The 2 min hold at 50 °C is required for optimal AmpErase UNG activity (see note 9, Section 4.3) 
b The 10 min hold at 95 °C is required for Ampli Taq Gold DNA polymerase activation 

In recent years, many real time PCR machines have been introduced which are 
cost effective. The ABI prism 7700/7000 (PE Applied Biosystems, Foster City 
Calif., USA), which is comparatively costlier, has become a part of the core facil- 
ity in all leading research centers around the world. It contains a built-in ther- 
mal cycler with 96 well positions, and is able to detect fluorescence between 
500 nm and 660 nm. It can be used for assays based on DNA binding dyes, mo- 
lecular beacons, and hydrolysis probes. RT-PCR reactions typically take 2 h to 

During PCR, light from a tungsten-halogen lamp gets focused simultane- 
ously to each well on the microplate. The light passes through the opening of 
the sample well and the light excites the fluorescent dyes present in each well of 
the consumable. The resulting fluorescence emission is collected from each well 
during the extension phase of the PCR reaction. A system of lenses, filters, and a 
dichroic mirror focuses the fluorescence emission into a charge-coupled device 
(CCD) camera. The filters separate the light (based on wavelength) into a pre- 
dictably spaced pattern across the CCD camera. The software collects the fluo- 
rescent signals from the CCD camera and applies data analysis algorithms by 
which the composite spectra is separated from the raw spectrum, the contribu- 
tion of each dye is determined, the background contribution is eliminated, the 
reporter signal is normalized with respect to passive reference dye, and finally 
the software displays the cycle -by- cycle changes in the normalized reporter sig- 
nal (AR n ) as an amplification plot. The passive reference dye is a component 
of the PCR master mix and hence it is present at the same concentration in all 
the wells of the plate. By normalizing the data using the passive reference, the 
software can account for minor variations in signal strength caused by pipetting 
inaccuracies and make better well-to-well comparisons of reporter dye signal. 
The graph of normalized reporter CR n ) versus cycle number during PCR appears 

S. Gochhait, et al. 

to have three stages. Initially, R n appears as a flat line because the fluorescent sig- 
nal is below the detection limit of the sequence detector. In the second stage, the 
signal can be detected as it continues to increase in direct proportion to the in- 
crease in the products of PCR. As PCR product continues to increase, the ratio 
of Taq polymerase to PCR product decreases. When the template concentration 
reaches 10" 8 M, the PCR product ceases to grow exponentially. This signals the 
third stage of R n change, which is roughly linear and finally reaches a plateau at 
about 1(T 7 M (Figs. 4.3, 4.4). 

After the run is finished, one needs to set the threshold and baseline (see note 
10). This is done to deduct the background noise. The software then calculates 
the C T value for each amplification curve, which for a given amplification curve 
occurs at the point that the fluorescent signal grows beyond the value of the 
threshold setting. The C T represents a detection threshold for the machine and 
is dependent on two factors: 

1 . Starting template copy number. 

2. Efficiency of DNA amplification on the PCR system. 

Thus the system creates quantifiable relationships between test samples on 
the number of cycles elapsed before achieving detectable levels of fluorescence. 
Test samples containing a greater initial template number cross the detection 
threshold at a lower cycle and have a lower C T value than samples containing a 
lower initial template. 

► Fig. 4.3 Typical displays of the contribution of each component spectrum when (a) FAM- and 
(b) VIC-labeled probes are used separately in a real time PCR reaction in the presence of FAM, 
VIC, and ROX dye detector b see next page 

4. mRNA Quantitation Using Real Time PCR 

S. Gochhait, et al. 

Fig. 4.3 (continued) Typical displays of the contribution of each component spectrum when (a) 
FAM- and (b) VIC-labeled probes are used separately in a real time PCR reaction in the presence 
of FAM, VIC, and ROX dye detector 

4. mRNA Quantitation Using Real Time PCR 

fflSfcNfcHiafiMiW s 1 

■ ii 

\\i \\ - 

x x 

^wl^^*. ^Ssj 

hj^- X^ 

*. V ■ X^^"^ 

"^^^lT^^s^^ ">- 

r x^w.^*^^ "*x*. 

i% ^X^**x^^^ 

^^L ^^^1 

tefr^^i x* 

^'i-^'s^ TB^t" -. 

^^^ pT" 

tL m L 

3 iD CD ■* f 

h a * 

Fig. 4.4 Real time amplification depicted as (a) linear plot and (b) log plot, showing baseline, 
threshold, and Cj b see next page 

S. Gochhait, et al. 

Fig. 4.4 (continued) Real time amplification depicted as (a) linear plot and (b) log plot, showing 
baseline, threshold, and Cr 

4. mRNA Quantitation Using Real Time PCR 

Data Analysis 

Table 4.4 shows the calculation for a set of experiments, which consists of chem- 
ically treated or untreated tissue cell line culture. The target gene and the endog- 
enous control gene have been amplified separately and the relative gene expres- 
sion is calculated by the comparative C T method. The final result is illustrated in 
Fig. 4.5. 

Table 4.4 Calculation for a set of experiment consisting of chemically treated or untreated tissue 
cell line culture. SD Standard deviation 

AC T (target 

gene C T 

gene C T 

gene C T 

- control 
gene C T ) 

AveragetSD 19.95 ±0.06 13.76±0.05 

Average±SD 18.9±0.05 

Fig. 4.5 Graphical representation of rela- 
tive gene expression data. The normalized 
target gene expression in the treated 
sample is increased 5-fold as compared 
with the untreated sample (calibrator) 

S. Gochhait, et al, 

1 . Work area should be clean and dust-free. 

2. To avoid contamination of the stock primers and probes, it is important to 
use clean, fresh TE buffer for the reconstitution as well as diluting the prim- 
ers/probes. The stock primers and probes must be stored at -20 °C while 
the working solutions can be kept at 4 °C for 1-2 months to avoid repeated 
thawing and freezing, to avoid damage. 

3. Data variability and pipetting errors can be greatly reduced by making mas- 
ter mixes of all common reagents whenever possible. 

4. Run appropriate controls along with each batch of samples. Each RT-PCR 
run should contain duplicate or triplicate reactions for NTC (no -tem- 
plate controls) and positive PCR controls. In most cases, we also run no- 
RT (without RT enzyme) controls, even if we know that the assay design 
is cDNA-specific, as this control also detects RT reagent contamination if 
it is present. The positive control should be a cDNA from an RNA sample 
known to express the target gene(s). The purpose of this control is to show 
that the PCR step was set up properly and functioned as expected. This is 
particularly useful when the samples show low or negative expression of the 
target gene. The NTC is used to detect PCR reagent contamination. 

5. Be consistent with every step of the assay. Always try to perform each part 
of the RT-PCR assay the same way, i.e. use the same RNA isolation proce- 
dure, quantification, same amount of RNA for RT reaction (by spectroscopy 
measurement), same amount of target (cDNA) for the real time PCR; do not 
change reagent brands without ensuring that the data does not change; set 
the same threshold for at least the same gene. This allows one to identify the 
problem when something goes wrong at any step. 

6. RTs extend a double-stranded oligonucleotide in a 5' to 3' direction. As 
such, the synthesis of a cDNA strand from a single-stranded mRNA requires 
a primer (with DNA better than RNA). Traditionally, three primer systems 
have been used for this purpose: 

a. The first is hexamer oligonucleotides with random sequences. These prim- 
ers bind to the RNA randomly and reverse transcribe all RNA proportion- 
ately. The advantages of using this method are several. First, this method 
reverse transcribes ribosomal RNA as well as mRNA, allowing for use of 
18S rRNA as the endogenous invariant gene control. Second, it does not 
require prior planning for the targets of choice for PCR amplification. 
Last, this approach is insensitive to sequence polymorphism and muta- 
tions and can be somewhat beneficial when there is RNA degradation. The 
main disadvantage to this system is that one is limited to 1-3 |ig of total 
RNA input before the reaction saturates and becomes non-quantitative. 

b. The second primer system for cDNA synthesis is the use of oligo dT 
(15-20 base poly-T primer). This binds to the poly A sequence of mRNA 

4. mRNA Quantitation Using Real Time PCR 69 

and reverse transcribes mRNA from its 3' poly A tail in a 5' direction. 
The potential advantage of this system is that it can support a larger input 
of RNA, because it reverse-transcribes only mRNA, which accounts for 
2-5% of the total RNA. Similar to the hexamer method, this approach 
also allows one to examine any mRNA transcript, as well as evaluate the 
expression of new genes as they become important at future dates. How- 
ever, the greatest disadvantage of this approach is that the results can vary 
based on the quality of the RNA. As more of the RNA is degraded, there 
are fewer full-length transcripts. Therefore, the evaluation of gene expres- 
sion using sequences at the 5' end of the message can be unreliable and 
even artifactual, especially when the possibility exists that the different 
samples may have slightly different RNA integrity (as is the case with 
most clinical samples), 
c. The third and the last method utilizes sequence-specific RT primers. 
Here RT can be performed using gene-specific primers that are reverse- 
complemented to a region 3' of the region of interest for PCR. Also, be- 
cause mRNA is single-stranded, only one primer is needed. Owing to the 
relatively small number of mRNA molecules undergoing RT by this ap- 
proach, RNA input in excess of 10 \xg (dependent on the level of gene 
expression) can often be used in a single RT reaction using optimized 
protocols. Additionally, multiplex RT with several gene-specific primers 
can also be used without a loss in quantitation. The practice of using the 
reverse PCR primer in the RT should be discouraged, because the high 
T m of the PCR primer (-60 °C) will result in non-specific priming during 
the relatively low- temperature RT and regions 3' of the RT primer will 
not be reverse transcribed and thus cannot be used in future. 
7. Actin, GAPDH, and 1 8sRNA are the most commonly used endogenous con- 
trol genes but histone 3, phosphoglycerate kinase 1, (3-2 microglobulin, cy- 
clophilin A and (3-glucoronidase have been also used in a few instances. Out 
of these, particularly, GAPDH has been under a scanner for use as a normal - 
izer (Bustin et al. 2000). Reports show that its expression changes under a 
variety of circumstances, suggesting a complex regulatory mechanism for 
the gene expression. Its expression level changes during the cell cycle (Man- 
sur et al. 1993), therefore it should not be used as an endogenous control 
when doing experiments on animal tissue culture cell line; alternatively har- 
vesting of the cells has to be done at the same confluence level. The same is 
correct when comparing gene expression between normal and tumor tissue, 
as the latter contains more actively dividing cells. Still, it is being used as an 
endogenous control owing to the fact that almost all the genes in the eukary- 
otic system invariably involve a complicated gene expression modulation. 
There is also a trend of using total RNA input (by accurate spectroscopy 
reading) as normalizing factor but it has its own limitations. Contaminating 
protein, free nucleotides, genomic DNA contamination, and other impuri- 
ties influence the spectroscopic reading of RNA at 260 nm. However, it is 
safe to consider more than one control for experimental purposes until and 

S. Gochhait, et al. 

unless it is proved that a particular control shows most stable expression in 
ones system. Thus there is an urgent need for a search of relevant and uni- 
versal normalizer for accurate quantification of gene expression. 
8. Multiplex PCR is the use of more than one primer pair in the same tube. 
This can be used in relative quantitation when one primer pair amplifies the 
target and the other primer pair amplifies the endogenous reference in the 
same tube, provided that the reporter dyes used in the probes have differ- 
ent emission wavelength maxima. The ABI prism 7700 sequence detection 
system has multicomponenting software, which uses a mathematical algo- 
rithm to determine the contribution of each dye using a pure dye spectra 
reference. But this can introduce some errors and the best way to get rid of 
this is to have reporter dyes having their largest differences in the emission 

wavelength maxima, e.g. 6-FAM, X 

= 518 nm, JOE, X 

= 554 nm. 

Reactions to amplify two different segments in the same tube share common 
reagents and, if the initial copy number is different than the more abundant 
species, will use up common reagents and ultimately hamper the amplifi- 
cation of rare species. Thus for accurate quantification, the primers of the 
abundant species can be limited. Fig. 4.6. shows amplification with the same 
amount of target but with different primer concentrations. It demonstrates 
that a lower primer concentration forces the reaction to enter the plateau 
phase at a lower level of product but C T remains the same (except for 5 nM). 
Thus the strategy for performing two independent reactions in the same 
tube is to adjust the primer concentrations such that C T values are obtained 
after which the exhaustion of primers leads to the end of reaction for the 
majority species so that the common reactants are available for amplifica- 
tion of the minority species. When both have the same or unknown mRNA 
abundance, then the limiting primer concentration needs to be defined for 
both amplicons. It can be defined by running a matrix of forward and re- 
verse primer concentration. The desired concentrations are those that show 
a reduction in AR n but have little effect on C T . 

Fig. 4.6 PCRamplifica 
tion with decreasing 
primer concentration 

4. mRNA Quantitation Using Real Time PCR 71 

9. Uracil-N-glycosylase (UNG) is the active ingredient in AmpErase. UNG 
recognizes and catalyzes the destruction of DNA strands containing deoxy- 
uridine but not the DNA containing thymidine. Incorporation of AmpErase 
into the master mix allows for the selective destruction of carryover prod- 
ucts (containing deoxyuridine) from previous amplification reactions. UNG 
catalyzes the cleavage of deoxyuridine-containing DNA at the deoxyuridine 
residues by opening the deoxyribose chain at the CI position. When heated 
in the first thermal cycle step at the alkaline pH of the master mix, the am- 
plicon DNA chain breaks at the position of the deoxyuridine, thereby ren- 
dering the DNA non-amplifiable. 

10. Baseline start and end cycles are chosen so that they correspond to the ini- 
tial cycles which show no amplification. Usually the narrowest linear part of 
the baseline in the linear amplification plot is selected and the end cycle se- 
lected is approximately five cycles before the first amplification starts. Base- 
line correction sets each curve at the origin. The threshold should be placed 
in linear part of the amplification plot above the noise. The run is analyzed 
once the baseline and the threshold are selected. The new SDS 1.1 version 
for data analysis by Applied Biosystems has auto baseline and threshold set- 
tings, which allows uniform correction. 

Benoy IH, Elst H, Van der Auwera I, Van Laere S, Van Dam P, Van Marck E, Scharpe S, Ver- 
meulen PB, Dirix LY (2004) Real-time RT-PCR correlates with immuno cytochemistry 
for the detection of disseminated epithelial cells in bone marrow aspirates of patients 
with breast cancer. Br J Cancer 91:1813-1820 

Bustin SA (2000) Absolute quantitation of mRNA using real-time reverse transcription poly- 
merase chain reaction assays. J Mol Endocrinol 25:169-193 

Bustin SA, Dorudi S (1998) Molecular assessment of tumour stage and disease recurrence 
using PCR-based assays. Mol Med Today 4:389-396 

Desjardin LE, Perkins MD, Wolski K, Horn S, Teixeira L, Chen Y, Johnson JL, Ellner JJ, Dietze 
R, Bates J, Cave MD, Eisenach KD (1999) Measurement of sputum mycobacterium tu- 
berculosis messenger RNA as a surrogate for response to chemotherapy. Am J Resp Crit 
Care 160:203-210 

Gibson UE, Heid CA, Williams PM (1996) A novel method for real time quantitative RT- 
PCR. Genome Res 6:995-1001 

Godfrey TE, Kelly LA (2005) Development of quantitative reverse transcriptase PCR assays 
for measuring gene expression. In: Keohavong P, Grant SG (eds) Molecular toxicology 
protocols. (Methods in molecular biology, vol 291) Humana, Totowa, pp 423-445 

Heid CA, Stevens J, Livak KJ, Williams PM (1996) Real time quantitative PCR. Genome Res 

Hill WE (1996) The polymerase reaction: applications for the detection of foodborne patho- 
gens. Crit Rev Food Sci Nut 36:23-173 

Hod Y (1992) A simplified ribonuclease protection assay. Biotechniques 13:852-854 

Holodniy M (1994) Clinical application of reverse transcription-polymerase chain reaction 
for HIV infection. Clin Lab Methods 40:335-349 

S. Gochhait, et al. 

Jothikumar N, Cromeans TL, Robertson BH, Meng XJ, Hill VR (2005) A broadly reactive one 
step real-time RT-PCR assay for rapid and sensitive detection of hepatitis E virus. J Virol 
Methods 131:65-71 

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time 
quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 25:402-408 

Lyamichev V, Brow MA, Dahlberg JE (1993) Structure specific endonucleolytic cleavage of 
nucleic acids by eubacterial DNA polymerases. Science 260:778-783 

Mansur NR, Meyer- Siegler K, Wurzer JC, Sirover MA (1993) Cell cycle regulation of the glyc- 
eraldehydes-3-phosphate dehydrogenase/uracil DNA glycosylase gene in normal human 
cells. Nucleic Acids Res 21:993-998 

Parker RM, Barnes NM (1999) mRNA detection by in situ and northern hybridization. Meth- 
ods Mol Biol 106:247-283 

PE Applied Biosystems (1997) Relative quantitation of gene expression. (User bulletin 2) Ap- 
plied Biosystems, Foster City 

Raeymaekers L (1999) General principles of quantitative PCR. In: Kochanowski B, Reischl U 
(eds) Quantitative PCR protocols, Humana, Totowa, pp 31-41 

Ramachandran C, Melnick SJ (1999) Multidrug resistance in human tumours - molecular 
diagnosis and clinical significance. Mol Diagn 4:81-94 

Rappolee DA, Mark D, Banda MJ, Werb Z (1988) Wound macrophage express TGF alpha and 
other growth factors in-vivo; analysis by mRNA phenotyping. Science 241:708-712 

Rychlik W, Spencer WJ, Rhoads RE (1990) Optimization of the annealing temperature for 
DNA amplification in vitro. Nucleic Acids Res 18:6409-6412 

Saccomanno CF, Bordonaro M, Chen JS, Nordstrom JL (1992) A faster ribonuclease prote- 
ction assay. Biotechniques 13:846-850 

Schutz E, Ahsen von N (1999) Spreadsheet software for thermodynamic melting point pre- 
diction of oligonuleotide hybridization with and without mismatches. Biotechniques 

Weis JH, Tan SS, Martin BK, Wittwer CT (1992) Detection of rare mRNAs via quantitative 
RT-PCR. Trends Genet 8:263-264 

Zamorano PL, Mahesh VB, Brann DW (1996) Quantitative RT-PCR for neuroendocrine 
studies. A minireview Neuroendocrinology 63:397-407 

Laboratory Practice for the Production 
of Polyclonal and Monoclonal Antibodies 

S. Khurana, S. Bhaskar, and A. Mukhopadhyay 

Antibody is defined as an immunoglobulin capable of specifically binding with 
the antigen that caused its production in a susceptible animal. Antibodies are 
produced by the plasma cell in response to the invasion of foreign molecules 
in a host. Immunoglobulins are glycoproteins and are present in five distinct 
classes in higher mammals: IgG, IgA, IgM, IgD, and IgE. They differ in size, 
charge, amino acid composition, carbohydrate content, and functions. IgG and 
IgA have different subclasses. 

Immunoglobulins have a basic unit of two light chains and two heavy chains 
held together by disulfide bonds. The light chain has molecular weight of 25 kDa, 
whereas the heavy chain molecular weight varies from 50 kDa to 77 kDa, de- 
pending upon the class of immunoglobulin. The chains are folded into discrete 
regions called domains; light chains have two domains and four to five domains 
are present in heavy chains. Half of the N-terminals of both light and heavy 
chains show much sequence variability and are known respectively as V L and 
V H domains (Fig. 5.1). Papain digestion generates two Fab fragments (antigen- 
binding sites) and one Fc fragment (antibody receptor-binding site) from each 
IgG molecule (Roitt et al. 1996). 

Antibodies are of two types, monoclonal and polyclonal. As the name sug- 
gests, a monoclonal antibody is a homogeneous population of antibodies pro- 
duced by a single clone, termed a hybridoma. A hybridoma produces many 
copies of a gene exactly for the same antibody that recognize one epitope on 
the antigen. Since monoclonal antibodies are highly specific, they are vulner- 
able to loss of antigen recognition if the epitope is modified through chemical 
treatments. In contrast, polyclonal antibodies are a heterogeneous mixture, 

National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi-1 10067, India, 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

S. Khurana, et al. 

binding site 

Light chain 

V L domain 

Heavy chain 

Fig. 5.1 Basic structure 
of Igd. It is composed of 
two heavy and two light 
chains, joined together 
by disulfide bonds. Vh 
and Vl domains are 
responsible for antigen 
detection and binding. 
Fc domain is involved for 
binding antibody with its 
cell surface receptor 

which recognizes a variety of epitopes on the same antigen. Because these poly- 
clonal mixtures of antibodies react with multiple epitopes of the antigen, they 
are relatively less specific and more tolerant of minor changes in the epitope. 

Production of Polyclonal Antibodies 

Raising polyclonal antibodies is much simpler than making monoclonal anti- 
bodies. The production of polyclonal antibodies consists of a few basic steps, 
like immunization of a suitable host, withdrawal of blood to check the antibody 
levels, final collection of blood, and purification of antibodies. It is analogous 
to the immunization of humans against certain diseases, where the humoral 
immune response (antibody response) is adequate to neutralize infection. The 
quantity and quality of the polyclonal antibodies produced from a given immu- 
nogen depend on a few important factors, as detailed in the next sections. 

Choice of Animal and Method of Immunization 

The choice of animal is governed by the amount of antibody required, the 
amount of immunogen/antigen available, and the phylogenetic relationship 
between the animals from which the antigen is obtained. For obvious reasons, 
phylogenetically unrelated species are considered to raise antibodies against 
an antigen. A good antibody response is generally obtained if slowly released 
antigen is processed by antigen -presenting cells (APCs) and subsequently pre- 

5. Laboratory Practice for the Production of Polyclonal and Monoclonal Antibodies 75 

sented to the T-cells. The antigen is mixed with adjuvant, and injected by either 
intradermal (ID), or intramuscular (IM), or subcutaneous (SC) routes in mul- 
tiple sites (6-10) of the animal. Further, booster (secondary) immunization be- 
come necessary for a high antibody titer. 

Preparation for Immunization 

Irrespective of the type of antigen injected, preparation for the production of 
polyclonal antibody remains unaltered. The general details are given here. 

Rabbit, sheep, goat, and chicken are commonly used as hosts to produce poly 
clonal antibodies. 

Freunds complete adjuvant (FCA), Freunds incomplete adjuvant (FIA), alum, 
muramyl dipeptide, and monophosphoryl lipid A can be used as an adjuvant. 
However, the most potent antibody response is obtained with FCA. Except 
Freunds adjuvant, other antigen -adjuvant preparations can be stored for several 
months at 4 °C. Antigen preparation with Freunds adjuvant should be made at 
the time of immunization (within 1-2 h). If FCA is used, it is recommended to 
make a uniform suspension of the adjuvant before mixing with the antigen. As 
a general rule, adjuvant and antigen solution are mixed in equal volumes. To 
prepare a uniform suspension, first Adjuvant (say 1 ml) is taken in a siliconized 
glass-vial, and to it 1 ml of detergent-free antigen solution in normal saline is 
added drop -wise with vigorous mixing. The final concentration of antigen is 
maintained at 0.2-2.0 mg/ml, depending upon the application. 

Antigen and Immunization Schedule 

The quantity of antigen to be injected, the duration, and the number of booster 
injections are determined by the nature of antigen and the host animal. The ex- 

S. Khurana, et al. 

act quantity of antigen to be injected and the ideal host for the specific antigen 
are decided by trial and error. In the case of rabbits, primary immunization with 
50-200 \xg antigen (non-rabbit source) in FCA is injected at several sites on the 
back of the animals (100-150 ul in each site). For each booster, the same dose 
of antigen in FIA is similarly injected 3-4 weeks after primary immunization. 
Primary immunization with 0.5-10.0 mg antigen (non-sheep/non-goat sources) 
in FCA is recommended for sheep and goats. The booster immunization is ex- 
actly similar to rabbits, except with a higher amount (0.5-10.0 mg) of antigen 
(Johnstone and Thorpe 1996). Chickens are immunized similar to rabbits, ex- 
cept that the booster is given 2-3 weeks after primary immunization. 

Production of Polyclonal Antibodies 

The procedure for manufacturing polyclonal antibodies in rabbits are given be- 

1. Take healthy rabbits (age: 4-6 months, weight: 0.5-0.6 kg) and be sure that 
the animals were not used in an immunization program in the past 6 months. 
Bleed the animals from an ear vein (2-3 ml blood) to check the total IgG level 
(pre-immunized) in the blood, and also to determine the presence of specific 
antibodies for which immunization has been planned. 

2. Prepare fresh FCA- antigen suspension, clean the back of the animals with 
70% ethanol, and inject 100 ul of suspension in 6-10 sites through the ID 
route. Maintain the rabbits as usual. 

3. At 3-4 weeks after primary immunization, a booster dose of antigen is in- 
jected, same as above. 

4. Bleed the animals through an ear vein 2 weeks after booster, and determine 
the antibody titer. When the sera contain a high level of antibody, it is ad- 
visable to sacrifice the animal and collect the entire blood through a heart 
puncture. About 60-70 ml blood can be collected from a rabbit. Alternately, 
weekly bleeding for 1-2 months is performed through jugular vein. In each 
bleed, about 15 ml of blood is collected. 

5. Antibodies are present in the serum fraction of the blood, so blood cells are 
separated soon after collecting blood. Otherwise, lysed cells contribute pro- 
tein contamination in the antibodies; also, proteolytic enzymes may degrade 
the antibodies. 

6. Allow blood to clot at room temperature for 1 h, detach clot from the walls of 
the container, and separate clot-free serum. 

7. Centrifuge clot for 30 min at 2000 g at 4 °C to remove trapped serum and mix 
with the clot-free serum. 

8. Further, centrifuge the pooled serum at 1500^ for 20 min at 4 °C. Store 
the serum at -20 °C or -70 °C, if not immediately subjected to purification 

5. Laboratory Practice for the Production of Polyclonal and Monoclonal Antibodies 77 

Materials and Equipment 

Polyclonal antibodies can be easily raised, as the production steps do not require 
any sophisticated laboratory facility. Besides the animal, it requires the adjuvant 
and the antigen, a bench-top centrifuge, glass/plastic containers for storing sera, 
and a freezer at -20 °C or -70 °C. 

Production of Monoclonal Antibodies 

Mice and rats have the ability to make antibodies which are able to recognize 
virtually all antigenic determinants and even discriminate between similar epi- 
topes. These make monoclonal antibodies a most attractive tool to target many 
molecules found in wide systems, such as receptors or other molecules found 
on the surface of normal cells, molecules specifically expressed on the surface 
of cancer cells, etc. In 1975, Kohler and Milstein described the process of cell 
fusion, "hybridoma technology", where B cells confer antibody production ca- 
pability, while myeloma cells enable hybridomas to divide indefinitely and grow 
well in culture. A single clone producing the desired antibody at high titer can 
be selected for large-scale culture for monoclonal antibody production (Kohler 
and Milstein 1975). There are many critical steps for generating hybridomas and 
producing monoclonal antibodies. 

Immunization of Mice or Rats 

Monoclonal antibodies specific for human antigens are generally raised in mice, 
and those of mice are raised in rats. The most important steps for the immuniza- 
tion of mice are described below: 

1. Immunize 6-8 week-old Balb/c mice with 5-20 ug antigen (98-99% pure) 
isolated from humans or any non-mice species in the presence of appropriate 

2. Booster is injected 3-4 weeks after primary immunization. Before immu- 
nization, pre-bleed the mice for ELISA negative control. The handling and 
processing techniques followed to separate sera are the same as for rabbits, 
except that a maximum of 200 |il of blood can be collected from each mouse 
from either tail vein or retro -orbital plexus. 

3. Bleeding is performed every week after injecting the booster dose. 

S. Khurana, et al. 

4. Once the antibody level in sera is significantly high, the mouse is aseptically 
sacrificed and the spleen removed. 

5. The connective tissue and fat is removed, and the spleen is taken in a 3 5 -mm 
Petri plate containing 2 ml of RPMI-1640 containing 10% FCS (Al). 

6. The spleen is teased with the help of a blunt-headed sterile forceps to obtain 
a single cell suspension. Cell clumps are separated, and the centrifuged cell 
pellet is suspended in 5 ml of ice-cold hemolytic reagent. 

7. After 5 min of treatment, 5 ml of ice-cold RPMI-1640 is added and the cell 
suspension is immediately centrifuged at 1500 rpm for 5 min. The cell pellet 
is washed in the same medium two times. About 50-60x1 6 cells can be re- 
covered from a spleen. 

8. The spleen cells are suspended in Al medium at a density of lOxlO 6 cells/ml. 
The cell suspension is kept at room temperature until used for fusion. 

Myeloma Cell Culture 

The myeloma (tumor) cells used for making hybridomas should not secrete a 
paraprotein. Ideally, myeloma cells should not produce immunoglobulin light 
chains; otherwise this will combine with the heavy chains of the monoclonal an- 
tibody to produce undesirable hybrid molecules (Johnstone and Thorpe 1996). 
Commonly used hypoxanthine, aminopterin, and thymidine (HAT) -sensitive 
myeloma cell lines are shown in Table 5.1. Suitable myeloma cells are cultured 
one week prior to fusion in roller bottles containing RPMI-1640 with 10% FCS 
(Al). Cells are cultured up to mid-log phase (2-3x1 6 cells/ml), harvested, 
washed two times in A0 medium, and finally resuspended in Al medium at a 
density of 5xl0 6 cells/ml. 

Table 5.1 Rodent B myeloma cell lines commonly used for making hybridoma (taken from John 
stone and Thorpe 1996) 

Cell line Animal Synthesis 

NS1 Mice (Balb/c) Light chain 

NSO Mice (Balb/c) Nothing 

Y3 Rat (Lou) Light chain 

Y2B Rat (Lou) Nothing 

5. Laboratory Practice for the Production of Polyclonal and Monoclonal Antibodies 79 

Setup for Fusion of Myeloma with Spleen Cells 

In general, a 1:5 proportion of myeloma and spleen cells is used for fusion. 
Take about 20x1 6 and lOOxlO 6 myeloma and spleen cells, respectively, in a 50- 
ml conical tube and centrifuge at 500 g for 10 min. Discard the supernatant, 
resuspend the cell pellet in 30 ml A0 medium at 37 °C, equilibrate cell suspen- 
sion at the same temperature and further centrifuge. The cell pellet is used in the 
following steps to carry out fusion. 

1. Set the timer for 6 min, and disrupt the cell pellet by tapping the tube. Start 
the timer, add 1 ml of 50% PEG (M.W. 4000) solution to the pellet over a 
1 min period with constant shaking. Mix for another 1 min, stop fusion by 
slowly adding 1 ml of A0 medium over a period of 1 min with constant stir- 
ring, and add 3 ml of A0 medium over 1 min and then 10 ml of A0 medium 
over a period of 2 min. 

2. Incubate for 5 min in a 37 °C water bath, then slowly add 30 ml of medium 

3. Centrifuge cell suspension at 500 g for 10 min, resuspend the pellet in 50 ml 
of HAT medium by gently swirling the tube, and culture the cells in 2xT-75 
flasks for 2 days. 

4. Transfer the cells from the flask into 2x50-ml tubes and centrifuge at 500 g for 
10 min. Resuspend the cell pellet in 2x20 ml HAT medium, mix with 1x106 
peritoneal macrophages per tube, and distribute 100 |il suspension in each 
well of 4x96-well plates. Alternatively, resuspend the cell pellet in 2x20 ml 
HAT medium supplemented with 50 (ig/ml of LPS and 20 (ig/ml of dextran 
sulfate. Hybridomas grow faster and produce more clones if the spleen cells 
respond well to these mitogens. 

5. Maintain the culture for 10-14 days, with 50% replacement of the me- 
dium every 3 days. Examine the plates for the presence of colonies and, for 
each well having colonies, test the culture supernatant for the presence of 

Selection and Cloning of Hybridoma 

When some of the wells show positive in antibody tests, it is important to re- 
clone the hybridoma as soon as possible. This is done to avoid potential loss of 
the positive clone due to overgrowth of non-secreting cells. To ensure that the 
antibody is monoclonal, cloning should be done 2-3 times before selecting the 
final hybridoma clone. Cloning can be accomplished by either growing the hy- 
bridoma in soft agar or by a limiting dilution method. 

S. Khurana, et al, 

Cloning by Limiting Dilution Method 

1. Collect cells from each positive well, and dilute cells at 50 cells/ml, 30 cells/ 
ml, 10 cells/ml, and 5 cells/ml in Al medium. 

2. Plate 100 |il cell suspension of each dilution in a 96-well plate (24-36 wells for 
each dilution). Maintain the cells in a C0 2 incubator at 37 °C for 2-3 weeks 
with 50% medium replacement twice a week (care should be taken to avoid 
cell loss during replacement of medium). 

If there is cell growth in <5 wells in each dilution, the odds are greater than 
95% that the clones will produce monoclonal antibody. If <80% of the clones 
tested are positive, the hybridoma should be recloned for the second time. If the 
cell dilutions mentioned above give too much or too little growth, an appropri- 
ate adjustment in cell dilution is needed to obtain either a lower or higher cell 
count. The cloning efficiency of hybridomas can be greatly enhanced by the ad- 
dition of 2000-3000 peritoneal macrophages per well or by including LPS and 
dextran sulfate in the cloning medium. The fastest growing clones producing a 
high antibody titer are selected for clonal expansion. At this point it is necessary 
to store a few vials of clone in liquid nitrogen. 

Production of Monoclonal Antibodies 

There are two techniques by which monoclonal antibodies are produced. Highly 
concentrated (5-10 mg/ml) antibodies can traditionally be produced in mouse 
peritoneal cavity; however, this is now banned in most countries. The second 
option for the production of monoclonal antibodies is cell culture based. 

Production in Ascitic Fluid 

Hybridomas are grown in the peritoneal cavity of the same strain of mice used 
as a donor of myeloma or spleen cells. This is to avoid rejection of hybridomas 
by host animals. If the NS-1 myeloma cell line is used for fusion with spleen cells 
of another mouse strain, it is recommended that Fl crossbreeds between Balb/c 
and the donor mouse strain of spleen cells are used to prepare ascitic fluid. As- 
citic fluid is produced as below: 

1. Each mouse is initially primed by injecting 0.5 ml of pristane via intraperito- 
neal (IP) injection. Pristane is a Q 4 branched oily hydrocarbon which induces 

5. Laboratory Practice for the Production of Polyclonal and Monoclonal Antibodies 81 

an oil-granuloma in the peritoneal cavity of the mouse. This environment is 
optimal for the acceptance and growth of hybridomas for the production of a 
high antibody titer in ascitic fluid. 

2. At 5-10 days after priming, freshly grown hybridoma cells (10xl0 6 per0.5 ml) 
are washed, suspended in normal saline, and injected IP into each mouse. 

3. At 7-21 days later, the ascitic fluid is collected by inserting a 20-gauge needle 
into the swollen peritoneum in the inguinal area. About 3-6 ml of ascitic 
fluid can be withdrawn from each mouse. Ascitic fluid is tapped every week 
for a few successive weeks. 

4 The ascitic fluid is allowed to clot, and cells and fibrin are removed by cen- 
trifugation at 1000 g for 10 min. The clear fluid is stored in -70 °C freezers, if 
antibody is not purified immediately. 

Production in Cell Culture 

Monoclonal antibodies can be produced in culture; in fact large-scale antibod- 
ies are produced in this way. However, by this process the yield of antibodies 
(5-50 ug/ml) is much lower, as compared with ascitic fluid. Cell culture based 
monoclonal antibody production can be scaled-up in much larger volumes in 
spinner flasks, as well as in bioreactors. A high concentration of monoclonal 
antibodies can be achieved in culture using a hollow fiber bioreactor. Two of 
the most useful strategies for improving yield of antibodies are: optimization of 
culture medium with low serum concentration, and high cell density culture. 

Materials and Equipment 

Besides an animal house, an established tissue culture laboratory is essential for 
making hybridomas and monoclonal antibodies; the details of the materials and 
facility requirements are as follows: 

Media and Materials 

A0 medium is RPMI-1640; Al medium is RPMI-1640 supplemented with 
10% heat inactivated FCS. 

Stock hypoxanthine/thymidine (HT) solution (lOOx): dissolve 135 mg hy- 
poxanthine to approximately 60 ml of distilled water containing 1.2 ml of 

S. Khurana, et al. 

1 M NaOH by stirring. If hypoxanthine is not completely dissolved, add ad- 
ditional 0.1 ml NaOH. Dissolve 38.6 mg thymidine into it, bring the volume 
to 100 ml, filter sterilize, and store at 4 °C. The solution is stable for several 

Stock hypoxanthine/aminopterin/thymidine (HAT) solution (lOOx): dissolve 
1.91 mg aminopterin in 100 ml of stock HT. 

Dextran sulfate solution (200x; not needed if macrophages are used): dis- 
solve 40 mg of dextran sulfate (MW=500 000) in 10 ml of distilled water, fil- 
ter sterilize, and store at 4 °C. The solution is stable for several weeks. 
Fusion reagent (50% polyethylene glycol-4000 solution): dissolve 10 g melted 
PEG and 1 ml DMSO in 9 ml of 0.15 M HEPES buffer (pH 7.5), filter steril- 
ize, and store at room temperature. The stock is stable for several months. 
Hemolytic agent: dissolve 0.2 g Tris base and 0.83 g NH 4 C1 in 60 ml MilliQ 
water, adjust to pH 7.2 with HC1, make up the volume up to 100 ml, filter 
sterilize, and store at 4 °C. The stock is stable for several months. 
LPS concentrate (lOOx; not needed if macrophages are used): aseptically add 
20 ml of distilled water to 100 mg vial of E. coli lipopolysaccharide, aliquot 
1 ml per tube, and store frozen at -20 °C. The stock solution is stable for sev- 
eral months. 

Other materials: phosphate buffered saline (sterilize by autoclaving), pristane 
(2,6,10,14-tetramethyl pentadecane), B-tumor cells, immunized animal. 

Laboratory Equipment 

C0 2 incubator, table-top centrifuge, 37 °C water bath, inverted microscope, 
sterile equipment for dissecting animal, plastic ware, etc. 

Purification of Antibody 

Antibody is a glycosylated protein, which is produced in relatively low amounts 
as compared with the other proteinacious contaminants present in either ascitic 
fluid or in cell culture supernatant. Because of this, purifying a small quantity of 
antibody from a large volume of dilute solution is carried out following a combi- 
nation of different techniques, normally used in protein chemistry. 

5. Laboratory Practice for the Production of Polyclonal and Monoclonal Antibodies 83 

Purification of IgG by Precipitation 
with Ammonium Sulfate 

The addition of ammonium sulfate in ascitic fluid or hybridoma culture super- 
natant causes precipitation (salting-out) of IgG, which can be directly used in 
many applications or further purified by chromatography techniques. The pre- 
cipitated IgG is usually very stable and can be stored long-term. About 40% 
pure antibody can be obtained by the ammonium sulfate precipitation tech- 
nique. Ammonium sulfate precipitation steps are as follows: 

1. Centrifuge ascitic fluid/culture supernatant at 2000 g for 15 min at 4 °C, and 
collect the clear supernatant. 

2. Add saturated ammonium sulpfate solution drop -wise to produce 35-45% 
final saturation (alternatively, directly add 2.7 g of ammonium sulfate per 
10 ml of fluid to obtain 45% saturation). Stir the mixture at 4 °C for 4-10 h. 

3. Centrifuge at 2000 g for 15-20 min at 4 °C, collect the pellet, and dissolve 
in one-tenth volume of PBS. The crude antibody solution is dialyzed against 
PBS for overnight with 3-4 buffer changes to obtain an ammonium sulfate- 
free preparation. Alternatively, dialyze in a buffer recommended in subse- 
quent purification steps. 

Materials and Equipment 

Saturated ammonium sulfate solution: dissolve excess (NH 4 ) 2 S0 4 into double 
distilled water (900 g in 1 1 final volume), filter through 0.45 |im filter and store 
at 4 °C PBS. 

Table-top centrifuge, dialysis membrane (20 kDa MW cut-off), magnetic 
stirrer, plastic/glass beaker. 

Purification of IgG by DEAE-Sepharose Chromatography 

Crude antibody from the previous step or directly from the ascitic fluid/culture 
supernatant can be purified by DEAE-Sepharose chromatography (Page and 
Thorpe 1996). The antibody is purified based on the principle that IgG has a 
higher or more basic isoelectric point than most serum proteins. The solution 
pH is kept below the isoelectric point of antibodies and, since IgG do not bind 
to the DEAE column (anion exchanger), they are thus separated out from the 

S. Khurana, et al. 

majority of the protein contaminants bound to the anion exchanger. Highly pu- 
rified (>90%) antibodies can be obtained by this technique. DEAE-Sepharose- 
based purification steps are as follows: 

1. Extensively dialyze the crude antibody/ascitic fluid/serum/culture superna- 
tant against 50 mM sodium phosphate buffer with 3-4 changes over a period 

2. Apply the dialyzed sample to the DEAE-Sepharose column, previously equil- 
ibrated in the same buffer, and collect the flow-through. Wash the column 
with 2 column volumes of the same buffer until the absorbance of the eluate 
at 280 nm (A 28 o) falls to base line. IgG is present in the wash, which is mixed 
with the flow-through. 

3. Elute the adsorbed protein contaminants and regenerate the column by pass- 
ing 2-3 column volumes of the phosphate buffer containing 1 M NaCl. 
Wash the column in 2-3 column volumes of the 50 mM phosphate buffer, 

and store in the same buffer containing 0.1% NaN 3 . 

Materials and Equipment 

DEAE Sepharose C1-6B (Pharmacia, Uppsala, Sweden), 50 mM sodium phos- 
phate buffer (pH 5.3), 1 M NaCl, sodium azide. 

Chromatography column, standard chromatography unit (feeding pump, 
UV-monitor, fraction collector, chart recorder), dialysis membrane (20 kDa 
MW cut-off), magnetic stirrer, plastic/glass beaker. 

Purification of IgG Using Immobilized Protein A 

Protein A is a group-specific ligand that binds with the Fc region of IgG-type 
antibodies. In the immobilized form, protein A is extremely useful in the pu- 
rification of antibodies, because it is easy to use and a high-capacity protein 
adsorbent. The recombinant Protein A-Sepharose (BioChain Institute, Calif.) is 
an affinity chromatographic matrix with recombinant protein A, immobilized 
by the epoxy method to a Sepharose 6B fast flow base matrix (BioChain Insti- 
tute 2006). The capacity of IgG binding to Protein A could be up to 25 mg of 
human IgG in 1 ml of wet gel. One-step purification of IgG of about 98% purity 
can be achieved using a Protein A-Sepharose column. Despite these enormous 
advantages, protein A cannot be used for all classes of IgG, as for example hu- 
man IgG 3 , mouse IgG 3 , sheep IgG^ etc., as they do not bind with the matrix. The 
purification steps are as follows: 

5. Laboratory Practice for the Production of Polyclonal and Monoclonal Antibodies 85 

Fig. 5.2 Separation of mouse IgG 2a by 
protein A-Sepharose column chromatogra- 
phy. Chromatogram shows distinct peak of 
IgG 2a (Biochain Institute, Hayward, Calif.) 

50 100 150 200 250 

Volume (ml) 

1. Equilibrate the column with 5-10 column volumes of binding buffer (20 mM 
sodium phosphate, pH 7). 

2. Apply the sample (equilibrated with binding buffer) to the column using a sy- 
ringe or pump. Wash the matrix with 5-10 column volumes of binding buffer 
until no protein appears in the effluent. 

3. Elute IgG with 2-5 column volumes of elution buffer (0.1 M sodium citrate, 
pH 4). The eluted fraction is immediately neutralized by adding 50-100 |il of 
1 M Tris-HCl, pH 9.0, in 1 ml of eluted fraction. 

4. Regenerate the column with 5 column volumes of regeneration buffer con- 
taining 0.1 M sodium citrate (pH 3). 

5. Wash the column with 5-10 column volumes of distilled water and finally 
with 20% ethanol. The column is stored at 4-8 °C. 

The chromatogram of mouse IgG2a sub-type, purified in protein A-Sepha- 
rose chromatography, is shown in Fig. 5.2. 

Materials and Equipment 

rProtein A-Sepharose (BioChain Institute, Calif.), chromatography column, 
buffers (for binding, washing, elution, as mentioned in the protocol), standard 
chromatography unit (feeding pump, UV-monitor, fraction collector, chart re- 

S. Khurana, et al, 

Analysis of Purity of IgG by Electrophoresis 

After purification of IgG using the above techniques, it is necessary to obtain 
some index of purity of the product. Sodium dodecyl sulphate-polyacrylamide 
gel electrophoresis (SDS-PAGE) is used to separate proteins and hence to de- 
termine their purity. The molecular weight of native IgG is 150 kDa, but in re- 
ducing SDS-PAGE it degrades into molecules of two different sizes, comprising 
heavy (50 kDa) and light (25 kDa) chains. These degraded heavy and light chains 
can be easily detected by staining with a suitable protein dye. If contaminating 
proteins are present in the preparation, they are also detected in the same gel, 
depending upon their quantity and the sensitivity of staining technique. The IgG 
sample, to be electrophoresed, is heated at 90-95 °C for 5 min in the presence 
of reducing sample buffer (Laemmli 1970). The sample buffer contains SDS and 
2-mercaptoethanol (2 -ME) or dithiothreitol (DTT). The anionic detergent SDS 
denatures IgG, binds to the uncoiled molecule, and confers a uniform negative 
charge. Whereas, being a reducing agent, 2-ME/DTT reduces the disulfide bonds 
of IgG to free sulfhydryl groups, and forms lower molecular weight proteins. The 
sequential steps for reducing SDS-PAGE analysis of protein are given below: 

1. Cast 10% and 5% (w/v) resolving and stacking gel, respectively, in a mini gel 
apparatus (10 cm height). Fill the anode and cathode reservoirs with running 

2. Prepare samples by boiling antibody solution (~1 mg/ml) with sample buffer 
(3:1). Load 15-20 ul sample(s) in each well, also load appropriate molecular 
weight standard. 

3. Electrophorese the gel at 30 mA constant current (60 mA for two gels) until 
the dye-front reaches the bottom-most portion of the gel. The average gel 
running time is 1.5-2.0 h. 

4. Remove the gel carefully from glass plates and stain with Coomassie brilliant 
blue R-250 for 5-10 min by gently rocking the content. 

5. Pour off the stain, wash the gel with tap water, and destain it with a metha- 
nol-acetic acid mixture with a couple of changes until the gel background is 

Coomassie brilliant blue staining of purified IgG subunits are shown in Fig. 5.3. 
The sensitivity of the Coomassie blue staining is about 1 ug to 2 |ag protein/band; 
below that level a protein band cannot be detected. The silver staining method 
is more sensitive, and protein as low as 100 ng/band can be detected. Therefore, 
silver staining is a more preferred technique to identify protein than Coomassie 
blue staining in order to detect minor protein contaminants. Silver staining 
steps can be followed from step 4 in the above. It is recommended to use gloves 
when handling gel, otherwise finger impressions may appear on the gel. 
1. Remove gel (resolving gel only) carefully from the glass plates and wash with 

an excess of gel fix solution (gel can be stored in this solution for several days 

with no effect on the quality of the staining). 

5. Laboratory Practice for the Production of Polyclonal and Monoclonal Antibodies 87 

12 3 4 

Fig. 5.3 Reducing SDS-PAGE analysis of 
IgG 2a . Lane 1 Molecular weight marker, lane 
2 before purification, lane 3 unbound (flow- 
through) fraction, lane 4 purified IgG 2a 
(Biochain Institute, Hayward, Calif.) 

2. Wash gel with 50% ethanol three times for 20 min each. Submerge the gel in 
sodium thiosulfate solution for exactly 1 min (long exposure in sodium thio- 
sulfate gives more background staining). 

3. Rinse the gel with double-distilled water three times for 20 s each. Again, 
submerge the gel for 20 min in the silver nitrate solution (gel may appear yel- 
lowish). Rinse the gel with distilled water three times for 20 s each to remove 
excess silver nitrate. 

4. Visualize the bands by incubating the gel (20-25 °C) for 10 min in develop- 
ing solution. When the desired bands appear, terminate the developing pro- 
cess by washing the gel with water. 

5. Soak the gel for 10 min in gel fix solution, wash in 50% methanol for 20 min, 
and finally stored in 50% methanol at 4 °C. 

Note: While developing the gel, a faint brown precipitate may appear that can 
be dissolved by agitating the content. The intensity of the band increases with 
the time of development, so care must be taken to avoid over- or under-staining 
the gel. A band of 500 ng protein typically arrives within 30 s of development, a 
band of 50 ng protein takes 2 min to be visualized (Rosenberg 1996). 

S. Khurana, et al, 

Materials and Equipment 

1. Electrophoresis: acrylamide solution (30%; 29.2 g acrylamide, 0.8 g bisacryl- 
amide per 100 ml; stock solution is filtered and stored at 4 °C in a dark-col- 
ored bottle), 1.5 M Tris-HCl (pH 8.8), 1 M Tris-HCl (pH 6.8), SDS solution 
(10%), ammonium persulfate solution (10%), N,iV,iV',iV'-tetramethylene-di- 
amine (TEMED), double-distilled water, 10% resolving gel (10 ml; prepared 
from 4.0 ml water, 3.3 ml of 30% acrylamide, 2.5 ml of 1.5 M Tris, 0.1 ml of 
10% SDS, 0.1 ml of 10% APS, 4 (il TEMED), 5% stacking gel (3 ml; prepared 
from 2.1 ml water, 0.5 ml of 30% acrylamide, 0.38 ml of 1.0 M Tris, 0.03 ml of 
10% SDS, 0.03 ml of 10% APS, 3 |il TEMED), running buffer (lOx: dissolve 
30.3 g Tris, 144.2 g glycine, 10 g SDS in 1000 ml distilled water), sample buffer 
[4x: 2.0 ml 2-ME, 0.8 g SDS, 2.5 ml Tris-HCl (1 M, pH 6.8), 4.0 ml glycerol, 
0.1 mg bromophenol blue, distilled water to make 10 ml; warm the mixture 
at 37 °C for complete solubilization of SDS, aliquot in 1.5 ml tube, store at 
-20 °C], molecular weight marker (prepare by dissolving powdered marker 
proteins standard in sample buffer, or use prestained markers in 20-100 kDa 

2. Coomassie blue staining: Coomassie brilliant blue R-250 (0.25% in destaining 
solution), destaining solution (400 ml methanol, 100 ml glacial acetic acid in 
1000 ml water). 

3. Silver staining: gel fixing solution (50% methanol in 12% acetic acid solution), 
sodium thiosulfate solution (dissolve 0.2 g in 1000 ml of double-distilled wa- 
ter), silver nitrate solution (dissolve 2 g in 1000 ml of double-distilled water 
containing 0.5 ml formaline), developing solution (dissolve 60 g sodium car- 
bonate, 4 mg sodium thiosulfate, 0.5 ml formalin in 1000 ml water), ethanol 
solutions (50%, 30%), methanol solution (50%). 

4. Equipment: power pack, electrophoresis tank and gel apparatus, micro-sy- 
ringe, hot plate, microfuge, rocking platform, glass/plastic container. 

Enzyme-Linked Immunosorbent Assay 

A number of alternative enzyme-linked immunosorbent assay (ELISA) proto- 
cols are available, allowing the qualitative detection or quantitative measurement 
of either antigen or antibody in sera or culture supernatant. ELISA is broadly 
classified in three groups: (a) indirect ELISA, (b) sandwich ELISA, and (c) com- 
petitive ELISA. These assays can be used for quality control of the culture su- 
pernatants containing antibody/ antigen, and the results are expressed in relative 
values (qualitative) or in exact concentrations using a standard curve based on 
known concentrations of the antibody or antigen in preparation (quantitative). 

5. Laboratory Practice for the Production of Polyclonal and Monoclonal Antibodies 89 

Step I: Coat 
with antigen 
and wash 

Step II: Block excess 
binding sites with BSA 
or milk protein 

Step III: Incubate 
with 1° antibody and 
wash off unbound Ab 

x-^ A >i XI 

Step V: React with substrate, Step IV: Incubate with 
arrest colour formation and HRP-conjugated 2° antibody 
take reading and wash off excess enzyme 

Fig. 5.4 Schematics of indirect antibody ELISA. Antigen (arrow), blocking (X), primary antibody 
(Y), HRP-conjugated secondary antibody (Y-) 

Antibody can be detected or quantitatively determined with an indirect ELISA. 
Here, micro titer plate wells are coated with antigen of one particular concentra- 
tion and different dilutions of antibody/ antibodies (polyclonal) are trapped on 
it. Bound antibody is then detected by reaction with the labeled second antibod- 
ies (Fig. 5.4). The amount of label bound is proportional to the concentration of 
the antibody in the test solution. The different steps involved in indirect anti- 
body ELISA are described below: 

1. Coat 96-well plate with 100 ul of antigen (0.2 ug/ml in PBS) and incubate 
overnight at 4 °C. 

2. Wash the plate with 3x200 ul of PBS-T per well with constant shaking. Block 
the wells with 200 ul of blocking solution by incubating at 37 °C for 1 h. 

3. Discard the blocking solution, add 100 ul of the primary antibody (1°) of dif- 
ferent dilutions in triplicate wells and incubate at 37 °C for 1 h. 

4. Wash the plate with 3x200 ul of PBS-T per well with constant shaking. Add 
100 ul of horseradish peroxidase (HRP) -coupled anti-mouse IgG secondary 
antibody (2°) from 1:5000 to 1:10 000 dilutions in blocking solution, and in- 

S. Khurana, et al. 

cubate for 30-45 min at 37 °C (if primary antibody is rabbit polyclonal, use 
anti-rabbit IgG/HRP as secondary antibody). In place of HRP, alkaline phos- 
phatase or (3-galactosidase conjugated 2° antibody can be used (with respec- 
tive substrate). 
5. Wash the plate with 3x200 ul of PBS-T per well with constant shaking. Incu- 
bate the plate with 100 |il of developing solution until a color change is evi- 
dent. Stop the reaction by adding 50 \A of 2.5 M H 2 S0 4 per well, and measure 
the absorbance at 492 nm. 

Materials and Equipment 

Standard antigen solution (1-10 |ig/ml), diluted monoclonal antibody solution/ 
culture supernatant, HRP-conjugated secondary antibody (anti-mouse), PBS 
(20 mM, pH 7.5, containing 150 mM NaCl), PBS-T (0.05% Tween 20 in PBS), 
blocking solution (2% BSA or 5% non-fat milk in PBS-T), developing solution 
[10 mg o-phenylenediamine (OPD) in 25 ml of citrate buffer at pH 5.5 (20 ml of 
H 2 0, 5.16 ml of 0.5 M Na 2 HP0 4 , 645 \A of 1.5 M citric acid), plus 12 |il of 30% 
H 2 2 ], 2.5 M H 2 S0 4 . The developing solution is unstable and should be freshly 
prepared. Sodium azide is an inhibitor of HRP, hence it should be avoided in 

Incubator (37 °C), micropipettes, ELISA plates, ELISA plate washer, ELISA 
plate reader, 4 °C refrigerator, plastic ware. 

The antibody is the workhorse in immunology and cell biology research to detect 
specific cell types in the body The major use of antibodies has been limited to 
the research applications. However, in the recent past, therapeutic monoclonal 
antibodies have become available to treat certain diseases in humans. Antibod- 
ies are characterized in terms of affinity, avidity, and bioneutralization capacity, 
which are not discussed in this Chapter. 

BioChain Institute (2006) rProtein A-Sepharose product literature. BioChain Institute, 

Johnstone A, Thorpe R (1996) Immuno chemistry in practice, 3rd edn. Blackwell Science, 

5. Laboratory Practice for the Production of Polyclonal and Monoclonal Antibodies 91 

Kohler G, Milstein C (1975) Continuous cultures of fused cells secreting antibody of pre- 
defined specificity. Nature 256:495-497 

Laemmli UK (1970) Cleavage of structural proteins during the assembly of the head of bacte- 
riophage T4. Nature 227:680-685 

Page M, Thorpe R (1996) Purification of IgG using DEAE-sepharose chromatography In: 
Walker JM (ed) The protein protocols handbook. Humana, Totowa, pp 725-726 

Roitt I, Brostoff J, Male D (1996) Immunology, 4th edn. Mosby, London 

Rosenberg IM (1996) Protein analysis and purification - benchtop techniques. Birkhauser, 

Modern Techniques for Analyzing 
Immunological Responses 

Satish Khurana, Sangeeta Bhaskar, and Asok Mukhopdhyay 

The immune system is a versatile defense method that has evolved to protect 
animals from invading pathogenic microorganisms. The immune response is 
the way body recognizes and defends itself against bacteria, viruses, and sub- 
stances recognized as foreign and potentially harmful to the body. Functionally, 
an immune response can be divided into two related activities - recognition and 
response. The immune system is able to discriminate one foreign pathogen from 
another and also between foreign molecules and the body's own cells and pro- 
teins. Once a foreign organism/antigen has been recognized, the immune sys- 
tem recruits a variety of cells and molecules to mount an appropriate response, 
called an effector immune response, to eliminate or neutralize the organism/an- 
tigen. Later exposure to the same foreign organism/antigen induces a memory 
immune response, characterized by a more rapid and heightened immune reac- 
tion that serves to eliminate the pathogen and prevent diseases (Goldsby et al. 

Type of Immune Responses 

The immune system is a complex set of cellular elements comprising different 
forms of lymphocytes and antigen -presenting cells to protect against infections. 

National Institute of Immunology, Aruna Asaf Ali Marg, New Delhi- 110067, India, 
email: ashok@nii.res. in 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

Satish Khurana, et al. 

The immune response is often divided into two types: the innate and the adap- 

Innate Immune Response 

This provides the first line of defense against infection, which includes cellular 
and molecular components that recognize a wide spectrum of conserved patho- 
genic components. It has broad reactivity and is uniform in all members of a 

Adaptive Immune Response 

This provides long-lasting and specific protection against known pathogens. It 
has a high degree of antigen specificity and memory. The major agents of adap- 
tive immunity are lymphocytes, antibodies, and other molecules they produce. 
The adaptive immune system, also called the acquired immune system, ensures 
that most mammals that survive an initial infection by a pathogen are generally 
immune to further illness caused by that same pathogen. This chapter describes 
specifically various techniques to study adaptive immune responses developed 
in mammals. The immune system operates throughout the body. However, there 
are certain sites where the cells of the immune system are organized into specific 
structures. These are classified as central lymphoid tissue (bone marrow, thy- 
mus) and peripheral lymphoid tissue (lymph nodes, spleen, mucosa-associated 
lymphoid tissue). The location of various lymphoid tissues in mice is shown in 
Fig. 6.1. Immune cells are formed in the bone marrow and are grouped into two 
major classes: lymphocytes and antigen -presenting cells (APC). Once the lym- 
phocytes are initially formed, some continue to mature in the bone marrow and 
become B cells. Other lymphocytes finish their maturation in the thymus and 
become T cells. Once mature, some lymphocytes stay in the lymphoid organs, 
while others travel continuously around the body through the lymphatic vessels 
and bloodstream. 

Adaptive Immune System 

In mammals, the adaptive immune system is divided into two classes: humoral 
and cellular. 

6. Modern Techniques for Analyzing Immunological Responses 95 

Fig. 6.1 Lymphoid tissues in mice: central lymphoid tissue (bone marrow and thymus, not shown 
in the figure), and peripheral lymphoid tissues (lymph nodes: mesenteric, popliteal, superficial 
inguinal, axillary, lateral axillary; spleen) 

Humoral Immune System 

This acts against bacteria and viruses in the body (blood) by means of eliciting 
an antibody (immunoglobulins) response. Antibodies are the antigen -binding 
proteins produced by differentiated B cells, known as plasma cells. Antigen re- 
ceptors on B cells consist of membrane-bound immunoglobulin heavy and light 
chains. Following the interaction of cell-surface Ig with its specific antigen and 
in the presence of T cells, B cells differentiate into plasma cells, which secrete an- 
tibodies. Secreted antibodies circulate in the blood, where they serve as effectors 
of humoral immunity by searching out and neutralizing antigens or marking 

Satish Khurana, et al. 

them for elimination. Most antigens are complex and contain many different 
antigenic determinants, and the immune system usually responds by producing 
antibodies to several epitopes on the antigen. Hence, there is a heterogeneous 
serum (polyclonal) antibody response to an immunizing antigen. 

Cellular Immune System 

This is involved in destroying bacteria and virus-infected cells with the help of 
T cells. T cells express a unique binding molecule on its membrane, known as 
the T cell receptor. Unlike antibodies, which can recognize antigen alone, T cell 
receptors can recognize only antigen that is bound to cell membrane proteins 
called MHC molecules. Both T and B cell compartments display enormous het- 
erogeneity in function and antigen specificity. There are two well defined sub- 
populations of T cells: T cytotoxic cells (Tc) and T helper cells (Th). T helper 
and T cytotoxic cells can be distinguished from one another by the presence 
of either CD4 or CD 8 membrane glycoproteins on their surfaces, respectively. 
After a Th cell recognizes and interacts with an antigen-MHC class II molecular 
complex, the cell is activated and secretes cytokines. The secreted cytokines play 
an important role in activating B cells, cytotoxic T cells, macrophages, and vari- 
ous other cells that participate in the immune response. 

Different Assay Systems to Study the Adaptive Immune 

The humoral immune response is studied by determining specific antibodies 
produced against antigens. The concentration of antibodies is determined by 
radio immuno assay (RIA) or ELISA techniques. The general procedures of di- 
rect ELISA for antigens/antibodies are described in Chapter 5. In this chapter 
we discuss assay systems used for measuring cell-mediated immune (CMI) re- 

Mixed Lymphocyte Proliferation Assays 

The lymphocyte proliferation assay measures the memory response of T cells. 
Lymphocytes placed in short-term tissue culture undergo clonal proliferation, 
when stimulated in vitro by a foreign molecule or antigen with which they are 

6. Modern Techniques for Analyzing Immunological Responses 97 

primed before. CD4 + lymphocytes proliferate in response to recognition of an- 
tigenic peptides in association with class II major histocompatibility complex 
(MHC) molecules on APCs. This proliferative response of lymphocytes to an- 
tigen in vitro occurs only if the mouse is immunized with the same antigen. 
Antigen-specific T-cell proliferation is a major technique for assessing the func- 
tional capacity of CD4 + lymphocytes to respond to various stimuli. The degree 
of proliferation is assessed by adding 3 [H] -thymidine to the culture medium 
and monitoring uptake of that into DNA in the course of repeated cell divisions. 
Spleen cells are mixed population of different subsets of T and B cells. Spleen 
also contains major APCs. Therefore, mixed lymphocyte proliferation assay can 
be conducted from spleenocytes isolated from immunized mice. The details of 
the proliferation assay are as follows: 

1 . Aseptically remove the spleen from the immunized mice, and place on a ster- 
ile petri plate containing 2 ml of RPMI 1640. Crush the spleen with the help 
of blunt forceps to release the cells. Collect cells by centrifugation and lyse 
the erythrocytes by treatment with Geys solution for 90 s. Stop the reaction 
of Geys solution by diluting 10 times volume of sterile PBS, centrifuge the 
cells, resuspend the pellet in 3 ml of complete medium and enumerate the 
cell number on a hemocytometer. About 50-60x1 6 mononuclear cells can 
be recovered from a spleen. 

2. Take 0.5xl0 6 cells in each well of a 96-well plate, add 2-fold serially diluted 
antigen (adjuvant-free) in triplicate wells, by which the mouse was immu- 
nized. Antigen concentrations may vary from 0.2 |ig/well to 2.0 |ig/well. As a 
negative control, take the same number of cells in triplicate wells, but without 
antigen. For a positive control, add PHA (1 |~ig/ml) in triplicate wells. The 
volume of the suspension is maintained at 200 ul. Culture the cells for about 
54 h in a C0 2 incubator at 37 °C. 

3. Add 0.5 uCi 3 [H] -thymidine in each well and further incubate for 18 h. Ob- 
serve the cells under a microscope to check proliferating cells. Cells exposed 
to antigen or PHA will show signs of proliferation (clumps of growing cells). 

4. Harvest the cells from the 96-well plate onto a glass fiber filter mat. Remove 
the mat from the cell harvester, insert in a plastic bag, add 10 ml of scintilla- 
tion fluid and seal the bag. Measure the incorporation of 3 [H] -thymidine in 
the DNA of multiplying cells on a (3-counter. The higher the proliferation, the 
higher is the cell count per minute (cpm). 

Materials and Equipment 

Immunized mice, antigen, Geys solution [dilute 20 ml of sterile solution A 
(3.5 g NH 4 C1, 0.185 g KC1, 0.15 g Na 2 HP0 4 , 0.012 g KH 2 P0 4 , 0.5 g glucose, 2.5 g 
gelatin in 100 ml water) with 5 ml of sterile solution B (0.42 g MgCl 2 6H 2 0, 
0.14 g MgS0 4 7H 2 0, 0.34 g CaCl 2 in 100 ml water) and 5 ml of sterile solution C 
(2.25 g NaHC0 3 in 100 ml water) in 70 ml of sterile water]; complete medium 

Satish Khurana, et al. 

(RPMI 1640 containing 10% FCS), PHA (1 mg/ml), 3 [H]-thydimine (specific 
activity -6.5 Ci/mmol). 

Sterile surgical apparatus, C0 2 incubator, inverted microscope, hemocytom- 
eter, cell harvester (including glass fiber filter), (3 -counter, plastic ware. 

Detection of Type of T Helper Responses (Th1/Th2) 

Two distinct classes of helper T cells, namely Thl and Th2, are formed in re- 
sponse to immunogens. Thl cells participate in cell-mediated immunity by se- 
creting IL-2, TNF-a, and IFN-y for activation of macrophages and Tc. In addi- 
tion to that, they inhibit both Th2 subset cell activity and the humoral immune 
responses. Th2 cells participate in humoral immunity by providing help to B 
cells to produce antibodies, which are needed to control extracellular pathogens. 
Moreover, they are also involved in the inhibition of cell-mediated responses. 
They secrete IL-4, IL-5, and IL-10, induce a class switch to IgE and IgGl, and 
support eosinophils and mast cells. Traditionally, the Thl/Th2 response is de- 
termined by measuring individual cytokines secreted by ELISA. In the recent 
past the cytometric bead array (CBA) technique has been introduced by BD 
Pharmingen, in which a series of particles with discrete fluorescence intensities 
are employed for the simultaneous detection of multiple cytokines. The CBA 
is combined with flow cytometry to create a powerful multiplexed assay. Each 
bead in a CBA provides a capture surface for a specific protein and is analogous 
to an individually coated well in an ELISA plate. This capture bead mixture is 
in suspension, hence it allows for the detection of multiple analyses in a small 
sample volume (BD Biosciences 2006). Five bead populations with distinct fluo- 
rescence intensities have been coated with capture antibodies specific for IL-2, 
IL-4, IL-5, IFN-y, and TNF-a proteins. The cytokine capture beads are mixed 
with the PE-conjugated detection antibodies and then incubated with recom- 
binant standards or test samples to form sandwich complexes. The samples 
are analyzed on a flow cytometer. CBA has several advantages compared with 
conventional ELISA: (a) it requires one-fifth sample volume as compared with 
ELISA technique, and (b) it takes less time than ELISA. The distinct steps for the 
CBA assay are as follows: 

1. Preparation of cytokine standards: reconstitute the lyophilized standards in 
assay diluent (buffer). The standards are diluted in the ranges from 1:2 to 
1:256 in the same assay buffer. The assay buffer is taken as a negative control. 

2. Preparation of cytokine capture beads: vigorously vortex each capture bead 
suspension for a few seconds, take 10 \il of each capture bead for each assay 
tube, and transfer 50 |il of mixed beads to each assay tube. 

3. Assay procedure: add diluted standards and test samples to the appropriate 
sample tubes (50 |il/tube). Then add PE detection reagent (50 (il/tube), incu- 
bate for 2 h at room temperature in the dark. Wash samples in 1 ml of wash 

6. Modern Techniques for Analyzing Immunological Responses 99 

buffer and centrifuge. Add 300 ul of wash buffer to each assay tube and ana- 
lyze by flow cytometer. 

The ranges of cytokines which can be estimated by the CBA technique varies 
from 20 pg/ml to 5000 pg/ml. For details, read the BD-CBA technical literature 
(BD Biosciences 2006). 

Materials and Equipment 

Mouse Thl/Th2 cytokine CBA kit (Becton Dickinson, Calif., USA), samples for 

Flow cytometer equipped with a 488 nm laser capable for detecting and dis- 
tinguishing fluorescence emissions at 576 nm and 670 nm, BD Cell Quest soft- 
ware, sample acquisition tubes, microfuge, vortex mixture. 

Cytotoxic T Lymphocyte Activity 

Under the influence of Th cell-derived cytokines, and on recognition of the an- 
tigen-MHC class I molecule complex, the Tc cell proliferates and differentiates 
into an effector cell, called a cytotoxic T lymphocyte (CTL). In contrast to the 
Tc cell, the CTL generally does not secrete many cytokines and instead exhibits 
cell-killing or cytotoxic activity. The CTL has a vital function in monitoring the 
cells of the body and eliminating virus-infected cells, tumor cells, and cells of 
a foreign tissue graft. They release granzymes to trigger ap op to tic death of the 
target (infected) cells. In general, CTLs are CD8 + and are therefore class I MHC 
restricted, although in rare instances CD4 + class II restricted T cells have been 
shown to function as CTLs. Three experimental systems are followed for mea- 
suring cell-mediated cytotoxic responses. 

Cell-Mediated Lympholysis 

In the cell-mediated lympholysis (CML) assay, suitable target cells (infected cells 
or altered self-cells, e.g. tumor cells) are labeled intracellularly with chromium- 
51( 51 Cr) by incubating the target cells with Na 2 51 Cr0 4 . Chromium diffuses into 
the cells and binds to cytoplasmic proteins, thus reducing passive diffusion of 
the same out of the cell. When specifically activated CTLs (effector cells) are 

Satish Khurana, et al. 

incubated with such labeled target cells, the latter undergo lysis and intracel- 
lular 51 Cr is released. The amount of 51 Cr released correlates directly with the 
number of target cells lysed by the CTLs (Brunner et al. 1968). By comparison 
with the 51 Cr release of the control cells, the corrected percent lysis is calculated 
for each concentration of effector cells. A non-radioactive flow cytometry-based 
technique is also followed for the CML assay (Derby et al. 2001). The details of 
the 51 Cr release assay are as follows: 

1. Preparation of target and effector cells: 

a. Wash the target cells in complete medium and resuspend the cells in 5 ml 
of the same medium. Allow cell clumps to settle down under gravity or 
pass the cell suspension through a single layer of 100-(im nylon mesh, 
collect unsettled or filtered cells, and enumerate the viable cell number by 
trypan blue exclusion. 

b. Centrifuge the cells for 5 min and gently resuspend the cell pellet in 
2-3 ml of complete medium. Add 0.2 ml of 51 Cr solution (1 mCi/ml) and 
20 ul of FBS. Mix gently and incubate in a loosely capped 15-ml conical 
tube for 45 min at 37 °C in a C0 2 incubator. 

c. Wash 51 Cr-labeled target cells 2-3 times with complete medium and col- 
lect the supernatant in a radioactive waste container. Resuspend labeled 
target cells in complete medium to a density of 10 6 cells/ml. 

d. Prepare a single-cell suspension of effector cells (spleen cells of immu- 
nized mice) in complete medium. Activate the effector cells with Con- 
canavalin A (2 |~ig/ml) for 2-3 days to sensitize the cells; unactivated cells 
are used as control. 

e. Add 100 ul of the effector cell suspension to triplicate wells of a 96- well 
plate for each effector cell density (effectontarget cell ratio may vary from 
1:1 to 10:1). 

2. Co-culture of target cells with CTL: 

a. Add 100 |J of 51 Cr-labeled target cells to wells containing effector cells or 
control lymphocytes or medium, for a final volume of 200 ul/well. 

b. Centrifuge the 96-well plate for 30 s at 200 g to enhance the contact be- 
tween the effector and the target cells. Incubate the plate for 3-6 h at 37 °C 
in a C0 2 incubator. 

c. Centrifuge the cells for 5 min at 200 g> lyse the cells by adding 100 |il of 
2% Triton X-100 to the control target cells alone (without effector cells) 
to measure maximum releasable 51 Cr. Harvest 100 |il of each supernatant 
into 51 Cr counting tubes. 

d. Count 51 Cr in a y- scintillation counter (1-2 min/sample). Calculate the 
corrected percent lysis for each concentration of effector cells, using the 
mean counts for each set of replicate wells. 

Test refers to effector cells with CTL activity and control refers to non-lytic 
cells or cell-free medium; and CTL activity is calculated as: 

CTL (%) = [(Test 51 Cr released -Control 51 Cr released) / (Maximum 51 Cr re- 
leased -Control 51 Cr released)] xlOO. 

6. Modern Techniques for Analyzing Immunological Responses 101 

Materials and Equipment 

Single-cell suspension of target cells, control target cells, effector cells, control 
effector cells, complete medium (RPMI 1640 supplemented with 10% ECS), 
sensitization medium (RPMI medium containing 1 mM sodium pyruvate and 
lx non-essential amino acids), concanavalin A (2 |ig/ml), Na 2 51 Cr0 4 (1 mCi/ 
ml), FBS, 2% Triton X-100. 

C0 2 incubator, inverted microscope, 51 Cr counting tubes (Skatron), y-counter. 

Mixed-Lymphocyte Reaction 

The mixed -lymphocyte reaction (MLR) is an in vitro method for assaying the 
proliferation of T cells in a cell-mediated response. Functional CTLs can be gen- 
erated by co-culturing allogeneic spleen cells (e.g. rat lymphocytes co-cultured 
with mouse lymphocytes) in a MLR. The T cells in a MLR undergo extensive blast 
transformation and proliferation. Both populations of allogeneic T lymphocytes 
proliferate in a MLR unless one population is rendered unresponsive by treat- 
ment with mitomycin C or lethal irradiation by X-rays (Lightbody and King 
1974). In the latter system (unresponsive), called one-way MLR, the unresponsive 
population provides stimulator cells that express alloantigens foreign to the re- 
sponder T cells. Within 24-48 h, the responder T cells start dividing in response 
to the alloantigens of the stimulator cells, and by 72-96 h, an expanding popula- 
tion of functional CTLs is generated, after which their activity is assessed with 
various effector assays (Ashwell et al. 1984). The assay method is as follows: 

1. Take a single-cell suspension of lxlO 7 responder cells/ml of sensitization me- 
dium in a 15 -ml conical tube. 

2. Prepare single-cell suspension of lxlO 7 stimulator cells/ml in complete me- 
dium in a 15-ml conical tube. Red blood cells may be removed, but this is not 
strictly necessary. 

3. Add mitomycin C to the stimulator cell suspension up to 25 ug/ml final con- 
centration. Incubate cells for 20 min at 37 °C in a C0 2 incubator. 

Note: mitomycin C treatment blocks cell division in the stimulator cells. 
This is particularly relevant for a MLR because the stimulator cells can also 
recognize alloantigens on the responder cells. Although syngeneic stimula- 
tor cells (such as those used for anti-viral and anti-TNP responses) do not 
recognize responder cells as foreign, blocking the division of stimulator cells 
is recommended for providing a clear distinction between responder and 
stimulator cells. Recovery of cells after mitomycin C treatment may be as low 
as 50%. Alternatively, treat the cells by y-irradiation at 2000 rad (tumor cells 
may require very high doses of about 10 000 rad). Irradiation at higher than 
2000 rad inhibits the antigen-presenting activity of B cells, but not that of 
macrophages or dendritic cells. 

Satish Khurana, et al. 

4. Add 1 ml each of responder and stimulator cells to the wells of a 24-well mi- 
croliter plate. Final cell concentration (i.e. sum of responder and stimulator 
cells) should not exceed 12xl0 6 cells/well in a volume of 2 ml. Cell recovery 
after 5 days is generally 50-100% of the responder cells initially plated. 
Note: addition of IL-2 (-10 units/ml) may enhance the generation of CTL 

5. Culture cells for 5 days at 37 °C in a C0 2 incubator. 

6. Transfer non-adhered effector cells in a sterile 15-ml conical tube, centrifuge 
for 5 min at 200 g> and resuspend cell pellet in complete medium. Maintain 
cells at room temperature until CTL activity is assayed by 51 Cr release assay 
as mentioned in Section 

Materials and Equipment 

Responder cells, stimulator cells, sensitization medium, complete medium 
(RPMI 1640 supplemented with 10% ECS), mitomycin C (0.5 mg/ml in HBSS). 

Graft Versus Host Reaction 

The graft versus host (GVH) reaction in experimental animals provides an in 
vivo system for studying cell-mediated cytotoxicity The GVH reaction develops 
when immuno-competent lymphocytes are injected into an allogeneic recipient 
whose immune system is compromised. Because the donor and recipient are 
not genetically identical, the grafted lymphocytes begin to attack the host and 
the hosts compromised state prevents an immune response against the graft. 
The grafted lymphocytes generally are carried to a number of organs, including 
the spleen, where they begin to proliferate in response to the allogeneic MHC 
antigens of the host. This induces an influx of host cells and results in visible 
spleen enlargement, or splenomegaly The intensity of a GVH reaction is as- 
sessed by determining the increase in the weight of the spleen as compared with 
the control spleen. 

Flow Cytometric Analysis of Immune Cells 

This technique is predominantly used to measure fluorescence intensity pro- 
duced by the fluorescent-labeled antibodies or ligands that bind to specific 

6. Modern Techniques for Analyzing Immunological Responses 103 

Cell sample 

Sheath fluid 

Dichroic mirror 

Laser Lens 

Photo-multiplier tube 2 

Photo-multiplier tube 1 

scattered light 

Forward scattered light 

Fig. 6.2 Optical system of a simplified four-color-parameter flow cytometer. The diagram shows, 
in schematic form, the arrangement of mirrors, optical filters, and detector photomultiplier tube. 
A single-cell suspension is forced through the nozzle of the machine under pressure. The cells, 
confined to the axis of the resultant fluid stream by a concentric sheath of cell-free fluid, pass 
through a laser beam, which is focused onto the stream 

cell-associated molecules. Thus, the flow cytometric technique is used to char- 
acterize different cell types present in heterogeneous populations. Morphologi- 
cally all lymphocytes are almost uniform, being small round cells with a dense 
nucleus and little cytoplasm. The different subpopulations of lymphocytes can 
be identified on the basis of expression of specific cell-surface proteins, using 
monoclonal antibodies targeted to the protein molecules. Flow cytometry is the 
most widely used technique in immunology and cell biology. 

Flow cytometer detects individual cells passing in a stream of fluid through a 
laser beam. Every time a cell passes through the laser beam, it deflects the light 
from the detector, and this interruption of the laser signal is recorded. If some 
of these cells are labeled with specific monoclonal antibodies tagged with fluo- 
rescent dyes, the labeled cells experience excitation by the laser and emit light 
that is recorded by a second detecting system (photomultiplier tubes) located at 
a right angle to the laser beam (Fig. 6.2). Depending upon the fluorescent dye 
used, the photomultiplier tubes are changed, as each dye has a different intensity 
of emitted light. The simplest form of the instrument counts the cell numbers 
and records the level of fluorescence by individual cells. By using a standard pro- 
gram, a computer can generate a plot (histogram) of cell number versus fluo- 
rescence intensity. The results can be generated in the form of a dot-plot, where 
each dot represents a single cell. By using flow cytometer, a mixture of more than 
five different cell types labeled with cell-specific antibodies tagged with five dif- 
ferent fluorescent dyes can be detected and analyzed. The advanced version of 
flow cytometer, called a fluorescence-activated cell sorter (FACS), is used both 
for analysis and for sorting one type of cells from a heterogeneous population, 
again depending upon the stained fluorescence intensity. The preparation of a 

Satish Khurana, et al. 

lymphocyte subpopulation by flow cytometric techniques is described by Man- 
son et al. (1987). The general staining technique and analysis of two different 
subtypes of T cells isolated from lymph nodes of immunized mice is described 

1. Prepare a single-cell suspension from lymph nodes of immunized mice and 
enumerate the viable cell number using the trypan blue exclusion method. 

2. Take 50 ul of cell suspension (about 0.5xl0 6 to l.OxlO 6 cells) into four wells of 
a 96 -well round-bottom micro titer plate, spin down to obtain cell pellet. 

3. Dislodge the cell pellet by hand-tapping and leave the plate on a ice bath. Add 
appropriately diluted labeled antibodies in each well as follows: 

a. Well 1 (sample for control; auto -fluorescing cells), add 50 \j! of PBS-BSA- 
sodium azide (AZ). 

b. Well 2 (sample for CD4 + cells), add 50 \d of anti-CD4 antibody conju- 
gated with PE. 

c. Well 3 (sample for CD8 + cells), add 50 |il of anti-CD8 antibody conju- 
gated with FITC. 

d. Well 4 (sample for CD4 + CD8 + cells), add 50 \A each of both anti-CD4 and 
anti-CD 8 antibodies. 

Incubate cells in ice bath for 45-60 min in dark. 

4. Spin down the cells, discard supernatants, and wash the cells three times each 
with PBS-BSA-AZ and PBS-AZ. Finally, resuspend the cells in 400 \A of PBS- 
AZ, and analyze by flow cytometer (the intensity of emission of fluorescent 
dye is quenched on exposure to light, so always store the sample tubes in the 
dark at 4-8 °C). If the samples are not analyzed on the same day, they must be 
fixed with 0.2-0.5% paraformaldehyde (final concentrations). 

To exclude dead cells from the assay, propidium iodide (PI) solution is some- 
times added to unfixed samples (fixing with paraformaldehyde leads to the 

* '* 

■ « 

^55. i % 

- — 

■ ' 

I 1-1 ■ 
y •■■—■, 

■ ■ - ■ '* 

Fig. 6.3 Dot-plot of flow cytometry analy- 
sis of lymphocytes. Cells are labeled with 
CD4 and CD8 antibodies conjugated with 
PE and FITC, respectively. Data shown in 
the figure are not actual 

6. Modern Techniques for Analyzing Immunological Responses 105 

death of cells). Dead cells are stained with PI, thus while analyzing the samples 
in a flow cytometer, the PI + cells (dead cells) are excluded. 

Figure 6.3 shows a typical dot-plot of CD4 and CD8 stained cells. The lower 
left quadrant represents autofluorescence, which means these cells (55.1%) ex- 
press neither CD4 nor CD8 molecules on their surface. The autofluorescence is 
due to intracellular constituents. Cells in the upper left quadrant (19.5%) rep- 
resent CD4 + cells. The average fluorescence intensity of these cells is increased 
more than the normal cells (autofluorescence) due to selective binding of PE- 
conjugated anti-CD4 antibody. Similarly, cells in the lower right quadrant 
(24.6%) represent CD8 + cells. It may be seen that about 0.8% cells are labeled 
with both anti-CD4/PE and anti-CD8/FITC antibodies (upper right quadrant), 
as these cells are CD4 + CD8 + (all these percentage values are not actual, they are 
just used to interpret the data of flow cytometry experiments). 

Materials and Equipment 

Cell samples (single-cell suspension), anti-CD4/PE, anti-CD8/FITC, PBS-BSA- 
AZ mixture (0.5% BSA and 0.1% sodium azide in PBS), PBS-AZ mixture (0.1% 
sodium azide in PBS), paraformaldehyde solution (5%, w/v, solution in PBS; 
paraformaldehyde is dissolved by warming the suspension at 50 °C for 1 h; the 
clear solution is filtered-sterilized and stored at 4 °C; the solution should be 
used within 1 month of preparation), Propidium iodide (PI) solution (2 mg/ml; 

Refrigerated centrifuge with swing- out bucket, micropipettes, round-bottom 
96 -well plate, flow cytometer. 

Magnetic Activated Cell Sorting 

Other than FACS, a sub-set of immune cells can also be sorted (purified) by 
using magnetic activated cell sorting (MACS) technology. The principle of sort- 
ing is based on super-magnetic microbeads coupled with specific monoclonal 
antibodies. Depending upon the requirements, microbeads are added to the cell 
suspension and get attached to the corresponding cell population on the basis 
of their antibody- tags with them. When this mixture is passed through a MACS 
column in the presence of a high magnetic field, the cells previously attached 
with the magnetic particles are retained on the column, allowing other cells to 
pass through the column (Funderud et al. 1987; Miltenyl Bio tec 2006). Later, the 
column-retained cells are eluted by detaching from the magnetic field, followed 

Satish Khurana, et al. 

Target cells are magnetically 

labeled with antibody conjugated 

Magnetically labeled cells are 
retained by the column in presence 
of strong magnetic fie Id 

StepS : 

Target cells are eluted by flashing 
with buffer, in absence of magnetic 

Fig. 6.4 Magnetic activated 
cell sorting. Positively se- 
lected cells are collected 
on the column, which are 
later eluted (adapted from 
Miltenyl Biotec, Bremen, 

by washing the column with buffer (Fig. 6.4). Two different strategies are fol- 
lowed to sort the cells: 

1. Positive selection. This means that the target cells are magnetically labeled 
and isolated directly as the positive cell fraction attached on the column. The 
positive selection is used for enrichment of rare cells at the highest purity 
level. The recovery of cells is of a high order and the selection process is much 
faster than alternative methods. 

2. Negative selection. This means that unwanted cells are magnetically labeled 
and eliminated from the mixture of cells; the unattached cells are the target 
cells. Negative selection is used for the removal of unwanted cells, and when 
specific antibody to the target cells is not available. 

The procedure for the positive selection of CD8 + cells from the spleen of an 
immunized mouse is given below: 

1. Prepare a single-cell suspension from spleen of immunized mice, as men- 
tioned in the earlier section and enumerate the cell number. Take a fixed 
number of cells (~20xl0 6 ) in a tube and wash with washing buffer. Resus- 
pend the pellet in 100 ul of same buffer and place the cells in an ice bath. 
Add the required amount of CD 8 microbeads to the cell suspension, mix the 
content, and incubate for 20-30 min. 

2. In the meantime, place the MACS column in the magnetic field of a suitable 
MACS separator, prepare the column by washing with the buffer. After the 
incubation of cells in step 1, wash the cells once in the same buffer, resuspend 
in 1 ml of buffer, and apply onto the column. 

3. Allow unbound cells pass through the column, and discard those cells. Wash 
the column with the same buffer to remove unbound cells. 

6. Modern Techniques for Analyzing Immunological Responses 107 

4. Detach the column from the magnet and place on a test tube stand on the 
top of a collection tube. Flush the column with the buffer to elute positively 
selected cells. 

5. To determine the purity of CD8 + cells, take an aliquot of cells and label with 
secondary antibody conjugated with FITC/PE, wash the cells, and analyze in 
a flow cytometer. 

Materials and Equipment 

Cell sample (single-cell suspension), filter- sterilized MACS buffer (PBS contain- 
ing 0.5% BSA and 2 mM EDTA), CD8 microbeads, secondary antibody conju- 
gate (FITC/PE). 

MACS separation column, magnet and stand, sample collection tubes. 

Isolation of Mononuclear Cells from Peripheral Blood 

Often mononuclear cells are isolated from the peripheral blood for analyzing 
subsets of immune cells (T-, B-, NK cells, macrophages, etc.). Experimental ani- 
mals are generally sacrificed to recover these cells from spleen or lymph nodes. 
However, in humans peripheral blood is the only source of these cells for immu- 
nological studies. Mononuclear cells (lymphocytes) can be separated from pe- 
ripheral blood by Ficoll-Hypaque density gradient centrifugation (p = 1.077). 
This method is based on the fact that the different cell types present in the pe- 
ripheral blood have different densities. When applied to density gradient cen- 
trifugation, mononuclear cells accumulate in the buff-colored layer, near the 
Ficoll-Hypaque and aqueous medium interphase, whereas eythrocytes and 
granulocytes, the denser cells fractions, are collected in the bottom of the centri- 
fuge and in the Ficoll-Hypaque, respectively. Careful collection of the buff-col- 
ored layer yields highly purified mononuclear cells. In order to remove platelets, 
the mononuclear cells are centrifuged through a FBS cushion gradient, which 
allows the penetration of mononuclear cells but not platelets. The lymphocytes 
can be further purified from monocytes by plastic adherence of the mononu- 
clear cells (monocytes adhering on the plastic plate). The various steps involved 
in isolation of mononuclear cells are described below: 

1. Collect blood (~2 ml, in the case of humans) in a heparinized tube, add an 
equal volume of sterile PBS and mix well. 

2. In a separate tube (15 ml), take 3-4 ml of Ficoll-Hypaque solution, and 
slowly layer the cell suspension over it with the help of a pipette. 

Satish Khurana, et al. 

3. Centrifuge the tube in a swing-out rotor at 600 gfor 30 min at room tempera- 

4. With the help of a 1-ml pipette tip, suck-out the buff layer and transfer it to 
a similar tube containing HBSS. Wash the cell pellet two times in the same 
buffer to remove traces of Ficoll-Hypaque. 

5. Finally, resuspend the cell pellet in complete medium and enumerate the vi- 
able cell number. 

Materials and Equipment 

Heparinized blood, PBS, Ficoll-Hypque solution, filter-sterilized HBSS (pH 6.4; 
5.4 mM KC1, 0.3 mM Na 2 HP0 4 7H 2 0, 0.4 mM KH 2 P0 4 , 4.2 mM NaHC0 3 , 1.3 
mM CaCl 2 , 0.5 mM MgCl 2 6H 2 0, 0.6 mM MgS0 4 7H 2 0, 137 mM NaCl, 5.6 mM 
D-glucose, 0.2% phenol red in water), FBS, complete medium. 

Conical tube (15 ml), table-top centrifuge with swing-out rotor, plastic ware. 

The immune system has been developed to protect against the threat of patho- 
gens. When invaded by foreign molecule(s), each mammal elicits a unique im- 
mune response. The primary function of such immune response is two-fold: 
first to counteract the pathogen, second to educate the immune system to take 
care of any similar threat in the future. The immune response means either the 
formation of neutralizing antibodies, or the development of cytotoxic T cells to 
destroy infected cells to prevent further spread of the disease. The immune re- 
sponse is specific for each pathogen/foreign molecule. With the development of 
understanding on various immune cells and the technological advancements of 
assay systems, it has become possible to analyze immune response qualitatively 
and quantitatively, and a few of them have been discussed in this chapter. 

Ashwell JD, DeFranco AL, Paul WE, Schwartz RH (1984) Antigen presentation by resting B 
cells: radiosensitivity of the antigen-presentation function and two distinct pathways of 
T cell activation. J Exp Med 159:861-869 

BD Biosciences (2006) Technical literature of BD cytometric bead array: mouse Thl/Th2 cy- 
tokine CBA. BD Biosciences, San Diego 

6. Modern Techniques for Analyzing Immunological Responses 109 

Brunner KT, Mauel J, Cerottini J-C, Chapuis B (1968) Quantitative assay of the lytic action 
of immune lymphoid cells on 51Cr labeled allogenic target cells in vitro: inhibition by 
isoantibody and by drugs. Immunology 14:181-196 

Derby E, Reddy V, Baseler M, Malyguine A (2001) Flow cytometric assay for the simulta- 
neous analysis of cell- mediated cytotoxicity and effector cell phenotype. BioTechniques 

Funderud S, Nustad K, Lea T, Vartdal F, Gaudernack G, Stenstad P, Ugelstad J (1987) Frac- 
tionation of lymphocytes by immunomagnetic beads. In: Klaus GGB (ed) Lymphocytes. 
IRL Press, Oxford, pp 55-65 

Goldsby RA, Kindt TJ, Osborne BA (2000) Kuby immunology, 4th edn. Freeman, New York 

Lightbody J, King YC (1974) Comparison of 137Cs irradiation and mitomycin C treatment of 
stimulator cells in the mixed lymphocyte culture reaction. Cell Immunol 13:326-330 

Manson DW, Penhale WJ, Sedgwick JD (1987) Preparation of lymphocyte subpopulations. 
In: Klaus GGB (ed) Lymphocytes. IRL Press, Oxford, pp 35-54 

Miltenyl Biotec (2006) Technical literature of MACS magnetic cell sorting. Miltenyl Biotec, 

Reeves JP, Reeves PA (1992) Selection of surgical procedures. In: Coligan JE, Kruisbeek ADF, 
Margulier DH, Shevach EM, Strober W (eds) Current protocols in immunology, vol 1. 
Wiley, New York 

Transcriptome Analysis 

S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

The phenotype of a living organism depends on the expression of its genetic ma- 
terial. Most living organisms, except some viruses, have DNA as genetic material. 
All cells of an organism have a similar genome structure and organization but 
there is a highly specialized regulatory network, which brings about the speci- 
ficity in their expression. At a given point in time, in a given cell, only a speci- 
fied part of its genome is active transcriptionally. In this modern era of "omes" 
and "omics" a new name - transcriptome - has been suggested to represent the 
set of all mRNA molecules (or transcripts) in one or a population of biological 
cells for a given set of environmental circumstances. Therefore, unlike the ge- 
nome, which is fixed for a given organism (apart from genetic polymorphisms), 
the transcriptome varies depending upon the context of the experiment. As not 
all the genes in the genome are transcribing at a given time, the transcriptome 
is less complex than the genome of an organism. The transcriptome, partially 
or fully, eventually gets translated to give rise to a proteome. Again, as some 
of the transcripts within the transcriptome never get translated into proteins, 
the proteome seem to be even less complex than the transcriptome. However, 
the complexity of the proteome increases due to its post-translational modifica- 
tions. These differently modified proteins function in the synthesis of various 

Sudesh Kumar Yadav: Biotechnology Division, Institute of Himalayan Bioresource 
Technology, CSIR, Palampur- 176061 (HP), India 

Sneh L. Singla-Pareek: Plant Molecular Biology, 

International Centre for Genetic Engineering and Biotechnology, Aruna Asaf Ali Marg, 

New Delhi- 1 10067, India 

Ashwani Pareek: Stress Physiology and Molecular Biology Laboratory, School of Life Science, 
Jawaharlal Nehru University, Aruna Asaf Ali Marg, New Delhi- 110067, India, 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

112 S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

primary and secondary metabolites, the total make-up of which is known as a 
metabolome. The combination of these intricate and interlinked information of 
the genome, RNA, proteins, and metabolites, are vital for the biological activity 
of an individual. 

The era of genomics started as early as in 1995 when the entire genome se- 
quence of the self-replicating organism, Haemophilus influenzae, was first de- 
scribed. This success opened up a new direction and within a decade, we had 
more than 100 genomes being sequenced or already sequenced, including 
higher plants such as Arabidopsis thaliana. The economically important crop 
plant rice has also been reported to be completely sequenced by the commercial 
sector (Arabidopsis Genome Initiative 2000; Butler and Pockley 2000; Daven- 
port 2001). By the end of 2004, there were as many as 163 genomes which had 
been completely sequenced. Many more such efforts are currently in progress 
- including representatives from Bacteria, Archaea, and Eukarya. A list of the 
genomes which have been completely sequenced or are in progress is available 
at: This illustrative information on ge- 
nome sequences can be exploited in several ways. One of the most important 
uses of the information available from genome sequencing is for the under- 
standing of the regulation of a functional genome, i.e. the transcriptome. This 
has been made possible with the advent of novel tools and techniques of molec- 
ular biology which aid in isolation, and thus, the analysis of biological material 
from very small amount of tissues. With the advancement of our understanding 
of these techniques, transcript analysis (transcriptomics), and protein profiling 
(proteomics), the most advanced strategies have been developed to provide an 
answer to the question: how does the expression of a gene respond variably to a 
particular external or developmental stimulus? 

A gene for a specific trait can be identified through analysis of complementary 
DNA (cDNA) or copies of messenger RNA (mRNA). This requires the isola- 
tion of pure RNA, and in some cases, mRNA. Messenger RNAs represent only a 
small percentage of the total RNA (about 1-3% in eukaryotes). However, mRNA 
contains valuable information and is directly responsible for protein translation. 
To assess the expression of a gene, it is quite important to analyze the amount of 
mRNA corresponding to that particular gene. Therefore, transcriptome analysis 
is one of the important tools to assess the expression of a gene. There are several 
ways to quantify RNA. Among these, the commonly used gene expression and 
quantitation assay methods include Northern blot analysis, dot/ slot blot hybrid- 
ization, in situ hybridization, RT-PCR, and microarray analysis. In this chapter, 
we have attempted to provide an insight into these contemporary techniques of 
transcriptome analysis. For brevity sake, we have not provided details related to 
the development of these techniques over time, but have presented the informa- 
tion in a manner in which the reader can gather basic information about these 
techniques and learn the principle along with the essential steps in the experi- 
ment. Readers are encouraged to explore the detailed references for individual 
techniques, as provided in the reference list. 

7. Transcriptome Analysis 

RNA Preparation 

For each of the analysis techniques described in this chapter, one of the pre- 
requisites is to have a good quality RNA preparation. Thus before describing 
each of these techniques, it is worthwhile to suggest some measures to obtain 
good preparation of RNA. To begin with, one needs to have a suitable extraction 
method for the RNA isolation from the source. If the sample is a plant, animal or 
microbial source, it can be fresh or frozen tissue. However, it has been seen that 
fresh tissue is a better source of good quality RNA. As little as 50-100 mg of tis- 
sue is suitable for total RNA extraction. If the source is a microorganism, grow 
cells and harvest at the stage when the maximum number of cells are at their 
exponential phase of growth. The basic principle of RNA extraction has been 
well summarized by Sambrook et al. (1989). This crude RNA preparation is well 
suited for its analysis by most techniques. However, if the RNA is to be used 
in enzymatic reactions, better and more reproducible results can be obtained 
when the RNA preparation is further cleaned. A fast and easy method relies on 
commercially available columns (e.g. Qiagen columns). In these methods, the 
RNA preparation is conditioned with a buffer provided by the manufacturer. 
The solution is applied to a column on which the RNA is specifically retained. 
The column is then washed with several buffers before the RNA is eluted and 
obtained in a highly pure form. The RNA quantity is measured with a spec- 
trophotometer and its integrity verified on a 0.8-1.0% agarose gel. This highly 
purified RNA can be commonly used for transcriptome analysis by employing 
techniques such as microarray and reverse transcriptase (RT)-PCR. 

Northern Analysis 

Northern blot analysis is the simplest and most commonly used technique for 
detection and quantification of specific RNA species from a particular cell or 
tissue type. In this method, total RNA is isolated and separated by electrophore- 
sis through an agarose/formaldehyde gel, which separates the RNA by size. The 
distance of migration of the RNA molecule is inversely proportional to the size 
of RNA molecule. After its separation on agarose, RNA is stained with ethid- 
ium bromide and visualized using UV light. In those gels having total RNA, 
the 28S and 18S ribosomal subunits are conveniently visible due to their high 

114 S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

abundance and act as convenient size markers (approx. 4.8 kb and 1.9 kb, re- 
spectively). To detect the mRNA of interest, we perform Northern blotting. For 
this purpose, it is necessary to transfer the RNA from the agarose/formaldehyde 
gel to a nitrocellulose or nylon membrane. On the membrane, RNA is detected 
by hybridization using a labeled probe. The probe may be a DNA or RNA mol- 
ecule, which is labeled either chemically or radio actively. During Northern blot- 
ting, one should keep the following precautions in mind: 

1. As formaldehyde is toxic and a potential carcinogen, use it inside the fume 
hood and do not inhale. 

2. Formamide and ethidium bromide are also toxic, and hence should be han- 
dled with gloves. 

3. UV light can damage eyes if not protected, therefore, wearing a facemask or 
goggles is recommended. 

4. Agarose can also cause nasty burns, so handle with care (Sambrook et al. 
1989; Trayhurn et al. 1994). 

After isolating the RNA, prepare the sample for electrophoresis. Take 10-20 |ig of 
RNA in a sterile Eppendorf tube, while maintaining the sample on ice. The vol- 
ume of RNA should be increased to 15 (al by the addition of DEPC-treated water. 
To this mixture, add de-ionized formamide, formaldehyde and running buffer 
(lOx stock), and 2.5 |il loading buffer. Next, denature samples by heating at 60 °C 
for 20 min, then snap -cool on ice. Prepare a 0.8-1.0% agarose in lOx running 
buffer by boiling (for example 1.2 g in 15 ml of buffer and make its volume up to 
150 ml with DEPC-treated water at the end). Add an appropriate concentration 
of iodoacetamide, formaldehyde, and ethidium bromide. Mix all the contents, 
make-up to its final volume by adding DEPC water, and pour into a sealed gel 
tray (do not forget to place the comb to form the wells just after pouring the gel). 
After 30 min, load the samples into the wells and run at 100 V for 2 h. 

After electrophoresis, analyze the gel under UV light. Wearing gloves, remove 
the gel from the tank, carefully place the gel on a transilluminator and either 
take a photograph or see it in a gel-documentation system, which is fitted with a 
camera and monitor. This picture of gel aids later in matching the position of the 
ribosomal markers on the photograph with the final X-ray film of the hybridized 
mRNA. The use of a Saran wrap is recommended while transporting gel from 
tank to UV transilluminator. Now, transfer the RNA from the gel to the nylon 
membrane (nitrocellulose or Hybond N nylon). The nylon membrane should be 
the same size as the gel. Take a glass tray of an appropriate size and pour transfer 
buffer into it. Place a glass plate on this tray and a Whatman paper over the glass 
plate, ensuring that two ends of the Whatman paper dip into the transfer buffer. 
Put the gel over the Whatman paper and the nylon membrane over the gel. Fi- 

7. Transcriptome Analysis 

500 g Block 

Bridge (3MM paper) 

Transfer buffer 

Nylon membrane 

] Two pieces of 3MM paper 
4 — Inverted agarose gel 
] Two pieces of 3MM paper 

Glass or plastic 
autoclaved tray 

Plastic tray 

Fig. 7.1 Northern blotting set up 

nally, add some filter papers and about 500 g of weight. Set up transfer as shown 
above and leave the RNA to transfer by capillary action overnight (Fig. 7.1). 

After the transfer, carefully disassemble the transfer apparatus and remove 
the nylon membrane. Here, mark the right and left sides by cutting a small cor- 
ner of the membrane with scissors. Neutralize the membrane in 100 mM Tris- 
HC1 (pH 8) and fix the RNA onto nylon membranes using a UV crosslinker 
or by baking for 2 h. Now the blot is ready to be placed in the hybridization 
chamber. For prehybridization, put the blot in a hybridization bottle and soak 
it with at least 10-15 ml of pre -hybridization buffer (50% formamide, 5x SSPE, 
5x Denhardts reagent, 1% SDS). Let it rotate in the hybridization chamber at 
56-60 °C for 4-5 h (by this time you can prepare the probe). Boil salmon sperm 
DNA for 5-10 min, snap -cool on ice, and add it to the hybridization buffer. In 
the hybridization step, the labeled probe is added to the pre -hybridization solu- 
tion. Here, do not forget to boil the probe for 10 min and then chill quickly on 
ice. Open the hybridization chamber, and without disturbing the membrane, 
add the denatured (boiled) probe to the hybridization buffer and mix gently, 
then return it to the hybridization chamber and incubate overnight at 56 °C. 

As a result of overnight hybridization, the complimentary sequences on the 
membrane should have hybridized with the probe. However, the membrane 
might have some background radioactivity due to non-specific binding of probe, 
which needs to be washed, in order to obtain a clean specific signal. For this 
purpose, we should perform at least three washings of the blot before develop- 
ing it. Discard the hybridization solution in the designated container/sink. Keep 
the membrane in the hybridization chamber for washes. Add about 50 ml of 2x 
SSC with 0.1% SDS (room temperature) to the hybridization chamber, wash the 
membrane for 10 min, and then discard the washing solution. Repeat the above 
washing step. Discard the second wash solution. Add 50 ml of 0.1 x SSC with 
0.1% SDS, preheated to 56 °C, to the hybridization chamber. Wash for 20 min 

S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

Oh 1h 2h 4h 8h 16h 32h 48h 

Control (water) 

Salinity stress 

Fig. 7.2 Northern blot, 
after washing and develop- 
ing the X-ray film. Blot 
shows the developmental 
regulation of gene A under 
control and salinity stress 

and discard the final wash solution. Remove the membrane from the hybridiza- 
tion chamber and put it on a dry piece of Whatman filter paper of similar size. 
Wrap it in Saran wrap and expose overnight to X-ray film after placing them in a 
cassette. X-ray film may be developed after 24 h, or can be left for longer periods 
if necessary (Fig. 7.2). 

1. The Northern blotting technique is helpful in determining the status of a 
gene, i.e. whether the gene in question is active or not. 

2. Depending on the inducibility of a novel gene by various signals, an idea can 
be obtained about the possible functions of the same. 

3. Information from analysis as in point 2 above can also be extrapolated to 
describe the feature of the promoter of the gene being analyzed. 

4. The tissue or stage-specific inducibility of a gene may also indicate its specific 

5. The data obtained from this technique can also be used for both qualitative 
and quantitative comparison of expression of gene(s). 

In Situ Hybridization 

In situ hybridization is a method of localizing and detecting specific mRNA 
sequences in tissue sections or cell preparations. In this technique, RNA or 

7. Transcriptome Analysis 

DNA isolation is not required as in the other methods of RNA analysis. Spe- 
cific mRNA is localized by hybridizing the complimentary strand of a nucleo- 
tide probe to the sequence of interest. The technique is appreciably sensitive 
as its detection limit range from ten to 20 copies of mRNA per cell. However, 
the technique also suffers from a major drawback associated with masking of 
low-copy signals due to associated protein or access of the probe to the target 
sequences, which are protected within complex cellular structures. Therefore, 
in order to detect the RNA in tissues or cells of interest, one has to increase the 
permeability within the cell without destroying its structural integrity. Theo- 
retically speaking, there are as many protocols for carrying out in situ hybrid- 
ization as there are different tissues that have been probed (Wilkinson 1994; 
Childs 1999). Here, we attempt to describe the basic steps of the process along 

with their underlying principle. 

Preparation of Sample 

There are three ways to prepare tissues for in situ hybridization, as described 

1. To make the sections of fresh tissue is not an easy job. Therefore, wherever 
possible, the tissue is snap-frozen (rapidly put into a -80 °C freezer) before 
sectioning. The completely frozen tissue is embedded in a special support 
medium for thin cryo -sectioning. The sections are lightly and rapidly fixed 
in 4% paraformaldehyde on a microscopic plate followed by their hybridiza- 

2. Large sections of the tissues are fixed in formalin and embedded in wax (par- 
affin sections) before being sectioned. 

3. For special samples such as cell suspension from leaf tissues or callus, the 
cells are cytospun onto glass slides followed by fixing them onto the slides 
with methanol. 

For permeabilization of the tissue, three commonly used reagents are HC1, 
detergents (Triton or SDS), and Proteinase K. HC1 is thought to act by extrac- 
tion of proteins and hydrolysis of the target sequence, which also help to de- 
crease the level of background staining. Detergent is frequently used to permea- 
bilize the tissue membranes by extracting the lipids. This is not usually required 
in tissue that has been embedded in wax, but may be more useful for intact 
cells or cryostat sections. Proteinase K is a non-specific endopeptidase attacking 
all peptide bonds and is active over a wide pH range. It is commonly used to 

118 S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

remove proteins that surround the target sequence (Tautz and Pfeifle 1989; de 
Almeida-Engler et al. 1994). 

Prehybridization is generally carried out to reduce background staining. But 
in in situ hybridization, this step is very crucial than any other technique of 
transcript analysis described in this chapter. Many of the non-radioactive oli- 
gonucleotide probe detection methods utilize enzymes such as peroxidases or 
alkaline phosphatases to visualize the label. Therefore there should not be any 
interference of endogenous tissue enzymes, which could result in giving a very 
high background. If interference is expected, then we have to neutralize our tis- 
sue or tissue sections. This can be achieved as follows: (a) for peroxidases, treat 
the tissues with 1% H 2 2 in methanol for 30 min, and (b) for alkaline phospha- 
tases, the drug levamisole may be added to the substrate solution. This should 
be added in a very low concentration otherwise residual alkaline phosphatase 
activity is usually lost during hybridization. Finally, prehybridization involves 
incubating the tissue/section with a solution that is composed of all the ele- 
ments of the hybridization solution, minus the probe. 

Hybridization of the oligonucleotide to the target mRNA within the tissue de- 
pends on several factors, like temperature, solution pH, monovalent cation 
concentration, and presence of organic solvents. A typical hybridization solu- 
tion which can be used at 37 °C temperature and with an overnight incubation 
period should have several essential components, as described here. Dextran 
sulfate is one of the most important components of a hybridization solution as it 
absorbs the maximum amount of water and thus reduces the amount of hydrat- 
ing water for dissolving the nucleotides. Therefore, dextran sulfate effectively 
increases the probe concentration in solution. While formamide and dithioth- 
reitol (DTT) reduce the thermal stability of bonds and allow hybridization at a 
lower temperature. The use of SSC (NaCl + sodium citrate) is also crucial as it 
dissociates into monovalent cations in solution, which interact with the phos- 
phate groups of nucleic acids, and as a result, decrease the electrostatic interac- 
tions between the two strands and make them comparatively stable. Hybrid- 
ization is generally reduced to a great extent in the presence of divalent ions. 
Therefore, EDTA is also added, which removes free divalent cations from the 

7. Transcriptome Analysis 

hybridization solution, thus increasing the efficiency of hybridization. In addi- 
tion to this, salmon sperm DNA, tRNA, and Denhardts solution are also added 
in the hybridization solution to decrease the chance of non-specific binding of 
the oligonucleotide probe. 

Mainly radioactive probes are used for in situ hybridization. The advantage 
of a radiolabeled probe is its ability to detect very low levels of transcripts, while 
the major limitations with the use of radiolabeled probes are poor spatial reso- 
lution and the requirement of long exposure time for microautoradiography. 
However, exposure time depends on the radioisotope used and the amount of 
target molecules in the tissue under experiment. Recently, the application of 
non-radioactive labeled nucleotides [e.g. biotin-UTP, digoxigenin (DIG)-UTP] 
considerably improved the detection limits for in situ hybridization technique. 
Among the non-radioactive labeling methods developed so far, DIG-based 
detection has proven to be the most appropriate, due to its high specificity and 
sensitivity. Another advantage of the DIG method is the high signal to noise 
ratio, since no plant other than Digitalis has been shown to have this compound 
(O'Neill etal. 1994). 

After overnight hybridization, the material is washed 2-3 times to remove un- 
bound probe or probe which has loosely bound to partially homologous or mis- 
matched sequences. Washing should be carried under stringency conditions 
similar to hybridization. However, the final wash should be carried out at low 
stringency, taking precautions not to dislocate the tissue. 

1. Expression of a gene can be localized in a specific cell, and hence, can be cor- 
related with its possible function (s). 

2. The differential level of the same gene in different tissues of an organism can 
be analyzed. 

3. Used for the identification of a microorganism in microbial ecosystem. 

4. Detection of specific microbes can be done in plant tissue through mRNA 

5. Diversity analysis of a microbes in a microbial ecology. 

6. Identification of pathogenic microbes responsible for a disease in humans. 

120 S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

Dot Blot and Slot Blot 

Specific transcript (mRNA) in an unfractionated preparation can be measured 
directly by immobilizing the sample in the form of a spot (dot blot) or in a mani- 
fold slot (slot blot). It is a relatively rapid technique for RNA detection and quan- 
titation as compared with those described above (Yadetie et al. 2004). In the dot/ 
slot blot, a desired RNA species is detected by using a labeled DNA/RNA probe. 
For the dot blot quantitation is usually visual, whereas the slot blot format is 
more easily and accurately quantitated by scanning with a densitometer. 

Sample Preparation 

This technique can be equally optimized for quantitation of both DNA and 
RNA. For obtaining purified DNA for dot/ slot blot, standard protocols of DNA 
isolation are followed. In the case of bacteria, we can use cell lysate directly as a 
DNA source. While using RNA for dot/slot blot, it is to be noted that all solu- 
tions and glassware involved with RNA work should be sterilized or treated to 
remove any RNase. Glassware should be washed in 0.2% diethylpyro carbonate 
prior to use, followed by autoclaving. 

Prior to the application of a DNA or RNA sample to the membrane, denatur- 
ation is required. For a DNA sample, Add 0.1 vol of 1 N NaOH and incubate for 
5 min at 37 °C or heat the sample for 5 min in a boiling water bath and imme- 
diately put on ice. Add 1 vol of 2 M ammonium acetate, pH 7. Dilute the sample 
in a suitable buffer prior to its application to the membrane. In contrast, RNA 
is denatured by mixing with 100% formamide (50% final), 37% formaldehyde 
(7% final), and 20x SSC (lx final). Incubate the mixture at 68 °C for 15 min, fol- 

7. Transcriptome Analysis 

lowed by cooling on ice. Alternatively, RNA may also be denatured with glyoxal 

or with methyl mercuric hydroxide. 

Membrane Preparation 

Wet the membrane thoroughly in deionized water and then soak in 1 M am- 
monium acetate, pH 7.0, or in 6-1 Ox SSC prior to use. A high salt buffer is nec- 
essary for retention of the DNA or RNA on nitrocellulose membranes. While a 
lower ionic strength buffer (2-5x final concentration) may be used for sample 
dilution with Nytran nylon membranes. 

Sample Application 

Apply sample aliquots to the membrane placed on the top of two sheets of dry 
filter paper (blot the membrane briefly to remove excess liquid before spotting 
sample). Allow sample area to dry prior to application of additional solution to 
the membrane. 

For immobilization, bake the membrane at 80 °C in a vacuum oven for 20 min 
to 1 h or until dry. Alternatively, DNA or RNA on the membrane may also be 
immobilized by UV crosslinking. For this purpose, the membrane is exposed to 
a UV source of 254 nm. 

Hybridization and Detection 

Hybridization of the blot prepared above is carried out by using a labeled probe, 
as described for Northern blotting. Specific hybridized bands are detected 
through autoradiography, and for the densitometric scanning of nitrocellulose 
blots, the blot membrane is made clear by immersing the same in xylene, paraf- 
fin oil, or immersion oil. 

S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

T C 

Fig. 7.3 Comparative profile expression on a slot of differentially expressed 
transcripts in control and treated samples. Total RNA isolated from control 
(C) and treated (T) microbes of six different species were subjected to slot 
blot analysis using the re-amplified PCR fragment as a probe. In the control 
conditions all the six probes used here are still expressing, while upon treat- 
ment four get down-regulated 

Let us try to understand the technique with the help of a hypothetical exam- 
ple where cell lysate from six different microbial species has been used to make 
a slot blot. The objective of the analyis is to see the expression of a particular 
gene under control and treated conditions in these different species. After using 
the labeled sequence as probe, results as shown in Fig. 7.3 have been obtained. 
Based on these results, it can be safely concluded that the gene in question is 
strongly down-regulated in all species except the two which show only a mar- 
ginal change in the level of the signal. 
Dot Blot 

For dot blot analysis, instead of making the slots, total RNA is loaded on the 
membrane in the form of dots. The rest of the procedure is exactly the same as 
described in slot blot analysis. We can describe dot blotting with an example 
that helps us in understanding the technique. In this experiment, six different 
microbial species have been analyzed. These species have been transformed with 
a specific stress-related gene, with the objective of improving their tolerance for 
a particular stress. Six non-transformed species have also been analyzed, along 
with their transformed counterparts. Through dot blot analysis, we can assess 
the degree of tolerance of these different species, as depicted in Fig. 7.4. It can 
be concluded from this experiment that expression of the gene in question is 
down -regulated in some species after just one week of growth under stress, 
while some tolerant ones still showed a high expression of the gene even after 
two or three weeks. 

7. Transcriptome Analysis 

3 wk 

Fig. 7.4 Comparison of a 
transcript in tolerant and 
intolerant microbial spe- 
cies by Dot blot analysis. 
Total RNA used for dot 
blot analysis was isolated 
on the first day (0) and 
on weeks 1,2, 3 of their 

1. The dot/ slot blot techniques, although they are crude methods in which iso- 
lated nucleic acid preparations in solution are applied directly to a transfer 
membrane, they skip the step requiring their analysis in agarose gel. 

2. These techniques provide a rapid qualitative screening method for target se- 
quences of RNA or DNA. 

3. Assays can be performed with either purified nucleic acids or cell lysates as 

4. They can be easily optimized for high-throughput analysis of samples such 
as identification of organisms and studies related to microbial community 

Reverse Transcriptase-Polymerase Chain Reaction 

The routine PCR technique greatly amplifies the copy number of a given DNA 
for analysis, cloning, and storage. However, RT-PCR starts with mRNA or to- 

124 S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

Reverse transcriptase 

RNase H 

Routine PCR 

Fig. 7.5 Diagrammatic representation of the major steps in RT-PCR 

tal RNA, makes a cDNA complimentary strand using reverse transcriptase, and 
then amplifies the product through routine PCR (Fig. 7.5). RT- PCR is most 
sensitive and accurate technique used for transcript analysis. It is used for both 
quantitation and comparision of RNA between two or more sources (Sperisen 
et al. 1992; Chelly and Kahn 1994). 

There are several factors affecting the performance of RT-PCR as they in- 
terfere with amplification efficiency. These are Mg 2 7dNTPs/primer concentra- 
tions, efficiency of reverse transcription, enzyme activity, pH, annealing tem- 
perature, cycle number, temperature variation, tube-to-tube variation, etc. Since 
PCR results in a million-fold amplification within a short span of time, variation 
in any of the above factors during the amplification process significantly affects 
the final results. Therefore, routine RT-PCR cannot be used for the purpose of 
quantitative analysis. This major problem, however, can be solved using quanti- 
tative RT-PCR. This method uses an external template as the internal control for 
all the steps in RT-PCR process (Schneeberger et al. 1995). 

RT-PCR comprises of two steps, including the reverse transcription where 
mRNA is converted to first-strand cDNA and the amplification of first-strand 
cDNA through routine PCR. During the first step, oligo dT primers are gener- 
ally used as mRNA and have the polyA tail at their 3' end Thus through this 
process, we can specifically make the first-strand cDNA of mRNA only. For the 
synthesis of cDNA from mRNA, reverse transcriptase is required. Reverse tran- 

7. Transcriptome Analysis 

scriptase can synthesize a DNA strand complementary to mRNA, and to carry 
out the routine PCR for amplification, mRNA is removed from the hybrid by 
using RNase H. For the purpose of reverse transcription, two types of reverse 
transcriptase are commercially available. One is from avian myeloblastosis vi- 
rus (AMV) and other from Moloney muriene leukemia virus (MMLV). AMV- 
RTase has a powerful RNase activity, which can easily digest the RNA moiety of 
RNA-DNA hybrids but lacks proof-reading activity and shows maximum activ- 
ity at 42 °C. In contrast, MMLV-RTase lacks RNase activity and shows maxi- 
mum activity at 37 °C. 

For carrying out the reaction, gene-specific primers along with enzyme and 
optimized RT buffer is required. Reverse transcription is carried out for 1.0- 
1.5 h and first-strand cDNA synthesis is followed by inactivation of enzyme at 
70 °C for 5 min. After inactivation, tubes are immediately put on ice to avoid 
the formation of secondary structures. Next the sample is treated with RNase 
H to degrade the RNA, and cDNA is used for amplification through routine 
PCR. The routine PCR comprises of three steps: denaturation (carried out at 
94-95 °C), annealing (annealing temperature depends on the T m of the primes 
used in the amplification), and extension (carried out at 72 °C). These three 
steps are followed for 30-35 cycles. 

Primer design is an extremely crucial step in RT-PCR. Following are the some 
important points, which should be kept in mind while designing primers: 

1. GC content of primer sequence should be 40-60%. 

2. There should be no continuous repeat of any one type of nucleotide. 

3. Length of primers should be 18-25 nucleotides, with forward and reverse 
primers not differing in their length by more than three nucleotides. 

4. There should be no inverted repeat sequence or self-complementary se- 
quence. These types of sequences may form a hair-pin loop structure and 
interfere in the annealing process. 

5. Two primers of a reaction should not be complementary to each other; else 
they would form primer-dimers, rendering them unavailable for amplifica- 
tion of the target sequences. 

6. Primer pair should not differ in their T m by more than 5 °C. A greater differ- 
ence in T m would not allow both the primers to anneal at same temperature. 

7. Useful sequences such as restriction sites are usually added at 5' end, while the 
3' end of primer is crucial; one should try to keep either G or C at the 3' end. 

8. The T m of a primer is calculated using the following formula: T m = 2(A+T) 
+ 4(G+C). 

Application of RT-PCR 

1. RT-PCR is very useful technique for the detection of viruses containing RNA 
as the genetic material. Also, the amplified product can be used as a probe for 
the identification of virus species. 

126 S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

2. An amplified fragment through RT-PCR can be used for ligation into a suit- 
able vector and transformed to a host where multiple copies can be gener- 

3. By comparing the known quantity of RNA, we can measure the unknown 
quantity in our experimental sample. 

4. Total RNA is converted to cDNA, which can be cloned into a suitable vector 
and transformed to a suitable host. 

5. cDNA prepared through RT-PCR can be cloned into a suitable sequencing 
vector and used for sequencing. 

6. To compare the differential expression of genes in an organism under two 
set of conditions, we isolate total mRNA and carry out the cDNA synthesis 
through RT-PCR. 

DNA Microarray 

Until the discovery of microarray technique, molecular biologists were working 
on the characterization of individual genes and monitoring its function. How- 
ever, expression of the whole genome of an organism became possible with the 
advent of microchip technology. This technology could not be developed earlier 
as it needed the description of the complete genome sequence of an organism 
or the availability of large EST databases. After the completion of the genome 
sequences of various organisms and their data availability, the development of 
microarray technology became possible. This technology has made the simul- 
taneous analysis of multiple genes very easy. The basic principle of this technol- 
ogy is described here. DNA molecules or oligonucleotides corresponding to the 
genes whose expressions have to be analyzed are used for making the probe. 
In this technique, oligonucleotides or cDNA molecules are attached in an or- 
dered fashion to a solid support that can be a nylon membrane or a glass slide. 
With the availability of robotic spotters and automated liquid-handling stations, 
the technique has become fully automated and this has also made it possible to 
produce arrays with several thousand genes represented on a few square centi- 
meters on the support. To determine the relative abundance of the correspond- 
ing transcripts in a total RNA preparation, the RNA species are converted into 
cDNA in the presence of fluorescent dyes. Commonly used labels are Cy3 and 
Cy5 available commercially. The labeled target sample is allowed to hybridize 
with spotted probes on the glass slide. Finally the intensity of the hybridization 
signal is a measure of the relative abundance of the corresponding mRNA in 
the sample. Thus comparing the intensities of hybridization signals for different 

7. Transcriptome Analysis 

mRNA samples allows the determination of changes in mRNA levels under the 
conditions tested for all of the genes represented on the arrays (Eisen et al. 1998; 
Lockhart and Winzeler 2000). Fodor (1997) proved that, by using this technol- 
ogy, one can display 409 000 spots in an area of 1.28 cm 2 . Hence, all 20 000- 
25 000 genes of Arabidopsis can be displayed on a single slide. The microarray 
technique is highly sensitive as it can detect mRNAs at level of 1:100 000 or 
1:500 000. Though the technique has its own limitations (such as high cost of 
operation, money-intensive set-up of facility, need for appropriate software and 
technical expertise), it recently became the technique of choice for researchers 
working with almost all organisms. 

The first step is designing the microarray itself. In principle, two different types 
of array techniques are used. In the first, fragments from either genomic clones 
or cDNA are amplified through PCR and spotted onto the appropriate solid 
support. In the second type, small oligonucleotides, designed based on available 
genetic information, are synthesized and spotted. Generally microscopic glass 
slides coated with polylysine are used for spotting the probe sample. The role 
of polylysine is to enhance the DNA/RNA binding to the plate through elec- 
trostatic interactions. For solid support, apart from glass slides, special coated 
plastic films are also used (Bertucci et al. 1999; Eisen and Brown 1999). 

DNA samples are printed with a microarrayer (sometimes also called a spot- 
ter) onto microscope slides. The whole operation of automated spotting is per- 
formed inside a dust- and vibration -free chamber. Sometimes, evaporation of 
the sample may also take place at this stage, which can be avoided by maintain- 
ing good humidity in the chamber during operation. For efficient coupling of 
printed cDNA, slides are left at room temperature for 24 h. Finally, dried slides 
are put in a beaker for washing, followed by air-drying, and storage at room 
temperature until further use. 

The basic principle of microarray technique remains the same, irrespective of 
the source of mRNA. Here, we describe the technique by taking an example of 
a microbial system. Microbes growing under natural environmental conditions 
are used as source 1 and microbes exposed to a kind of stress are used as source 
2 for mRNA isolation. For qualitative and quantitative assay of the differentially 
expressed genes using a microarray, RNAs are extracted from both types of mi- 
crobes. Messengers RNA are then converted into cDNA by reverse transcrip- 
tion. At this stage, cDNA from source 1 is labeled with a green dye (Cy3) and 
cDNA from source 2 is labeled with a red dye (Cy5). These labeled cDNA are 
used for hybridization with the probes spotted onto the solid support. 

During hybridization, green- and red-labeled cDNAs are mixed together and 
put on the matrix of spotted single-strand DNA (probes). For hybridization, 
the chip is incubated overnight at 60 °C under high humidity conditions. At 

S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

this temperature, DNA strands that encounter the complementary strands of 
the probes on the slide, create double-stranded DNA. The newly formed dou- 
ble-stranded DNA has one unlabeled and another labeled strand. After hybrid- 
ization and washing, the microarrays are scanned at two different wavelengths 
corresponding to the absorbance of the red and green dyes and the signals are 
analyzed. A laser beam is passed through the microarray slide that excites each 
spot on the plate and the fluorescent emissions are gathered through a photo- 
multiplicator (PMT) coupled to a confocal microscope. If the hybridization is 
stronger with one of the samples, the spot appears either red or green. If the in- 
tensities of binding of two dyes to target samples are same, then the spot on the 
microarray appears to be yellow. We have now two images from the same slide 
corresponding to the two dyes. For a given spot on the slide, we measure the sig- 
nal intensities in the green dye emission wavelength and the signal intensities in 
the red dye emission wavelength. If the amount of fluorescent DNA fixed onto 
the plate is proportional to the mRNA amount used for hybridization, directly 
calculate the red/green fluorescence ratio. If this ratio is greater than 1 (red on 
the image), the gene expression is greater in the source 2; if this ratio is smaller 
than 1 (green on the image), the gene expression is greater in source 1. We can 
visualize and interpret these differences in expression using commercially avail- 
able software (Fig. 7.6). 

At the end of microarray analysis, we cluster the expression profiles obtained 
through arrays. Genes that share the same expression profile on several experi- 
ments gradually form clusters during phylogenetic analysis. Other techniques 
such as principal component analysis or neuronal networks are also now being 
used for microarray analysis and clustering. The final data is presented as hier- 
archical clustering, where each column represents the microarray data from one 
experiment and each row a specific gene (Chuaqui et al. 2002). 

ft ft i t ft ft 

ft ft ft ft 

ft * ) ftft ftft ft* 

ft ft ftft 

»!«•** lit* 

■ ft 

■ ■' ft • * * fr ■ 

ftft** ft* ft* ** 

■ ■ ■ h m <h ma mm 

ft ft) ■ ■ i ft ft 4 

ftft- ■ ft 1 

ftft ft ft ft ft ■■■ 

9 ■ *■ ■ ■ 

m fa fa> m ■ ■ m MM MM 

* *) ft ft P 1 ft* ft * ft ft 

P R ft ft 

1 ft* 

■ ■ 

* II ft* ft 4 . * 

m P ■• ■ * 

■ t- ■ • ft ft ft ft ft ft 

" ft ft 

ft ft ft ft 

■ ft ■ ft- 

* ft ftft ftft 

ft ft * ■ ■ ft ft ft ft 

ft ft** 

Pill - 

ft ft P R h ■ •« 

ft ft ft ft ft * 

## | ft ft ■ ■ i 

■ ft ftft 

■ r 

■ - ■ 

1 ft I * ft ftft 

• ■ ftft ftft ft* **■■** 1 

* ■ 

• ft 

ftft** I ft ft * * ■ 

ft - 

41 1 • iRRI ll « 

v m •• ■ ■ - ft ft * ■ ft* P i 

ft ■ i 

r ft | 1 ■ 

* . ft ■ • ft ft ft 4 ft 

ft! ■ ft -• ft ft * « 4 4 

■ ftf 

ft ft ft ft ■ 

ft ft ft ft ft ft if 

ft ■ 

ft ft 

ft ■ ft 

ftft* ft 4 ft 4 ft I 

ft | ft | -***•« 

■ ft ft ■ 

ft i ** • • 

■ ft » 

ftft ■ » 

ft ft ftj * -1 ftft* 

■ 1 ft r ft 4 ft • ft * ■ 

■ ft ft ft ■«****** 

ftft * « 

ftft ■ftft* 

ft ft 

R ■ ft ■ ft * • ft ft * 

■ ft 

■ ft ft ft ft 4 

ftft ft ft ftft ft* 

ft * ft ft ft ft »IIMl> III! 

«»ft*ftftftt ft« 

ftft R ft 

*fj i ■ ft* 

ft ft ft ft ft r ft ft V 4 4 i ft ft 

■ ■ ft ft * ft -t p « p « ft » 4 

P R 

■ ft ft ft ft ft 

##*■ ft ft • ■ 

■ ■ ■ ■ 

ft ■ ** 

■ft ftft ftft ftft ft* ■« 

ft ft ft ft * 4 ft ► ft ft 4 ft ft 

ft 4 i ■ ft ft ft * 

* ft R ft 

ftft ftift -ftft 

■■ ft 

P P 

ft ft ftft ft ■ * ft ■■ 

■ Plf « ft 

i P R R 

ft ■ 

■ ft • > ft ■ ■ ■ i- ft ■ 

ii ■ ■ 

■ ■ 

■ ■ ft* ftft ■ ' 

** m m ft V ** 

ft ft ■ P ft* ft « P ft ft 

+ ft R ft 

■ ft 

ft ft- ft * ft ■ 

ft ft ft ft * 1 * * ft- 

ftPPR ft* tft ftft 

■ ft 

• ft ftft 

ftft P ft ft* ft* ft ■ 

ft ■ ft ft ft ft » ftft 

■ ■ 

■ - PR 

Wftft ft ■ ft ■ * - 

4ft ft ft ft ft > 

ftft i i« 

ft ft 

ft ft 

■ ftftftf 

P 1 ft 

■ ft 

ft R 

ft • i ft ftft 

P P R ft ft ft ft ■ ■ R ft 

ft ft 

ft P 

ft ft ft R l ft ftJ ft • ft ft, ft 

■ ft ft » ■ ' 

R ft ft ft 

ftft" ft « - 

• ft ■ ft 

ft ft ft ft ft * ftft--* 

Fig. 7.6 A representative 
image of a cDNA microar- 
ray from barley. RNA from 
unstressed seedlings has 
been labeled with Cy3, 
while Cy5 has been used 
for labeling RNA extracted 
from seedlings which were 
osmotically stressed for 4 h 
(A. Pareek and H Bohnert, 
unpublished data) 

7. Transcriptome Analysis 

1. A snapshot of the whole transcriptome of a system at a given time-point can 
be obtained since multiple genes can be analyzed simultaneously. 

2. The whole genome can be used for expression analysis. 

3. Gene expression studies can be performed for a subset of genes which are 
believed to be a part of the metabolic pathway. 

4. Differential expression in the levels of gene(s) in the same organism under 
two different set of conditions or among two different organisms can be con- 

5. Based on the coordinated expression profiles of a subset of genes, an inference 
can be obtained about their possible involvement in a metabolic pathway. 

Transcriptome analysis is a very powerful tool in contemporary science. The 
above-mentioned techniques alone, or in combination with each other, can pro- 
vide useful information for functional analysis of a gene or a group of genes. 
Additionally, high-throughput analysis of differential gene expression has 
proved to be a powerful tool for discovering novel genes through microarray 
analysis (Taniguchi et al. 2001). Changes in mRNA steady-state levels are mostly 
accomplished by changing the transcriptional rate of genes. Such fluctuations 
in relative mRNA amounts are indicative of changes in environment and de- 
velopmental program or reflect responses to all kinds of stimuli. To properly 
understand a genes function it is not only critical to know when, where, and to 
what extent a gene is expressed, it is also essential to discover other genes which 
are co-regulated with the gene of interest. Monitoring the transcriptome, i.e. the 
complement of all transcribed mRNAs of an organism, by measuring mRNA 
concentrations of defined genes in a multiparallel and quantitative way allows 
us to assign function to a multitude of unknown genes. Generally speaking, 
changes in mRNA abundance are related to changes in protein levels. Therefore, 
the information gathered from transcriptome analysis can easily be extrapolated 
to proteome analysis to gain additional information about certain biological 
processes at the physiological level. There are many examples in the literature 
where transcriptome analysis techniques have been applied and used in further- 
ing our understanding of the complex aspects of molecular mechanisms of liv- 
ing organisms. In the present era of biotechnology, transcriptome analysis is at 
its peak to provide the solutions to all expected questions of bioscience. 

130 S.K. Yadav, S.L. Singla-Pareek, and A. Pareek 

The authors would like to gratefully acknowledge the funding received from the 
Department of Science and Technology, Department of Biotechnology, Govern- 
ment of India, The International Foundation for Science, Sweden, and The In- 
ternational Atomic Energy Agency, Austria. 

Almeida Engler de J, Montagu Van M, Engler G (1994) Hybridization in situ of whole -mount 
messenger RNA in plants. Plant Mol Biol Rep 12:321-331 

Arabidopsis Genome Initiative (2000) Analysis of the genome sequence of the flowering plant 
Arabidopsis thaliana. Nature 408:796-815 

Bertucci F, Beranrd K, Loriod B, Chang YC, Granjeaud S, Birnbaum D, Ntuyen C, Peck K, 
Jordan B (1999) Sensitivity issues in DNA array-based expression measurements and 
performance of nylon microarrays for small samples. Hum Mol Genet 8:1715-1722 

Butler D, Pockley P (2000) Monsanto makes rice genome public. Nature 404:534 

Chelly J, Kahn A (1994) RT-PCR and mRNA quantitation. In: Mullis DB, Ferre F, Gibbs RA 
(eds) The polymerase chain reaction. Birkhauser, Boston, pp 97-109 

Childs GV (1999) In situ hybridization with non- radioactive probes. In: Methods in molecu- 
lar biology. Humana, Totowa, pp 131-141 

Chuaqui RF, Bonner RF, Best CJ, Gillespie JW, Flaig MJ, Hewitt SM, Phillips JL, Krizman 
DB, Tangrea MA, Ahram M, Linehan WM, Knezevic V, Emmert-Buck MR (2002) Post- 
analysis follow-up and validation of microarray experiments. Nat Genet 32:509-514 

Davenport RJ (2001) Rice genome. Syngenta finishes, consortium goes on. Science 291:807 

Eisen MB, Brown PO (1999) DNA arrays for analysis of gene expression. Methods Enzymol 

Eisen MB, Spellman PT, Brown PO, Botstein D (1998) Cluster analysis and display of ge- 
nome-wide expression patterns. Proc Natl Acad Sci USA 95 : 14863- 14868 

Fodor S (1997) Massively parallel genomics. Science 277:393 

Jason W, O'Neill J W, Bier E (1994) Double-label in situ hybridization using biotin and di- 
goxigenin-tagged RNA probes. BioTechniques 17:870-875 

Lockhart DJ, Winzeler EA (2000) Genomics, gene expression and DNA arrays. Nature 405 

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular cloning: a laboratory manual. Cold 
Spring Harbor Laboratory, Plainview 

Schneeberger C, Speiser P, Kury F, Zeillinger R (1995) Quantitative detection of reverse tran- 
scriptase-PCR products by means of a novel and sensitive DNA stain. PCR Methods 
Appl 4:234-238 

Sperisen P, Wang SM, Reichenbach, P, Nabholz M (1992) A PCR-based assay for reporter 
gene expression. PCR Methods Appl 1:164-170 

Taniguchi M, Miura K, Iwao H, Yamanaka S (2001) Quantitative assessment of DNA micro- 
arrays - comparison with Northern blot analyses. Genomics 71:34-39 

Tautz D, Pfeifle C (1989) A nonradioactive in situ hybridization method for the localization 
of specific RNAs in Drosophila embryos reveals translational control of the segmenta- 
tion gene hunchback. Chromosoma 98:81-85 

7. Transcriptome Analysis 

Trayhurn P, Duncan JS, Nestor A, Thomas ME A, Rayner DV (1994) Chemiluminescent 
detection of mRNAs on Northern blots with digoxigenin end-labeled oligonucleoides. 
Anal Biochem 222:224-230 
Wilkinson DG (1994) In situ hybridization. A practical approach. IRL Press, Oxford 
Yadetie F, Sandvik AK, Bergum H, Norsett K, Laegreid A (2004) Miniaturized fluorescent 
RNA dot blot method for rapid quantitation of gene expression. BMC Biotechnol 4:12 

RNAi Technology: a Tool for Functional 
Validation of Novel Genes 

R. Karan, S. Kumari, S.K. Yadav, and A. Pareek 

Until the past decade, mRNA was considered as a passive molecule serving only 
as a blueprint for the vast amount of information trapped in the highly signifi- 
cant biomolecule - DNA. But the more ebullient nature of RNA has come into 
the picture with recent discoveries about the possible role RNA can play in regu- 
lating gene expression. An emerging field of study involves the role of RNA in 
gene silencing. RNA mediates gene silencing either at the transcriptional level 
or post-transcriptional level. Recently there has been a spurt of activity to study 
the intricacies of this phenomenon. 

The first significant finding that paved the way for these studies came from a 
serendipitous discovery while attempting to enhance flower color in Petunia. In 
the year 1990, Napoli et al. were trying to engineer Petunia plants for increased 
anthocyanin production by the overexpression of chalcone synthase (chsA). 
Unexpectedly, instead of getting plants with higher anthocyanin content, varie- 
gated flowers with white patches were obtained (Napoli et al. 1990). It was later 
confirmed that the introduction of the chsA transgene led to the inhibition of 
endogenous gene expression. This phenomenon was termed "co -suppression" 
and several workers reported such instances independently. Further studies 
suggested that this phenomenon did not involve reduced transcription, rather 
degradation of the transcripts through a partial duplex mRNA was responsible 
for triggering this precise "gene silencing". Since this mechanism was involv- 
ing post-transcriptional mRNA degradation, it was termed post-transcriptional 

Ratna Karan, Sumita Kumari, Ashwani Pareek: School of Life Sciences, 
Jawaharlal Nehru University, New Delhi, India, 
email: Ashwani Pareek: 

Sudesh Kumar Yadav: Biotechnology Division, 

Institute of Himalayan Bioresource Technology, Palampur- 176061 (HP), India 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

134 R. Karan, S. Kumari, S.K. Yadav, and A. Pareek 

gene silencing in plants (in short, referred to as PTGS, Matzke and Matzke 
1995). PTGS seems to serve a natural function of protecting the genome against 
mobile elements like viruses and transposons, orchestrating the functioning of 
the developmental programs of an organism. Entry of virus in a plant genome 
"pre-exposed" to a similar virus triggers the synthesis of dsRNA, which ulti- 
mately degrades the viral genome. Besides plants, homology-dependent gene 
silencing was found to occur commonly in fungal systems as well and these 
events were referred to as "quelling" (Cogoni et al. 1996). 

In recent years, there has been an upsurge of information regarding the ma- 
chinery involved in the RNAi mechanism and its potential role in functional 
genomics. In the present chapter, we provide details to understand how gene 
silencing works and how it can be employed as a tool of functional genomics to 
unravel the function of unknown genes. So far, three phenotypically different 
but mechanistically similar forms of RNAi have been reported which include 
"PTGS" or "co-suppression" in plants, "quelling" in fungi, and "RNAi" in the 
animal kingdom. For our purpose, we take the liberty of using all three terms 
interchangeably in the following text. 

Machinery Involved in RNAi 

Investigations forayed to decipher the outcome of RNAi have revealed its in- 
volvement in gene regulation. Both genetic and biochemical approaches have 
led to a greater understanding of the basis of silencing. The critical components 
involved in the processing of RNAi include inducer, Dicer, RNA- induced silenc- 
ing complex (RISC), and RNA-dependent RNA polymerase (RdRp). All these 
components (details described in the following text) in coordination with other 
effector molecules work together in an organized fashion, resulting in silencing 
of the target gene (Fig. 8.1). 

": K 

^ ^ y Fig. 8.1 Cartoon depicting 

^ ^"^^^^^^^^""" the generalized RNAi- 

Promoter Sense orientation Iiitroti Atmscijseorioitatioii 

■ mediated gene silencing 

X Transcription 

r i ■ r ■ 1 1 1 f i mr^> ^ipm ^rna 

y m 1 1 1 1 J] y i r ii i i |; siRNA 

y si RNA as&oriaicd RISC 

y | | t | | t _ L ^^n^g^n-i_L i^iiiiiiiiii y Target 111RNA 
i i i i i i ■ i 5' y i i i i i i i i i i i i i y Cleaved mRNA 

8. RNAi Technology: a Tool for Functional Validation of Novel Geness 135 

A dsRNA produced either by a transgene introduced into an organism or by 
direct injection of dsRNA (as in the case of animal systems) homologous to tar- 
get mRNA actually induces the onset of whole process. Such a RNA molecule is 
called an inducer (Palauqui and Balzergue 1999). 

Dicer is a double-stranded RNA-specific enzyme that belongs to the RNase III 
family of endonucleases. RNase III specifically cleaves double-stranded RNA 
(Robertson et al. 1967). RNase Ill-type enzymes - DROSHA (present in the 
nucleus), DICER (present in cytoplasm) in animals, and dicer-like (DCL) in 
plants - catalyze the processing of miRNA and siRNA precursors. Due to the 
ability to "dice" dsRNA molecule into equal pieces, it was termed "Dicer". Earlier, 
RNase III was regarded as unique to bacteria but biochemical studies on yeast 
RNA processing reactions and genome sequencing projects led to the identifica- 
tion of RNase III orthologs in fungi, plants, and animals, which established a 
RNase III superfamily (Rotondo and Frendewey 2001). 

RNA-Dependent RNA Polymerase 

RNA dependent RNA polymerase (RdRp) was first discovered in RNA viruses 
(Blumenthal and Carmichael 1979), which are responsible for transcription and 
replication of the viral genome. RdRp activity has also been detected in plants 
like Chinese cabbage (Astier-Manifacier and Cornuet 1971), tobacco (Duda et 
al. 1973), tomato (Boege and Sanger 1980), cucumber (Khan et al. 1986). RdRp 
amplifies the siRNA produced by the action of Dicer. This siRNA then systemi- 
cally moves from one cell to another cell, so it has systemic inheritance from one 
part of a plant to another part of the same plant. 

RNA-lnduced Silencing Complex 

Small RNAs associate with factors such as ARGONAUTE (AGO) proteins in 
effector complexes to guide target RNA cleavage, translational repression, or 
chromatin modification. This RNA-induced silencing complex (RISC) recog- 

136 R. Karan, S. Kumari, S.K. Yadav, and A. Pareek 

nizes siRNA produced by the Dicer. It has both unwinding and endonucle- 
ase activity. The siRNA duplex containing ribonucleoprotein (RNPs) particles 
is subsequently rearranged into the RISC (Hammond et al. 2000). It mostly 
remains associated with the antisense strand of RNA (Nykanen et al. 2001). 
Finally, the RISC complex associated with the single-stranded antisense RNA 
identifies and pairs with its complementary homologous target mRNA which 
is to be degraded. Endonucleolytic cleavage of the target mRNA occurs at the 
center of the siRNA-mRNA hybrid (Elbashir et al. 2001). 

miRNA and siRNA 

According to their origin or function, broadly two types of naturally occurring 
small RNA have been described: short interfering RNAs (siRNAs), and mi- 
cro RNAs (miRNAs). RNA-templated RNA polymerization, e.g. from viruses 
or hybridization of overlapping transcripts from repetitive sequences such as 
transgene arrays or transposons, gives rise to siRNAs which guide mRNA deg- 
radation or chromatin modification. In addition, endogenous transcripts that 
contain complementary or near-complementary 20- to 50-base pair inverted re- 
peats fold back on them to form dsRNA hairpins. These dsRNAs are processed 
into miRNAs that mediate translational repression or mRNA degradation. This 
class of small RNAs, sharing mechanistic similarity to siRNA, but with charac- 
teristic differences, is called microRNA (miRNA) and was known long before 
the term siRNA was coined. 

RNAi as a Tool of Functional Genomics 

Much before the discovery of PTGS, antisense RNA technology was being used 
to achieve gene silencing. However, loss of function was never achieved; the 
expression of the targeted gene could be reduced to almost 70% of the origi- 
nal levels. With the available platform of discoveries made so far, a group of 
workers from the Carnegie Institution of Washington made an attempt to use 
double-stranded RNA to achieve gene silencing (Fire et al. 1998). Interestingly, 
the dsRNA was found to be substantially more effective at producing interfer- 
ence than either sense or antisense strands individually. This was the first ever 
endeavor to obtain gene silencing through artificially induced dsRNA and this 
phenomena was termed "RNA interference" (RNAi). 

In the post-genome-sequencing era, the ever-burgeoning repository of ge- 
nome sequences has now focused the impetus to validate the functions of all of 
these predicted genes. "Loss-of- function" mutants have been the most preferred 

8. RNAi Technology: a Tool for Functional Validation of Novel Geness 137 

tools to study functional aspects of genes but the conventional methods to ob- 
tain such mutants, viz. homologous recombination and random mutagenesis, 
are tedious and have met little success so far. Currently, PTGS is the most fa- 
vored technique available for large-scale functional assays of genes (Baulcombe 
1999; Vauchret et al. 2001; Waterhouse et al. 2001). 

RNAi can be defined in simple terms as "homology-dependent sequence- 
specific degradation of mRNA that leads to gene silencing". Unlike antisense 
RNA technology, it has been found to be more potent and efficacious in com- 
plete knockdown of a particular gene against which a double-stranded RNA is 
produced. A double-stranded RNA is introduced or induced in an organism. 

Production of dsRNA 

Besides the naturally occurring dsRNAs, a dsRNA targeted against a specific 
gene can also be induced artificially which is recognized by the enzymatic ma- 
chinery present inside the cell and finally leads to the breakdown of the mRNA 
complementary to the antisense strand of siRNA associated with RISC complex. 
dsRNA can be synthesized in vitro and then introduced into the cell; vector- 
based dsRNA production can also be achieved in the plant cell in vivo. ihRNA 
(hairpin RNA) is the common choice in the plants for PTGS. Based on its high- 
est potency, dsRNAs can be produced in cells by one of the possible mechanisms 
as described below: 

Two Independent Complementary Transcripts 

In this method, the selected fragment of gene is cloned in sense orientation and 
antisense orientation as independent expression cassettes in separate vectors. 
Both cassettes are transfected in cells simultaneously where cloned fragments 
in the two cassettes are expressed separately and lead to the production of long 
dsRNA, which initiates the RNAi pathway inside the transfected cell (Fig. 8.2). 
This strategy is mainly used in animal cells that lack the interferon response, 
such as embryonic cells and somatic cells. 

Single Transcript with Inverted Repeat 

In this case, the selected DNA fragment of gene is cloned in sense and antisense 
orientation in a single construct flanking an intron that expresses and produces 

R. Karan, S. Kumari, S.K. Yadav, and A. Pareek 

Fig. 8.2 Production of dsRNA from two 
independent complementary transcripts. 
Large arrows depict the direction of func- 
tional mRNA synthesis 

hairpin dsRNA (Fig. 8.3) that are efficiently processed by Dicer. This strategy is 
employed in both plant and animal cells. 

Constitutive and Inducible RNAi 

Constitutive expression of dsRNA may cause deleterious effects on the develop- 
mental stages of organism if the product of that particular gene is required for 
metabolism during development. Generally, CaMV35S promoter-driven dsRNA 
production is utilized for unraveling the functions of genes and also to check the 
efficiency of newly designed RNAi vectors. Constitutive gene silencing cannot 
be used with genes involved in fundamental processes such as embryo viability. 
To overcome the deleterious effects of constitutive dsRNA production, there is a 
need to develop the construct, which could only produce dsRNA during specific 
developmental stages, in a tissue-specific manner. Now, inducible expression of 
RNAi cassettes are available in which the inhibition of expression of the desired 
gene can be achieved at the desired period during growth and development. The 
induction of RNAi cassettes is being done by applying ethanol (Caddick et al. 
1998), estradiol (Guo et al. 2003), and dexamethasone (Wielopolska et al. 2005). 
Several vector systems have been developed so far which have enabled both 
constitutive as well as inducible gene silencing in plant systems (Table 8.1). 

An inducible RNAi system should work when there is a need to silence the 
gene so that unwanted gene silencing could be avoided. The inducible RNAi 

ds hairpin RNA 

Fig. 8.3 Production of dsRNA from single 
transcripts with inverted repeat. Large 
arrows depict the direction of functional 
mRNA synthesis 

8. RNAi Technology: a Tool for Functional Validation of Novel Geness 139 

Table 8.1 Different types of RNAi vectors 

RNAi Vector 

(gateway vector) 

p AND A (gateway vector) 

Constitutive (CaMV35S) 

Constitutive (ubiquitin) 

Estradiol (irrevers- 
ibly inducible) 

Dexamethasone (re- 
versibly inducible) 

CSIRO, Australia 

Miki and Shimamoto (2004) 
Guo et al. (2003) 

Wielopolska et al. (2005) 

system should be reversible in nature to "switch on" and "switch off" the dsRNA 
production whenever the silencing of a gene is desired. Inducible promoters 
provide an alternative approach for temporal and spatial gene expression con- 
trol (Table 8.2). 

Thereafter, RNA interference can be employed successfully for gene func- 
tional analysis by reverse genetic approaches. 

Table 8.2 Constitutive/inducible promoters used for regulating RNAi/ antis ens e gene constructs 

sense gene 

Arabidopsis beta- amy- 

Kaplan and 

lase (BMY8) gene 

Guy (2005) 

A. thaliana chro- 

Mamani et 

protein 11 (CHR11), 

al. (2005) 

CaMV35S promoter 

MeloidoQvne incognita 

Bakhetia et 

dual oxidases (per- 
oxidase and NADPH 
oxidase) gene 

A. thaliana phytoene 
desaturase gene, driven 
by heat-shock gene 
promoter (HSP18.2) 

Heat inducible Arabidopsis 

al. (2005) 

Masclaux et 
al. (2004) 

R. Karan, S. Kumari, S.K. Yadav, and A. Pareek 

Table 8.2 (continued) Constitutive/inducible promoters used for regulating RNAi/antisense gene 

sense gene 

Torenia hybrida, chal- 

Torenia hybrida 

Fukusaki et 

cone synthase (CHS) 

al. (2004) 

Arabidopsis puta- 

Laval et al. 

tive vacuolar sorting 

receptor (atbp80) 

Rice, metallothionein 

Wong et 

gene (OsMT2b) 

al. (2004) 

Antisense RNAand RNAi 

Antisense RNA is a type of RNA molecule, which is complementary to a specific 
mRNA. Antisense RNA can be produced by cloning the gene of interest in anti- 
sense orientation relative to the promoter. It is relatively easy and inexpensive to 
produce antisense RNA rather than dsRNA. However, antisense RNA has vari- 
able efficacy and specificity in comparison with RNAi because antisense RNA 
hybridizes with its corresponding mRNA and inhibits protein synthesis tran- 
siently whereas in the case of RNAi the corresponding mRNA is cleaved which 
leads to relatively more intense gene silencing effects rather than by antisense 

Potential Areas of Application 

As the repository of information about thousands of genes has increased over 
the years, unraveling processes unknown, the quest for knowing more of it has 
certainly increased. In this post-genomic era, a plethora of sequence informa- 
tion provides a platform to expedite the process of ascribing functions to genes. 
Functional genomics has come to rescue to satiate this quest. Until now homolo- 
gous recombination was used for underexpression studies, which unfortunately 
claimed valuable time and money. Chemical mutagenesis and T-DNA inser- 
tions have also been the method of choice for study of loss of function in plant 
systems. However, associated shortcomings limit their successful applications. 

8. RNAi Technology: a Tool for Functional Validation of Novel Geness 141 

These methods require a large population to screen the mutants and often more 
than one generation to select a suitable mutant. A mutation may not even show 
up for the gene of interest and the function of gene under study may remain 
unknown. There may also be a combination of mutations, thus making it diffi- 
cult to decipher the effect of knockdown. Thereafter, antisense technology came 
up as a new promising area but overtime experiments carried out to achieve 
silencing have posed questions on its efficiency. Complete knockdown is often 
difficult to obtain through antisense technology, limiting the success to 60-70% 
only. At this point in time, discovery of RNAi emerged as a savior to achieve ef- 
ficient gene silencing, paving the way for delineating the functions of unknown 
genes. Ongoing experiments to dig out more of this mechanism have postulated 
several biological roles for this process, the most evident being the ability to 
elicit a defense response in plant systems against viruses (Voinnet 2001). This 
homology-dependent sequence-specific phenomenon lowers the titer of invad- 
ing viruses through an endogenous RNase-inducible mechanism leading to vi- 
ral RNA degradation. (Goldbach et al. 2003). Interestingly, this natural biologi- 
cal phenomenon can be tamed effectively to generate a transient loss of function 
assays to assess gene function as a rapid alternative to stable transformation. 
By introducing host cDNA fragments within the viral genome, it is possible to 
redirect this mechanism to corresponding endogenous host mRNAs, thereby 
allowing down -regulation of host gene expression (Hein et al. 2005; Scofield et 
al. 2005). Studies in virus-induced PTGS have also revealed the involvement of 
viral suppression that interferes with PTGS. This provided a basis to look for 
such suppressors in other organisms. Studies in Caenorhabditis elegans indicate 
an increased activity of transposable elements in RNAi-defective mutants. RNAi 
may have a role in maintaining the genome stability, although not much has 
been worked out in this respect (Hannon 2002). dsRNA has also been observed 
to induce DNA methylation and chromatin remodeling (Wassenegger 2000). 
This provides further evidence for its active role in genome organization. Induc- 
tion of dsRNAs to incite RNAi was used successfully in plants. However, appli- 
cations in mammals did not yield favorable results as long as dsRNAs (>30 nt) 
induced a sequence non-specific interferon response, which in turn resulted in 
global inhibition of mRNA translation (Elbashir et al. 2001). To overcome hin- 
drance, transfection of siRNA into mammalian cell lines was attempted and it 
was found to be efficient in silencing the endogenous genes (Dykxhoorn et al. 
2003). Using siRNAs, a number of disease-related genes have been targeted ef- 
ficiently, thus unveiling the therapeutic potential of this technique. A mutated 
allele for spinobulbular muscular atrophy (SBMA) was targeted through siRNA 
in human kidney 293T cells which resulted in decreased levels of mutated tran- 
script along with reduced polyglutamine toxicity (Caplen et al. 2002). This 
opened a new area to be exposed for the treatment of diseases caused by mu- 
tated alleles. The successful specific inhibition of K-RAS VI 2 expression, an on- 
cogene in human tumor cells, resulted in loss of anchorage-dependent growth 
and tumorogenicity through virus-mediated siRNA delivery. This unraveled the 
possibilities of tumor- specific gene therapy (Brummelkamp et al. 2002). The 

142 R. Karan, S. Kumari, S.K. Yadav, and A. Pareek 

siRNA construct directed against HIV-1 rev mRNA (Lee et al. 2002) and HIV-1 
co -receptor CCR5 (Qin et al. 2002) was found to be effective in reducing HIV- 
infected cells. These findings indicate that siRNA could be useful in antiviral 
strategies. siRNA can also be applied to whole animals by hydrodynamic deliv- 
ery, resulting in gene silencing in various tissues (Lewis et al. 2002; McCaffrey 
et al. 2002). These findings offer a mere highlight of the tremendous potential 
that this technique holds in itself for the benefit of mankind and stills need to be 
explored in depth. 

RNAi has come up as a major breakthrough in the field of molecular biology, 
providing altogether a new face to the unexplored nature of the enigmatic mole- 
cule "RNA". Beyond providing a better understanding of the interplay of several 
factors in gene regulation, this technique offers immense potential in the field of 
therapeutics, functional genomics, and molecular breeding. 

Although this technique offers many credentials awaiting to be tapped, any 
decision regarding its application must not be impetuous, particularly when in- 
tended for human therapeutics. We must ascertain its existing limitations. Do 
humans really lack RdRp that can induce transitive silencing to exert potential 
side-effects and can we avoid the saturation of RISC and possibilities of site-di- 
rected mutagenesis? There are several questions that need to be addressed be- 
fore the technique can be actually put to use. 

Authors would like to thank UGC (R.K.) and CSIR (S.K.) for their research fel- 
lowships, and thank the International Foundation for Science, Sweden, the In- 
ternational Atomic Energy Agency, Vienna, and DBT, Government of India, for 
supporting the RNAi-related research in the laboratory. 

Astier-Manifacier S, Cornuet P (1971) RNA-dependent RNA polymerase in Chinese cab- 
bage. Biochim Biophys Acta 232:484-493 

Bakhetia M, Charlton W, Atkinson HJ, McPherson MJ (2005) RNA interference of dual 
oxidase in the plant nematode Meloidogyne incognita. Mol Plant Microbe Interact 

8. RNAi Technology: a Tool for Functional Validation of Novel Geness 143 

Baulcombe DC (1999) Fast forward genetics based on virus-induced gene silencing. Curr 
Opin Plant Biol 2:109-113 

Blumenthal T, Carmichael GG (1979) RNA replication: function and structure of Qbeta-rep- 
licase. Annu Rev Biochem 48:525-548 

Boege F, Sanger HL (1980) RNA dependent RNA polymerase from healthy tomato leaf tissue. 
FEBS Lett 12:91-96 

Brummelkamp TR, Bernards R, Agami R (2002) A system for stable expression of short inter- 
fering RNAs in mammalian cells. Science 296:550-553 

Caddick MX, Greenland AJ, Jepson I, Krause KP, Qu N, Ridell KV, Salter MG, Suhuch W, 
Sonnewald U, Tomsette AB (1998) An ethanol inducible gene switch for plants: manipu- 
lation of carbon metabolism. Nat Biotechnol 16:177-180 

Caplen NJ, Taylor JP, Statham VS, Tanaka F, Fire A, Morgan RA (2002). Rescue of polygluta- 
mine-mediated cytotoxicity by double stranded RNA mediated RNA interference. Hum 
Mol Genet 11:175-184 

Cogoni C, Irelan JT, Schumacher M, Schmidhauser TJ, Selker EU, Macino G (1996) Trans- 
gene silencing of the al- 1 gene in vegetative cells of Neurospora is mediated by a cyto- 
plasmic effector and does not depend on DNA-DNA interactions or DNA methylation. 
EMBO J 15:3153-3163 

Duda CT, Zaitlin M, Siegel A (1973) In vitro synthesis of double stranded RNA by an enzyme 
system isolated from tobacco leaves. Biochim Biophys Acta 319:62-71 

Dykxhoorn DM, Novina CD, Sharp PA (2003) Killing the messenger: short RNAs that silence 
gene expression. Nat Rev Mol Cell Biol 4:457-467 

Elbashir SM, Lendeckel W, Tuschl T (2001) RNA interference is mediated by 21- and 22- 
nucleotide RNAs. Genes Dev 15:188-200 

Fire A, Xu S, Montgomery MK, Kostas SA, Driver SE, Mello CC (1998) Potent and specific 
genetic interference by double- stranded RNA in C. elegans. Nature 391:806-810 

Fukusaki E, Kawasaki K, Kajiyama S, An CI, Suzuki K, Tanaka Y, Kobayashi A (2004) Flower 
color modulations of Torenia hybrida by downregulation of chalcone synthase genes 
with RNA interference. J Biotechnol 111:229-240 

Goldbach R, Bucher E, Prins M (2003) Resistance mechanisms to plant viruses: an overview. 
Virus Res 92:207-212 

Guo HS, Fei JF, Xie Q, Chua NH (2003) A chemical regulated inducible RNAi system in 
plants. Plant J 34:383-392 

Hammond SM, Bernstein E, Beach D, Hannon GJ (2000) An RNA-directed nuclease medi- 
ates post- transcriptional gene silencing in Drosophila cells. Nature 404:293-296 

Hannon GJ (2002) RNA interference. Nature 418:244-251 

Hein I, Barciszewska-Pacak M, Hrubikova K, Williamson S, Dinesen M, Soenderby IE, Sun- 
dar S, Jarmolowski A, Shirasu K, Lacomme C (2005) Virus-induced gene silencing- 
based functional characterization of genes associated with powdery mildew resistance in 
barley. Plant Physiol 138:2155-2164 

Huanca-Mamani W, Garcia-Aguilar M, Leon-Martinez G, Grossniklaus U, Vielle-Cal- 
zada JP (2005) CHR11, a chromatin remodeling factor essential for nuclear prolif- 
eration during female gametogenesis in Arabidopsis ihaliana. Proc Natl Acad Sci USA 

Kaplan F, Guy CL (2005) RNA interference of Arabidopsis beta-amylase8 prevents maltose 
accumulation upon cold shock and increases sensitivity of PSII photochemical efficiency 
to freezing stress. Plant J 44:730-743 

Khan ZA, Hiriyanna KT, Chavez F, Fraenkel-Conrat H (1986) RNA-directed RNA poly- 
merases from healthy and from virus-infected cucumber. Proc Natl Acad Sci USA 

144 R. Karan, S. Kumari, S.K. Yadav, and A. Pareek 

Laval V, Masclaux F, Serin A, Carriere M, Roldan C, Devic M, Pont-Lezica RF, Galaud JP 
(2003) Seed germination is blocked in Arabidopsis putative vacuolar sorting receptor 
(atbp80) antisense transformants. J Exp Bot 54:213-221 

Lee NS, Dohjima T, Bauer G, Li H, Li MJ, Ehsani A, Salvaterra P, Rossi J (2002) Expression 
of small interfering RNAs targeted against HIV 1 rev transcripts in human cells. Nat 
Biotechnol 20:500-505 

Lewis DL, Hagstrom JE, Loomis AG, Wolff JA, Herweijer H (2002) Efficient delivery of siRNA 
for inhibition of gene expression in postnatal mice. Nat Genet 32:107-108 

Masclaux F, Charpenteau M, Takahashi T, Pont-Lezica R, Galaud JP (2004) Gene silencing 
using a heat-inducible RNAi system in Arabidopsis. Biochem Biophys Res Commun 

Matzke MA, Matzke AJM (1995) How and why do plants inactivate homologous transgenes? 
Plant Physiol 107:679-685 

McCaffrey AP, Meuse L, Pham TT, Conklin DS, Hannon GJ, Kay MA (2002) RNA interfer- 
ence in adult mice. Nature 418:38-39 

Miki D, Shimamoto K (2004) Simple RNAi vectors for stable and transient suppression of 
gene function in rice. Plant Cell Physiol 45L:490-495 

Napoli C, Lemieux C, Jorgensen R (1990) Introduction of a chimeric chalcone synthase gene 
into petunia results in reversible co-suppression of homologous genes in trans. Plant 
Cell 2:279-289 

Nykanen A, Haley B, Zamore PD (2001) ATP requirements and small interfering RNA struc- 
ture in the RNA interference pathway. Cell 107:309-321 

Palauqui JC, Balzergue S (1999) Activation of systemic acquired silencing by localised intro- 
duction of DNA. Curr Biol 9:59-66 

Qin XF, An DS, Chen IS, Baltimore D (2002) Inhibiting HIV 1 infection in human T cells by 
antiviral mediated delivery of small interfering RNA against CCR 5. Proc Natl Acad Sci 
USA 100:183-188 

Robertson HD, Webster RE, Zinder ND (1967) A nuclease specific for double stranded RNA. 
Virology 12:718-719 

Rotondo G, Frendewey D (2001) Pac I ribonucleases of Schizosaccharomyces pombe. Methods 
Enzymol 342:168-193 

Scofield SR, Huang L, Brand AS, Gill BS (2005) Development of a virus-induced gene-silenc- 
ing system for hexaploid wheat and its use in functional analysis of the Lr21 -mediated 
leaf rust resistance pathway. Plant Physiol 138:2165-2173 

Vauchret H, Beclin C, Fagard M (2001) Post- transcriptional gene silencing in plants. J Cell 

Sci 114:3083-3091 

Voinnet O (2001) RNA silencing as a plant immune system against viruses. Trends Genet 

Wassenegger M (2000) RNA-directed DNA methylation. Plant Mol Biol 42:203-220 
Waterhouse PM, Graham MW, Wang MB (2001) Virus resistance and gene silencing in plants 

is induced by double stranded RNA. Proc Natl Acad Sci USA 95:13959-13964 
Wielopolska A, Townley H, Moore I, Waterhouse P, Helliwell C (2005) A high-throughput 

inducible RNAi vector for plants. Plant Biotechnol J 3:583-590 
Wong HL, Sakamoto T, Kawasaki T, Umemura K, Shimamoto K (2004) Down- regulation of 

metallothionein, a reactive oxygen scavenger, by the small GTPase OsRacl in rice. Plant 

Physiol 135:1447-1456 

Molecular Matchmaking: 

Techniques for Biomolecular Interactions 

R. Oberoi, P. Kumar, and S.K. Lai 

Protein interactions play pivotal roles in virtually all the cellular processes. They 
are intrinsic to every cellular process, ranging from DNA replication, transcrip- 
tion, splicing, and translation, to secretion, cell cycle control, signal transduction, 
metabolism, formation of cellular macrostructures, and enzymatic complexes. 
Thus the identification of protein-protein interactions remains fascinating and 
very helpful in understanding biological phenomena. 

Tools for the Study of Protein-Protein Interactions 

In recent years, the convergence of biochemistry, cellular, and molecular biology 
has made available a number of powerful techniques for studying such interac- 
tions. Together, these constitute an impressive collection of tools for studying in- 
teractions among proteins. These techniques vary in their sensitivity, efficiency, 
and rapidity, but judicial deployment of a combination of them has proved to be 
effective and reliable. 

Two broad approaches are generally applied to the study of protein-protein 
interactions: experimental and computational. Computational methods (Va- 
lencia and Pazos 2002) are used to infer protein interaction networks and pre- 
dict the function of proteins. When the molecular structure of two proteins is 
known, the molecular prediction (or docking problem) of protein interactions 

Virology Group, International Centre for Genetic Engineering & Biotechnology (ICGEB), 
New Delhi, India, Tel: 91-11-26177357, Fax: 91-11-26162316, email: 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

R. Oberoi, et al. 

can be analyzed. Therefore, as more genomic, structural and protein interac- 
tion data become available, the ability to predict protein interactions in silico is 
strengthened. The experimental approaches include physical/biochemical, ge- 
netic and biophysical methods to select and detect proteins that bind another 
protein. Traditionally, the tools available to analyze protein-protein interactions 
in multicellular organisms have been restricted to biochemical (also referred 
to as physical methods) approaches. However, despite obvious advantages, bio- 
chemical approaches can be time-consuming. Biochemical methods that detect 
proteins that bind to other proteins generally result in the appearance of a band 
on a polyacrylamide gel. Under this category, protein affinity chromatography, 
affinity blotting, co-immunoprecipitation, far- westerns, cross-linking are popu- 
lar techniques to detect proteins that interact with a known protein (Phizicky 
and Fields 1995). Certain spectroscopic techniques, including fluorescence po- 
larization spectroscopy (FPS), surface plasmon resonance, and mass spectros- 
copy, are used for several cases of protein interactions. Biacores surface plasmon 
resonance technology has become widely popular. This is a label-free technology 
for monitoring biomolecular interactions as they occur. It also uses spectroscopy 
to measure changes in molecular size. The instrument monitors changes in re- 
fractive index that occur at a liquid/metal interface when biomolecules interact. 
Several new fluorescent imaging-based biophysical techniques are also available 
for studying protein-protein interactions, such as fluorescence resonance en- 
ergy transfer (FRET), bioluminescence resonance energy transfer (BRET), fluo- 
rescence correlation spectroscopy, and biomolecular fluorescence complemen- 
tation (Boute et al. 2002). Other widely applicable methods are library-based 
methods. A variety of methods have been developed to screen large libraries 
for genes or fragments of genes whose products may interact with a protein 
of interest. As these methods are by their nature highly qualitative, the inter- 
actions identified must be subsequently confirmed by biochemical approaches. 
Library screens are generally performed in bacteria or yeasts, organisms with 
rapid doubling times. Thus, these procedures can be completed rapidly. Protein 
probing and phage display are common library screening techniques. Protein 
probing uses a labeled protein as a probe to screen an expression library in order 
to identify genes encoding interacting proteins. Since all combinations of pro- 
tein-protein interactions are assayed, including those that might never occur 
in vivo, the possibility of identifying artifactual partners exists and is a typical 
disadvantage of most exhaustive screening procedures. A second drawback de- 
rives from the use of a bacterial host, where not all post-translational modifica- 
tions needed for the interaction might occur. Despite obvious advantages, bio- 
chemical approaches can be tedious and time-consuming. Also coming along 
the pike is the application of microarrays and protein chips to protein-protein 
interactions (MacBeath and Schreiber 2000). All in vitro methods suffer from 
one common drawback, i.e., the genes encoding the interacting proteins are not 
readily available. An answer to this problem was the introduction of the yeast 
two-hybrid system by Fields and Song in 1989. 

9. Molecular Matchmaking: Techniques for Biomolecular Interactions 147 

Currently, the yeast two -hybrid system is the most widely used genetic assay 
for the detection of protein-protein interactions (Fields and Sternglanz 1994; 
Fashena et al. 2000; Bartel and Fields, 1995). The yeast two-hybrid system has 
become popular because it requires little individual optimization and because, 
compared with conventional biochemical methods, the identification and char- 
acterization of protein-protein interactions can be completed in a relatively 
short time-span and is inexpensive. Most importantly, novel protein-protein 
interactions can be easily selected from a pool of potential interaction partners 
(e.g., a cDNA expression library; Gyuris et al. 1991; Chevray and Nathans 1992) 
and genetic systems not only yield information on the interaction itself but also 
directly provide the cDNA encoding the novel interaction partner. Furthermore, 
no previous knowledge about the interacting proteins is necessary for a screen 
to be performed. Since its conception, the two-hybrid system has become one 
of the most widely used experimental methods. The basic method is constantly 
being improved and widely used with a range of improvements and modifica- 
tions to overcome drawbacks and limitations. It is no longer applicable to study 
only protein-protein interactions but has been extended to allow screening for 
DNA and RNA interactions, assaying interactions in the cytosol rather than be- 
ing limited to the nucleus, and screening in bacterial or mammalian hosts. 

The Two-Hybrid System 

The classic two-hybrid assay exploits the modular nature of the yeast Saccharo- 
myces cerevisiae transcriptional activator, GAL4, required for the expression of 
genes encoding enzymes for galactose utilization (Johnson 1987). GAL4 con- 
sists of two separable and functionally distinct essential domains: (a) the DNA 
binding domain (DBD; Keegan et al. 1986) which binds to specific DNA se- 
quences [upstream activation sequences (UAS; Giniger et al. 1985)] in GAL4 
responsive promoters, and (b) a transcription activation domain (TAD; Ma and 
Ptashne 1987) required for the transcriptional activation of the GAL4 respon- 
sive genes. Theoretically the two-hybrid principle is very straightforward. To 
study interaction between two proteins X and Y, protein X (the bait) is fused in- 
frame to DBD and protein Y (the prey) is fused to the TAD, where either hybrid 
protein alone fails to activate the transcription. The bait and prey fusions are 
co -expressed in yeast, where the interaction of proteins X and Y reconstitutes 
the proximity of GAL4 domains, reconstituting a functional transcription fac- 
tor, and transcription of downstream reporter occurs. Commonly, auxotrophic 
markers that can be selected for are used in combination with the lacZ gene 
encoding the bacterial /3-galactosidase. The common auxotrophic markers HIS3 
and LEU2 allow the selection of interactions by monitoring growth on selective 
plates lacking histidine or leucine, respectively, whereas lacZ can be easily mea- 
sured using a colorimetric assay. 

R. Oberoi, et al, 

The Split-Ubiquitin System 

This is a genetic technique, based on the split-ubiquitin system (Johnsson and 
Varshavsky 1994a,b; Stagljar et al. 1998), which offers the advantage that it can 
be used to detect interactions between virtually any type of protein in the cell - 
that is, between two integral membrane proteins, between a membrane protein 
and a cytoplasmic protein, or between two cytoplasmic proteins, provided that 
one of them is artificially anchored to the membrane. To date, this system is the 
most widely used of the alternative yeast-based two-hybrid systems. 

The split-ubiquitin system is an alternative assay for the in vivo analysis of 
protein interactions. The system pioneered/proposed by Johnsson and Var- 
shavsky (1994a) was originally developed to detect interactions between soluble 
proteins and later modified to work with membrane proteins. 

Reverse Two-Hybrid System 

In this system, the conventional yeast two -hybrid system has been modified to 
allow genetic selection of events responsible for the dissociation of particular 
interactions, e.g., mutations, drugs, or competing proteins. For the reverse two- 
hybrid system, yeast strains are generated such that the expression of interacting 
hybrid proteins increases the expression of a counter-selectable marker that is 
toxic under particular conditions (negative selection; Vidal et al. 1996a). Under 
these conditions, dissociation of the interaction provides a selective advantage 
(as the counter-selectable marker is no longer expressed), thereby facilitating 
detection: a few growing yeast colonies in which hybrid proteins fail to interact 
can be identified among millions of non-growing colonies expressing interact- 
ing hybrid proteins. This system has a variety of uses. For example, mutations 
that prevent an interaction can be selected from large libraries of randomly gen- 
erated alleles (Vidal et al. 1996b). Similarly, molecules that dissociate or prevent 
an interaction can be selected from large libraries of peptides or compounds. 

Sos Recruitment System (Cyto Trap Yeast Two-Hybrid System) 

This system was developed by Aronheim et al. (1994, 1997). It is another modi- 
fication of the yeast two-hybrid system to bypass the reconstitution of transcrip- 
tion factor and takes advantage of a cell proliferation signaling pathway. In this 

9. Molecular Matchmaking: Techniques for Biomolecular Interactions 149 

system, the protein-protein interactions are artificially tethered to yeast cell 
membranes. Interaction is detected by activation of the Ras signal transduction 
cascade by localizing a signal pathway component, human Sos (h-Sos), to its site 
of activation in the yeast plasma membrane. 

Yeast One-Hybrid System 

The one-hybrid system is an extension, by simplification, of the two-hybrid con- 
cept. The yeast one-hybrid or single hybrid system is a genetic system to identify 
DNA binding proteins. It provides a genetic screen to identify cDNAs encod- 
ing polypeptides that bind short sequences (motifs) of DNA, usually ds-acting 
regulatory elements of expressed genes (Li and Herskowitz 1993; Inouye et al. 
1994). In this method also, the bipartite structure of the yeast transcription fac- 
tor GAL4 is exploited. Each cDNA in the library being explored is expressed as a 
fusion protein with the activation domain of the GAL4 protein. This fusion pro- 
tein interacts directly with a DNA binding site/target element and transactivates 
reporter genes (HIS3, lacZ). The usual upstream activating sequences (within 
the promoters of these reporter genes) in the yeast two-hybrid systems are re- 
placed by the target DNA motif. This motif is introduced in multiple copies to 
provide increased sensitivity to the screen. 

Double Interaction Screen 

Yu et al. (1999) developed the double interaction screen (DIS) to identify part- 
ners of DNA binding transcription factors. DIS is a modification that combines 
yeast two -hybrid and one-hybrid screens, used to identify partners of DNA 
binding transcription factors. As in the one-hybrid screen, a ds-acting regula- 
tory element is cloned upstream of reporter genes lacZ and HIS3. This DNA 
motif is known to be a direct target of the transcription factor (TF) in question, 
i.e., protein X, and also contains binding sites for other transcription factors 
whose activities are independent of protein X. Thus, two baits are available in 
the screen, the ds- regulatory element itself, [which is used in the first screen to 
"anchor" a native full length TF (protein X) to DNA upstream of reporter gene] 
and X anchored to the regulatory element via native binding sites. Next, screen- 
ing of the cDNA library allows identification of three types of proteins: (a) DNA 
binding proteins that interact directly with the regulatory element, (b) protein 
bait partners that also bind to specific DNA sequences, and (c) protein bait part- 
ners that interact only at the protein level. 

R. Oberoi, et al, 

Yeast Three-Hybrid orTri-Hybrid System 

Different cellular mechanisms often involve interactions between more than two 
proteins. The three-hybrid system is based on the reconstitution of a transcrip- 
tional activator complex either to search for or to study a protein that interacts 
with two others, providing information about ternary complexes. The technique 
detects either direct or mediated interactions between two fusion proteins. As 
in the yeast two-hybrid system, one protein is a fusion with DBD (that is DBD- 
X) and the other with the AD (that is AD-Y) of the GAL4 proteins. Different 
variations that involve third partners as native proteins, in the absence of any 
fused domains, are referred to as "tribrid" systems. The third protein can act 
either as a bridging factor (it interacts with both X and Y, which alone do not 
interact with each other), a stabilizing factor (it promotes/induces/strengthens 
the weakly interacting proteins X and Y), or as a regulating factor (it post-trans- 
lationally modifies X and/or Y in order for them to interact, and in this case 
it may not necessarily be part of the reconstituted transcriptional activator). 
In either case, the third partner allows transcriptional activator formation and 
stimulates reporter gene transcription by the reconstituted transcription factor. 
Hence, the interaction between X and Y is mediated by the third protein. An- 
other utility of the three-hybrid system is that, if X and Y interact and recon- 
stitute the transcription factor, the system can be used to search for inhibitors. 
The three-hybrid system actually encompasses a range of different systems to 
study RNA-protein, small organic ligand-receptor or protein-protein interac- 
tions, which all have in common the basic principle of the two -hybrid systems 
but are mediated by a third partner. These third partners are quite diverse, from 
proteins to small molecules and nucleic acids. 

1. Take 50 \xl of freshly grown appropriate yeast reporter strain. Inoculate into 
a 250-ml baffled flask containing 100 ml of YPD. Place on shaker at 30 °C 
with shaking (150 rpm) overnight. 

2. Check cell density of l-4xl0 7 using a spectrophotometer (OD 600 = 1.00). 

3. Transfer cells into two 50-ml sterile falcon tubes and centrifuge at 3000 rpm 
for 2 min at room temperature. 

4. Resuspend the cell pellet with 10 ml of Lithium acetate (LiAc) solution, cen- 
trifuge at 3000 rpm for 5 min, and discard the supernatant. 

5. Resuspend cells in 500 ul of LiAc solution with gentle shaking and store 
tubes in ice until further use. 

9. Molecular Matchmaking: Techniques for Biomolecular Interactions 151 

6. Take 100 \il of cells in a sterile micro centrifuge tube, add 10 (il of plasmid 
DNA, mix well, and incubate at room temperature for 5 min. 

7. Add 280 \A of PEG 3350 solution and mix by inverting the tube 4-6 times. 

8. Incubate at 30 °C for 45 min. 

9. Add 43 (il of DMSO and mix by inverting the tube 4-6 times. 

10. Heat shock at 42 °C for 5 min, chill on ice for 1-2 min. 

11. Centrifuge at 4000 rpm for 1 min at room temperature and resuspend cells 
in 0.1 ml of sterile H 2 0. 

12. Spread plate transformation mix on selective media plates and incubate at 
30 °C for 3 nights. 

13. Pick the largest colonies and restreak them on the same selection medium 
for master plates. Plates sealed with parafilm may be stored at 4 °C for 
3-4 weeks. 

Reagents, Materials, and Equipment 

Regular molecular biology laboratory equipment, like microcentrifuge, incuba 
tor, water bath, and a laminar hood. 

Reagents and Materials 

YPD or the appropriate SD liquid medium, sterile lxTE/LiAc (prepare imme- 
diately prior to use from lOx stocks), sterile 1.5-ml micro centrifuge tubes for 
the transformation, appropriate SD agar plates (100 -mm plates), appropriate 
plasmid DNA in solution, appropriate yeast reporter strain for making com- 
petent cells, Herring Testes carrier DNA (10 mg/ml; denature the carrier DNA 
by placing it in boiling water for 20 min and immediately cool it on ice), ster- 
ile 40-50% PEG-LiAc solution (make PEG solution in lx 0.1 M LiAc), lOx TE 
buffer (0.1 M Tris-HCl, 10 mM EDTA, pH 7.5, autoclaved), 0.1 M LiAc, 100% 
DMSO, glass spreader to spread cells on plates. 

Composition of Reagents 

1. YPD medium: yeast extract (lg/lOOml), peptone (2g/100ml), dextrose 
(2 g/ 100 ml). 

R. Oberoi, et al. 

2. YPD plates: yeast extract (1 g/100 ml), peptone (2 g/100 ml), dextrose 
(2 g/100 ml), agar (2 g/100 ml). 

3. LiAc solution: 0.1 M LiAc (0.1 g/10 ml), 10 mM Tris-HCl (pH 8.0), 1 mM 
EDTA (50 jil/ 10 ml). 

4. 50% PEG 3350 solution: 50% PEG 3350 in LiAc solution. 

5. lOx dropout (SD) LT": YNB (1.87 g/250 ml), dextrose (5.0 g/250 ml), agar 
5.0 g/250 ml, amino acid mixture* (25 ml/250 ml), H 2 (225 ml), histidine 
(500 |il). 

6. lOx dropout (SD) LTH": YNB (1.87 g/250 ml), dextrose (5.0 g/250 ml), agar 
(5.0 g/250 ml), amino acid mixture* (25 ml/250 ml), H 2 (225 ml). 

7. lOx TE pH 8.0: 10 mM Tris-HCl (6.0578 g), 1 mM EDTA (1.8612 g). 

* Amino acid mixture: L-isoleucine (300 mg/1), L-valine (1500 mg/1), L-ad- 
enine hemisulfate (200 mg/1), L-arginine HC1 (200 mg/1), L-lysine HC1 
(300 mg/1), L-methionine (200 mg/1), L-phenylalanine (500 mg/1), L-threo- 
nine (2000 mg/1), L-tyrosine (300 mg/1), L-uracil (200 mg/1). 

Notes and Points to Watch 

For the highest transformation efficiency, use the competent cells within 1 h 
of their preparation. 

Prepare the media plates in advance and allow them to dry at room tempera- 
ture for 2-3 days. 

To obtain even growth on plates, continue to spread the transformation mix 
over the agar surface until all liquid has been absorbed. 
Calf thymus DNA is not recommended as carrier DNA. 

Aronheim A, Engelberg D, Li N, al-Alawi N, Schlessinger J, Karin M (1994) Membrane tar- 
geting of the nucleotide exchange factor Sos is sufficient for activating the Ras signaling 
pathway. Cell 78:949-961 

Aronheim A, Zandi E, Hennemann H, Elledge SJ, Karin M (1997) Isolation of an AP-1 re- 
pressor by a novel method for detecting protein-protein interactions. Mol Cell Biol 

Bartel PLS, Fields S (1995) Analyzing protein-protein interactions using two-hybrid system. 
Methods Enzymol 254:241-263 

Boute N, Pernet K, Issad T (2002) The use of resonance energy transfer in high throughput 
screening: BRET versus FRET. Trends Pharmacol Sci 23:351-354 

Chevray PM, Nathans D (1992) Protein interaction cloning in yeast: identification of mam- 
malian proteins that react with the leucine zipper of Jun. Proc Natl Acad Sci USA 

9. Molecular Matchmaking: Techniques for Biomolecular Interactions 153 

Fashena SJ, Serebriiskii I, Golemis EA (2000) The continued evolution of two-hybrid screening 
approaches in yeast: how to outwit different preys with different baits. Gene 250:1-14 

Fields S, Song OK (1989) A novel genetic system to detect protein-protein interactions. Na- 
ture 340:245-246 

Fields S, Sternglanz R (1994) The two-hybrid system: an assay for protein-protein interac- 
tions. Trends Genet 10:286-292 

Giniger E, Varnum SM, Ptashne M (1985) Specific DNA binding of GAL4, a positive regula- 
tory protein of yeast. Cell 40:767-774 

Gyuris J, Dencso L, Polyak K, Duda E (1991) Complex interaction of yeast nuclear proteins 
with the enhancer/promoter region of SV40. Curr Genet 20:359-363 

Inouye C, Remondelli P, Karin M, Elledge S (1994) Isolation of cDNA encoding a metal re- 
sponse element binding protein using a novel expression cloning procedure: the one hy- 
brid system. DNA Cell Biol 13:731-742 

Johnson M (1987) A model fungal gene regulatory mechanism: the GAL genes of Saccharo- 
myces cerevisiae. Microbiol Rev 51:458-476 

Johnsson N, Varshavsky A (1994a) Split ubiquitin as a sensor of protein interactions in vivo. 
Proc Natl Acad Sci USA 91:10340-10344 

Johnsson N, Varshavsky A (1994b) Ubiquitin-assisted dissection of protein transport across 
membranes. EMBO J 13:2686-2698 

Keegan L, Gill G, Ptashne M (1986) Separation of the DNA binding from the transcriptional 
activation function of a eukaryotic regulatory protein. Science 231:699-704 

Li JJ, Herskowitz I (1993) Isolation of ORC6, a component of the yeast origin of recognition 
complex by a one-hybrid system. Science 262:1870-1874 

Ma J, Ptashne M (1987) A new class of yeast transcriptional activators. Cell 51:113-119 

MacBeath G, Schreiber SL (2000) Printing proteins as microarrays for high-throughput func- 
tion determination. Science 289:1760-1763 

Phizicky EM, Fields S (1995) Protein-protein interactions: methods for detection and analy- 
sis. Microbiol Rev 59:94-123 

Stagljar I, Korostensky C, Johnsson N, te Heesen S (1998) A genetic system based on split- 
ubiquitin for the analysis of interactions between membrane proteins in vivo. Proc Natl 
Acad Sci USA 95:5187-5192 

Valencia A, Pazos F (2002) Computational methods for prediction of protein interactions. 
Curr Opin Struct Biol 12:368-373 

Vidal M, Brachmann RK, Fattaey A, Harlow E, Boeke JD (1996a) Reverse two-hybrid and 
one-hybrid systems to detect dissociation of protein-protein and protein-DNA interac- 
tions. Proc Natl Acad Sci USA 93:10315-10326 

Vidal M, Braun P, Chen E, Boeke JD, Harlow E (1996b) Genetic characterization of a mam- 
malian protein-protein interaction domain by using a yeast reverse two-hybrid system. 
Proc Natl Acad Sci USA 93:10321-10326 

Yu Y, Yussa M, Song J, Hirsch J, Pick L (1999) A double interaction screen identifies positive 
and negative ftz regulators and Ftz- interacting proteins. Mech Dev 83:95-105 

Environmental Proteomics: Extraction 
and Identification of Protein in Soil 

Z. Solaiman, M. A. Kashem and I. Matsumoto 

Proteomics involves the systematic study of proteins in order to provide a com- 
prehensive view of the structure, function and regulation of biological systems. 
Advances in instrumentation and methodologies have fueled an expansion of the 
scope of biological studies from simple biochemical analysis of single proteins 
to measurements of complex protein mixtures. Proteomics is rapidly becom- 
ing an essential component of biological research such as health, environmental 
and agricultural sciences. Environmental proteomics concerns the study of pro- 
teins and peptides found in water, sediment, soils, etc. Coupled with advances 
in bioinformatics, the proteomics approach to comprehensively describing bio- 
logical systems will undoubtedly have a major impact on our understanding of 
the microbes, soil and protein interactions. It has the potential to improve our 
knowledge further on function, cellular localization, post-translation modifica- 
tion and the source of proteins found in environmental samples. Proteomics 
complements genomics (i.e. nucleic acid-based) approaches to study microbial 
diversity and functions. 

Initially, proteomics focused on the generation of protein maps using two- 
dimensional polyacrylamide gel electrophoresis. The field has since expanded to 
include not only protein expression profiling, but also the analysis of post-trans- 
lational modifications and protein-protein interactions. Protein expression, or 
the quantitative measurement of the global levels of proteins, may still be done 
with two-dimensional gels; however, mass spectrometry has been incorporated 

Zakaria Solaiman: School of Earth and Environmental Sciences, The University of Adelaide, 
SA 5005, Australia; Present address: School of Earth and Geographical Sciences, 
The University of Western Australia, Crawley, WA 6009, Australia, 

Mohammed Abul Kashem and Izuru Matsumoto: Proteomics Laboratory of Pathology, 
School of Medical Science, Blackburn Building (D06), University of Sydney, NSW 2006, 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

Z. Solaiman and A. Kashem 

to increase sensitivity, specificity and to provide results in a high-throughput 
format. A variety of platforms are available to conduct protein expression stud- 
ies and this site provides links to these resources. In order to identification and 
characterization the protein component of a given sample, a number of tech- 
nologies could be utilized. In this chapter we highlight some critical points to 
give an outline of this technique for soil proteomics studies. 

Proteins are released into the soil environment after the death and disruption 
of the cells of organisms, or as extracellular enzymes, which are excreted by a 
number of microorganisms (Skujins 1976). These are also exuded from plant 
roots (Brenner et al. 1998). Although the extracellular protein present in soil is 
quickly become decomposed into small polypeptide fragments by indigenous 
soil microbes, some portion is considered to be resistant to microbial decompo- 
sition by binding with clay mineral and humic substances (Boyd and Mortland 
1990). Soils are known to contain a wide variety of cell-free enzymes (Skujins 
1976) that display considerable stability (Zantua and Bremner 1977). These en- 
zymes have been recognized by indirect enzyme assay of soil solution or soil 
extract, but there is a scarcity of research on the extracellular enzyme/protein 
molecules measured rather than enzyme activity (Murase et al. 2003). In earlier 
research it was shown that mineralizable organic nitrogen can be extracted from 
soils by a neutral phosphate buffer solution (Matsumoto et al. 2000). Recently, 
Ogunseitan (2006) outlined soil proteomics study in detail. 

Sample Preparations 

Soil samples should be fresh or stored at -80 °C for a short period of time on 
extraction. Protein extraction can be performed directly or indirectly from soil 
samples. Direct extraction can be performed by bead beating, sonication, vortex 
or chemical lysis. The indirect method involves isolation of microbial cells be- 
fore protein extraction. 

Protein solubilization and cell lysis are key factors for effective analysis. In 
general, samples should be lysed before submission. Precipitated samples must 
be solubilized in resuspension solution and clarified by centrifugation if neces- 
sary. The solution or supernatant is then analyzed. Contaminants such as poly- 
saccharide, phenolic compounds, nucleic acid, lipids and insoluble material 
should be removed from the sample prior to submission. 

Precautions should be taken to reduce the keratin contamination because 
this is the primary limitation to the sensitivity of protein identification. Pro- 
tein precipitation with trichloroacetic acid may interfere with isoelectric focus- 
ing. Proteins should never be heated in the presence of urea. The reason is that 
cyanates, which accumulate in urea solutions, carbamylate the primary amino 
groups on proteins at elevated temperatures, producing species with altered iso- 
electric point, changed susceptibility to proteases and altered mass. 

10. Environmental Proteomics: Extraction and Identification of Protein in Soil 157 

Protocols for Protein Extraction from Soil 

Very few extraction methods have been developed to extract protein from soil. 

Extraction of Extracellular Protein 

This extraction method is after Murase et al. (2003). 

1. Mix 100 g soil with 300 ml of 67 mM phosphate buffer (pH 6.0), consisting of 
Na 2 HP0 4 .12H 2 (2.38 g/1) and KH 2 P0 4 (8.17 g/1) and mildly shaken at 25 °C 
for 1 h. 

2. Filter soil extract through no. 6 filter paper (Advantec Toyo, Tokyo) and then 
passed through 0.2 (im pore size cellulose acetate membrane filter to remove 
bacterial cells in 50 ml centrifuge tube. 

3. Add TCA to a final concentration of 5%, keep filtrate at 4 °C for at least 12 h. 

4. Centrifuge at 3400 rpm (2100 g) for 30 min to remove the TCA soluble com- 

5. Discard supernatant, wash TCA insoluble fraction with ethanol into a 1.5-ml 
micro tube and centrifuge at 1200 rpm (11 000 g) for 2 min. 

6. Resuspend pellet in ethanol using sonication, centrifuge and discard super- 

7. Resuspend pellet in diethyl ether, centrifuge and discard supernatant. 

8. Dry pellet in a vacuum desicator. 

9. Dissolve pellet in a 20 |il of sample buffer for direct analysis or store at -20 °C. 

Extraction of Whole-Cell Protein 

The method of total protein extraction from soil outlined here comes from Sin- 
gleton et al. (2003); and it was originally based on modifications and develop- 
ments on the method proposed by Ogunseitan (1993). 

1. Take 1 g of soil (50% WHC) in an Eppendorf cetrifuge tube (1.5 ml). 

2. Add 100 ul of protease inhibitor cocktail (Sigma P 2714). 

3. Add 1 ml of extraction buffer. 

4. Mix for 10 s on a vortex mixer. 

5. Do 4 cycles of snap freezing in liquid nitrogen and thawing to 25 °C. 

6. Centrifuge at 20 000 rcf for 15 min at 4 °C. 

7. Take about 600 |il clear supernatant. 

8. Measure protein concentration in extract by Bradford dye protein reagent 

Z. Solaiman and A. Kashem 

9. Perform SDS-PAGE (polyacrylamide gel electrophoresis) analysis after add- 

ing size marker. 

Protein Loading 

The protein concentration in the sample is important for effective loading. Sev- 
eral methods are used for protein assay. The Bradford method is more conve- 
nient but has a few limitations. However, for doing final experiments, it should 
be better to optimize the protein loading through gel running. If you are "fish- 
ing" for proteins or working with low-abundance protein, it is better to load 
more protein. You can rehydrated a maximum of 200 ul of solution per strip, 
therefore, a high concentration of protein in the sample is better. Precipitated 
protein should be re-dissolved in buffer to gain as high a concentration as pos- 

Protein Expression Analyses 

To characterize protein expression differences among species, you can run one 
dimension polyacrylamide gel electrophoresis (PAGE) or high-resolution 2D- 
PAGE of whole-cell protein extract may be necessary. 

Dissolve protein in 10% acrylamide for separation in SDS-PAGE with a size 
marker and then stain with Coomassie brilliant blue R250 (CBB-R) or with sil- 
ver staining, after electrophoresis (Fig. 10.1). 

Two-Dimension SDS-PAGE Analysis 

Two-dimension SDS-PAGE analysis is performed in steps. The procedures stated 
elsewhere (Biorad; Proteome System Ltd.; Kashem et al. 2007) are described in 
detail below: 

10. Environmental Proteomics: Extraction and Identification of Protein in Soil 

L 4-" TO 

Fig. 1 0.1 Electrophoresis of extracellular proteins extracted from greenhouse soil. Proteins marked 
with arrows were subjected to N-terminal amino acid sequencing. The amount of each sample 
applied was equivalent to 75 g of soil, except WT-2 (equivalent to 7.5 g of soil). The control was 
prepared from 67 mM phosphate buffer. Protein markers (MW-SDS-200; Sigma) were loaded at 
about 9 mg in all. WT-1, WT-2, WT-10 and WT-17 are different soils. This figure was reproduced 
from Murase et al. (2003) with permission from the author as well as from Elsevier Science Ltd 

First Dimension 

Isoelectric focusing (IEF) represents the first dimension. Each sample protein 
applied to an IPG strip migrates to its isoelectric point (pi), the point at which 
its net charge is zero. Different pH ranges and sizes of IPG are available in the 

Features and benefits of IPG strips: 

1. Narrow- and wide-range strips with overlap options, in three lengths, allow 
optimal resolution of most protein samples. 

2. Control in manufacturing ensures reproducible performance. 

3. IPG strips reduce preparation time and reduce reagent waste. 

4. Strips are labeled for polarity to ensure proper orientation. 

If you are "fishing" for proteins, then it is best to start with a 3-10 strip. The 
problem with the 3-10 strip is that pretty much all proteins fall in that range, so 
you have a lot of spots overlapping. Once you know the range you are interested 
in, you could use a strip with a higher resolution (lower range), i.e. the gel size 
remains the same (7, 1 1, or 18 cm) but the resolution is much greater, so you can 
focus on just the proteins which fall in a 4-7 range or 5-6 range. In our experi- 
ence, most of the metabolic proteins are found within pH 4-8 and polymer- 

Z. Solaiman and A. Kashem 

containing samples present some difficulty for separation of protein in the IPG 
gel. Strip rehydration is allowed to take place for at least 6 h and air bubbles 
trapped beneath the strip should be removed. Electro focusing is carried out for 
100-10 000 V for 8 h and further run for 9 h at a constant 10 000 V, depending 
on strip length and the presence of salts and detergent in the original sample. 
Protocol for isoelectric focusing: 

1. Rehydrate IPGs in a disposable Dry Strip tray with 200 \A of extract and 2 \A 
of orange tracking dye for 6 h - gel-side down, remove backing tape and any 
air bubbles beneath the gel. 

2. Assemble IEF - damp the wicks, center the IPG strips under a covering fluid 
(paraffin oil). Ensure no air bubbles are trapped under the strips. Make sure 
+pH end is near the anode and that strip gel is in contact with the wicks. 

3. Run ID on ElectrophoretIQ3 - first phase with increasing voltage protocol, 
second phase with maximum voltage (i.e. 100-10 000 Vfor 8 h, then 10 000 V 
constant for further 9 h). 

4. Next morning, drain paraffin oil into waste bottle, blot underside of strips 
and place in Dry Strip tray channels. 

5. Equilibrate the IPGs for 2x 10 min on shaker in equilibration buffer (6 M 
urea, 2% SDS, 50 mM Tris-acetate pH 7, bromophenol blue). 

Second Dimension 

This technique has become a core technology in proteomics applications since 
the introduction of 2D electrophoresis 30 years ago. Currently, 2D electropho- 
resis is one of the preferred analytical techniques used to resolve and separate 
hundreds to thousands of proteins and protein isoforms. The first dimension 
separates proteins based on their inherent isoelectric point (pi). The second di- 
mension is mass-driven, separating the focused proteins on the basis of molecu- 
lar weight through the use of a denaturing polyacrylamide gel electrophoresis 
(Fig. 10.2). 

When preparing protein extracts for isoelectric focusing, it is best to avoid 
solutions with high ionic strength and ionic detergents such as SDS. High salt 
and detergent content interfere with the initial phase of 2D electrophoresis and 
proteins do not separate or focus properly. Also, during sample preparation, the 
removal of nucleic acids and/or cellular debris improves protein separation and 
decrease background interference for visualization. 

Protocol after Kashem et al. (2007) for 2D SDS-PAGE: 

1. Wash 6-15% GelChips with MilliQ water and then with running buffer. 

2. Fill top of gel with running buffer to aid placement of IPG. 

3. Fill bottom tank with running buffer. 

4. Place gels in tank. Equilibrated IPGs are slotted into the recess of 6-15% 
GelChips and pressed firmly against the top of the SDS gel with a thin spatula 
(ensure plastic backing is against long glass plate). 

10. Environmental Proteomics: Extraction and Identification of Protein in Soil 161 

* pHIO 

Fig. 10.2 Two-dimensional (2D) SDS-PAGE obtained from environmental samples. Protein 
bands were separated based on their iso-electric point as well as molecular weight (MW) 

5. Place molecular weight marker equidistant from the end of the +pH strip and 
the end of the gel. 

6. Ensure rubber gasket has not slipped (stop voltage leaking). 

7. Place blanks in any unused slots (normally on side slots). 

8. Fill top tank with buffer up to line. 

9. Run gels according to default setting on ElectrophoretIQ3 - until BPB front 
has migrated to the bottom of the gel. One voltage phase should be used. 

Gel Staining 

Dyes are used to detect proteins following electrophoresis, and the intensity of 
staining provides a measure of protein abundance. Precautions should be taken 
after running the gel, such as using clean dishes and freshly made stain solutions 
for staining the gels to prevent contamination from keratin, dust, saliva or any 
other proteins you are using in your laboratory. In general, we use a Coomassie 

Z. Solaiman and A. Kashem 

blue stain. If you see a faint protein band using this stain, then you can use sil- 
ver staining. Silver stain is more sensitive than Coomassie blue but may render 
proteins impervious to mass spectrometry (MS). However, if you use silver stain, 
the gels have to be totally de-stained before digestion. The de-staining process 
for silver stained gels is a kinetically slow process and may lead to additional 
protein loss during repeated treatment. If staining with silver is chosen, please 
do not use any cross -linking for fixation (such as glutaraldehyde fixation). If you 
are preparing the samples, it is far better to pool your sample together and run 
them on a single lane to get the highest concentration effect and to get it to stain 
by a colloidal blue stain. Also, please note that extreme caution has to be used to 
avoid contamination with keratin, especially for low-level protein samples. 

Coomassie Brilliant Blue Staining Protocol (For Mini Gels) 

1. Fix gel in 100 ml of 46% methanol, 7% acetic acid for 1 h. 

2. Stain gel in 100 ml of 46% methanol, 7% acetic acid, 0.1% Coomassie brilliant 
blue R-250 (filter this before use) for 1 h. 

3. Destain gel in 100 ml of 5% methanol, 7.5% acetic acid for 24 h. Replace if 

4. Store the gel in 1-2% acetic acid in clean sealed sample tubes at 4 °C. 

Silver Staining Protocol 

Silver staining is a procedure used to detect low levels of biological compounds 
such as DNA and proteins in an immobilized medium, e.g. polyacryl amide gel 
(Okaley et al. 1980). Silver stain can be used with both DNA and proteins. It 
is generally used to detect levels of compounds that are present in very small 
quantities. Silver staining is more sensitive (0.1 ng protein per band) than tradi- 
tional Coomassie blue method (50-100 ng protein per band). 

The reducers, potassium ferricyanide (30 mM) and sodium thiosulfate 
(100 mM), should be made fresh. Mix the two reducers in a 1:1 ratio and im- 
mediately add the reducers to cover the gel pieces. 

Once the silver brown color disappears, remove the reducers and wash with 
water until the gel piece is clear [note: incubation after washing with water in 
ammonium bicarbonate (100 mM) will speed this process]. 

Silver-stained gels are usually stored in 1% acetic acid at 4 °C. The residual 
acetic acid should be removed by thoroughly rinsing the gel with water be- 
fore destaining. Make sure that the gel piece is clear before proceeding with 

10. Environmental Proteomics: Extraction and Identification of Protein in Soil 163 

Image Analysis 

After scanning the gel, the images are analyzed by computer-based software 
program. The analysis of sets of 2DE images currently forms a bottleneck in 
the proteomics research pipeline. A single wide-range pH gel can resolve over 
3000 separate spots, many of which correspond to individual protein species. 
The number of identifiable spots from the same sample can be analyzed by the 
software. Many commercial image analysis packages have been developed to 
analyze 2D images. We have used Phoretix TM 2D expression software. These 
programs facilitate the generation of statistical data concerning proteins that 
have been identified as differentially expressed. Image analysis programs are 
employed with the view to ascertaining differential protein expression in the 
visualized proteome for comparative samples. 

Spot Cut 

When you acquire an image of your gel, please take special care not to allow your 
gel to contact any contaminated surfaces during the process. When you cut out 
the bands of interest, be sure to use extremely clean surfaces and new scalpels 
for band excision. Ideally this should be done in a laminar flow hood to mini- 
mize contamination from dust, hair, skin flakes, dirt, etc. Even trace amounts 
of such contaminants usually contain keratins in much larger amounts than the 
proteins present in the gel bands of interest. Therefore, such contaminants can 
cause the failure of attempts to characterize the proteins. Once cut, gel bands 
can be stored frozen in water or 1% acetic acid in clean, sealed sample tubes. 
Blank bands from the same gel are very helpful for measuring the background 
and trypsin peak. 

Protein Digestion 

Proteins of interest are excised either manually, or with a Spot Picker. Proteins 
are denatured, reduced and alkylated before digestion with trypsin overnight. 
In-gel digestion is performed with sequencing-grade, modified trypsin supplied 
frozen by Promega Corp. Trypsin is made up by dissolving in 20 ug of trypsin 
in 200 |il of bicarbonate buffer. This 0.10 |ig/|J solution can be used according 

Z. Solaiman and A. Kashem 

the protein content in the sample in a 1:30 ratio (enzyme:substrate by weight). 
This is an approximate value for the trypsin catalyst. Peptides released from gel 
plugs are then extracted, purified using CI 8 ZipTips from Millipore Corp. and 
spotted onto MALDI targets for mass spectrometry. These operations may be 
performed either manually or with a spotting robot. If there is sufficient amount 
of protein, it can be spotted directly from the dilute solution onto the MALDI 
target with matrix. If there is not enough sample, preconcentrate by drying the 
sample down in a Speedvac to a smaller volume. However, this also increases 
the salt and/or urea concentration and make it difficult to see the ions directly 
by MALDI. You may have urea crystals crashing out at the bottom of the tube. 
You can stop the drying down process when there is still some (-50 (il of liquid) 
left in the centrifuge tube. This sample can be taken (containing the peptides) 
and zip-tipped to get rid of the extra urea. Most of the urea is probably crashed 
out at the bottom of the tube. Care should be taken about the contamination of 

karatin or other proteins. 

Mass Spectrometry Analysis 

There are several methods for submitting proteins to identification, but the most 
powerful to date is mass spectrometry (MS). Proteins are sent into a pair of 
tandem MS devices (MS/MS). The proteins are sorted and groups of proteins 
of similar mass to charge ratio (m/z) are sent to be ionized and characterized to 
determine the identiy of each protein. This process is automated so that thou- 
sands of proteins can be identified for each experiment. Several mass spectrom- 
eters that can be used for proteomics including the Agilent MSD ion trap SL, 
Thermo Finnigan LTQ, Thermo Finnigan Deca, Applied Biosystems Voyager- 
STR-DE MALDI-TOF MS, Micromass MALDI and Micromass Q-TOF. We 
use Qstar XL Excell Hybride MS system (AB applied Biosystem). The several 
thousand tandem mass spectra obtained from a sample also contain the tryp- 
sin as well as gel spectra. The trypsin/gel spectra should be removed from the 
samples and all the samples spectra calibrated, using at least two major spectra 
of trypsin. 

Spectral Analysis 

The application of certain constraints, such as mass accuracy limits of the instru- 
ment, narrowing down taxonomic category (such as microbes, human, plant, 

10. Environmental Proteomics: Extraction and Identification of Protein in Soil 165 

rat, etc.), specifying modifications on residues (oxidation, propionamide, bio- 
tin k, phosphorylation), peptide tolerance (low tolerance is better), spectra area 
(monoisotopic peak >2000), etc., helps make the search more efficient. There 
are many spectra that do not result in a successful identification due to the poor 
quality of the fragmentation pattern achieved. Sometimes a poor fragmentation 
is due to the charge state of the ion (>3+ or 1+), specific sequence of an ion or 
simply poor sensitivity. The spectra obtained from MALDI-TOF are searched 
against the predicted fragment ions from the trypsin digestion of proteins con- 
tained in a database such as NCBI, using mascot (http://www.matrixscience. 

N-Terminal Amino Acid Sequencing 

Alternative techniques can be used according to Murase et al. (2003) after elec- 
trophoresis in ID SDS-PAGE as follows: 

1. For sequencing of N-terminal amino acids, separate proteins by SDS-PAGE 
before elctroblotting onto a polyvinylidene difluoride (PVDF membrane) in 
a blotting apparatus. 

2. After electrophoresis, place the gel between a sheet of PVDF membrane and 
several sheets of filter paper (CB-09A type; Atto), all of which are soaked with 
blotting buffer (0.38 g/1 SDS, 2.92 g/1 glycine, 5.82 gl Tris), in a blotting ap- 
paratus and electroblot proteins at a constant current of 100 mA for 1 h. 

3. Wash PVDF membrane with deionized water, stain with 0.1% CBB-R in 50% 
methanol and 10% acetic acid for 2 min, then destain in a solution of 45% 
methanol and 7% acetic acid until the protein bands become clear. After 
washing with deionized water, dry the membrane in air and store at -20 °C 
until use. 

4. Cut out the protein band on the PVDF membrane with a clean razor and 
then analyze by a sequenator. 

5. Search homology using obtained sequence from the database. 

Proteomics is a method can be used to investigate the functions of microbes 
indigenous to soils. It is a culture-independent technique and it could explore 
the ways for analysis of microbial community and functional relationships in 
studying soil microbiology. 

Z. Solaiman and A. Kashem 

We thank Dr. Murase as well as Elsevier Science Ltd. for giving us permission to 
use some of the figures and text. 

Boyd SA, Mortland MM (1990) Enzyme interaction with clays and clay-organic matter com- 
plexes. In: Bollag JM, Stotzky G (eds) Soil biochemistry, vol 6. Dekker, New York, pp 

Brenner ED, Lambert KN, Kaloshian I, Williamson VM (1998) Characterization of LeMir, a 
root-knot nematode-induced gene in tomato with an encoded product secreted from the 
root. Plant Physiol 118:237-247 

Kashem MA, James G, Harper C, Wilce P, Matsumoto I (2007) Differential protein expression 
in the corpus callosum (splenium) of human alcoholics: A proteomics study. Neuro- 
chem Int 50: 450-459 

Matsumoto S, Ae N, Yamagata M (2000) Extraction of mineralizable organic nitrogen from 
soils by a neutral phosphate buffer solution. Soil Biol Biochem 32:1293-1299 

Murase A, Yoneda M, Ueno R, Yonebashi K (2003) Isolation of extracellular protein from 
greenhouse soil. Soil Biol Biochem 35:733-736 

Ogunseitan OA (1993) Direct extraction of proteins from environmental samples. J Micro- 
biol Methods 17:272-281 

Ogunseitan OA (2006) Soil proteomics: extraction and analysis of proteins from soils. In: 
Nannipieri P, Smalla K (eds) Nucleic acids and proteins in soil. Springer, Berlin Heidel- 
berg New York, pp 95-1 16 

Okaley BR, Kirsch DR, Morris NR (1980) A simplified ultrasensitive silver stain for detecting 
proteins in polyacrylamide gels. Anal Biochem 105:361-363 

Singleton I, Merrington G, Colvan S, Delahunty JS (2003) The potential of soil protein-based 
methods to indicate metal contamination. Appl Soil Ecol 23:25-32 

Skujins J (1976) Extracellular enzymes in soil. CRC Critical Reviews in Microbiology 

Zantua MI, Bremner JM (1977) Stability of urease in soils. Soil Biol Biochem 9:135-140 

DGGE and RISA Protocols 

for Microbial Community Analysis in Soil 

Z. Solaiman and P. Marschner 

Soil microorganisms are pivotal for nutrient cycling and maintenance of soil 
health. Interactions between different species of the microbial community are 
important for ecosystem functioning. Traditional microbiological techniques 
have often failed to describe these interactions and may therefore be inadequate 
in detecting perturbations within soil microbial communities because 99% of 
soil microorganisms are not culturable (Schwieger and Tebbe 1997). Several 
culture-independent methods have been developed for the assessment of mi- 
crobial community structure and identification of species within the commu- 
nity. Most common are methods that rely on extraction of DNA from soil and 
subsequent characterization of DNA sequences. Several protocols for extraction 
of soil DNA suitable for further molecular analysis have been devloped, among 
them those which are described in this chapter: direct extraction of DNA from 
soil, PCR amplification of rRNA genes, followed by DNA sequence analysis by 
denaturant gradient gel electrophoresis (DGGE) or ribosomal intergenic spacer 
analysis (RISA; Borneman 1999; Van Elsas and Wolters 1995). We also use fatty 
acid methyl esters (FAME) techniques to study microbial community analysis. 
The protocols of DNA-based techniques are described in detail in this chapter, 
the FAME method is described in Chapter 12 in this book. 

Zakaria Solaiman: School of Earth and Environmental Sciences, The University of Adelaide, 
SA 5005, Australia; Present address: School of Earth and Geographical Sciences, 
The University of Western Australia, Crawley, WA 6009, Australia, 

Petra Marschner: School of Earth and Environmental Sciences, 
The University of Adelaide, DP 636, SA 5005, Australia 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

Z. Solaiman and P. Marschner 

Soil DNA Extraction 

Fast Prep cell disruptor/bead-beater (BIORAD) and centrifuge 

1. Phosphate buffer (PB) at pH 7.2 (autoclaved) preparation 200 mM 
(Table 11.1). Dissolve either NaH 2 P0 4 .H 2 0, or Na 2 HP0 4 .H 2 0, or Na 2 HP0 4 
in deionized water and add slowly NaH 2 P0 4 solution to adjust the pH to 7.2. 

2. Polyvinyl pyrrolodine (PVP) solution (autoclaved) or polyvinyl polypyrrolo- 
dine (PVPP) powder. Dissolve 100 mg PVP per milliliter of phosphate buffer 
or use PVPP as powder. 

3. 3 M CaCl 2 (autoclaved). Dissolve 333 g CaCl 2 per liter of Milli-Q water. 

4. 20% SDS. Dissolve 20 g SDS in 100 ml Milli-Q by slowly heating the suspen- 
sion. If crystalized, reheat carefully for a few minutes before use to dissolve 

5. Binding matrix Q-BIOgene (BIO 101) 

6. Guanidine thiocyanide (2.75 M) solution. To 200 ml of MilliQ water slowly 
add 322.25 g of guanidine thiocyanate while mixing continuously. Mix until 
the salt is completely dissolved. Add 3.35 g sodium citrate and mix until com- 
pletely dissolved. Add water to bring to final volume of 1 1. Filter through a 
Whatman No. 42 filter paper. 

7. Wash buffer. Mix Tris-HCl (10 mM), EDTA (0.5 mM) and NaCl (5 mM). 
Then dilute this mixture with ethanol (>95%) at 1:1 ratio. 

DNA Extraction Protocol 

This protocol is modified after Wechter et al. (2003). The DNA is liberated from 
the microbial cells by homogenization with glass beads in presence of a phos- 
phate buffer and SDS (surfactant). After centrifugation the supernatant contain- 
ing DNA and proteins is transferred into a fresh tube. Proteins are then removed 
by precipitation. The DNA is bound to a silica matrix and is washed twice with 
an ethanol-salt buffer to remove humic substances and other contaminants. For 
extracts from some soils, additional washing with guanidine thiocyanide solu- 

11. DGGE and RISA Protocols for Microbial Community Analysis in Soil 169 

Table 11.1 Phosphate buffer (PB) preparation 

Reagent mg/mmol g/ 1 00 ml 

NaH 2 P0 4 137.99 2.75 (for pH adjustment) 

NaH 2 PO 4 .H 2 156.01 3.12 

Na 2 HPO 4 .H 2 177.99 3.57 

Na 2 HPQ 4 141.9 2.84 

tion may be required to remove substances which inhibit the polymerase dur- 
ing PCR. Because of the high salt concentration the DNA remains bound to 
the silica matrix. The remaining ethanol must be removed completely, as it may 
inhibit the polymerase. The DNA is liberated from the silica matrix by adding 
ultrapure water to the dried silica matrix pellet. 

1. Fill 2-ml screw cap tube with (0.1 mm) glass beads up to the first line (ap- 
prox. 10 mm from the bottom). Then add 5-8 (2 mm) glass beads and 1 
(40 mm) glass bead. 

2. Weigh out soil (500 mg; or roots with adhering soil) and place into the 

3. Add 450 |il PB and 450 \xl PVP and 2 \xl of 3 M CaCl 2 ; tightly close cap and 
process in First Prep (30 s at speed 5.5); then centrifuge tubes at 14 000 rpm 
for 10 min. 

4. Transfer supernatant in a 1.5-ml microcentrifuge tube, then add 400 |al PVP 
or 0.1 g PVPP and 30 |il 20% SDS. 

5. Vortex for 5 s and then incubate at 4 °C for 5 min. 

6. Centrifuge tubes at 14 000 rpm for 10 min. 

7. Pour out supernatant in a 2.0-ml microcentrifuge tube and add 300 |al bind- 
ing matrix (shake binding matrix before use). 

8. Invert tubes by hand or place on shaker for 5 min. 

9. Centrifuge 1 min at 14 000 rpm and discard supernatant. 

10. Add 500 ul of 5.5 M guanidine thiocyanate, vortex and spin for 20 s and dis- 
card supernatant. 

11. Add 500 ul of 5.5 M guanidine thiocyanate, vortex and spin for 20 s and dis- 
card supernatant. 

12. Add 500 ul wash buffer, resuspend pellet by vortexing (bound DNA is 

13. Centrifuge at 14 000 rpm for 1 min and discard supernatant. 

14. Add 500 |al SEWS (wash) buffer, resuspend pellet by vortexing. 

15. Centrifuge at 14 000 rpm for 1 min and discard supernatant. 

16. Centrifuge again at 14 000 rpm for 2 min (remove as much ethanol from 
the pellet as possible) and remove as much of the liquid as possible using a 

17. Dry pellet for 10 min with the lid open (ethanol evaporates). 

18. Add 100 |al sterile ultrapure water, resuspend pellet by vortexing (DNA is 
liberated from the binding matrix) and then centrifuge at 14 000 rpm for 
2 min (DNA is in the supernatant). 

Z. Solaiman and P. Marschner 

19. Carefully remove as much of the supernatant as possible without getting any 
of the binding matrix into the DNA extract. Transfer DNA extract in new 
1.5-ml tube (can be stored at -20 °C for several months). If the solution is 
not completely clear, centrifuge again and transfer clear supernatant to fresh 
tube. The extract should not contain any binding matrix as this may inter- 
fere with the PCR. 

Polymerase Chain Reaction Protocol for DGGE 

This polymerase chain reaction (PCR) protocol for DGGE (modified after Clark 
and Atkins 2004) is a process by which a target sequence is amplified one mil- 
lion-fold. The principle of PCR is that short oligonucleotide primers bind to 
the DNA flanking the target region. The primers serve as starting points for the 
polymerase enzyme, which amplifies the DNA region between the primers and 
increases the concentration of the target DNA region exponentially. DNA am- 
plification is performed in a thermocycler. 

For DGGE, PCR can be carried out using a wide range of primers, for ex- 
ample universal primers for bacteria (Muyzer et al. 1993), fungi (Vainio and 
Hantula 2000), actinomycetes (Heuer et al. 1997). Here we outline a DGGE 
protocol only for bacterial community structure. In our laboratory, PCR is rou- 
tinely performed in 20-25 |J total volume containing 1 |il template DNA from 
lOx diluted samples (10-20 ng soil DNA), 2.0-2.5 \xl of lOx PCR reaction buffer 
(with final MgCl 2 concentration 2.5-3.15 mM). But larger volumes can also be 
used. Diluted DNA extracts, e.g. lOx, 20x, or 50x may give better amplification 
than the undiluted extract because the concentration of inhibiting substances is 
reduced. Different dilutions should be tested and selection of the correct dilu- 
tion should be based on the band intensity in an agarose gel or a DGGE gel. Our 
studies showed that dilutions up to 50x did not result in loss of bands in DGGE. 
Annealing temperatures and MgCl 2 concentration may have to be adjusted for 
each new primer set used (Clark and Atkins 2004). We outline nested PCR here, 
but this may not be necessary and it should be tested whether just the second 
round PCR yields sufficient product for DGGE. 

First Round PCR 

The bacterial primer set for the first round PCR (Weisburg et al. 1991): 
The PCR master mix (20 ul) is described in Table 11.2. 

11. DGGE and RISA Protocols for Microbial Community Analysis in Soil 171 

The cycling conditions are as follows: 93 °C for 5 min, then 95 °C for 30 s, 
then 55 °C for 30 s, for 34 cycles, followed by 72 °C for 2.30 min, then 72 °C for 
5 min and finally hold at 4 °C constant. 

GC Clamp 16S PCR (Second Round PCR) 

The second round PCR is performed in 25 \xl volume. 

The primer set for the GC clamp 16S PCR (Muyzer et al. 1993): 

The PCR master mix (25 \d) is described in Table 11.3. 

The cycling conditions are as follows: 93 °C for 5 min, then 94 °C for 30 s, 
then 53 °C for 30 s, for 29 cycles, followed by 72 °C for 2 min, then 72 °C for 
10 min and finally hold at 4 °C constant. 

Table 1 1 .2 First round PCR master mix 

PCR buffer 1 Ox 

MgCl 2 

Reverse primer rD 1 

Forward primer fD 1 

Taq polymerase 

Template DNA 

11.3 ul 
2.0 ul 

2.0 ul (2 mM dNTPs) 
2.0ulof25mMMgCl 2 
0.8 ul of 5 pm/ul 
0.8 ul 5 pm/ul 

1.0 ul (10-50 ng DNA) 

Table 1 1 .3 Second round PCR master mix 

PCR buffer 

MgCl 2 

GC F 341 

GC R 534 

Taq polymerase 

Template DNA 

11.9 ul 

2.5 ul 

2.5 ul (2 mM dNTPs) 

2.5ulof25mMMgCl 2 

1.0 ulof 5 pm/ul 

1.0 (ilof 5 pm/ul 

O.lulof 5 units/ ul 

1.0 ul from fDl/rDl PCR 

Z. Solaiman and P. Marschner 

The amplification success of DNA should be tested in an agarose gel after the 
first and the second PCR. 

DGGE Techniques 

DGGE was originally designed to detect single base mutations in DNA se- 
quences. Muyzer et al. (1993) expanded the use of DGGE to assess the micro- 
bial community composition in environmental samples. A given section of the 
DNA or RNA is amplified; the resulting DNA sequence has the same length 
for all species, but the species differ in sequence. The DGGE gel has a linear 
gradient of increasing concentrations of denaturants (urea, formamide) which 
separates the sequences based on their stability towards the denaturants. The 
separation of different sequences during electrophoresis is related to the guani- 
dine and cytosine(GC) content of the fragment. The stability of double-stranded 
DNA increases with GC content because there are three bonds between G and 
C compared with only two bonds between adenine and thymine (AT). Thus, 
sequences with a high GC content migrate further through the gel than low-GC 
sequences, resulting in a banding pattern that reflects the structure of the com- 
munity being assessed. To prevent smearing of the bands, the 5' end of the for- 
ward primer contains a 35-40 base pair GC clamp to ensure that the two strands 
are not completely separated (Marschner et al. 2005; Kirk et al. 2004). 

DGGE has advantages of being reliable, reproducible and rapid. After elec- 
trophoresis, bands can be excised and sequenced (e.g. Yang and Crowley 2000). 
However there are several limitations to the identification of species from DGGE 
bands: (i) one band may contain the sequences of several species and sequenc- 
ing may or may not reveal the presence of all species in a band, (ii) fragments 
used in DGGE are typically relatively short (300-1000 bp) to give good band 
resolution and these fragments are often not long enough to identify organisms 
at a species level, and (hi) only abundant species can generate a band. In DGGE 
the detection limit for bacteria may be as high as 10 6 cells per gram of soil (Gel- 
somino et al. 1999). 

The optimal gradient in DGGE needs to be tested for a given soil. The first 
DGGE should have a wide gradient, e.g. 15-70%. If most bands are found in a 
small proportion of the gel, e.g. over 35-55%, then this narrower gradient can 
be used for subsequent gels for better band resolution. 

Biorad DGGE kit 

11. DGGE and RISA Protocols for Microbial Community Analysis in Soil 173 

1 1 .4.2 

1. Acrylamide solution: acrylamide-bis-acrylamide 37.5:1, 40%. Preferably use 
purchased acrylamide solution. If not available, make up own stock solution: 
acrylamide 38.93 g, bis-acrylamide 1.07 g, H 2 (ultra pure) to 100 ml. 

2. Formamide: deionized formamide. 

3. Denaturing solution, 0%: acrylamide 20 ml, 50x TAE buffer 2 ml, H 2 (ultra 
pure) to 100 ml. 

4. Denaturing solution, 100%: urea 42 g, acrylamide 20 ml, 50x TAE buffer 
2 ml, formamide 40 ml, H 2 (ultra pure) to 100 ml. This solution precipi- 
tates in the cold. To re-suspend, place bottle with a stirring bar in a beaker 
with water and put on stirrer with a hot plate. Stir slowly and heat up to max. 
40 °C. Both 0% and 100% solutions can be stored at 4 °C for several weeks, 
but 1- to 2-week-old solutions work best. 

5. TAE buffer, 50x: Tris base 242 g, concentrated acetic acid 57.1 ml, 0.5 M 
EDTA (pH 8.0) 100 ml, H 2 to 1000 ml. EDTA only dissolves in solutions 
with pH 8.0. Weigh EDTA then prepare 4 M NaOH and add 50 ml to the 
EDTA and stir. When it is dissolved, check pH and fill up to the final vol- 
ume with deionized water. To make TAE buffer, weigh Tris into bottle, add 
concentrated acetic acid and EDTA solution and add approximately 600 ml 
deionized water. Stir until dissolved (takes about 1 h). Then adjust to final 
volume with deionized water. 

6. TAE runnning buffer, lx, buffer used in the DGGE tank: 50x TAE buffer 
140 ml, H 2 (deionized) to 7000 ml. Needs to be freshly prepared for each 

7. Dye preparation 

a. DGGE gel dye: mix bromophenol blue 50 mg, xylene cyanol 50 mg and 
1 x TAE buffer 1 ml. 

b. Sample loading dye: mix bromophenol blue solution (2%) 0.25 ml, xylene 
cyanol solution (2%) 0.25 ml, glycerol (99%) 7.0 ml and milli-Q water 
2.5 ml. 

1 1 .4.3 

Assembling the Gel Chamber 

1. Clean glass plates and spacer with ethanol and wipe dry with a tissue paper. 

2. Place the glass plates and spacer together with the sandwich clamps in the 
casting stand in which a rubber strip should be placed at the bottom to pre- 
vent leakage. Make sure that the glass plates are perfectly aligned at the bot- 

Z. Solaiman and P. Marschner 

1 1 .4.4 

Casting the Gel 

Mixing Solutions 

Place all solutions except the 100% denaturing solution on ice to avoid prema- 
ture polymerization, and then mix solutions in tubes also placed on ice. 

Final volume of the solutions in each tube: 18 ml for 1 mm thick gel. 

Volume of the 0% and 100% denaturing solution depends on desired gradi- 
ent. For example: 

18 ml of 35% solution = 11.5 ml of the 0% denaturing solution + 6.5 ml of the 
100% denaturing solution. 

18 ml of 55% solution = 8.1 ml of the 0% denaturing solution + 9.9 ml of the 
100% denaturing solution 

1. Add 160 ul of the DGGE gel dye to the solution with the higher denatur- 
ant concentration. Then mix. The gel dye is not necessary for the separation 
but allows visual verification of the gradient (dark blue where the denaturant 
concentration is highest, becoming lighter as the concentration of the dena- 
turant decreases). 

2. Add 160 ul of ammonium persulfate (10%; stored at -20 °C and thawed be- 
fore use) to both solutions. 

3. Add 16 |il of TEMED to both solutions. 

4. Mix well. 

1 1 .4.4.2 

Gel Casting Procedures 

1. Gels should be cast immediately after preparation of the solutions because 
the solutions polymerize within 30-45 min after addition of ammonium per- 
sulfate and TEMED. 

2. Load solutions into the syringes. Join the short tubings from the two syringes 
with the long tubing. Add a narrow gauge needle to the end of the long tubing 
and place needle between the two glass plates. Insert syringes into the gradi- 
ent former. Then slowly turn the wheel of the gradient former so that there is 
a steady flow of solution but not too fast, otherwise the gradient will not be 

3. Put in comb. 

4. Cover gels with damp paper towels and leave gels to polymerize for at least 
2 h or overnight at room temperature before loading sample. 

5. Fill the DGGE tank with lx TAE buffer (7 1). Turn on the heater of the DGGE 
tank and check that set temperature is 60 °C. It will take about 1 h for the buf- 
fer to reach that temperature. 

11. DGGE and RISA Protocols for Microbial Community Analysis in Soil 175 

1 1 .4.5 

Loading of the Samples 

1. Mix by using 20 |il of PCR product (5 \xl were used to verfiy the amplification 
in an agarose gel) samples with 8 ul of loading dye. 

2. Pipette the entire sample in a pocket of the gel. 

3. When all samples are loaded, put the lid back on the tank. Turn on the heater 
and the pump, wait for 1-2 min. Connect lid to the power supply and adjust 
to 150 V for 5 h or 70 V overnight (about 16 h). Shorter run times with a high 
voltage are also possible, but the resolution is often better when low voltage 
and longer run times are used. 

1 1 .4.6 

Staining and Imaging of the Gels 

There are several procedures for DNA staining, such as ethidium bromide, silver 
and Sybr gold/green. Ethidium bromide is the most commonly used staining 
procedure in molecular biology because it is inexpensive and the resolution is 
good. Silver staining is the most sensitive but it is more time-consuming than 
the other two staining methods and results in large amounts of toxic liquid 
waste. In our laboratory, we use Sybr gold for staining and it is relatively quick 
and reliable. The outline procedure is as follows (Marschner et al. 2005): 

1. After running gel, remove the gel holder with the gels. Let the gels cool for 
about 5 min. 

2. Remove gel with longer glass plate attached and put the gel facing up in a 
plastic staining tray. 

3. Spread the staining solution (10 ml of lx TAE buffer with 2 |il of SYBR gold) 
on the gel and use alignment card to distribute the solution evenly over the 
gel. Close the staining tray and incubate for 30-45 min in the dark. 

4. After the incubation, visualize the banding under UV light and take a picture 
of the gel. Store the image for further processing. 

Ribosomal Intergenic Spacer Analysis 

RISA is also a DNA-based method for microbial community analysis. It involves 
PCR amplification of a region of the rRNA gene operon between the small (16S) 
and large (23S) subunits termed the intergenic spacer region. By using oligonu- 
cleotide primers targeted to conserved regions in the 16S and 23S genes, RISA 
fragments can be generated from the dominant bacteria in an environmental 

Z. Solaiman and P. Marschner 

sample. While the majority of the rRNA operon serves a structural function, the 
taxonomic value of the intergenic spacer region lies in the significant heteroge- 
neity in both length and nucleotide sequence. In RISA, we exploit the length of 
heterogeneity of the intergenic spacer region between 150 bp and 1500 bp with 
the majority of the intergenic spacer region lengths being between 150 bp and 
500 bp (Fisher and Triplett 1999). 

The RISA protocol for bacterial community analysis described here is based 
on Borneman and Triplett (1997) and Yin et al. (2000). RISA has also been used 
for fungal community analysis (Ranjard et al. 2001). 

RISA has following features compared to DGGE: 

1. The amplified region is longer (positions 23R to 1406F, i.e. 1383 bp). 

2. No GC tail is attached to the forward primer. 

3. The species differ in the length of the amplified region. 

4. The species are separated according to the length of the region in an agarose 
or an acrylamide gel. The acrylamide gel may give a better resolution than the 
agarose gel. 

In some cases, samples that cannot be amplified for DGGE can be amplified 
for RISA. This may be due to the fact that the primers for RISA do not contain a 
GC tail, which is more difficult to amplify. 

Polyacrylamide gel casting system 

1. Denaturing loading buffer (10 ml): 95% formamide 9.5 ml, 20 mM EDTA 
(0.4 ml of 0.5 M stock solution), 0.05% bromphenol blue 5 mg, 0.05% xylene 
cyanol 5 mg. 

2. TBE buffer (5x): Tris 54.0 g/1, boric acid 27.5 g/1, EDTA 3.72 g/1. 

PCR Protocol 

1. Primer set: 

11. DGGE and RISA Protocols for Microbial Community Analysis in Soil 177 

Note that Y, B, R and B stand for a random mix of the following bases. 

Y= C/T; B= G/C/T; R= A/G; B= G/C/T. 

2. PCR master mix (in 25 |il total volume): H 2 12.8 fil, PCR buffer 2.5 ul,dNTPs 
(2 nmol/|il) 3.0 ul, MgCl 2 2.5 mM 2.5 ul (MgCl 2 solution is only necessary if 
polymerase buffer does not contain Mg), primer 1 (5 pmol/ul) 1.0 ul, primer 
2 (5 pmol/ul) 1.0 ul, polymerase (5 U/uL) 0.25 ul, template DNA 2.0 ul. 

3. PCR cycle: 94 °C for 5 min and then 34 cycles of 94 °C for 1 min, 52 °C for 1 
min, 72 °C for 2 min, 72 °C for 10 min, then hold at 4 °C constant. 

Gel Preparation and Loading 

Preparation of the Acrylamide Gel 

1. 5% polyacrylamide with a 37.5:1 acrylamide :bisacrylamide ratio contain- 
ing 7 M urea: 40% solution of 37.5:1 acrylamide:bisacrylamide 12.5 ml, urea 
42 g, 5x TBE buffer 20 ml, Milli-Q water to 100 ml. 

2. For one gel (1 mm thick): 5% acrylamide solution (see above) 35 ml, Temed 
30 ul, 10% APS 300 ul. 

Gels can be cast by loading the acrylamide solution into a syringe and then 
dispensing the solution through a needle between the two glass plates. When 
the gel sandwich is filled, insert the comb. Allow to polymerize for a least 2 h. 
After removing the comb, rinse out the wells to remove precipitated urea. Pre- 
electrophorese gel at 60 °C for 30-45 min at 40 V. 

Loading of the Samples 

For RISA, the double-stranded DNA product from the PCR has to be denatured 
before the PCR product is loaded on the RISA gel. The denaturation is carried 
out by adding a denaturing buffer and heating the samples to 80 °C for 10 min. 
After denaturation, the samples should be placed on ice and loaded quickly on 
the gel to prevent re-annealing of the two DNA strands. 

1. Precipitate PCR products with ethanol and resuspend in 25 ul TE buffer for 
purification of DNA. This step may not be necessary if the gels are not stained 
with silver. 

2. Add 15 (J.1 denaturing loading buffer. 

Z. Solaiman and P. Marschner 

3. Heat samples at 80 °C for 10 min, then place on ice for <1 0-1 5 min. 

Load samples immediately onto a pre-heated and pre-run gel at 60 °C for 
45 min at 40 V. 

Gel Running 

Run gel with 200 V for 5 h at 60 °C in a lx TBE buffer. 

Staining and Imaging of the Gels 

As like as DGGE gel, RISA gel can be stained with ethidium bromide, silver and 
Sybr gold/green. We use Sybr gold for staining and it is relatively quick and reli- 
able. The outline procedure is as follows (Marschner et al. 2005): 

1. After running gel, remove the gel holder with the gels. Let the gels cool for 
about 5 min. 

2. Remove gel with longer glass plate attached with and put the gel facing up in 
a plastic staining tray. 

3. Spread the staining solution (10 ml of lx TAE buffer with 2 |il of SYBR gold) 
on the gel and use alignment card to distribute the solution evenly over the 
gel. Close the staining tray and incubate for 30-45 min in the dark. 

4. After the incubation, visualize the banding under UV light and take a picture 
of the gel. Store the image for further processing. 

Data Analysis 

Gel banding patterns generated by DGGE or RISA can be compared visually, 
but due to the often high number of bands per sample (between 10 and >30) this 
is unsatisfactory, particularly when many samples are compared. Digitization of 
the banding patterns allows subsequent analysis by a range of multivariate anal- 
ysis techniques, such as principal component analysis or cluster analysis. When 
samples from different gels are to be compared, it is important to normalize the 
banding pattern both for band intensity and band position. Due to differences 
in staining intensity, and for DGGE, slight differences in gradient between gels, 
variation in banding pattern between samples only due to the fact that they are 
placed on different gels ("gel effect"). To normalize the band position, a standard 

11. DGGE and RISA Protocols for Microbial Community Analysis in Soil 179 

should be included in every gel to be compared. This standard (containing no 
more than 5-10 bands) may be a mix of DNA of pure cultures or one sample 
with a few bright bands. The positions of the bands in the samples are then ex- 
pressed relative to 3-4 bands in the standard. Normalization of band intensity 
can be carried out by dividing the intensity of each band in a given sample by 
the average intensity of the gel. We found that this normalization is quite effec- 
tive, but does not completely remove the "gel effect". It is therefore important to: 
(a) place the samples randomly on the different gels, or (b) place the replicates 
of a given treatment on different gels. 

With culture-independent methods we are starting to get a better picture of 
the enormous biodiversity of microorganisms in soils. New primers are con- 
stantly being developed, allowing the amplification of specific microbial groups 
or functional genes. However, there are a number of limitations to DNA-based 
methods: (a) due to amplification bias during PCR, the abundance of a DNA 
sequence in a sample and band intensity may not be directly related; (b) most 
methods can only detect the most abundant species/DNA sequences present 
and may therefore underestimate biodiversity. Despite these limitations, DNA- 
based methods such as DGGE and RISA are powerful tools that can provide in- 
sight into microbial community composition. Despite our better understanding 
of microbial diversity in the environment, it is intriguing that we currently do 
not know whether the most abundant species/DNA sequences are also the func- 
tionally most important ones. Moreover, the link between diversity and ecosys- 
tem function or sustain ability is far from clear. Clearly, more research is needed 
and DNA-based methods will play an important role in such studies. 

Borneman J (1999) Culture-independent identification of microorganisms that respond to 
specified stimuli. Appl Environ Microbiol 65:3398-3400 

Borneman J, Triplett EW (1997) Molecular microbial diversity in soils from eastern Amazo- 
nia: evidence for unusual microorganisms and microbial population shifts associated 
with deforestation. Appl Environ Microbiol 63:2647-2653 

Clark I, Atkins S (2004) Microbial environmental surveillance - a molecular biology manual. 
IACR, Rothamsted, pp 50 

Fisher MM, Triplett EW (1999) Automated approach to ribosomal intergenic spacer analysis 
of microbial diversity and its application to freshwater bacterial communities. Appl En- 
viron Microbiol 65:4630-4636 

Z. Solaiman and P. Marschner 

Gelsomino A, Keijzer WAC, Cacco G, Van Elsas JD (1999) Assessment of bacterial commu- 
nity structure in soil by polymerase chain reaction and denaturing gradient gel electro- 
phoresis. J Microbiol Methods 38:1-15 

Heuer H, Krsek M, Baker P, Smalla K, Wellington EMH (1997) Analysis of actinomycete 
communities by specific amplification of genes encoding 16S rRNA and gel electropho- 
retic separation in denaturing gradients. Appl Environ Microbiol 63:3233-3244 

Kirk JL, Beaudette LA, Hart M, Moutoglis P, Klironomos JN, Lee H, Trevors JT (2004) Meth- 
ods of studying soil microbial diversity. J Microbiol Methods 58:169-188 

Marschner P, Baumann K, Solaiman Z (2005) Molecular approaches to study the microbial 
community structure and function in the rhizosphere. In: Podila GK, Varma A (eds) 
Biotechnological applications of microbes. I.K. International, New Delhi, pp 311-334 

Muyzer G, De Waal EC, Uitterlinden AG (1993) Profiling of complex microbial populations 
by denaturing gradient gel electrophoresis analysis of polymerase chain reaction- ampli- 
fied genes encoding for 16S rRNA. Appl Environ Microbiol 59:695-700 

Ranjard L, Poly F, Lata J-C, Mougel C, Thioulous J, Nazaret S (2001) Characterization of 
bacterial and fungal soil communities by automated ribosomal intergenic spacer anal- 
ysis fingerprints: biological and methodological variability. Appl Environ Microbiol 

Schwieger F, Tebbe CC (1997) Efficient and accurate PCR amplification and detection of a 
recombinant gene in DNA directly extracted from soil using the expand™ high fidelity 
PCR system and T4 gene 32 protein. Biochemica 2:21-23 

Vainio EJ, Hantula J (2000) Direct analysis of wood-inhabiting fungi using denaturing gradi- 
ent gel electrophoresis of amplified ribosomal DNA. Mycol Res 104:927-936 

Van Elsas JD, Wolters A (1995) Polymerase chain reaction (PCR) analysis of soil microbial 
DNA. In: Akkermans ADL, Elsas Van JD, De Bruin (eds) Molecular and microbial ecol- 
ogy mannual. Kluwer, Dordrecht, pp 1-10 

Wechter P, Williamson J, Robertson A, Kluepfel D (2003) A rapid, cost-effective procedure 
for the extraction of microbial DNA from soil. World J Microbiol Biotechnol 19:85-91 

Weisburg WG, Barns SM, Pelletier DA, Lane DJ (1991) 16S ribosomal DNA amplification for 
phylogenetic study. J Bacteriol 173:697-703 

Yang CH, Crowley DE (2000) Rhizosphere microbial community structure in relation to root 
location and plant iron nutritional status. Appl Environ Microbiol 66:345-351 

Yin B, Crowley DE, Sparovek G, De Melo WJ, Borneman J (2000) Bacterial functional redun- 
dancy along a soil reclamation gradient. Appl Environ Microbiol 66:4361-4365 

Soil Microbial Community Structure 
and Function Assessed by FAME, 
PLFA and DGGE - Advantages 
and Limitations 

P. Marschner 

Microorganisms play a pivotal role in nutrient availability, plant growth and 
plant health. It has been estimated that one gram of soil contains approximately 
10 9 prokaryotes and more than 2000 genome types, with an average genome 
type representing less than 0.05% of the soil community (Torsvik et al. 1990). 
Until a few decades ago, soil microorganisms could only be studied by direct mi- 
croscopic observation or culture-dependent methods. It is now recognized that 
culture-dependent methods such as dilution plating on standard media assess 
less than 5% of soil microorganisms (Bakken 1985). Although some previously 
unculturable bacterial species can now be isolated using special media and incu- 
bation methods (Janssen et al. 2002), most soil bacteria remain non-culturable. 
The advent of culture-independent methods has revolutionized soil microbial 
ecology because they make it possible to study a much greater fraction of soil 
microorganisms. With these new techniques, many new microbial species and 
even families have been discovered (Hugenholtz et al. 1998) and new insights 
obtained into microbial community composition, the interactions between mi- 
croorganisms and the factors influencing microbial communities in soil. 

In this chapter, three of the most widely used methods, fatty acid methylester 
(FAME), phospholipid fatty acid (PLFA) analyses and denaturing gradient gel 
electrophoresis (DGGE) are briefly described and their advantages and limi- 
tations outlined. Details on DGGE and FAME methodology can be found in 
Chapter 11. It should be noted that there are many variations to the methods 
described, more information can be found in the cited literature and method- 
ological manuals. 

Soil and Land Systems, School of Earth and Environmental Sciences, 

The University of Adelaide, SA 5005 DP 636, Australia, Tel: +61 08 8303 7379 

Fax: +61 08 8303 6511, email: 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

P. Marschner 

Microbial Community Structure Based 
on Fatty Acid Patterns 

Phospholipid fatty acids are components of the membranes of all organisms and 
each species has a characteristic fatty acid pattern. In soil microbial ecology, 
fatty acid patterns have been initially used to identify isolated microorganisms, 
but are now very common in studies of soil microbial communities. 

To obtain fatty acid profiles, the fatty acids are extracted from soil (Frostegard 
et al. 1993a, b). FAME patterns are based on all fatty acids extracted (polar and 
non-polar fatty acids), whereas for phospholipid fatty acids (PLFA) patterns, the 
polar phospholipids are separated from the non-polar lipids by exchange col- 
umns (Baath et al. 1995; Frostegard et al. 1993a). For PLFAs and FAMEs the 
fatty acids are methylated and then detected by gas chromatography (GC). 

Phospholipids are dephosphorylated within minutes in soil (White 1993). 
Thus, PLFA profiles are derived from active microorganisms only, whereas 
FAME profiles may also include fatty acids from microorganisms that died 
recently. Nevertheless, shorter-chain fatty acids (C<20, which predominate in 
microbial cell membranes) are rapidly decomposed in soil, thus the majority 
of FAMEs are also derived from the living biomass (Jandl et al. 2005). Fatty ac- 
ids extracted from soil may also be derived from plant residues, roots or soil 
animals, however the fatty acids from these organisms are usually longer-chain 
(C>20) than those of microorganisms (C10-C20; Jandl et al. 2005). 

The fatty acid pattern is used to determine community composition. The 
biomass of groups such as gram-negative bacteria, gram-positive bacteria, ac- 
tinomycetes, fungi and other soil organisms can be estimated by determining 
the concentration of so-called signature fatty acids (White 1993; White et al. 
1996), which are specific for a given group (Table 12.1). While there are 10-15 
bacterial signature fatty acids, only 2-3 fatty acids are characteristic for fungi, 
which may lead to an underestimation of fungal biomass. However, Klamer and 
Baath (2004) found a good correlation between the concentration of the fungal 
signature fatty acid 18:lco9c and ergosterol (a sterol that is only found in fungi; 
Klamer and Baath 2004). 

Under stress such as nutrient limitation or drought, many microorganisms 
produce specific fatty acids. These have been used to assess the physiologi- 
cal status of microbial communities (Baath and Anderson 2003; White 1993). 
However, it should be noted that the relationship between stress and these fatty 
acids was determined in laboratory cultures and it is not clear whether such a 
relationship also exists in diverse soil communities. 

PLFA patterns have been used to study the effect of a range of factors on soil 
microbial communities, e.g. pH or acid rain in forest soils (Baath and Anderson 
2003; Baath et al. 1995; Frostegard et al. 1993a; Pennanen et al. 1998), heavy 
metal addition (Frostegard et al. 1993b; Kandeler et al. 2000) or soil amend- 
ments (Marschner et al. 2003; Zelles et al. 1995). 

Many studies report the effect of environmental factors on microbial commu- 
nity structure assessed by FAME. Examples include effects of management and 

12. Soil Microbial Community Structure and Function Assessed by FAME 183 

Table 1 2.1 Signature fatty acids, based on Zak et al. (2000) and Olsson et al. (1997). Nomenclature 
is based on the ratio of number of carbon atomsmumber of double bonds in the fatty acid, followed 
by the position of the double bond from the methyl end of the molecule. Cis- and trans- configu- 
rations are indicated by c and t, respectively; prefixes a and i indicate anteiso- and iso- branching; 
lOMe indicates a methyl group on the tenth C atom from the carboxyl end of the molecule; cy refers 
to cyclopropane fatty acids (Frostegard et al. 1993a). AM Arbuscular mycorrhizal fungi 

Signature fatty acid 

Signature fatty acid 

Gram+ bacteria 

Gram- bacteria 

AM fungi 

crop rotation (Buyer and Drinkwater 1997; Buyer and Kaufman 1996), the intro- 
duction of foreign bacterial strains (Gagliardi et al. 2001), heavy metal pollution 
(Brim et al. 1999), biosolid application (Sullivan et al. 2006), plant species (Ibekwe 
and Kennedy 1998; Marschner et al. 2005) or salinity (Pankhurst et al. 2001). 

Fatty acids specific for arbuscular mycorrhizal (AM) fungi and certain stor- 
age structures have been used to measure AM root colonization and hyphal bio- 
mass in soil (Olsson et al. 1997, 1998). 

FAME Extraction and Data Analysis 

The method described below for FAME extraction is based on Pankhurst et 
al. (2001) and Hawke (personal communication) and uses 6 g soil, but smaller 
amounts of soil can also be used. If the amount of soil available varies consider- 
ably between samples, a pre-test should be performed to determine the smallest 
possible sample size. This is done by comparing the FAME patterns derived 
from different amounts of soil. The lower limit of soil would then be the amount 
of soil that still gives a similar pattern as the greatest amount. If small amounts 
of soil are used, it may be advantageous to also use smaller volumes of the ex- 
tractants. After sampling, the soils should be kept on ice for transport and then 
stored at -20 °C or -80 °C to prevent decomposition of the fatty acids. 

P. Marschner 

Culture tubes with Teflon-lined screw-cap, water bath, centrifuge, end-over-end 
shaker, gas chromatograph. All glassware should be washed with deionized wa- 
ter and twice with chloroform to avoid fatty acid contamination. 

Reagent 1: NaOH (45 g), methanol (HPLC grade; 150 ml), deionized distilled 

water (150 ml). 

Reagent 2: 6.0N HC1 (150 ml), methanol (HPLC grade; 275 ml). 

Reagent 3: hexane (HPLC grade; 200 ml), methyl- tert-butyl ether (HPLC grade; 

200 ml). 

Reagent 4: NaOH (10.8 g), deionized distilled water (900 ml). 

Extraction Procedure 

1. Place 6 g fresh soil in a culture tube with a Teflon-lined screw-cap. 

2. Add 6 ml of reagent 1 for saponification. 

3. Seal with a Teflon-lined screw cap and vortex to ensure good soil/liquid con- 

4. Place tubes in a 100 °C water bath for 30 min and then cool in ice-water. 

5. Centrifuge tubes for 3 min at 3000 g. 

6. Transfer 3 g of the supernatant in a glass tube with screw-cap. 

7. Add 6 ml of reagent 2 and vortex. 

8. Incubate at 80 °C for 10 min, then allow to cool. 

9. Add 1.5 ml of reagent 3 and close tube with screw-cap. 

10. Place end-over-end shaker for 10 min. 

11. Centrifuge the extract at 3000 g for 3 min. 

12. Transfer top phase to a new tube. 

13. Add 4 ml of reagent 4 and close tube with screw-cap. 

14. Place on an end-over-end shaker for 5 min. 

15. Centrifuge for 3 min at 3000 g. 

16. Collect the top phase into a GC vial. 

17. Evaporate completely under a nitrogen gas stream. 

18. Add 10 (J.1 of 19:0 methyl ester standard, then add 200 ul of reagent 3 and 
mix carefully. 

19. The samples can be analyzed directly or stored at -20 °C for later analysis 

12. Soil Microbial Community Structure and Function Assessed by FAME 185 

To estimate recovery of fatty acids during extraction, a known concentration 
of fatty acid 13:0 can be added after step 6 (13:0 is usually not found in soils or 
is present at very low concentrations only). The peak height of 13:0 is then be 
compared with that of 19:0. For example, if the concentration of 13:0 is 5.0 times 
higher than that of 19:0, the peak of 13:0 should be 5.0 times greater than that of 
19:0. If it is only 2.5 times greater, that suggests an extraction efficiency of 50%. 

Data Analysis 

The fatty acids are separated by GC. MIDI is a GC software package originally 
used for the identification of microorganisms from pure cultures by FAME pat- 
terns. It can also be used to generate FAME patterns from soil. However FA- 
MES can also be separated by GC without the MIDI system. Standard fatty acid 
mixes are commercially available (e.g. from Supelco). They may contain up to 
37 fatty acids and include the most common fatty acids found in soils. Peaks 
in the samples are then identified by matching their retention time with those 
of the standard mix. Commercially available standard FAME mixes also come 
with a recommendation of the column and the temperature program to be used. 
The temperature program may need to be adjusted to obtain optimal separation 
of the peaks. 

During sample preparation, the internal standard [nonadecanoic acid (19:0)] 
is added to all samples. This fatty acid is not found in soils and can therefore be 
used to normalize the fatty acid patterns. Normalization is performed by divid- 
ing the peak of each individual fatty acid by the peak of the internal standard 
(19:0). Dividing this value by the dry weight of the soil gives the fatty acid con- 
centration in (ig per g soil. 

Fatty acid concentrations can be expressed in micrograms or millimoles per 
gram soil or in weight% (wt%). The weight% of fatty acids is calculated by di- 
viding the peak of each fatty acid by the sum of fatty acids of the sample and 
multiplying this value by 100. 

PLFA Analysis 

The method described here is based on a procedure described by Bardgett et al. 
(1996), which was based on Blight and Dyer (1959) as modified by White et al. 

Principle: fatty acids are extracted with a reagent (Blight and Dyer 1959) con- 
taining chloroform, methanol and citrate buffer. Lipid extracts are separated 
into neutral, glyco- and phospholipids via passage through an exchange col- 
umn. The phospholipids are converted into fatty acid methylesters which can be 
determined by GC. 

P. Marschner 

Materials and Reagents 

Citrate buffer (0.15 M), pH 4: 31.52 g citrate dissolved in 1 1 water, pH adjusted 

Extraction reagent (Blight and Dyer 1959): chloroform, methanol and citrate 

buffer mixed in a ratio of 1:2:0.8 (by vol.). 
KOH-MeOH (0.2 M): 5.61 g KOH dissolved in 500 ml methanol gelost (can be 

stored at 5 °C for up to 2 months). 
Acetic acid (1 M): 5.72 ml of 100% acetic acid diluted with deionized water to a 

final volume of 100 ml. 
Internal standard: methylnondecanoate (CI 9:0), 230.8 |ig/ml: 5.770 mg methyl - 

nondecanoate dissolved in 25 ml isooctane. 
Rinsing solution for columns: chloroform and methanol 1:1 (v/v). 
Acetone, hexane chloroform solution (4:1, v/v), methanol toluol solution (1:1, 

Silica-bonded columns for fractionation (e.g. 500 mg, 3 ml; from Varian). 
Glass centrifuge tubes (25 ml, 10 ml). 
Heating block to concentrate samples and for methanolysis. 
Optional: Baker system with vacuum pump for rapid elution from columns. 
All glassware should be washed with deionized water and twice with chloro- 
form to avoid fatty acid contamination. 

PLFA Procedure 

1 . Lipid Extraction 

Weigh out 0.5 g soil (organic matter-rich soils) to 2.0 g soil (organic matter- 
poor soils) in 25-ml glass centrifuge tubes. Negative controls (without soil) 
should be subjected to the same treatment as the samples. 
Add 1.5 ml citrate buffer, 1.9 ml chloroform, 3.8 ml methanol and 2 ml Blight 
and Dyer reagent, vortex. 

Shake tubes for 2 h, followed by centrifuging at 2500 g for 10 min. 
Transfer supernatant into a new 25-ml glass centrifuge tube. Wash soil pellet 
again with 2.5 ml Blight and Dyer reagent (vortex, centrifuge) and combine 
with first supernatant. 

2. Phase Separation 

Add 3.1 ml chloroform and 3.1 ml citrate buffer to the supernatant and 

Centrifuge at 2500 g for 10 min. 

Transfer 1-3 ml from the lower (organic) phase into a new 10-ml glass tube. 

Dry at 40 °C under a stream of N 2 . The tubes can be stored at -20 °C until the 

following steps are carried out. 

12. Soil Microbial Community Structure and Function Assessed by FAME 187 

3. Lipid Fractionation 

Note: elution can be speeded up by applying negative pressure to the bottom 
of the columns, e.g. Baker system. 

Condition silica-bonded columns with 2x 1 ml chloroform. 
Dissolve dried sample in 300 ul chloroform and add to the column using a 
Pasteur pipette. Rinse the pipette with 2x 300 \A chlororform. 
Elute neutral lipids with 5 ml chloroform and discard eluate. 
Elute glycolipids with 20 ml acetone and discard eluate. 
Elute phospholipids with 5 ml methanol and transfer eluate into a 10-ml cen- 
trifuge tube. 
Dry at 40 °C under a stream of N 2 . 

4. Alkaline Methanolysis 

Add 30 (il internal standard (CI 9:0) to sample and then dissolve sample in 
1 ml methanol toluol solution (1:1, v/v). 

Add 1 ml of 0.2 M KOH-MeOH and incubate for 15 min at 37 °C in a water 

Add 2 ml hexane-chloroform solution, 0.3 ml of 1 M acetic acid and 2 ml 
deionized water, vortex. 
Centrifuge for 5 min at 2500 g. 

Transfer upper (organic) phase into a 10-ml glass tube using a Pasteur pi- 

Add 2 ml hexane-chloroform solution to the lower phase, vortex and com- 
bine the supernatant with the previous one. 

Dry at 40 °C under a stream of N 2 . The dried extract can be stored at -20 °C 
until analysis. 

5. Fatty Acid Determination 

Dissolve dried extract in 100 |il isooctane and transfer into GC vial. 

Fatty acids can be separated by a 50 m capillary column (HP-5, Agilent) and 

detected by a flame ionization detector. 

Calculations and Data Analysis 

7I _ ^ FM c 7 e-21000100 

c\nmoll g] = —^- — IA 

Correction for negative control: 

^A FM -c IS -2-l000^ 

c\nmol I g] = 

y y Ais • MWfm j ) 

P. Marschner 

c [nmol/g]: concentration of fatty acid methylester 

A FM : area of the fatty acid methylester 

MW ¥M : molecular weight of the fatty acid methylester (|ig/|imol) 

C IS : concentration of internal standard (ug) 

A IS : area of internal standard 

SW: weight of soil sample (g) 

DW: dry weight of soil (%) 

2: corrects for the use of 3 ml from 6 ml organic phase in phase separation 

1000: factor for expression (nmol) 

c NC : Concentration in negative control (nmol) 

FAME and PLFA patterns can be analyzed in a number of ways: (a) concen- 
tration of individual fatty acids, (b) concentration of signature fatty acids (see 
Table 12.1) and their ratios, e.g. ratio of bacterial to fungal fatty acids, (c) diver- 
sity using the Shannon-Weaver index (H') = -T(n\/N) x ln(n!/AT), where n = 
concentration of each fatty acid and N = sum of concentration of all bands of the 
sample (Zak et al. 1994), and (d) multivariate analyses such as cluster analysis, 
principle component analysis, etc. 

Advantages and Limitations of Fatty Acid Patterns 

1. Advantages 

• Extraction procedure is relatively simple and quick if only FAMEs are mea- 
sured, more laborious for PLFAs. 

• Phospholipids are rapidly dephosphorylated (White 1993) and fatty acids de- 
composed in soil (Jandl et al. 2005). Therefore PLFAs are considered to be 
derived mainly from living organisms. 

• Signature fatty acids can be used as indicators for biomass of certain micro- 
bial groups and the ratios between them. The sum of microbial signature fatty 
acids in a given sample can be used as a measure of microbial biomass. 

• Peak patterns represent community composition and can be compared us- 
ing multivariate analyses. With some multivariate analysis methods, such as 
canonical correspondence analysis or multidimensional scaling, it is possible 
to relate community composition with environmental factors. 

• Certain fatty acids have been used to assess the physiological status of micro- 
bial communities (Baath and Anderson 2003; White 1993). However the re- 
lationship between stress and these fatty acids was determined in laboratory 
cultures and it is not clear whether such a relationship also exists in diverse 
soil communities. 

2. Limitations 

• Only a small number of fatty acids are truly characteristic for certain groups, 
many are ubiquitous and may be derived from other soil organisms (Jandl et 

12. Soil Microbial Community Structure and Function Assessed by FAME 189 

al. 2005). Hence the background of unspecific fatty acids may mask differ- 
ences in microbial community structure. 

• It is often assumed that, due to the limited number of signature fatty acids for 
fungi, fungal biomass may be underestimated. Nevertheless, the correlation 
between fungal fatty acid content and other measures of fungal biomass, e.g. 
ergosterol, is quite high (Klamer and Baath 2004). 

• FAME patterns may also contain fatty acids from dead microorganisms and 
plant residues. 

• No information about species composition. 

Denaturing Gradient Gel Electrophoresis 

Denaturing gradient gel electrophoresis (DGGE) is a method that relies on sep- 
arating species according to differences in sequence of the target DNA or RNA 
region. DGGE involves several steps which are described below: (1) DNA/RNA 
extraction from soil, (2) polymerase chain reaction (PCR) of the target region, 
and (3) DGGE itself. 

DNA Extraction from Soil 

DNA extraction from soil is often more difficult than from many other ecologi- 
cal samples (Wintzigerode et al. 1997) because: 

1. Microbial cells can be located within soil aggregates and adhere tightly to 
soil organic matter and minerals. Thus efficient DNA/RNA extraction is only 
possible by mechanical breakdown of aggregates and release of the cells ad- 
hering to soil particles. 

2. Spores of fungi and gram-positive bacteria have thick and tough walls; DNA 
will only be released from spores after rupture of the spore walls. 

3. Many soils contain large amounts of humic substances and phenolic com- 
pounds, which inhibit the polymerase enzyme in the PCR. For successful 
PCR, the inhibiting substances have to be removed or the extract needs to be 

In the indirect DNA extraction methods, the cells are first separated from the 
soil followed by DNA extraction from the cell suspension. Direct methods ex- 
tract the DNA from the soil sample directly without prior separation of the cells. 
An example of an indirect method is described by Duarte et al. (1998). They 
separated the cells from soil aggregates by shaking the soil with a buffer solu- 

P. Marschner 

tion and then subjecting the cell pellet to bead beating. Subsequently the DNA 
was purified by isopropanol precipitation (Duarte et al. 1998). The advantage of 
separating the cells from the soil prior to bead beating is that the concentration 
of humic acids is minimized, which may be important in soils with very high 
organic matter content. 

The method described in Chapter 11 is an example of a direct method. Soil 
samples are homogenized in a bead beater. After removal of proteins and hu- 
mic acids by precipitation, DNA is bound to a silica matrix, purified by several 
washing steps and finally desorbed into water. 

Kozdroj and Van Elsas (2000) compared four methods: two direct methods 
(bead beating, grinding in liquid N) and two indirect methods. They found that 
DNA yield decreased in the following order: direct bead beating > grinding in 
liquid N > indirect methods, whereas DNA purity was greater in the indirect 
than in the direct methods. However, they found that the cell pellet in the in- 
direct methods only contained a subset of the microbial community in the soil, 
namely cells that were easily dislodged from aggregate surfaces. Bead beating 
methods extracted substantial amounts of humic substances and PCR was only 
possible after purification (Kozdroj and Van Elsas 2000). 

There are a number of commercial kits for the extraction of soil DNA or RNA, 
which are often as efficient and less labor-intensive than "home-made" methods. 
Two of the most widely used kits are the soil DNA or RNA kits from Qbiogene 
and MoBio. It should be noted that, due to the difficulties in DNA extraction 
from soils mentioned above, DNA extraction kits developed for plant tissues or 
microbial pure cultures will often not efficiently extract DNA from soils. 

Humic substances which can inhibit the polymerase in PCR may be removed 

1. Addition of 200 |il of 100 mM A1NH 4 (S0 4 ) 2 solution to tubes before bead 
beating [A1NH 4 (S0 4 ) 2 should be filter- sterilized (2 \im) before use; Braid et al. 

2. Addition of PVPP or PVP (0.1 g/0.2 g soil) before bead beating. Autoclave 
PVP before use (Wechter et al. 2003). 

3. Washing the DNA bound to silica matrix with 2x 500 ul of 5.5 M guanidine 
thiocyanate, then vortexing, spinning for 20 s and discarding supernatant. 

4. Using exchange resins (Kuske et al. 1998). 

Polymerase Chain Reaction 

Polymerase chain reaction (PCR) is a process by which a target sequence is am- 
plified one million -fold. It has revolutionized molecular studies because it allows 
the detection of sequences that have very low initial concentrations. Briefly, PCR 
involves binding of short oligonucleotide primers to the DNA flanking the target 
region. The primers serve as starting points for the polymerase enzyme, which 

12. Soil Microbial Community Structure and Function Assessed by FAME 191 

amplifies the DNA region between the primers and increases the concentration 
of the target DNA region exponentially because the sequences amplified in one 
cycle act as templates in the next cycle. Amplification is carried out in thermocy- 
clers which can change the temperature of the sample within seconds. Thermo- 
cyclers typically undergo programs with the following temperatures: 95 °C for 
separation of the double strands, 45-55 °C (depending on the primers used) for 
primer annealing and 75 °C for extension during which the polymerase enzyme 
creates a matching strand of the target DNA sequence between the primers. PCR 
programs usually consist of 20-40 such cycles and are designed to maximize the 
yield of the target DNA. Thus, the final DNA yield is considered to be a poor 
indicator of the initial target DNA concentration. Success of the PCR can be 
visualized under UV light by running the products in an agarose gel (1-2%) and 
staining with ethidium bromide or Sybr green or Sybr gold. For quality control 
it is important to include in every PCR run at least one negative control (water 
instead of sample) and at least one postive control. The positive control may 
consist of: (a) solution containing target DNA sequence (b) DNA from target 
organism, or (c) extract of the environmental sample that contains target DNA. 

Primer design is critical for the specificity of the PCR reaction. Primers can 
be designed from existing databases or from sequences derived from own stud- 
ies. In each case the specificity has to be checked carefully. Universal primers 
are designed to amplify the DNA of a large group of organisms such as bacteria 
or fungi. However, Watanabe et al. (2001) showed that many so-called univer- 
sal eubacterial primers were in fact not universal because they did not amplify 
the DNA of certain bacterial species or genera (Watanabe et al. 2001). Fungal 
primers may also amplify DNA from other eukaryotes such as soil animals and 
plants (Borneman and Hartin 2000). 

Primers can be family-, genus- or kingdom-specific or have a functional gene 
as target. Some examples are given below: 

1. Bacteria (Muyzer and Smalla 1998; Watanabe et al. 2001) 

2. Actinomycetes (Heuer et al. 1997) 

3. Fungi (Vainio and Hantula 2000) 

4. Pseudomonas (Widmer et al. 1998) 

5. Bacillus (Garbeva et al. 2003) 

6. Ammonia oxidizers (Avrahami et al. 2003) 

7. Nitrogen -fixing (nifi genes (Chelius and Lepo 1999). 

A PCR protocol for bacteria is described in Chapter 11. PCR conditions vary 
with primer. The reader is referred to the appropriate conditions in the relevant 

When using soil extracts, it is important to perform PCR pre-tests. Often, un- 
diluted DNA extracts contain high concentrations of substances inhibiting the 
polymerase. Therefore DNA extracts may have to be diluted. Dilutions between 
1:10 to 1:500 or even 1:1000 have been used. It is recommended to try several 
dilutions of the DNA extracts (using between three and five samples) and select 
the dilution that gives the most consistent amplification. 

P. Marschner 

There are a number of pitfalls of PCR (Wintzigerode et al. 1997): 

1. PCR amplification of DNA in soil extracts may be inhibited by humic acids 
or humic substances. Purification of extracts to remove inhibiting substances 
may lead to loss of DNA. 

2. Not all sequences are amplified to the same extent due to PCR bias or differ- 
ential PCR amplification. 

3. Possible PCR artifacts: (a) formation of chimeric molecules (two single 
strands which differ slightly in sequence form a double strand) and (b) dele- 
tion or point mutations during PCR (polymerase reading errors). 

4. A given organism may contain multiple copies of the same gene with similar 
or slightly different sequence leading to overestimation of the abundance of 
this organism compared to organisms with single gene copies. 

5. Primer design is based on known sequences, thus the DNA of some species 
of target organisms may not be amplified because their DNA sequence is 
slightly different. 

Consequently, the frequency of genes or species determined after PCR may 
not truly reflect their frequency in the sample. Primers targetting the same genes 
may differ in amplification bias, thus the frequency of genes or species will also 
depend on primer choice. 

DGGE Procedures 

Denaturing gradient gel electrophoresis (DGGE) was originally designed to de- 
tect single base mutations in isolates but is now often used to assess microbial 
community composition in environmental samples (Muyzer et al. 1993). 

After DNA extraction and PCR, the amplified DNA region from different 
species has approximately the same length (which, depending on the primers 
used, may be 300-1000 base pairs long) but each differs in sequence. The sepa- 
ration of different sequences during electrophoresis is based on the guanidine 
and cytosine (GC) content of the fragment. For details see Chapter 11. Denatur- 
ation, the partial separation of the two strands, is achieved in polyacrylamide 
gels by denaturing chemicals (urea, formamide) with the concentration of the 
denaturants increasing from the top to the bottom of the gel. Thus sequences 
with a high GC content, which are more stable, migrate further through the 
gel than GC-poor sequences. When the PCR product of a microbial commu- 
nity is electrophoresed in a DGGE gel, the fragments migrate through the gel 
and form a band when they reach the concentration of denaturants (DGGE) at 
which they denature (Fig. 12.1). The result is a banding pattern that varies with 
community composition. A GC tail (clamp) is added to one primer in the PCR 
to avoid complete separation of bands, which would result in smeared bands 
(Muyzer and Smalla 1998). 

12. Soil Microbial Community Structure and Function Assessed by FAME 193 

Depending on the primers used, the community composition of different mi- 
crobial groups can be assessed. Patterns generated from DNA reflect the com- 
munity composition of the total community of the target organisms or genes, 
whereas RNA patterns include only the active fraction, and in case of mRNA of 
a functional gene, the gene-expressing fraction of the community. 

For interpretation of banding patterns it should be noted that species often 
contain several copies of the same gene that differ slightly in sequence. Hence 
one species may produce several bands in DGGE (Muyzer and Smalla 1998). 
In contrast, a given band may contain the sequence of more than one species 
because they differ only by a few base pairs within the amplified DNA region 
(Yang and Crowley 2000). 

After electrophoresis, bands can be excised and sequenced (e.g. Yang and 
Crowley 2000). However there are several limitations to the identification of 
species from DGGE bands: (a) one band may contain the sequences of several 
species and sequencing may or may not reveal the presence of all species in a 
band, (b) fragments used in DGGE are typically relatively short (300-1000 bp) 
to give good band resolution and these fragments are often not long enough to 
identify organisms at a species level, and (c) only abundant species generate a 
band because the detection limit for bacteria in DGGE may be as high as 10 6 
cells/g soil (Gelsomino et al. 1999). 

Community composition of eubacteria has been studied by DGGE in the rhizo- 
sphere of different plant species (Duineveld et al. 1998; Marschner and Baumann 
2003; Marschner et al. 2001a, b; Yang and Crowley 2000), soils from different 
ecosystems and geographical regions (Gelsomino et al. 1999), heavy metal-pol- 
luted soils (Kandeler et al. 2000) and hot springs (Ferris et al. 1996). DGGE has 
also been used to assess the community composition of bacterial groups such as 
ammonia oxidizers (Avrahami et al. 2003; Baeckman et al. 2003), sulfate reducers 

Denaturant gradient concentration increases from top 
to bottom of the gel. 

DNA moves downwards through the gel until it 
reaches denaturant concentration at which the double 

strands separate => formation of a band. 
GC-rich sequences are more stable than GC-poor 

sequences => GC-rich sequences migrate further 

down in the gel. 

Banding pattern represents community composition 

of target organisms. 

Each band represents a species or group of species 

with similar melting behaviour. 

Fig. 1 2.1 Example of DGGE profiles of five bacterial communities 

P. Marschner 

(Sass et al. 1998), Desulfovibrio sp. (Wawer and Muyzer 1997) and bacteria with 
nif genes (Piceno and Lovell 2000; Rosado et al. 1998). The community composi- 
tion of fungi (Pennanen et al. 2001; Vainio and Hantula 2000) and actinomycetes 
(Heuer et al. 1997) in soils was also determined by DGGE. 
Comments on DGGE 

For assembling the gel sandwiches and pouring the gel, the reader is referred to 
Chapter 11 or the manual of the DGGE equipment. Here only a few additional 
comments are presented. 

• Given the large variability in community structure, at least four replicates of a 
given treatment/site should be run in the DGGE. 

• It is crucial to ensure that glass plates and spacers are carefully aligned to 
avoid leaking of the gel. 

• Gels should be poured slowly to avoid "smiling" of the gels. 

• For better resolution, it is recommended to let the gels polymerize overnight 
or at least 5-6 h at room temperature. During this period, the gels should be 
kept moist by placing wet paper towel on the top of the gels and covering the 
gels with a plastic bag. 

• Combs with different number of "teeth" are available. Combs with e.g. 20 
"teeth" result in larger wells which are easier to load than small wells (from 
combs with 25 or more "teeth"). 

• For the initial DGGE, a wide gradient (e.g. 25-75%) should be used. This 
selection can be based on the gradient used in the reference from which the 
primers were taken. However, it is recommended to use a wider gradient ini- 
tially because each soil will differ in community structure and hence in range 
of GC content of the amplified region. In the wide gradient the bands will 
usually be concentrated in a certain part of the gel. A narrower gradient can 
then be selected for better separation of the bands. 

• With larger sample numbers it is usually necessary to use more than one gel. 
Since gradient and staining intensity are not identical in different gels, the in- 
fluence of gel on banding patterns can be quite strong and may lead to wrong 
conclusions about treatment effects. To avoid this "gel effect", the different 
replicates of a given treatment/site should be placed on different gels. This 
can be done randomly (when the sample number is very large), or by placing 
only one or two replicates of each treatment on a gel and the other replicates 
on other gels. 

• When more than one gel is used, the band position should be normalized 
with respect to position and intensity (see below). In this case it is important 
to run at least one "standard" in each gel and expressing the position of the 
bands of the sample relative to 3-4 bands in the standard. This standard can 
be a sample, a commercially available base pair ladder or a mix of DNA from 

12. Soil Microbial Community Structure and Function Assessed by FAME 195 

pure cultures. Ideally, the standard should contain at least 3-4 strong bands 
that can be easily identified. 

• Electrophoresis time ranges between 3 h and 18 h, with a higher voltage at 
shorter run times. Band resolution is often better at longer run times and 
lower voltage, but it is recommended to try short and long electrophoresis 
times initially. 

• Gels may be stained with ethidium bromide, Sybr green/gold or silver. Silver 
staining usually results in better band resolution. However, it is more time- 
consuming than the other two staining methods and silver-stained bands 
cannot be sequenced. In order to avoid damage, the gels should always be 
submerged when handling them during staining. 

Data Analysis 

If only a few samples are compared, visual comparison of the samples may be 
sufficient. However, band patterns may be very complex (between 10 and 40 
bands per sample) and visual comparison may be subjective. Therefore it is rec- 
ommended to digitize the band patterns and compare them statistically. 

Digitization involves expressing band position and band intensity in numeri- 
cal values. There is a range of commercially available digitization software. They 
usually allow both manual and automatic band detection and should also in- 
clude the possibility of normalization of the band position relative to that of 
bands in the standard. 

If more than one gel is used, the band position should be normalized with 
respect to position and intensity. 

Normalization of intensity can be done by dividing the intensity of a given 
band by either the average intensity of the sample or the average intensity of the 
gel. In both cases the values may be multiplied by 100, to express them as %. 

Digitized banding patterns can be analyzed by a wide range of statistical 
analysis (e.g. Marschner and Baumann 2003; Marschner et al. 2001a; Yang and 
Crowley 2000), similar to those mentioned above for fatty acid patterns. 

Advantages and Limitations of DGGE 

1. Advantages 

• Rapid assessment of complex communities of target organisms. 

• Banding patterns can be compared visually or after digitization by multivari 
ate analyses. 

• Bands can be excised and sequenced. 

P. Marschner 

Wide range of primers allows studying microbial communities with different 
resolution: kingdoms (e.g. bacteria, fungi), genera (e.g. Pseudomonas, Bacil- 
lus), genes (e.g. nif genes). 

Patterns of expression of certain genes can be compared if mRNA is used as 

2. Limitations 

High detection limit (10 6 cells/g soil), thus only abundant species are de- 

Community complexity can be underestimated as one band may contain sev- 
eral species, or overestimated as one species may form several bands. 
Artifacts due to chimeric double strands (DNA double strands formed by 
two single DNA strands that differ slightly in sequence). 
Length of fragment may not be sufficient to allow species identification by 

Due to PCR step, DGGE is not truly quantitative (see section on PCR above). 
DNA can be bound to soil particles (Cai et al. 2006) where it is protected 
against microbial decomposition. Therefore DGGE profiles may also include 
bands from dead organisms. 

Community composition of target group only, no information about general 
community (as in fatty acid-based methods), unless a large number of differ- 
ent primers are used. 

Fatty acid-based methods such as FAME and PLFA and DNA-based methods 
such as DGGE can provide insights into microbial community composition 
at different scales. Fatty acid profiles reflect the general microbial community 
composition and are quantitative but provide no information on species com- 
position. DNA-based methods have the advantage that the target community 
(kingdom, species, genes) can be selected. However they are not quantitative 
because they rely on gene amplification in PCR. Ideally, fatty acid-based meth- 
ods should be combined with DNA-based methods to provide a comprehensive 
picture of the microbial community. 

Both DGGE and FAME/PLFA can be used to compare soil microbial com- 
munities as affected by, e.g. management or soil type. Undoubtedly, one goal in 
soil microbial ecology is linking community structure and function. However, 
we are still a long way from this goal. To move towards this goal, assessment of 
microbial community structure should be combined with other methods such 
as nutrient analysis, enzyme activity determination and real-time PCR of func- 
tional genes. 

12. Soil Microbial Community Structure and Function Assessed by FAME 197 

Avrahami S, Liesack W, Conrad R (2003) Effects of temperature and fertilizer on activity and 
community structure of soil ammonia oxidizers. Environ Microbiol 5:691-705 

Baath E, Anderson TH (2003) Comparison of soil fungal/bacterial ratios in a pH gradient us- 
ing physiological and PLFA-based techniques. Soil Biol Biochem 35:955-963 

Baath E, Frostegard A, Pennanen T, Fritze H (1995) Microbial community structure and 
pH response in relaton to soil organic matter qualityin wood ash fertilized, clear-cut or 
burned coniferous forest soils. Soil Biol Biochem 27:229-240 

Baeckman JSK, Hermansson A, Tebbe CC, Lindgren PE (2003) Liming induces growth of a 
diverse flora of ammonia- oxidizing bacteria in acid spruce forest soil as determined by 
SSCP and DGGE. Soil Biol Biochem 35:1337-1347 

Bakken LR (1985) Separation and purification of bacteria from soil. Appl Environ Microbiol 

Bardgett RD, Hobbs PJ, Frostegard A (1996) Changes in soil fungal:bacterial biomass ratios 
following reductions in the intensity of management of an upland grassland. Biol Fertil 
Soils 22:261-264 

Blight EG, Dyer WJ (1959) A rapid method of total lipid extraction and purification. Can J 
Biochem Physiol 37:911-917 

Borneman J, Hartin RJ (2000) PCR primers that amplify fungal rRNA genes from environ- 
mental samples. Appl Environ Microbiol 66:4356-4360 

Braid MD, Daniels LM, Kitts CL (2003) Removal of PCR inhibitors from soil DNA by chemi- 
cal flocculation. J Microbiol Methods 52:389-393 

Brim H, Heuer H, Kroegerrecklenfort E, Mergeay M, Smalla K (1999) Characterization of the 
bacterial community of a zinc-polluted soil. Can J Microbiol 45:326-338 

Buyer JS, Drinkwater LE (1997) Comparison of substrate utilisation assay and fatty acid anal- 
ysis of soil microbial communities. J Microbiol Methods 30:3-11 

Buyer JS, Kaufman DD (1996) Microbial diversity in the rhizosphere of corn grown under 
conventional and low-input systems. Appl Soil Ecol 5:21-27 

Cai P, Huang Q, Zhang X, Chen H (2006) Adsorption of DNA on clay minerals and various 
colloidal particles from an alfisol. Soil Biol Biochem 38:471-476 

Chelius MK, Lepo JE (1999) Restriction fragment length polymorphism analysis of PCR- am- 
plified nifH sequences from wetland plant rhizosphere communities. Environ Technol 

Duarte GF, Rosado AS, Seldin L, Cook WA, Van Elsas JD (1998) Extraction of ribosomal 
RNA and genomic DNA from soil for studying the diversity of the indigenous bacterial 
community. J Microbiol Methods 32:21-29 

Duineveld BM, Rosado AS, Van Elsas JD, Van Veen JA (1998) Analysis of the dynamics of 
bacterial communities in the rhizosphere of the chrysanthemum via denaturing gra- 
dient gel electrophoresis and substrate utilization patterns. Appl Environ Microbiol 

Ferris MJ, Muyzer G, Ward DM (1996) Denaturing gradient gel electrophoresis profiles of 
16S rRNA-defined populations inhabiting a hot spring microbial mat community. Appl 
Environ Microbiol 62:340-346 

Frostegard A, Baath E, Tunlid A (1993a) Shifts in the structure of soil microbial communi- 
ties in limed forests as revealed by phospholipid fatty acid analysis. Soil Biol Biochem 

Frostegard A, Tunlid A, Baath E (1993b) Phospholipid fatty acid compostion, biomass, and 
activity of microbial communities from two soil types experimentally exposed to differ- 
ing heavy metals. Appl Environ Microbiol 59:3605-3617 

P. Marschner 

Gagliardi JV, Buyer JS, Angle JS, Russek CE (2001) Structural and functional analysis of 
whole-soil microbial communities for risk and efficiency testing following microbial in- 
oculation of wheat roots in diverse soils. Soil Biol Biochem 33:25-40 

Garbeva P, Van Veen JA, Van Elsas JD (2003) Predominant Bacillus spp. in agricultural soil un- 
der different management regimes detected via PCR-DGGE. Microb Ecol 45:302-316 

Gelsomino A, Keijzer WAC, Cacco G, Van Elsas JD (1999) Assessment of bacterial commu- 
nity structure in soil by polymerase chain reaction and denaturing gradient gel electro- 
phoresis. J Microbiol Methods 38:1-15 

Heuer H, Krsek M, Baker P, Smalla K, Wellington EMH (1997) Analysis of actinomycete 
communities by specific amplification of genes encoding 16S rRNA and gel electropho- 
retic separation in denaturing gradients. Appl Environ Microbiol 63:3233-3244 

Hugenholtz P, Goebel BM, Pace NR (1998) Impact of culture- independent studies on the 
emerging phylogenetic view of bacterial diversity. J Bacteriol 180:4765-4774 

Ibekwe AM, Kennedy AC (1998) Fatty acid methyl ester (FAME) profiles as a tool to investi- 
gate community structure of two agricultural soils. Plant Soil 206:151-161 

Jandl G, Leinweber P, Schulten HR, Ekschmitt K (2005) Contribution of primary organic 
matter to the fatty acid pool in agricultural soils. Soil Biol Biochem 37:1033-1041 

Janssen PH, Yates PS, Grinton BE, Taylor PM, Sait M (2002) Improved culturability of soil bac- 
teria and isolation in pure culture of novel members of the divisions Acidobacteria, Acti- 
nobacteria, Proteobacteria and Verrumicrobia. Appl Environ Microbiol 68:2391-2396 

Kandeler E, Tscherko D, Bruce KD, Stemmer M, Hobbs PJ, Bardgett RD, Amelung W (2000) 
Structure and function of the soil microbial community in microhabitats of a heavy 
metal polluted soil. Biol Fertil Soils 32:390-400 

Klamer M, Baath E (2004) Estimation of conversion factors for fungal biomass determination 
in compost using ergosterol and PLFA 18:2w6,9. Soil Biol Biochem 36:57-65 

Kozdroj J, Van Elsas JD (2000) Application of polymerase chain reaction - denaturing gradi- 
ent gel electrophoresis for comparison of direct and indirect methods of soil DNA used 
for microbial community fingerprinting. Biol Fertil Soils 31:372-378 

Kuske CR, Banton KL, Adorada DL, Stark PC, Hill KK, Jackson PJ (1998) Small-scale DNA 
sample preparation method for field PCR detection of microbial cells and spores in soil. 
Appl Environ Microbiol 64:2463-2472 

Marschner P, Baumann K (2003) Changes in bacterial community structure induced by my- 
corrhizal colonisation in split-root maize. Plant Soil 251:279-289 

Marschner P, Crowley DE, Lieberei R (2001a) Arbuscular mycorrhizal infection changes the 
bacterial 16S rDNA community composition in the rhizosphere of maize. Mycorrhiza 

Marschner P, Yang CH, Lieberei R, Crowley DE (2001b) Soil and plant specific effects on bac- 
terial community composition in the rhizosphere. Soil Biol Biochem 33:1437-1445 

Marschner P, Kandeler E, Marschner B (2003) Structure and function of the soil microbial 
community in a long-term fertilizer experiment. Soil Biol Biochem 35:453-461 

Marschner P, Solaiman MZ, Rengel Z (2005) Growth, phosphorus uptake, and rhizosphere 
microbial community composition of a phosphorus- efficient wheat cultivar in soils dif- 
fering in pH. J Plant Nutr Soil Sci 168:343-351 

Muyzer G, Smalla K (1998) Application of denaturing gradient gel electrophoresis (DGGE) 
and temperature gradient gel electrophoresis (TGGE) in microbial ecology. Antonie van 
Leeuwenhoek 73:127-141 

Muyzer G, De Waal EC, Uitterlinden AG (1993) Profiling of complex microbial populations 
by denaturing gradient gel electrohphoresis analysis of polymerase chain reaction- am- 
plified genes coding for 16S rRNA. Appl Environ Microbiol 59:695-700 

Olsson PA, Baath E, Jakobsen I (1997) Phosphorus effects on the mycelium and storage struc- 
tures of an arbuscular mycorrhizal fungus as studied in the soil and roots by analysis of 
fatty acid signatures. Appl Environ Microbiol 63:3531-3538 

12. Soil Microbial Community Structure and Function Assessed by FAME 199 

Olsson PA, Francis R, Read DJ, Soderstrom B (1998) Growth of arbuscular mycorrhizal my- 
celium in calcareous dune sand and its interaction with other soil microorganisms as 
estimated by measurement of specific fatty acids. Plant Soil 201:9-16 

Pankhurst CE, Yu S, Hawke BG, Harch BD (2001) Capacity of fatty acid profiles and substrate 
utilisation patterns to describe differences in soil microbial communities associated with 
increased salinity or alkalinity at three locations win South Australia. Biol Fertil Soils 

Pennanen T, Fritze H, Vanhala P, Kiikkila O, Neuvonen S, Baath E (1998) Structure of the mi- 
crobial community in soil after prolonged addition of low levels of simulated acid rain. 
Appl Environ Microbiol 64:2173-2180 

Pennanen T, Paavolainen L, Hantula J (2001) Rapid PCR-based method for the direct 
analysis of fungal communities in complex environmental samples. Soil Biol Biochem 

Piceno YM, Lovell CR (2000) Stability in natural bacterial communities. I. Nutrient addition 
effects on rhizosphere diazotroph assemblage composition. Microb Ecol 39:32-40 

Rosado AS, Duarte GF, Seldin L, Van Elsas JD (1998) Genetic diversity of nifH gene se- 
quences in Paenibacillus azotofixans strains and soil samples analysed by denaturing 
gradient gel electrophoresis of PCR- amplified gene fragments. Appl Environ Microbiol 

Sass H, Wieringa E, Cypionka H, Babenzien HD, Overmann J (1998) High genetic and physi- 
ological diversity of sulfate-reducing bacteria isolated from an oligotrophic lake sedi- 
ment. Arch Microbiol 170:243-251 

Sullivan TS, Stromberger ME, Paschke MW (2006) Parallel shifts in plant and soil micro- 
bial communities in response to biosolids in a semi-arid grassland. Soil Biol Biochem 

Torsvik V, Salte K, Sorheim R, Goksoyr J (1990) Comparison of phenotypic diversity and 
DNA heterogeneity in a population of soil bacteria. Appl Environ Microbiol 56:776-781 

Vainio EJ, Hantula J (2000) Direct analysis of wood-inhabiting fungi using denaturing gradi- 
ent gel electrophoresis of amplified ribosmomal DNA. Mycol Res 104:927-936 

Watanabe K, Kodama Y, Harayama S (2001) Design and evaluation of PCR primers to am- 
plify bacterial 16S ribosomal DNA fragments used for community fingerprinting. J Mi- 
crobiol Methods 44:253-562 

Wawer C, Muyzer G (1997) Genetic diversity of Desulfovibrio spp in environmental samples 
analyzed by denaturing gradient gel electrophoresis of (NiFe) hydrogenase gene frag- 
ments. Appl Environ Microbiol 61:2203-2210 

Wechter P, Williamson }, Robertson A, Kluepfel D (2003) A rapid, cost-effective procedure 
for the extraction of microbial DNA from soil. World J Microbiol Biotechnol 19:85-91 

White DC (1993) In situ measurement of microbial biomass, community structure and nutri- 
tional status. Philos Trans R Soc Lond B 344:59-67 

White DC, Davis WM, Nickels JS, King JC, Bobbie RJ (1979) Determination of the sedimen- 
tary microbial biomass by extractable lipid phosphate. Oecologia 40:51-62 

White DC, Stair JO, Ringelberg DB (1996) Quantitative comparisons of in situ microbial bio- 
diversity by signature biomarker analysis. J Ind Microbiol 17:185-196 

Widmer F, Seidler RJ, Gillevet PM, Watrud LS, Di Giovanni GD (1998) A highly selective 
PCR protocol for detecting 16S rRNA genes of the genus Pseudomonas (sensu stricto) in 
environmental samples. Appl Environ Microbiol 64:2445-2453 

Wintzigerode F, Gobel UB, Stackebrandt E (1997) Determination of microbial diversity in 
environmental samples: pitfalls of PCR-based rRNA analysis. FEMS Microbiol Rev 

Yang CH, Crowley DE (2000) Rhizosphere miccrobial community structure in relation to 
root location and plant iron nutritional status. Appl Environ Microbiol 66:345-351 

P. Marschner 

Zak DR, Pregnitzer KS, Curtis PS, Holmes WE (2000) Atmosperic C0 2 and the composition 

and function of soil microbial communities. Ecol Appl 10:47-59 
Zak JC, Willig MR, Moorhead DL, Wildman HG (1994) Functional diversity of microbial 

communities: a quantitative aproach. Soil Biol Biochem 26:1101-1108 
Zelles L, Rackwitz R, Bai QY, Beck T, Beese F (1995) Discrimination of microbial diversity by 

fatty acid profiles of phospholipids and lipopolysaccharides in differently cultivated soils. 

Plant Soil 170:115-122 

Measurement of Microbial Biomass 
and Activity in Soil 

Z. Solaiman 

Soil acts as a growth medium and can provide several biological functions such 
as transforming, storing and cycling energy-rich organic compounds. Soil mi- 
crobial biomass is one of the most important soil biological properties. It regu- 
lates many critical processes in ecosystems, such as the biophysical integration 
of organic matter with soil solid, aqueous and gaseous phases. It also becomes 
vital in regulating the quantity and quality of components in the hydrologic cy- 
cle and in greenhouse gas emissions. The measurement of microbial biomass is 
useful for describing biomass turnover in different ecosystems. Several methods 
are used today to study soil microbial biomass. Among them the substrate-in- 
duced respiration and the fumigation -extraction methods are used frequently 
for biomass determination (Machulla 2003). 

The best indicator of the whole metabolic activity of soil microbial popula- 
tions is soil respiration, a robust parameter that can be rapidly and reproducibly 
determined. It allows gross comparisons of soils and reflects soil management 
changes, or the impact of elevated atmospheric C0 2 on soil microorganisms 
(Machulla 2003). In addition to microbial biomass and soil respiratory activity, 
soil enzymes can be determined. Enzymes in soil act as transformation agents 
for organic substances like cellulose, lignin, sugar and amino acids. Soil enzymes 
are mostly of microbial origin and are closely related to microbial biomass. Vari- 
ous enzymes have been measured for their suitability in soil investigations. This 
method was normally selected based on the specific element of interest such as 

Zakaria Solaiman: School of Earth and Environmental Sciences, The University of Adelaide, 
SA 5005, Australia; Present address: School of Earth and Geographical Sciences, 
The University of Western Australia, Crawley, WA 6009, Australia, 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

Z. Solaiman 

C, N or P. Dehydrogenase is one of the most frequently used enzyme tests for 
the measurement of total microbial activity in soil. 

Protocols for Microbial Biomass Determination 

The measurement of soil microbial biomass is one of the most accurate proce- 
dures used for a better understanding of the nutrient cycle in soil. Soil organic 
matter is the vital source of energy for microorganisms. It can be pooled into 
several fractions that vary in turnover time. The active fraction of organic mat- 
ter consists of amino acids, proteins and carbohydrates, representing that small 
but dynamic portion of the huge and slowly changing background of stabile or- 
ganic matter. This labile pool is readily available for microbial use and is mostly 
stored by soil microorganisms. A portion of such kind of organic substances 
can be quantified as an indicator of the actual amount of microbial populations. 
Thus, there has been increasing interest for definite measurements of the soil 
microbial biomass and several methods have been attempted to provide more 
accurate and useful procedures for microbial biomass measurements. 

Chloroform Fumigation-Extraction Method 
for Microbial Biomass C and N 

Here I outline microbial biomass C and N measurement by the fumigation -ex- 
traction procedure according to Vance et al. (1987) with some modifications. 
This chloroform fumigation -extraction method is theoretically based on the 
quantitative extraction of C and N held in the microbial biomass. The method 
outlined here is very commonly used due to its simplicity and applicability for a 
wide group of soils. In addition, various organic forms such as soluble free sug- 
ars, carbohydrates and proteins can also be measured in the same extracts (Jo- 
ergensen et al. 1996). Ninhydrin, which is a reagent forming a purple complex 
with various molecules, such as amino acids, peptides and proteins (Moore and 
Stein 1948), has been lately used as a simple an reliable parameter in microbial 
biomass determinations (Joergensen and Brookes 1990). 

Following soil fumigation with alcohol-free chloroform, a group of samples 
is extracted with 0.5 M K 2 S0 4 ; and C, extractable ninhydrin-reactive N, total N 
and NH4 N can be determined in fumigated and non-fumigated K 2 S0 4 extracts. 
One of the advantages of this method is that it can determine microbial biomass 
C and N in the same soil extract. With this technique it is necessary to use either 
chloroform with low levels of amylene as the stabilising agent or chloroform 

13. Measurement of Microbial Biomass and Activity in Soil 203 

with ethanol as the stabilising agent (in the latter case, you need to separate the 
ethanol out first to remove carbon contamination). 

Spectrophotometer, TOC analyser. 

Alcohol-free chloroform, 0.5 M K 2 S0 4 . 

To produce alcohol-free chloroform: place 300 ml chloroform in a beaker, 
add a stirring bar, place on the stir-heater in a fume hood and heat carefully to 
65 °C or until just below boiling, then boil for 5-10 min, allow the chloroform 
to cool, pour it into a dark glass bottle and store it in the refrigerator. 

Protocol for Extraction 

1. Prepare samples from freshly collected soil (0-10 cm) after removing large 
pieces of plant material before pre-treatment. 

2. Pass all samples through a 2-mm sieve, adjust water-holding capacity to 45- 
50%, pre-incubate at 25 °C for 1 week and store at 4 °C before analysis. 

3. Weigh 20 g (dry weight equivalent) soil into a glass beaker (50 ml) and label 
(using masking tape and a pencil). The chloroform may cause the marker 
pens to run out, so it is best to use a pencil. 

4. Put into the dessicator, add some wet paper in the base to keep humidity up 
and to stop soil drying out, then add your glass beakers with soil and then 
add the chloroform in another beaker. 

5. To ensure it boils quickly but not too vigorous, add approximately 30 ml 
chloroform to a 50 ml glass beaker containing some anti-bumping granules 
(at a big pinch, they can be re-used). 

6. Place the 50-ml beaker containing chloroform and anti-bumping granules 
into a larger glass beaker (250 ml) that contains a little hot water. Do not put 
in too much as you do not want the water to flood into the 50-ml beaker. If 
the water and chloroform mix you will get very violent bubbling, which is 
likely to go over the soil. Then seal dessicator and apply a vacuum so that the 
chloroform boils for about 2 min. 

Z. Solaiman 

7. Leave sealed dessiccator for 5-10 min, then re-apply the vacuum for a couple 
more minutes of boiling (just to ensure a good fumigation). Then seal des- 
sicator and store at 22 °C or 25 °C (there are correction factors for these tem- 
peratures) for 24 h. 

8. Extract the soil with 80 ml of 0.5 M K 2 S0 4 for 20 g fumigated soil; and use 
deionised water-washed Whatman No. 42 filter papers (and also discard the 
first 5-10 ml of extract). Add one similar non-fumigated soil extraction on 
the first day. Keep some blanks of the 0.5 M K 2 S0 4 that passed through the 
filter paper. If there is a high carbon background, then it may be necessary to 
acid-wash all new plastic ware, including storage vials. The extracts can be 
stored at -20 °C before analysis. 

Measurement of Microbial Biomass C and N 

Microbial biomass C can be analysed by TOC analyser and microbial biomass 
N either by persulfate digestion on an autoanalyser or by ninhydrin-positive 
compounds on a heating block using a spectrophotometer. 

Extractable C in soil extracts could be measured with an automated carbon 
analyser. Organic C determination can be accelerated simply by using combus- 
tion, oxidation and infrared ray absorption processes (Shibara and Inubushi 
1995; Wuetal. 1990). 

Ninhydrin- reactive nitrogen can be determined in soil extracts, following Jo- 
ergensen and Brookes (1990). Measure absorbance colorimetrically at 570 nm 
after the addition of ninhydrin solution (Turgay and Haraguchi 2000). 

Measure extractable total N by the total persulfate oxidation procedure. This 
is based on the oxidation of total N to N0 3 -N in alkali at elevated temperature by 
using persulfate as described by Cabrera and Beare (1993). The total N oxidised 
to N0 3 -N is reduced to N0 2 -N within a copperised cadmium reduction unit 
and can be measured according to the modified Gries-Ilosvay method (Keeney 
and Nelson 1982). The determination of extractable NH 4 -N colorimetrically in 
soil extracts is based on the original indophenol blue procedure (Alef and Nan- 
nipieri 1995). 

Calculation of Microbial Biomass C and N 

The C and N flush due to fumigation can be calculated from the difference be- 
tween the C and N content in fumigated and in non-fumigated samples. Factors 
to convert the flush into biomass (flush*factor) can be found in the literature 
(Sparling and Zhu 1993; Wu et al. 1990). 

Biomass C (BC) can be calculated as indicated by Wu et al. (1990): 

BC = EC: kEC, 

13. Measurement of Microbial Biomass and Activity in Soil 205 

where EC = [(extractable C in fumigated soil extracts) - (extractable C in 
non-fumigated soil extracts)] and kEC = 0.45 (extractable part of microbial C 
after fumigation). 

Biomass N can be calculated according to Jenkinson (1988): 

BN = EN: kEN, 

where EN = [(total N, determined in fumigated extracts) - (total N, deter- 
mined in non-fumigated soil extracts)] and kEN = 0.45 (extractable part of mi- 
crobial N after fumigation). 

Biomass ninhydrin -reactive N (BNRN) and extractable NH4 + -N (ENH4) can 
be calculated based on the same principle of the fumigation extraction method 
as (Joergensen and Brooke 1990; Turgay and Haraguchi 2000): 

BNRN = [(ninhydrin-N in extracts of fumigated soils) - (ninhydrin-N in ex- 
tracts of non-fumigated soils)] 

ENH4 = [(NH4 + -N in extracts of fumigated soils) - (NH4 + -N in extracts of 
non-fumigated soils)]. 

Hexanol Extraction Method for Microbial P 

The principle of the hexanol extraction method is essentially the same as the 
fumigation extraction method proposed by Brookes et al. (1982) and latter by 
Kouno et al. (1995), except that gas/liquid chloroform is used. The P in the mi- 
crobial biomass P is solubilised by hexanol and then extraction is carried out 
by distilled water. Soil microbial biomass P is estimated from the amount of P 
absorbed by resin membranes after elution with NaCl/HCl solution. 

Equipment and Materials 

Balance, dispenser, horizontal shaker, photometer, polyethylene tubes (50 ml). 

Fresh soil samples (or moist samples stored at 4 °C), from which large pieces 
of organic matter and roots have been removed. 

1. Anion-exchange resin membranes BDH 55164 2S (BDH Laboratory Sup- 
plies, Poole, UK). Cut each sheet (supplied as 12x12 cm sheets) into 12 strips, 
approximately 6x2 cm each. 

Z. Solaiman 

2. 0.1 M NaCl/HCl (29.22 g NaCl, 49.1 ml HC1 in 5 1 H 2 0), 0.5 M NaHC0 3 , 
hexanol, P standard solution. 

3. Colour reagent for P determination following Murphy and Riley (1962). This 
reagent must not show any trace of blue colour (Murphy and Riley 1962). 

Protocol for Extraction 

The method of measurement of microbial biomass P in soil outlined here is 
based on the fumigation -extraction method of Kouno et al. (1995) in which 
chloroform is used as a fumigant. Instead of liquid chloroform as suggested by 
Kouno et al. (1995), we use hexanol because chloroform may dissolve the anion- 
exchange membranes, which would change the composition of the membrane 
(Else Bunemann, personal communication). Hexanol has been shown to be as 
effective a fumigant as chloroform (McLaughlin et al. 1986). We also use 0.1 M 
NaCl/HCl to elute P from the resin strips as it is efficient and is less acidic than 
0.5 M HC1, thus creating fewer problems with photometric P measurement. 
Protocol to prepare resin strips to make bicarbonate form: 

1. Shake resin strips for 1 h in 0.5 M HC1 to remove any remaining P and wash 
with distilled water. 

2. Shake for 1 h in 0.5 M NaHC0 3 (prepare freshly) and wash with water. 

3. Shake for 1 h in 0.5 M NaHC0 3 , leave in NaHC0 3 . 

4. Wash 3 times with water, put in water before use. 

5. Weigh moist soil equalising 2 g dry soil into tubes. 

6. Add 30 ml water to all samples. 

7. Add one resin strip (6x2 cm) per sample. 

8. Add 1 ml hexanol (1 -hexanol) to the samples that are to be fumigated. 

9. Add 1 ml of a P solution containing 20 (ig/ml P to samples for sorption cor- 

10. Include also blanks with H 2 only (no soil) or H 2 plus P spike. 

11. Shake horizontally for 16 h. 

12. Rinse resin strips with H 2 0, remove adhering water by shaking, put strips 
into a clean vial. 

13. Add 30 ml of 0.1 M NaCl/HCl; allow at least 30 min in the fumehood to 

14. Shake for 2 h to elute P from resin membrane. 

15. Take out resin strips and store resin in HC1. 

Measurement of Microbial Biomass P 

Measure P concentration in NaCl/HCl elute (e.g. 0.4 ml sample + 2 ml H 2 + 0.5 ml 
Murphy and Riley colour reagent) in spectrophotometer at 712 nm or 880 nm. 

13. Measurement of Microbial Biomass and Activity in Soil 207 

Calculation of Microbial Biomass P 

The P flush due to fumigation can be calculated from the difference between 
available P content in fumigated and in non-fumigated samples. Factors to con- 
vert the flush into biomass (flush*factor) can be found in the literature (Kouno 
et al. 1995). The P content in fumigated samples is corrected by using a sorp- 
tion curve between non-fumigated (no P added) and P-spiked samples (known 
amount of P added, chosen in the range of expected hexanol-labile P). Check 
linearity of sorption curve with a range of different P spikes, using single P spike 
if sorption curve is linear. 

Protocol for Total Microbial Activity Determination 

A sensitive and rapid method for the measurement of total microbial activity 
using fluorescein diacetate (FDA) is described here, after Adam and Duncan 
(2001), modified from Schnurer and Rosswall (1982). FDA hydrolysis is widely 
accepted as an accurate and simple method for measuring total microbial ac- 
tivity in a range of soils. Colourless FDA is hydrolysed by both free and mem- 
brane-bound enzymes, releasing a coloured end-product fluorescein which can 
be measured by spectrophotometry. The advantage of this method is that it is 
simple, rapid and sensitive. Note: some part of this protocol was copied from 
Adam and Duncan (2001), with permission from Elsevier. 

1. Potassium sulfate buffer, 60 mM, pH 6.0: dissolve 8.7 g K 2 HP0 4 and 1.3 g 
KH 2 P0 4 in approximately 800 ml deionised water. Make volume up to 11 
with deionised water. Store in 4 °C fridge and check pH on day of use. 

2. Chloroform/methanol (2:1): take 666 ml chloroform into a 1-1 volumetric 
flask. Then make volume to 1 1 with methanol and mix content thoroughly. 

Z. Solaiman 

3. FDA stock solution (1000 ug/ml): dissolve 0.1 g fluorescein diacetate (3 '6'- 
diacetyl-fluorescein; Sigma-Aldrich Co.) in approximately 80 ml of acetone 
and make volume to 100 ml with acetone. Store solution at -20 °C. 

4. Fluorescein stock solution (2000 |ig/ml): dissolve 0.2265 g fluorescein sodium 
salt in approximately 80 ml of 60 mM potassium phosphate buffer, pH 7.6, 
and then make up to 100 ml with buffer. 

5. Fluorescein standard solution (20 |ig/ml): add 1 ml of stock solution (2000 |ig/ 
ml) to a 100-ml volumetric flask and then make up to 100 ml with 60 mM 
potassium phosphate buffer, pH 7.6. 

6. Standard curve: prepare standard curve 1-5 (ig/ml from 20 (ig/ml standard so- 
lution by appropriate dilution in 60 mM potassium phosphate buffer, pH 7.6. 

Protocol for Extraction 

1. Weigh 2 g of moist soil (sieved <2 mm) into a 50-ml conical flask. 

2. Add 15 ml of 60 mM potassium phosphate buffer, pH 7.6. 

3. Add 0.2 ml of 1000 (ig/ml FDA stock solution to start the reaction; prepare 
blanks without the addition of FDA substrate. 

4. Put stoppers on the flasks and shake contents by hand. Then place flasks in an 
orbital incubator (100 rpm) at 30 °C for 20 min. 

5. Add 15 ml of chloroform/methanol (2:1, v/v) immediately to terminate the 
reaction (should be done in a fume cupboard). 

6. Transfer contents to 50-ml centrifuge tubes and centrifuge at 2000 rpm for 
approximately 3 min. 

7. Filter supernatant (Whatman No. 42) into 50-ml conical flasks, then measure 
at 490 nm on a spectrophotometer. 

8. Calculate the concentration of fluorescein using standard curve and express 
as (j.g/g fluorescein oven-dry soil. 

Protocol for Soil Dehydrogenase Enzyme Analysis 

Soil enzymes play an important role by catalysing many reactions and have po- 
tential as an indicator of microbial activity in soils. Dehydrogenases are oxido- 
reductase enzymes that take part in respiration in microbial cells (Mosher et al. 
2003). Dehydrogenase activity can be measured by reduction of 2,3,5-triphe- 
nyltetrazolium chloride (INT) to a red-coloured iodonitrotetrazolium forma- 
zan (INTF), which can be measured by a colorimetric method (Friedel et al. 
1994). A simple assay is outlined here, after von Mersi and Schinner (1991) and 
Mathew and Obbard (2001) with some modifications. 

13. Measurement of Microbial Biomass and Activity in Soil 209 

1. 2,3,5-Triphenyl tetrazolium chloride (INT): dissolve 500 mg of INT in 2 ml of 
dimethylformamide, make-up the volume to 100 ml with 0.1 M Tris/HCl buf- 
fer (pH 7.9) and dissolve in an ultrasonic bath (von Mersi and Schinner 1991). 

2. Iodonitro tetrazolium formazan (INTF): prepare standard curve using 
0-24 ng/ml INTF. 

Protocol for Extraction 

1. Collect soil cores of 0-15 cm, air-dry, sieve through 2 mm, homogenise, anal- 
yse on same day or keep at 4 °C for a short period of time before analysis. 

2. Weigh 5 g of soil into a 50-ml screw-cap centrifuge tube and add 2.5 ml of 
deionised water. 

3. Add 1 ml of Tris/INT to start the reaction; prepare blanks without the addi- 
tion of INT substrate. 

4. Cap the tubes and place them in an orbital incubator (100 rpm) at 40 °C for 
2 h in the dark. 

5. Add 10 ml of extracting solution (dimethylformamide:ethanol in a 1:1 ratio). 

6. To extract the developed INTF, keep samples in the dark for 1 h, shake vigor- 
ously every 20 min and filter solution with Whatman No. 42. 

7. Measure the INTF in filtrate on a spectrophotometer at 464 nm in the dark as 
tetrazolium compound is light-sensitive. 

8. Calculate the concentration of INTF using standard curve and express as |ig 
INTF/g oven dry soil. 

Measurement of microbial biomass and activity is essential to investigate the 
functions of a microbial community. These approaches have the resolution to 

Z. Solaiman 

get a comprehensive view of various stages of microbial community changes 
due to anthropogenic disturbances or sustainable farming systems. While pro- 
tocols are briefly outlined here, the reader should consult the references listed 
for greater exploration of the techniques. 

Adam G, Duncan H (2001) Development of a sensitive and rapid method for the measure- 
ment of total microbial activity using fluorescein diacetate (FDA) in a range of soils. Soil 
Biol Biochem 33:943-951 

Alef K, Nannipieri P (1995) Soil nitrogen. In: Alef K, Nannipieri P (eds) Methods in applied 
soil microbiology and biochemistry. Academic, London, pp 79-87 

Brookes PC, Powlson DS, Jenkinson DS (1982) Measurement of microbial biomass phospho- 
rus in soil. Soil Biol Biochem 14:319-329 

Cabrera MR, Beare MH (1993) Alkaline persulphate oxidation for determining total nitrogen 
in microbial biomass extracts. Soil Sci Soc Am J 57:1007-1012 

Friedel JK, Molter K, Fischer WR (1994) Comparison and improvement of methods for de- 
termining soil dehydrogenase activity by using triphenyltetrazolium chlorite. Biol Fertil 
Soils 18:291-296 

Jenkinson DS (1988) Determination of microbial biomass carbon and nitrogen in soil. In: 
Wilson JR (ed) Advances in nitrogen cycling in agricultural ecosystems. CAB Interna- 
tional, Wallingford, pp 368-386 

Joergensen RG, Brookes PC (1990) Ninhydrin reactive nitrogen measurements of microbial 
biomass in 0.5 M K 2 S0 4 soil extracts. Soil Biol Biochem 22:1023-1027 

Joergensen RG, Mueller T, Volkmar W (1996) Total carbohydrates of the soil microbial bio- 
mass in 0.5 M K2S04 soil extracts. Soil Biol Biochem 28:1147-1153 

Keeney DR, Nelson MH (1982) Nitrogen - inorganic forms In: Page AL, Miller DR, Keeney 
DR (eds) Methods of soil analysis, part 2, chemical and microbiological methods. ASA/ 
SSSA, Madison, pp 643-698 

Kouno K, Tuchiya Y, Ando T (1995) Measurement of soil microbial biomass phosphorus by 
an anion exchange membrane method. Soil Biol Biochem 27:1353-1357 

Machulla G (2003) Soil microbial indicators and their environmental significance. J Soil Sedi- 
ment 3:229 

Mathew M, Obbard JP (2001) Optimisation of the dehydrogenase assay for measurement of 
indigenous microbial activity in beach sediments contaminated with petroleum. Bio- 
technol Lett 23:227-230 

McLaughlin MJ, Alston AM, Martin JK (1986) Measurement of phosphorus in the soil mi- 
crobial biomass: a modified procedure for field soils. Soil Biol Biochem 18:437-443 

Mersi W von, Schinner F (1991) An improved and accurate method for determining the 
dehydrogenase activity in soils with iodonitrotetrazolium chloride. Biol Fertil Soils 

Moore S, Stein WH (1948) Photometric ninhydrin method for use in chromatography of 
amino acids. J Biol Chem 243:6281-6283 

Mosher JJ, Levison BS, Johnston CG (2003) A simplified dehydrogenase enzyme assay in 
contaminated sediment using 2-(p-iodophenyl)-3(p-nitrophenyl)-5-phenyl tetrazolium 
chloride. J Microbiol Methods 53:411-415 

Murphy J, Riley JP (1962) A modified single solution method for the determination of phos- 
phate in natural waters. Anal Chem Acta 27:31-36 

13. Measurement of Microbial Biomass and Activity in Soil 211 

Schnurer J, Rosswall T (1982) Fluorescein diacetate hydrolysis as a measure of total microbial 
activity in soil and litter. Appl Environ Microbiol 43:1256-1261 

Shibara F, Inubushi K (1995) Measurement of microbial biomass C and N in paddy soils by 
the fumigation- extraction method. Jpn J Soil Sci Plant Nutr 41:681-689 

Sparling GP, Zhu C (1993) Evaluation and calibration of methods to measure microbial bio- 
mass C and N in soils from Western Australia. Soil Biol Biochem 25:1793-1801 

Turgay OC, Haraguchi A (2000) Different indices in soil microbiological activities: measure- 
ments of soil microbial biomass carbon, nitrogen and NRN. Proc Int Symp Desertifica- 
tion 2000 

Vance ED, Brookes PC, Jenkinson DS (1987) An extraction method for measuring soil mi- 
crobial biomass. Soil Biol Biochem 19:703-707 

Wu J, Joergensen RG, Pommerening B, Chaussod R, Brookes PC (1990) Measurement of 
soil microbial biomass C by fumigation- extraction - an automated procedure. Soil Biol 
Biochem 22:1167-1169 

I mmu no-Technology for the Localization 
of Acid Phosphatase Using Native Gel 
Bands in Piriformospora indica and Other 
Soil Microorganisms 

R. Malla, U. Pokharel, R. Prasad, R. Oelmuller, and A. Varma 

Piriformospora indica a newly discovered model endophyte, has been shown to 
transfer phosphate (P) from the external medium into the roots of the plants 
(Varma et al. 2000, 2004; Malla et al. 2002). The axenic cultivability of this fun- 
gus provides an opportunity to study the enzyme involved in phosphate meta- 
bolism, purification and the biochemical and immunological characterization 
of this enzyme, including a comparative study in isozyme polymorphism, the 
use of tools like two-dimensional PAGE and molecular markers like random 
amplified polymorphic DNA (RAPD) to establish the variability between P. in- 
dica and the closely related organism Sebacina vermifera. 

Taxonomic Status 

Proteomics and genomics data about this fungus were recently presented (Pes- 
kan et al. 2004; Kaldorf et al. 2005; Shahollari et al. 2005). Extrapolating from 
known rDNA sequences in the Sebacinaceae, it is evident that there is a cosm 

Utprekshya Pokharel: Department of Microbiology, Punjab University, Chandigarh, India 

Ralf Oelmueller: Institute of General Botany, Department of Environmental Sciences, 
University of Jena, Dornburger Street 159, D07743, Jena, Germany 

Ram Prasad; Ajit Varma: Amity Institute of Microbial Science, Amity University, Uttar 
Pradesh, Sector-125, Noida, Uttar Pradesh, India 

Rajani Malla: Department of Microbiology, Tri-Chandra Campus, Tribhuvan University, 
Kathmandu, Nepal, Tel: 009771-4670857, 00977-9851013734, 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmuller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

R. Malla, et al. 

of mycorrhizal biodiversity yet to be discovered in this group. Taxonomically, 
the Sebacinaceae is recognized within a new order, the Sebacinales (Weifi et al. 
2004). The order primarily contains the genera Sebacina, Tremelloscypha, Efibu- 
lobasidium, Craterocolla and Piriformospora. 

Phosphatases play an important role in the P metabolism of the organism by 
hydrolysis of polyP and organic phosphates (Pasqualini et al. 1992). Phospha- 
tases are enzymes of wide specificity, which cleave phosphate ester bonds, and 
this plays an important role in the hydrolysis of polyP and organic phosphates. 
In fungi, these phosphatases may be located in the periplasmic space, cell wall, 
vacuoles and culture medium. Acid and alkaline phosphatases are the two forms 
of active phosphatase. Alkaline phosphatase (ALPase) occurs in roots mainly af- 
ter mycorrhizal colonization and has been proposed as a marker for analyzing 
the symbiotic efficiency of root colonization (Tisserant et al. 1993). However, 
the purification of enzyme has so far been unsuccessful (Kojima et al 2001). 
Extra- and intracellular phosphatases are responsible for the hydrolysis of vari- 
ous forms of phosphates, including complex and insoluble phosphates. Acid 
phosphatase (ACPase) has been found to be mainly involved in the uptake of P 
by fungal mycelia and ALPase is linked with its assimilation (Fries et al. 1998). 
ACPase in soil originates from both plants and fungi, while ALPase is believed 
to be of purely microbial origin (Gianinazzi-Pearson and Gianinazzi 1978; 
Tarafdar and Rao 1996). Studying ACPases is difficult due to their multiform 
occurrence in organisms, their relative nonspecificity, small quantity and their 
instability in dilute solution. Their study is also complicated by wide variations 
in the activity and property of isozyme between species and between different 
developmental stages (Alves et al. 1994). 

Acid Phosphatase 

Extracellular ACPase is usually localized in the cell wall, outer surface of root 
epidermis cells and the root apical meristem. Intracellular ACPase appears to be 
much less stable than extracellular forms, which remain stable for hours to days 
(Miller et al. 2001). In plants ACPases activity is increased by salt and osmotic 
stress (Ehsanpour and Amini 2003). 

The first truly secreted ACPase gene to be characterized was from Arabidopsis 
(AtsAPase; Haran et al. 2000). sAPase, the white lupin ACPase, is a glycoprotein. 

14. Localization of ACPase 

Protein blots probed with antibodies for sAPase showed rapid accumulation of 
the protein in P-deficient roots accompanied by secretion into the rhizosphere 
(Miller etal. 2001). 

Alkaline Phosphatase 

Alkaline phosphatase occurs in roots mainly after mycorrhizal colonization and 
has been proposed as a marker for analyzing the symbiotic efficiency of my- 
corrhizal colonization (Tisserant et al. 1993). ALPase is active in alkaline con- 
ditions; and ALPase activity is shown to increase sharply prior to mycorrhizal 
stimulation of plant growth and then to decline as the mycorrhizal colonization 
ages and P accumulates within the host. Saito (1997) found that ALPase activity 
is localized in the arbuscular hyphae of Gigaspora margarita and that glucose 
is one of the carbon sources from host plant to arbuscular mycorrhizal (AM) 
fungi. Phosphate efflux from the fungi to the host plant at arbuscules is sup- 
ported by the recent discovery of novel plant P t transporters that are localized 
around arbuscules and acquire Pj from the fungi (Rausch et al. 2001; Harrison et 
al. 2002; Paszkowski et al. 2002). 

Purification of this enzyme has so far been unsuccessful (Kojima et al. 2001); 
and little is known about the enzymatic characteristics of the ALPase in AM 
fungi. The AM ALPase is expressed under symbiotic conditions and it may have 
a role in nutrient exchange with host plants rather than in nutrient uptake from 
the rhizosphere (Aono et al. 2004). However, the function of arbuscular ALPase 
in symbiosis is still little known, and cloning of the enzyme may shed light on its 
unknown function. A cDNA clone showing similarity to the yeast ALPase gene, 
PH08 (Keneko et al. 1987), was found in an expressed sequence-tagged (EST) 
library constructed from the extraradical hyphae of Glomus intraradices. Using 
this clone, Aono et al. (2004) cloned the ALPase gene from the AM fungi Gl. 
intraradices and GL margarita for the first time. 

Acid Phosphatases in P. indica 

The fungus P. indica produces only one form of intracellular ACPase irrespec- 
tive of the phosphate concentration. The enzyme is possibly a constitutive en- 
zyme showing a molecular mass of 66 kDa, as separated by SDS-PAGE (Malla 
et al. 2004). The enzyme shows the pH and temperature optima of 5.3 and 40 °C, 
respectively. The K m forp-NPP (monoester) is 0.35 mM. Antibodies were raised 
against cytosolic ACPase, and using a gel band in native PAGE after selective 

R. Malla, et al. 

precipitation with ammonium sulfate, followed by gel filtration and ion ex- 
change chromatography, gave sufficient quantities of antibodies based on im- 
munoblot analysis. Its reaction with native protein as well as denatured protein 
is significant. The antibody immuno -precipitates a single band of approximately 
66 kDa protein in SDS gel. The antiserum localized the enzyme on the vacuoles, 
cell wall and cytoplasm of the mycelium, indicating the possible sites of phos- 
phate metabolism (Malla and Varma 2004). 

Immunotechnology for the Detection 

and Localization of Acid Phosphatase in P.indica 

Extraction of Protein and Enzyme Assay 

1 . Materials and equipment 

Hill and Kafer medium, centrifuge, spectrophotometer. 

2. Reagents and solutions 

Disodium P-nitro phenyl phosphate (Sigma N-2640), sodium acetate buffer 
(0.05 M, adjusted to pH 5.3), 0.05 M NaOH, phosphate buffer saline (PBS; 
pH7.4), protein extraction buffer (Rosendahl 1994), Tris-HCl (10 mM), 
NaHC0 3 (10 mM), MgCl 2 (10 mM), Na 2 EDTA (0.1 mM), (3-mercaptoetha- 
nol (10 mM), sucrose (150 g/1), Triton X-100 (1 ml/1), protease inhibitors 
from stock (-80 °C), dissolved in distilled water and pH adjusted to 8.0. 

3. Experimental procedures 

a. Inoculate usually 6-8 actively growing agar discs of fungus into 500-ml 
Erlenmeyer flasks containing 250 ml of Hill and Kafer broth. Incubate the 
flasks at 28±2 °C, with constant shaking at 120 rpm on a rotary shaker 
(GFL 3019; Germany). 

b. Harvest biomass and homogenize using extraction buffer, pH 7.4, with 
liquid nitrogen. 

c. Centrifuge at 12 000 g for 20 min. The crude enzyme extract can be stored 
at -80 °C in aliquots. Using those aliquots, acid phosphatase activities are 
determined spectrophotometrically using P-nitro phenyl phosphate as 

4. Calculation 

Enzyme activity unit/mg = (EA410 nm/min x Total volume x D.F.)/18.5 

(Enz. Vol) mg/ml 

Specific Activity = [Protein of interest (units)] /Total Protein cone. Mg 

14. Localization of ACPase 

Purification of Protein by Column Chromatography 

This method follows Cutler (2001). Materials: Sephadex G-100 (Sigma; fraction- 
ation range: 5000-100 000), chromatography column (22.5x38.0 cm) plugged 
with a small amount of glass wool 

Experimental Procedure 

1. Packing of the column: 

a. Allow the dry gel to swell in excess water and leave to stand for 3 days 
with intermittent stirring and decantation. Wash with buffer (PBS) and 
pack into the column. Prior to packing the column the matrix should 
made in the form of thick slurry. 

b. Pour the slurry into the column slowly with the help of glass rod and 
allow to settle. Repeat this until the required volume is reached. Note: 
special care should be taken to avoid introduction of air bubbles while the 
column is packing. 

2. Application of protein sample: 

a. Once the column is packed, allow the buffer to run through the column 
overnight for equilibration and stabilization. Disconnect the column 
from the buffer reservoir and allow the gel to just run. 

b. Carefully apply the protein sample (partially purified by ammonium sul- 
fate precipitation, then dialyzed; Fig. 14.1) before drying the gel and run- 
ning it down the inside wall of the column so that the gel bed is not dis- 
turbed. When the samples enter the bed, gently overlay the gel with buffer 
and reconnect the column to the buffer reservoir. 

c. Record the flow rate approximately 0.5 ml/min. Collect fractions of 4 ml 
each and test for enzyme activity and protein concentration. 

d. Store the column in a buffer containing 0.02% sodium azide to prevent 
microbial growth, while not in use. 

Purification of Protein by Ion Exchange Chromatography 

This method follows Bollag et al. (1996). Materials: DEAE-Sephadex Tris buffer, 
pH 7.4. 

R. Malla, et al. 

Fig. 14.1 Fractionation of ACPase by ammonium sulfate precipitation. Saturation in each lane: 
lane 1 50%, lane 2 60%, lane 3 70%, Lane 4 80%, lane 5 90%. The crude extract fractionated by each 
different % saturation of ammonium sulphate was centrifuged at 12 000 rpm for 30 min. The pellet 
obtained after centrifugation was dissolved in 80 mM phosphate buffer saline (PBS). Total protein 
was estimated by the method of Bradford (1976). 50 ug of total protein was loaded in each well 
of 10% native PAGE. After separation for 6 h the gel was neutralized with 50 mM sodium acetate 
buffer and assayed with 2 mg/ml p-nitrophenyl phosphate (p-NPP). The optimum % saturation of 
ammonium sulfate for ACPase is 80% 

Experimental Procedure 

The appropriate pH for ion exchange chromatography can be determined by test 
tubes experiments. Take nine test tubes, each containing 1 ml of ion exchanger 
DEAE Sephadex already soaked and washed with appropriate buffer, pH rang- 
ing from 5.5 to 9.0. Remove the excess buffer and add 100 \A of protein solution 
to each tube. Mix the tube and allow the matrix to settle for a few minutes. Test 
the supernatant for protein of interest. The best pH which bound the protein 
can selected for ion exchange. 

1. Preparation of matrix and packing of column: 
As above. 

2. Sample application: 

a. Drain the column until the buffer reach the surface of the matrix bed and 
close the column outlet. 

b. Gently apply the sample pooled from gel filtration chromatography onto 
the bed surface with the help of a pipette. 

c. Open the column outlet until the sample enters the matrix. Add buffer 
gently to the bed surface and then hook up buffer reservoir. 

d. Remove the unbounded protein by washing. After washing the protein 
elute with 0.1 MNaCl. 

14. Localization of ACPase 

Native Polyacrylamide Gel Electrophoresis 

This native PAGE method follows Walker (1994). Reagents and materials: 10% 
acrylamide solution from stock, separating gel buffer (1.5 M Tris-HCl, pH 8.8), 
stacking gel buffer (0.5 M Tris-HCl, pH 6.8), 10% ammonium persulfate in wa- 
ter, 0.04% TEMED sample buffer (5x), electrophoresis buffer, staining solution, 
de-staining solution, micro -syringe for loading samples. 

Experimental Procedure 

1. Transfer 10% polyacrylamide gel solution to the gel cassette by running the 
solution carefully down one edge between the glass plates until it reaches a 
position 1 cm from the bottom of the sample loading comb. 

2. To obtain a smooth surface carefully run a distilled water and butanol mix- 
ture down one edge into the cassette, using a Pasteur pipette. 

3. Allow the gel to polymerize. After polymerization of separating gel, pour- 
off the overlaying water mixture and dry the surface with the application of 
Whatman filter paper. 

4. Apply 4% stacking gel to the gel cassette until the solution reaches the cut 
away edge of the gel plate. 

5. Place well forming comb into this solution and allow to polymerize. This 
preparation takes about 30 min. 

6. Carefully remove the comb and spacer after the gel sets and assemble the 
cassette in the electrophoresis tank filled with electrophoresis buffer. 

7. Mix 50 ug each samples (1 |ig/ml) with 5x sample loading buffer. 

8. Centrifuge for 5 min at 5000 rpm in micro-centrifuge. 

9. Load the samples onto the gel wells with the help of a Hamilton micro-sy- 
ringe or gel loading tips. The dense sample settles to the bottom of the load- 
ing well. 

10. Connect the power pack to the apparatus and run the proteins in stacking 
gel at a constant voltage of 70 V; and run in the separating gel at 120 V until 
the dye front reaches the bottom of the plate, 1 cm above the edge. Note: The 
native PAGE is run in a cold room maintained at 4 °C. 

After completion of electrophoresis, the gel is subjected to: 

a. ACPase enzyme assay. 

b. Gel staining for 60 m in Coomassie blue. 

Observe the resulting bands and compare with bands in gel enzyme assay. 
Note: One can identify the desired protein in Coomassie-stained gel. Cau- 

R. Malla, et al. 

tion: Acrylamide is neurotoxic even at minimal doses. Normally a small por- 
tion of gels remains unpolymerized even after electrophoresis, Gloves must 
be worn at all times when making or handling gels. 

Detection of Enzyme in Native PAGE 

This protocol follows Walker (1996). Reagents: sodium acetate buffer (50 mM, 
pH 5.3), p-nitrophenyl phosphate di-sodium salt (2 mg/ml; Sigma Chemical 

Experimental Procedure 

1. For the detection of protein for their biological activity, duplicate samples can 
be run in native gel. One set of samples can bestained by Coomassie for all 
protein bands and another set for phosphatase activity. 

2. Equilibrate the gel in 50 mM sodium acetate buffer, pH 5.3, for 30 min at 4 °C 
in cold room. 

Fig. 14.2 Location of acid phosphatase in native gel. Native PAGE of Piriformospora indica was 
stained by Coomassie blue (left) and gel assayed (right) using p-NPP as substrate. Lane 1 CF, lane 2 
W/MR Separation was done in 8% gel at 4 °C for 6 h. Duplicate samples were run. One set of sam- 
ples was stained for protein profile with Coomassie blue (left) and the other set for acid phosphatase 
activity, washing the gel in 2 mg/ml substrate solution that gave a yellow colored p-nitrophenol 
product at the site of enzyme. The arrows represent the bands of acid phosphatase 

14. Localization of ACPase 

3. Immerse the gel in solution containing 2 mg/ml of the enzyme substrate 
(p-NPP) in a shaking water bath until a yellow color develops (Fig. 14.2). 

Elution of Enzyme 

This process is modified from that of Summers and Szewczyk (1996). Materials 
and reagents: transilhiminator, sharp razor blade, dissecting scissors, electro - 
blotting apparatus, nitrocellulose membrane (NC), Ponceau S stain, Ponceau S 
(0.5%), acetic acid (10%), elution buffer 1 and elution buffer 2. 

1. Elution Buffer 1: NH 4 HC0 3 (50 mM), SDS (4%), PMSF (2 mM), DTT 
(2 mM), TPCK (50 uM), benzedene (50 |iM), DTT (2 mM). 

2. Elution Buffer 2: SDS (2%), Tritan X-100 (1%), Tris-HCl (50 mM), pH 9.5. 

Experimental Procedure 

Run 6% native polyacrylamide gel and assay for ACPase in presence of 2 mM 
p-NPP. The yellow band formed can be subjected to either of the following pro- 
1. Manual cutting of bands: 

a. Cut the gel into small pieces and pass through different pore sized needles 
with the help of plastic disposable syringe along with elution buffer 1. 

b. Transfer the gel to a Falcon tube. Boil the mixture over a boiling water 
bath for 6 min then keep at 60 °C overnight in a water bath. 

c. Centrifuge at 13 000 rpm in a spin filter (Fig. 14.3). 

d. Collect the supernatant and separate in 12% SDS-PAGE with molecular 

2. Electro -blotting: 

a. Electro-blot the gel onto NC membrane (see the methodology for West- 
ern blot, Section 14.2.10). 

b. After transfer, stain the NC membrane with Ponceau S for 5 min. Excise 
the bands of interest with scissors. 

c. Destain the membrane with distilled water. Place the membrane in an 
Eppendorf tube and add 0.2 ml of elution buffer 2 per cm 2 of membrane. 

d. Mix well by vortexing the immobilon in eluant for 10 min. 

e. Spin down the immobilon for 5 min. Collect the supernatant. 

Note: Elution is necessary for the determination of molecular size of the pro- 
tein, which can be achieved by SDS-PAGE. 

R. Malla, et al, 

Separation of protein from 
native gel electrophoresis 

Add elution buffer 
and vorte; 

Slices of 
lamide gel 

^^— - 

— - 

Mince into 

After passing through needle, 
place into centrifugal device 

E luted protein 
in Elution buffer 

Fig. 14.3 Diagrammatic protocol for the elution of protein from polyacrylamide gel electropho 

Isolation of Acid Phosphatase for Raising Antibody 

Reagents: same as above (14.2.4 Native PAGE). 

Experimental Procedure 

The overall process of separation of protein in native gel is given in Section 
14.2.4. The only difference is that the comb in stacking gel is inserted in an in- 
verted position to obtain a big well which can hold about 2 ml of the partially 
purified fraction of ACPase from ion exchange chromatography. 

Production of Antibodies using Acid Phosphatase in Native Gel 

The method used here (Malla and Varma 2004a) is essentially a modification of 
Amero et al. (1996). The difference is that, instead of SDS-PAGE, the protein is 
separated in native PAGE or in a nondenatured form. 

14. Localization of ACPase 

Reagents: glutaraldehyde, Freund's complete and incomplete adjuvant, PBS, 
pH 7.4, p-nitrophenyl phosphate di-sodium salt (Sigma; 2 mg/ml). 

Experimental Procedure 

1. After completion of electrophoresis assay, view the gel for ACPase on a trans- 
illuminator and cut out the yellow bands of interest manually with a razor 

2. Then crosslink proteins in the gel by immersing the gel by gentle shaking in 
2% glutaraldehyde for 40 min (Reichli 1980). This step minimizes loss of pro- 
teins during subsequent washing of the gel and enhances the immunological 
response by polymerizing the proteins. 

3. Glutaraldehyde can be removed by washing with PBS, several times at a 
regular interval of 20 min. Caution: Any residual glutaraldehyde is toxic to 
animals. Residual glutaraldehyde can easily be detected by smell. Subsequent 
washing also removes nitrophenol (yellow color) produced during the en- 
zyme assay and the process may also remove lots of undesirable elements 
from the gels, including unpolymerized acrylamide, which is very harmful to 

4. Preparation of antigen: 

a. Pass the polyacrylamide and PBS mixture through different pore sized 
needles ranging from 18G to 24G. 

b. Mix approximately 200 |ig of protein from one syringe with 500 ul of 
Freund's complete or incomplete adjuvant into another 3 -ml syringe with 
the help of a disposable emulsifying adapter until a uniform white and 
viscous emulsion is formed (Fig. 14.4). 

Fig. 14.4 Emulsification 
of antigen. The protein is 
mixed with the help of a dis- 
posable emulsifying adapter 
until a uniform white and 
viscous emulsion is formed 

R. Malla, et al, 

Table 1 4.1 Immunization schedule for the production of antibodies against purified acid phospha 
tase. The adjuvants used were from Sigma (Hahn et al. 1998). s.c. Subcutaneous 

Amount of antigen Adjuvant 

Approx. 200 ug of 
antigen in poly- 
acrylamide gel 

Approx. 200 ug of 
antigen in poly- 
acrylamide gel 

Bleeding for antiserum 

Approx. 200 ug of 
antigen in poly- 
acrylamide gel 

Bleeding for antiserum 

Approx. 200 ug of 
antigen in poly- 
acrylamide gel 

Bleeding for antiserum 

Approx. 200 ug of 
antigen in poly- 
acrylamide gel 

Bleeding for antiserum 

Freunds com- 
plete, 500 ul 

Freunds incom- 
plete, 500 ul 

Freunds incom- 
plete, 500 ul 

Freunds incom- 
plete, 500 ul 

Freunds incom- 
plete, 500 ul 

c. Inject the prepared antigen sub-cutaneously in rabbits, according to the 
schedule given in Table 14.1. 

Antiserum Preparation 

1. Apparatus: centrifuge 

2. Experimental procedure 

a. Allow the collected blood to clot normally for 2 h at room temperature 
followed by overnight at 4 °C to allow clot to retract. 

b. Loosen the clot from the side of the tube walls gently with a wooden ap- 
plicator stick. 

c. Separate the upper straw-colored liquid, centrifuge at 8000 rpm for 
30 min at 4 °C in a micro -centrifuge to remove remaining blood cells and 

14. Localization of ACPase 

d. The supernatant thus obtained can be used as raw serum, which may be 
stored frozen for long period of time in screw-top -tubes, at least 6 months 
at -20 °C and for several years at -70 °C in aliquots. 

Note: assay of antibody titer (detection of antibodies) can be done by double 
and single immunodiffusion, enzyme linked immunosorbent assay (ELISA). 

Purification of Immunoglobulin from Serum 

Fractionation by Ammonium Sulphate 

This method follows Heide and Schwick (1978). 

1. Reagents: saturated ammonium sulfate solution, PBS, pH 7.4. 

2. Experimental procedure 

a. Precipitate the immunoglobulin (IgG) fraction in the antiserum up to 
50% by slowly adding an equal amount of saturated ammonium sulfate 
solution drop -wise while gently stirring the sample at 4 °C for 2 h. 

b. Centrifuge at 8000 rpm for 20 min at 4 °C. Discard the supernatant and 
drain the pellet (carefully invert the tube over a paper tissue). 

c. Dissolve the precipitate in 10-20% of the original volume in PBS or other 
buffer by careful mixing with a wide-gage Pasteur pipette. 

d. When fully dispersed, add more buffer to give 20-50% of the original vol- 
ume and dialyze against the required buffer (e.g., PBS) at 4 °C overnight 
with three changes of buffer. 

Caution: Immunoglobulin can be stored at -20 °C in aliquots (Harris 2001), 
for later use or further purification by DEAE-Sepharose CL-6B. 

Purification by DEAE-Sephadex CL-6B Chromatography 

DEAE-Sephadex ion exchange chromatography yields IgG purified from other 
immunoglobulin subclasses and most serum proteins (Johnstone and Thorpe 

1. Reagents and materials: 0.02 M sodium phosphate equilibration buffer, 
pH 7.4 (NaH 2 P0 4 .H 2 and Na 2 HP0 4 ), 0.1 M NaCl, sodium azide, chroma- 
tography column, DEAE-Sephadex CL-6B. 

2. Experimental procedure, sample application and elution 

R. Malla, et al. 

a. After equilibration of the column with equilibration buffer, disconnect 
the column from buffer and apply about 5 ml of the dialyzed serum sam- 
ple to the column without disturbing the gel bed. 

b. After applying the sample to the gel base, gently overlay the gel with buf- 
fer and reconnect the buffer to the reservoir. 

c. Elute the fractions with 0.1 M NaCl. Collect the fractions (4 ml each) 
which contain IgG and monitor the absorbance of the elute at 280 nm. 

d. After use, store the column with sodium azide solution to prevent bacte- 
rial contamination. 

Western Blot 

This Western blot protocol is after Towbin et al. (1979). 

1. Reagents: transfer buffer (containing Tris-base, glycine, methanol, SDS), 
washing buffer [Tris buffer saline with Tween-20 (TBST)], blocking buffer 
[5% BSA (A4503; Sigma, St. Louis,USA) in 25 mM TBS], dilution buffer (1% 
BSA in 25 mM TBS), Ponceau S stain, substrate solution [3,3'-diamino-ben- 
zedine tetra hydrochloride (DAB; Sigma), in combination with urea perox- 
ide], antiserum (diluted in 1% BSA in TBS), enzyme conjugated secondary 
antibody (HRPO, anti-rabbit IgG; A-9169, Sigma, ). 

2. Materials and apparatus: Bio-Rad trans-blot apparatus, orbital shaker, ni- 
trocellulose sheet (0.45 |im pore size; Schnieder & Schuell, Germany), filter 
paper (Whatman 3MM, Maidstone, UK), piece of polyacrylamide gel with 
protein of interest or acid phosphatase, SDS-PAGE, native PAGE. 

Experimental Procedure 

a. Place four pieces of wetted 3MM filter paper on the cathodal side of the 
cassette on top of the wetted sponge pad. 

b. Place the gel of protein separated in SDS- or native PAGE onto the filter 
papers (keep them wet), then place the nitrocellulose sheet on the gel, i.e., 
on the anodal side, carefully avoiding air bubbles throughout the process. 

c. Place the remaining four filter papers over nitrocellulose membrane and 
expel all air bubbles between the nitrocellulose membrane and gel. This 
can be achieved by soaking the gel/nitrocellulose/nTter paper assembly lib- 
erally with transfer buffer and then pressing with the help of a Teflon rod. 

d. Finally place a wet sponge pad on top of the filter paper and clamp se- 
curely and tightly in the perforated cassette. 

e. Then submerge the sandwich assembly in transfer tank filled with trans- 
fer buffer in a cold room at 4 °C. 

14. Localization of ACPase 

f. Connect the transfer assembly to the power supply. Run electrophoresis 
at 40 V for 3 h. 
1 . Ponceau S stain 

a. Stain the stripe of the blot with 100 ml of Ponceau S for 15 min imme- 
diately after electroblotting to confirm that the polypeptides have been 
transferred successfully onto the filter and mark the position of markers. 

b. De-stain with de-ionized water and TBS. 

2. Immuno -detection 

Incubate the blot at 4 °C with the following solutions, with intervals of five wash- 
ings with TBST (15 min each with gentle shaking): 

a. 50 ml of blocking buffer (5% BSA in TBS) for 2 h to block the remaining 
protein binding sites on the nitrocellulose. 

b. 50 ml of 1:10 dilution of antiserum purified by DEAE-Sephadex CL-6B 
diluted in 1% BSA in TBS overnight. 

c. 50 ml of 1 : 1 00 dilution of enzyme conjugated secondary antibody diluted 
in 1% BSA in TBS for 2 h. 

Visualization of antigen -antibody complex 

Briefly rinse the blots twice with 50 ml sodium acetate buffer. 

Incubate the blot with 50 ml of diaminobenzidine (DAB) combined with 

urea peroxide (Sigma) until red-brown bands appear. 

c. Stop the reaction by rinsing the blot repeatedly with distilled water 
(Fig. 14.5). 

205.0 > 

116.0 > 

< 66kDa 

Fig. 1 4.5 Left IgG fractionation and purification steps. The antiserum raised was collected by retro- 
orbital bleeding, kept at room temperature for 2 h, then overnight at 4 °C. The clear serum was 
separated by centrifugation and purified by ion exchange chromatography using DEAE Sephadex 
CL-6B (lane 2). Lane 1 Molecular marker (Sigma). Right Immunoblotting analysis of acid phospha- 
tase with protein separated in native PAGE. Lane 1 Cytoplasmic fraction, lane 2 wall membrane 

R. Malla, et al, 

This immuno -fluorescence method follows Meyberg (1998). Reagents: 3.7% 
paraformaldehyde, filtered through an 0.4 |im Millipore filter and mixed with 
an equal amount of double strength buffer, washing buffer 1 (PBS containing 
100 mM glycine), permeabilizing buffer (0.1% Triton X-100 in PBS), washing 
buffer 2 (PBST), blocking buffer (1% BSA), PBS, pH 7.4. 

Experimental Procedure 

1 . Cell culture 

a. Immerse the cover glasses in 50% H 2 S0 4 . Wash in running tap water, 
Sterilize under UV light for 4 h. 

b. Grow the culture in culture dishes with the cover glasses for 48 h. Drain- 
off culture medium and rinse cover slips with PBS. 

2. Fixation 

a. Fix cells in 3.7% para-formaldehyde in PBS for 15 min at room tempera- 
ture. Wash three times for 5 min each with PBS containing 100 mM gly- 

b. Permeabilize the cells with 0.1% Triton X-100 in PBS for 4 min. Rinse 
with PBS. 

c. Incubate in 1% BSA in PBS, pH 7.4, for 30 min to block unspecific bind- 
ing. Wash with PBST, 3x10 min. Incubate with primary antibody diluted 
1:100 in 1% BSA, PBS, pH 7.4 for 60 min. 

d. Wash with PBST, 3x10 min. 

e. Incubate with FITC (F-0382; Sigma Aldrich), conjugated secondary anti- 
body developed in goat diluted 1:100 in 1% BSA, PBS, pH 7.4, for 60 min 
at 37 °C. 

f. Wash with PBST, 3x10 min. Mount in PPD -mounting medium (or 90% 
glycerol). Observe under fluorescence microscope (model, FV-300; 
Olympus; Fig. 14.6). 

Localization of ACPase by Immunogold Technique 

This technique follows Botton and Chalot (1991). Reagents: phosphate buffer 
saline (PBS, 0.1 M), fixative (1% glutaraldehyde, 2% paraformaldehyde) fil- 
tered through a 0.45 [im pore-sized filter paper, stock solution of 4% osmium 

14. Localization of ACPase 

Fig. 14.6 Immunofluorescence of Piriformospora indica using FITC conjugated antibody. Immu- 
nofluorescence of P. indica. Chlamydospore. a/b Hyphae seen under blue filter in confocal mi- 
croscopy (Olympus), using FITC (F-0382; Sigma Aldrich) conjugated second antibody developed 
in goat. The characteristic fluorescence pigments restricted at the chlamydospore cell wall may 
be due to low penetration power. The characteristic fluorescence is distributed uniformly in the 

R. Malla, et al. 

tetroxide, primary antibody (raised against acid phosphatase in rabbit), second- 
ary antibody (anti-rabbit Goat IgG conjugated with gold particles), stain (uranyl 
acetate, lead citrate). 

Experimental Procedure 

1. Fixation: 

a. Fix the 4-day-old samples at 4 °C for 18 h. 

b. Wash the tissues in fresh buffer and post-fix for 2 h in 1% osmium tetrox- 
ide (Palade 1952) in the same buffer at 4 °C. 

2. Embedding procedure: 

After fixation, dehydrate the specimens in graded alcohol/acetone solutions 
and embed in LR white resin. 

3. Ultra-thin sectioning and staining: 

a. Cut ultra-thin sections (60-90 nm thick) on an ultra-microtome dia- 
mond knife. From the good portion of the knife-edge, cut silver sections. 

b. Spread the ribbons containing silver sections by toluene. 

c. Pick up the ribbons on the shining surface of the nickel grids. 

d. Carefully rinse the grid in perfectly clean, de-ionized water several times 
to remove all dirt from the ribbon. 

4. Labeling the grid with primary antibody: 

a. Add primary antibody IgG (1:100) raised in rabbit against acid phospha- 
tase to the nickel grid containing ultra-thin sections and keep overnight 
at 4 °C. 

b. Wash with 0.1 M PBS four times. Dilute IgG with 0.1% BSA in 0.1 M 

5. Labeling with secondary antibody: 

a. Add anti-rabbit-goat IgG conjugated with 15 nm gold particles (1:100). 

b. Wash with 0.1M PBS and diluted with 0.1% BSA in 0.1M PBS. 

Note: To keep background labeling low short incubation time was preferred. 

6. Staining the grid: 

Stain the sections then stain in 0.5% aqueous uranyl acetate (Watson 1958), 
for 10 min and in lead citrate (Reynolds 1963) for 5 min. The staining can be 
carried out in the following way: 

a. Keep one or two drops of stain on a parafilm M sheet. As this material is 
hydrophobic, the stain remains as a drop. The grid with a ribbon is then 
held over the drop of stain, keeping the shining surface of the grid down- 
ward so that the ribbon is immersed in the stain. 

b. After staining, the grid is taken out of the stain with the help of fine twee- 
zers. Then hold the grid over a beaker vertically and run de -ionized water 
carefully over it. 

14. Localization of ACPase 

Fig. 14.7 Immunolocal- 
ization of acid phospha- 
tase in P. indica, shown by 
electron micrographs (a, 
bM) of an ultrathin sec- 
tion of P. indica mycelium 
treated with secondary 
antibody (goat anti- rabbit) 
coupled to colloidal gold 
(15 nm size). Dark dots 
are gold particles indicat- 
ing localization of the 
enzyme acid phosphatase. 
Localization is prominent 
in vacuoles, cell wall and 
cytoplasm. The cells were 
fixed with 1% glutaralde- 
hyde and post-fixed with 
1 % osmium tetroxide. 
The primary antibody 
was raised against acid 

c. Continue the process for 5-6 min for complete removal of the excess 

d. Drain off the excess water with the help of a filter paper. Place the grid in 
a grid box. Observe the stained sections with a Philips CM- 10 electron 
microscope. Operate the microscope at 60-80 kV (Fig. 14.7). 

R. Malla, et al, 

An inability to attain a high titer of antiserum after several booster injections 
may be due to the use of inappropriate adjuvant. Some experimentation may 
be necessary to optimize the antigen/adjuvant ratio for different antigens. Inad- 
equate antigen emulsification may also result in a poor antiserum titer. Repeat 
the emulsification process. Be sure to use phosphate buffer saline. Avoid plastic 
syringes. The antigen injected may be of a poor immunogen. This method is 
very useful when purified protein is not available or difficult to obtain. Since 
nondenatured protein in native gel is used as immunogen, its reaction with na- 
tive protein is very strong or it easily immunoprecipitates native protein (Malla 
and Varma 2004). The advantage of using native protein in gel over denatured 
protein in SDS gel is that the antibody generated by this method is of a high ti- 
ter. When antibodies are raised against denatured proteins, they may only react 
with the denatured protein and may not immunoprecipitate native proteins. 

The idea is to inject as much antigen as possible with a minimum amount 
of gel. Injection of too much gel may harm animals and also creates persistent 
wounds at the injection site. The animal may die during the project. Acrylamide 
is neurotoxic even at minimal doses. Normally a small portion of gel remains 
unpolymerized even after electrophoresis. 

The immune system and the products resulting from an immune response as 
well as their interactions with other cellular molecules can provide powerful 
tools if ones conceptual approach is sound. Antibodies raised against cytosolic 
acid phosphatase of P. indica using gel bands in native PAGE, after selective 
precipitation of ammonium sulfate followed by gel filtration and ion exchange 
chromatography, gave productive antibody and immunoblotting analysis. The 
antibody localized the enzyme at different locations within the cell structure. Its 
reaction with native protein as well as denatured protein was significant. 

Alves JM, Siachakr CD, Allot M, Tizroutine S, Mussio I, Servaes A (1994) Isozyme modifica- 
tions and plant regeneration through somatic embryogenesis in sweet potato. Plant Cell 
Rep 13:437-441 

14. Localization of ACPase 

Amero SA, James TC, Elgin SCR (1996) Production of antibody using proteins in gel bands. 
In: Walker JM (ed) The protein protocols handbook. Humana, Totowa, pp 717-720 

Aono TIE, Dewbre GR, Maldonado-Mendoza, Harrison MJ, Saito M (2004) Expression of 
alkaline phosphatase genes in arbuscular mycorrhizas. New Phytol 162:525-534 

Bollag DM, Rozycki MD, Edelstein SJ (1996) Protein methods, 2nd edn. Wiley- Liss, New 
York, pp 231-269 

Botton B, Chalot M (1991) Techniques for the study of nitrogen metabolism in ectomycor- 
rhiza. Methods Microbiol 23:203-252 

Bradford MM (1976) A rapid and sensitive method for the quantitation of microgram quanti- 
ties of protein utilizing the principle of protein-dye binding. Ann Biochem 72:248-252 

Cutler P (2001) Chromatography on the basis of size. In: Simon RA (ed) Protein purifica- 
tion techniques. A practical approach, 2nd edn. Oxford University Press, Oxford, pp 

Ehsanpour AA, Amini F (2003) Effect of salt and drought stress on acid phosphatase ac- 
tivities in alfalfa (Medicago sativa L.) explants under in vitro culture. Afr J Biotechnol 

Fries LL, Pacovsky MRS, Safir GR, Kaminski J (1998) Phosphorus effect on phosphatase ac- 
tivity in endomycorrhizal maize. Physiol Plant 103:162-171 

Gianinazzi-Pearson V, Gianinazzi S (1978) Enzymatic studies on the metabolism of vesicu- 
lararbuscular mycorrhiza. II. Soluble alkaline phosphatase specific to mycorrhizal infec- 
tion in onion roots. Physiol Plant Pathol 12:45-53 

Hahn AC, Goebel, Hock B (1998) Polyclonal antibodies for the detection of arbuscular my- 
corrhizal fungi. In: Varma A (ed) Mycorrhiza manual. Springer, Berlin Heidelberg New 
York, pp 255-270 

Haran S, Logendra S, Saskar M, Bratanova M, Raskin I (2000) Characterization of Arabi- 
dopsis acid phosphatase promoter and regulation of acid phosphatase expression. Plant 
Physiol 124:615-626 

Harris ELV (2001) Concentration of the extract. In: Simon R (ed) Protein purification tech- 
niques, a practical approach, 2nd edn. Oxford, University Press, Oxford, pp 111-154 

Harrison MJ, Dewbre GR, Liu JY (2002) A phosphate transporter from Medicago truncatula 
involved in the acquisition of phosphate released by arbuscular mycorrhizal fungi. Plant 
Cell. 14:2413-2429 

Heide K, Schwick HG (1978) Salt fractionation of immunoglobulins. In: Weir DM (ed) 
Handbook of experimental immunology, vol 1: immuno chemistry. Blackwell Scientific, 
Oxford, pp 7.1-7.11 

Johnstone A, Thorpe R (1996) Immunochemistry in practice. Blackwell Science, Oxford, pp 

Kaldorf M, Koch B, Rexer K-H, Kost G, Varma A (2005) Patterns of interaction between 
Populus Esch5 and Piriformospora indica: a transition from mutualism to antagonism. 
Plant Biol 7:210-218 

Keneko Y, Hayashi N, Toh-e A, Banno I, Oshima Y (1987) Structural characteristics of the 
Pho8 gene encoding repressible alkaline phosphatase in Saccharomyces cerevisiae. Gene 

Kojima T, Hayatsu M, Saito M (2001) Electrophoretic detection and partial purification of 
the phosphatase specific for arbuscular mycorrhizal symbiosis. Bull Natl Grassl Res Inst 

Malla R, Varma A (2004) Phosphatase(s) from microorganisms. In: Varma A, Podila GK (eds) 
Biotechnological applications of microbes. IK International, New Delhi, pp 125-150 

Malla R, Singh A, Md Z, Yadav V, Verma SA, Rai M, Varma A (2002) Piriformospora indica 
and plant growth promoting Rhizobacteria: an appraisal. In: Rao GP, Bhat DJ, Lakhanpal 
TN, Manoharichari C (eds) Frontiers of fungal diversity in India. International Book 
Distributing, Lucknow, pp 401-419 

R. Malla, et al. 

Malla R, Prasad R, Giang PH, Pokharel U, Oelmueller R, Varma A (2004) Characteristic fea- 
tures of symbiotic fungus Piriformospora indica. Endocytobios Cell Res 15:579-600 

Meyberg M (1998) Selective staining of fungal hyphae in parasitic and symbiotic plant fungus 
associations. Histochemistry 88:197-199 

Miller SS, Liu J, Allan DL, Menzhuber CJ, Fedorova M, Vance CP (2001) Molecular control 
of acid phosphatase secretion in to the rhizosphere of proteoid roots from phosphorus- 
stressed white lupin. Plant Physiol 127:594-606 

Palade GE (1952) A study of fixation for electron microscopy. J Exp Med 95:285-297 

Pasqualini, Panara SF, Antoneilli M (1992) Acid phosphatase activity in Pinus pinea, Tuber 
albidum ectomycorrhizal association. Can J Bot 70:1377-1383 

Paszkowski U, Kroken S, Roux C, Briggs SP (2002) Rice phosphate transporters includes an 
evolutionarily divergent gene specifically activated in arbuscular mycorrhizal symbiosis. 
Proc Natl Acad Sci USA 99:13324-13329 

Peskan T, Shahollari B, Pham HG, Hehl S, Markent C, Blank V, Kost G, Varma A, Oelmueller 
R (2004) Association of Piriformospora indica with Arabidopsis thaliana roots represent 
a novel system to study beneficial plant-microbe interactions and involve in early plant 
protein modifications in the endocytoplasmic reticulum and in the plasma membrane. 
Physiol Plant 122:465-471 

Rausch C, Daram P, Brunner S, Jansa J, Laloi M, Leggewie G, Amrhein N, Bucher M (2001) 
A phosphate transporter expressed in arbuscule containing cells in potato. Nature 

Reichli M (1980) Use of glutaraldehyde as a coupling agent for proteins and peptides. Meth- 
ods Enzymol 70:159-165 

Reynolds ES (1963) The use of lead citrate at high pH on an electron opaque stain in electron 
microscopy. J Cell Biol 17:208-212 

Rosendahl S (1994) Isozyme analysis of mycorrhizal fungi and their mycorrhiza. In: Norris 
JR, Read D, Varma A (eds) Techniques for mycorrhizal research. Academic, London, pp 

Saito M (1997) Regulation of arbuscular mycorrhizal symbiosis: hyphal growth in host roots 
and nutrient exchange. JARQ 31:179-183 

Shahollari B, Varma A, Oelmueller R (2005) Expression of receptor kinase in roots is stimu- 
lated by the basidiomycete Piriformospora indica and the protein accumulates in Triton- 
X-100 insoluble plasma membrane microdomains. J Plant Physiol 162:945-958 

Summers DF, Szewczyk B (1996) Elution of SDS-PAGE separated proteins from immobilon 
membranes for use as antigens. In: Walker JM (ed) The protein protocols handbook. 
Humana, Totowa, pp 699-702 

Tarafdar JC, Rao AV (1996) Contribution of Aspergillus strains to acquisition of phosphorus 
by wheat (Triticum aestivum L.) and chick pea (Cicer arietinum L.) grown in a loamy soil. 
Appl Soil Ecol 3:190-194 

Tisserant B, Gianinazzi-Pearson V, Gianinazzi S, Gollotte A (1993) Inplant histochemical 
staining of fungal alkaline phosphatase activity for analysis of efficient arbuscular my- 
corrhizal infections. Mycol Res 97:245-250 

Towbin H, Staehlin T, Gordon J (1979) Electrophoretic transfer of proteins from polyacryl- 
amide gels to nitrocellulose sheets: procedure and some applications. Proc Natl Acad Sci 
USA 76:4350-4354 

Varma A, Rai MK, Sudha, Sahay N (2000) Microbial biotechnology: new-paradigms and role 
in sustainable agriculture. In: Rajak RC (ed) Microbial biotechnology for sustainable de- 
velopment and productivity, Scientific Publishers, Lahore, pp 22-37 

Varma A, Abbott LK, Werner D, Hampp R (2004) The state of art. Plant surface microbiology. 
In: Varma A, Abbott L, Werner D, Hampp R (eds) Plant surface microbiology. Springer, 
Berlin Heidelberg New York, pp 1-11 

14. Localization of ACPase 

Walker JM (1994) Basic protein and peptide protocols. In: Walker JM (ed) The protein proto- 
cols handbook. Humana. Totowa, pp 186-187 

Walker JM (1996) Non- denaturing polyacrylamide gel electrophoresis of protein. In: Walker 
JM (ed) The protein protocols handbook. Humana, Totowa, pp 51-54 

Watson ML (1958) Staining times section for electron microscopy with heavy metals. J Bio- 
phys Biochem Cytol 4:475-478 

Weifi M, Selosse MA, Rexer KH, Urban A, Oberwinkler F (2004) Sebacinales: a hitherto 
overlooked cosm of heterobasidiomycetes with abroad mycorrhizal potential. Mycol Res 

Use of Short Oligonucleotide Primers 
in Random Amplified Polymorphic DNA 
Techniques for Species Identification 

R. Malla and A. Varma 

The introduction of molecular techniques in biology has been a major force in 
the areas of systematics and population biology of the fungi. The introduction 
of PCR-based methods has significantly increased the level of activity. The sim- 
plicity of the techniques, coupled with the general use of particular regions of 
the genomes, has resulted in many important advances in our understanding of 
taxonomic grouping as well as the evolutionary histories and functional proper- 
ties associated with them. The nuclear genomes of fungi are small, intermedi- 
ate between that of prokaryotes and the higher eukaryotic plants and animals. 
Compared with higher plants and animals, fungi have a much lower percent- 
age of redundant DNA. Typically 10-20% of the DNA in fungi is redundant, 
while as much as 80% of the DNA maybe redundant in other eukaryotes (Dutta 
1974). The bakers yeast Saccharomyces cerevisiae contains a genome of 16 chro- 
mosomes, including 13.4 million bases. Its genome displays significant redun- 
dancy, with 53 duplicated gene clusters among the 16 chromosomes. These du- 
plicated regions represent more than 30% of the entire genome (Mewes et al. 
1997). Fungi have extrachromosomal genetic elements, the most important of 
which are found in mitochondria. Mitochondrial (mt) genomes provide another 
source of genetic variability that is independent of sexual reproduction. The mi- 
tochondrial genome in fungi is usually uniparentally (maternally) inherited. 
The mtDNA is the useful tool for the taxonomic studies because it is relatively 
small, making it possible to analyze the entire genome, and its composition is 
not complicated by the recombination that occurs (Taylor 1986). 

Variation within species can be assayed using the random amplified poly- 
morphic DNA (RAPD) method (Welsh and McClelland 1990; Williams et al. 

Rajani Malla: Department of Microbiology, Tri-Chandra Campus, Tribhuvan University, 
Tel: 009771-4670857, 00977-9851013734, 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmuller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

R. Malla 

1990), in which arbitrary short oligonucleotide primers, targeting unknown se- 
quences in the genome, are used to generate amplification products that often 
show size polymorphism within species. RAPD analysis offers the possibility of 
creating polymorphism without any prior knowledge of the DNA sequences of 
the organism investigated. The method is fast and economic for screening large 
number of samples. The RAPD band pattern has been used to define some fun- 
gal species in which species-specific bands or combinations of bands have been 
considered. In these techniques there is the assumption that bands with identi- 
cal mobility and staining intensity are of the same or very similar sequences. 
Characterization of species at morphological and protein level is not fully re- 
liable since environmental conditions influence the nature of the organism to 
a great extent. The use of molecular markers such as RAPDs along with mor- 
phological and protein traits may provide a more clear concept of the species. 
RAPD markers are randomly distributed through out the genome and can be 
efficiently and randomly sampled using established procedures. The RAPD pro- 
cedure developed by Welsh and McClelland (1990) and Williams et al. (1990) 
involves simultaneous amplification of several anonymous loci in the genome 
and has been used for genetic, taxonomic and ecological studies of several fungi 
(Zinnoetal. 1998). 

PCR-based techniques have already been applied to endo-and ectomycorrhi- 
zal fungi where morphological characters are in conflict, ambiguous and miss- 
ing (Podila and Lanfranco 2004). This approach has allowed the development 
of molecular tools for their identification and increased the level of understand- 
ing in the molecular taxonomy of microorganisms (Solaiman and Abbott 2004; 
Varma et al. 2004). The most commonly used PCR-based techniques include 
amplification of variable regions in the ribosomal genes, restriction fragment 
length polymorphism (RFLP), amplification of short repeated sequences (mic- 
rosatellites) and random amplification of polymorphic DNA (RAPD; Erlich et al. 
1991). These techniques provide a different degree of resolution in the study of 
genetic polymorphisms. RAPD reveals intraspecific differences by originating 
DNA fingerprints, which maybe unique for a single isolate (Perotto et al. 1996). 
Identification of individual clones is essential for the better understanding of 
the diversity, structure and dynamic of populations of ectomycorrhizal fungi. 
Unfortunately, this approach is time-consuming. RAPD (Welsh and McClelland 
1990; Williams et al. 1990) has therefore been used for the analysis of popula- 
tions of Suillus granulatus (Jacobson et al. 1993) and Laccavia bicolor (Buschena 
et al. 1992). However, this technique has been reported to be very sensitive to 
experimental variables and the RAPD assay conditions described for one spe- 
cies may not be suitable for another. Huai et al. (2003) studied the genetic varia- 
tion and spatial distribution of the ectomycorrhizal fungus Tricholoma terreum. 
The 33 sporophores studied belonged to distinct genotypes, based on the analy- 
sis of RAPD markers. The genets of T. terreum were small and not larger than 
0.5 m. Two major phenetic groups, i.e., eight individuals in group 1 and 25 in 
group 2, were identified by principal component analysis and by the unweighed 
pair group method with arithmetic means of simple matching coefficients, 

15. Use of Short Primers in RAPD 

respectively. The application of RAPD analysis was investigated for the identi- 
fication of ectomycorrhizal symbionts of spruce (Picea abies) belonging to the 
genera Boletus, Amanita and Lactarius at and below the species level. Using both 
fingerprinting [Ml 3, (GTG) 5 , (GACA) 4 ] and random oligonucleotide primers 
(VI, V5), a high degree of variability of amplified DNA fragments (band-shar- 
ing index 65-80%) was detected between different strains of the same species, 
hence enabling the identification of individual strains within the same species. 
The band-sharing index between different species of the same genus (Boletus, 
Russula, Amanita) was in the range 20-30% and similar values were obtained 
when strains from different taxa were compared. Thus RAPD is too sensitive 
at this level of relationship and cannot be used to align unknown symbionts 
to a given taxon. They therefore conclude that RAPD is a promising tool for 
the identification of individual strains and could thus be used to distinguish 
indigenous and introduced mycorrhizal strains from the same species in natural 
ecosystem. The genetic variability of Trichoderma isolates using the RAPD were 
analyzed by Goes et al. (2002), who found high intra-specific genetic variation 

among those fungi. 

Polymorphism between Piriformospora indica 

and Sebacina vermifera, Members of the Order Sebacinales 

Piriformospora indica, a new endophyte (Verma et al. 1998) has the ability to 
grow axenically. The cultivability of this fungus in different synthetic media, like 
Aspergillus medium (Malla et al. 2002; Pham et al. 2004), provided an opportu- 
nity to study the comparative isozyme polymorphism and a molecular marker 
like RAPD to establish variability in between P. indica and the closely related 
organism Sebacina vermifera (Malla et al. 2004b). The analysis of enzymes, iso- 
zymes like laccase, malate dehydrogenase, esterase, peptidase, peroxidase, acid 
and alkaline phosphatase and non-enzymic proteins and their mobility dis- 
played clear variations among different species (Malla et al. 2004a). 

Proteomics and genomics data about this fungus were recently described 
(Peskan et al. 2004; Kaldorf et al. 2005; Shahollari et al. 2005). S. vermifera sensu 
stricto consists of a broad complex of species possibly including mycobionts of 
jungermannioid and ericoid mycorrhizas. Extrapolating from the known rDNA 
sequences in the Sebacinaceae, it is evident that there is a cosm of mycorrhizal 
biodiversity yet to be discovered in this group (Weifi et al. 2004). 

The acid phosphatases (ACPases; Fig. 15.1) in P indica and S. vermifera sensu 
stricto are similar in their molecular mass. The antibody raised against the 
ACPase of P. indica showed a maximum ELIS A reading with S. vermifera sensu 
stricto, supporting a strong relationship between these two fungi. The immunob- 
lot analysis showed a strong reactivity of P. indica antiserum with S. vermifera 

R. Malla 

Fig. 15.1 3D structure 
of acid phosphatase 

sensu stricto. The antiserum blotted bands at 66 kDa with S. vermifera separated 
in denatured PAGE and at a similar location with P. indica in non-denatured 
PAGE. The antiserum also localized the enzyme in S. vermifera by an immuno- 
fluorescence technique, showing a strong relationship of this fungus with P. in- 
dica (Fig. 15.2). The immunogold labeling of antiserum from P. indica precisely 
localized the enzyme in the cytoplasm and vacuoles of S. vermifera, support- 
ing the strong immunological link between these two fungi. Two-dimensional 
maps of crude protein of these two fungi showed some differences in minor 
proteins. P. indica and S. vermifera sensu stricto belonging to same taxonomic 
group show similar morphology, functions and isozymes. However, they show 
distinct genetic variation based on the RAPD analysis and can be considered to 
be placed within species from the same ancestral root. 

The study aimed to establish genetic diversity between the two species P. in- 
dica and S. vermifera sensu stricto belonging to the same order, Sebacinales. 
Seven random 10-bp oligonucleotide primers of different origin were used. 
Clustering of similarity matrices was done by the un-weighted pair group 
method with arithmetic mean (UPGMA) and projection by the TREE program 
of NTSYS-pc (Numerical Taxonomy System, Applied Biostatistic). Out of seven 
primers, six gave scorable, reproducible DNA products (bands) suitable for es- 
tablishing a genetic diversity. UPGMA cluster analysis clustered the isolates into 
two distinct groups. The average genetic similarity between both fungi was 0.58 
(i.e., 58%) and can be considered to place them within species from the same 
ancestral root. These results illustrated the potential value of RAPD techniques 
for detecting polymorphism among fungal isolates. 

15. Use of Short Primers in RAPD 

66kDa > 

Fig. 15.2 Western blot analysis of P. indica and S. vermifera sensu stricto. Protein separated by 10% 
SDS PAGE transferred to nitrocellulose membrane by electroblotting. The blot were blocked using 
5% bovine serum albumin and reacted with acid phosphatase antiserum and peroxidase conjugat- 
ed secondary antibody, visualized using DAB. Lanes 1, 2 Cytoplasmic fraction (CF; lane 1) and wall 
membrane fraction (W/MF; lane 2) of P. indica reacted with homogenous antiserum. Lanes 3, 4 CF 
{lane 3) and W/MF (lane 4) of S. vermifera sensu stricto cross-reacted with P. indica antiserum. The 
result shows precisely defined bands in all samples. All blotted bands represent similarities in their 
molecular mass, supporting immunologically highly related species 

General Protocol for RAPD Technique 
to Show Polymorphism 

1. Equipment: thermal cycler, gel electrophoresis apparatus, band analysis soft- 
ware, UV transilluminator and gel documentation system. Caution: UV rays 
are dangerous. Protect eyes with a plastic shield. 

2. Reagents (all the chemicals, primers and enzymes were obtained from Op- 
eron Technology): DNA isolation buffer (Moller et al. 1992), 2% hexadecy- 
ltrimethyl ammonium bromide (CTAB), NaCl (1.4 M), EDTA (20 mM), 
Tris HC1 (100 mM), chloroform:isoamylalcohol (20:1), isopropanol, sodium 
acetate, ethanol (70%), Tris EDTA (TE, pH 8.0), Tris-HCl (pH 8.0, 10 mM), 
EDTA (pH 8.0, 1 mM), DNA amplification mixture for PCR, RNase A, load- 
ing buffer, bromophenol blue (0.25%), sucrose in water (40%, w/v; store in 
small aliquots at 4 °C), primers (short oligonucleotide), ethidium bromide 
(caution: ethidium bromide is a powerful mutagen; wear gloves and masks 
when handling and weighing). Note: all buffers, pipette tips and Eppendorfs 
should be sterilized at 121 °C for 15 min. Sterilize by autoclaving at 15 psi (ca. 

3. DNA amplification mixture for PCR (25 ul; Operon Technologies, Alameda, 
Calif.): lOx buffer (2.5 ul), MgCl 2 (2.5 ul), dNTPs (10 mM; 0.8 ul), primer 
(30 ng/ul; 1.0 ul), Taq polymerase (3 units/ul; 0.5 ul), template DNA (1 ul), 
Milli Q water (ultrapure, 16.7 ul). 

R. Malla 

Experimental Procedures 

DNA Extraction 

1. Carry out isolation and purification of fungal DNA following the modified 
CTAB protocol of Moller et al. (1992). 

2. Inoculate flasks containing 100 ml Hill and Kafer medium with axenic cul- 
ture of P. indica and place in a growth chamber at 28 °C for 6-8 days. Collect 
the hyphae by filtration. Keep the mycelial network at -20 °C. 

3. Grind the freeze-dried mycelia (5 g) using liquid nitrogen and transfer 
the powdered mycelium into Eppendorf tubes (2 ml). Add equal amounts 
of pre-warmed isolation buffer (2% CTAB, 1.4 M NaCl, 20 mM EDTA, 
100 mM Tris-HCl) as fast as possible and incubate for 30 min at 60 °C in a 
water bath. Gently mix after every 10 min. Add one volume of chloroform: 
isoamyl-alcohol (24:1). 

4. Cap the tubes and shake for 10 min by hand. Mix gently but thoroughly to 
ensure emulsification of the phase. 

5. Centrifuge the emulsion for 10 min (15 000 rpm at room temperature). Ex- 
tract the upper aqueous phase with fresh chloroform isoamyl alcohol and 
transfer the final aqueous phase to a new Eppendorf tube using a large bore 

6. After adding 0.6 vol. of ice-cold isopropanol and 0.1 vol. of sodium acetate, 
cap the tubes and place at -20 °C overnight and then centrifuge again at 
15 000 rpm for 10 min. 

7. Transfer the precipitated whitish network of DNA-CTAB complex to a new 
Eppendorff tube. Add washing solution (70% ethanol) and incubate for 
30 min. 

8. Mix gently but thoroughly by hand and centrifuge for 5 min at 8000 rpm at 
4 °C. Remove residual CTAB at this step. 

9. Decant the washing solution and dry the pellet at 37 °C for 3 h to ensure the 
removal of all parts of ethanol. 

10. Add appropriate volume of lx TE buffer and allow the pellet to dissolve at 
4 °C without agitation. 

11. After extraction, purify the DNA by using RNase A. Dilute the DNA in TE 
buffer (lx) for RAPD and store at -20 °C for further use. 

12. DNA concentration can be quantified by UV spectrophotometer at 260 nm 
and by comparison to DNA standards by agarose gel electrophoresis. 

15. Use of Short Primers in RAPD 

■S .■ 

£ ^ <? ,Cy ^ 

^ ft ^ / ft ^ ft ^ * / ft 

<V h %' V %' 

^ <V V V <V <V 

V <V 

^^K ^^H^^^^b IH 

^r^ 4^fc 

1 |-f V 

L ^W " ' 

L ^^^^^^^B 

I ■■* ^ 

*M p 

m y. 

Fig. 15.3 The RAPD analysis of P. indica and 5. vermifera sensu stricto to show genetic variation 
between these two fungi. Out of seven primers used for amplification, six have given a productive 
polymorphism. Lanes 1, 16 Marker (XDNA £coRl, ffmdIII). Lanes 2, 3 Primer OPA10, lanes 4, 
5 OPDOT, lanes 6, 7 OPC06, lanes 8, 9 OPC10, lane 10, 11 OPCOT, lanes 12, 13 OPI04, lanes 14, 
15 OPI10. No polymorphism was observed when the genomic DNA was amplified with OPC10 
(lanes 8, 9) 

Piriformospora indica 

Sebacina vermifera 

I i i i i I i i i i I i i i i I i i i i I 

0.54 0.55 0.56 0.57 0.58 

Fig. 15.4 Dendrogram showing phylogenetic relationship between P. indica and S. vermifera sensu 
stricto. The NTSYS-pc computer program (Numerical Taxonomy System, Applied Biostatistics) 
was used for data analysis 

R. Malla 

RAPD Analysis 

RAPD analysis is done following Zinno et al. (1998). 

1. DNA amplification is done in a total volume of 25 ul, containing 2.5 \A buf- 
fer (lOx without MgCl 2 ), 2.5 |il MgCl 2 , 0.8 |il dNTPs (10 mM), 1.0 \xl primer 
(30 ng/|il), 0.5 (il Taq polymerase (3 units/|il) and DNA according to con- 
centration use. Random 10-bp oligonucleotide primers (Operon Technolo- 
gies Alameda, Calif.) are used to produce amplification: OPA10 (GTGATC- 

2. Each isolate is tested at a range of DNA concentrations from 0.5 ul to 2.5 ul 
and the clearest amplification of RAPD bands is used. 

3. DNA is amplified in a PTC-200 thermal cycler (Techne, UK) with the follow- 
ing thermal profile: 95 °C for 5 min (initial denaturation cycle), then 36 cy- 
cles of 94 °C for 30 s (denaturation cycle), 36 °C for 2 min (annealing) and 
72 °C for 2 min (extension); and a final extension at 72 °C for 5 min. 

4. For separation, the amplified DNA samples are mixed with 6x loading dye 
and electrophoresed on 1.5% agarose gel in 1% TBE at 3.5 V/cm for 2 h, then 
stained with ethidium bromide and photographed under a transilluminator 
(Figs. 15.3, 15.4). 

Only amplification products that are reproducible over two amplifications 
should be included. The variation in the intensity of fluorescence of different 
ethidium bromide-stained PCR products across the isolates was not considered 
for the purpose of data analysis. 

The RAPD data confirmed that, even between these two species of Sebacinales 
belonging to same morpho-zymographical groups and with minor protein dif- 
ferences shown by 2-D PAGE, the level of variation was substantially high ac- 
cording to RAPD. Thus, it is suggested that such isolates should be considered as 
separate species. Molecular characterization offers an alternative approach for 

15. Use of Short Primers in RAPD 

more reliable and reproductive identification at species level. By using molecular 
markers like RAPDs, genetic polymorphism within species can be assayed. The 
use of immunological, molecular and enzymological techniques has opened an 
important area of research in P. indica. This study has opened up several novel 
pathways which can be explored to fill some lacunae in the molecular aspects of 
arbuscular mycorrhizal research, since P. indica is an axenically cultivable fun- 
gus mimicking various AM characters. 

Buschena CA, Doudrick RL, Anderson NA (1992) Persistence of Laccaria spp as mycorrhizal 
symbionts of container-grown black spruce. Can J For Res 22:1883-1887 

Dutta SK (1974) Repeated DNA sequences in fungi. Nucleic Acids Res 1:1411-1419 

Erlich HA, Gelfand DH, Sninsky JJ (1991) Recent advances in the polymerase chain reaction. 
Science 252:1643-1651 

Goes LB, Costa ABL, Freire LLC, Oliveira NT (2002) Randomly amplified polymorphic DNA 
of Trichoderma isolates and antagonism against Rhizoctonia solani. Braz Arch Biol Tech- 

Huai WX, Guo LD, He W (2003) Genetic diversity of an ectomycorrhizal fungus Tricholoma 
terreum in a Larix principis-rupprechtii stand assessed using random amplified polymor- 
phic DNA. Mycorrhiza 13:265-270 

Jacobson KM, Miller OK, Turner BJ (1993) Randomly amplified polymorphic DNA mark- 
ers are superior to somatic incompatibility tests for discriminating genotype in natural 
populations of the ectomycorrhizal fungus Swillus granulatus. Proc Natl Acad Sci USA 

Kaldorf M, Koch B, Rexer KH, Kost G, Varma A (2005) Patterns of interaction between Popu- 
lus Esch5 and Piriformospora indica: a transition from mutualism to antagonism. Plant 
Biol 7:210-218 

Malla R, Varma A (2004a) Phosphatase(s) from microorganisms. In: Varma A, Podila 
GK (eds) Biotechnological applications of microbes. IK International, New York, pp 

Malla R, Prasad R, Giang PH, Pokharel U, Oelmueller R, Varma A (2004b) Characteristic fea- 
tures of symbiotic fungus Piriformospora indica. Endocytobiosis Cell Res 15:579-600 

Malla R, Singh A, Md Z, Yadav V, Suniti, Verma A, Rai M, Varma A (2002) Piriformos- 
pora indica and plant growth promoting Rhizobacteria: an appraisal. In: Rao GP, Bhat 
DJ, Lakhanpal TN, Manoharichari C (eds) Frontiers of fungal diversity in India, pp 

Mewes HW, Abbermann K, Bahr M, Frishman D, Gleissner A, Hani J, Heumann K, Kleine K, 
Maierl A, Oliver SG, Pfeiffer F, Zollner A (1997) Overview of the yeast genome. Nature. 

Moller EM, Bahnweg G, Sandermann H, Geiger HH (1992) A simple and efficient protocol 
for isolation of high molecular weight DNA from filament fungi, fruit bodies and in- 
fected plant tissue. Nucleic Acids Res 20:6115-6116 

Peskan T, Shahollari B, Pham HG, Hehl S, Markent C, Blank V, Kost G, Varma A, Oelmueller 
R (2004) Association of Piriformospora indica with Arabidopsis thaliana roots represent 
a novel system to study beneficial plant-microbe interactions and involve in early plant 
protein modifications in the endocytoplasmic reticulum and in the plasma membrane. 
Physiol Plant 122:465-471 

R. Malla 

Perotto S, Actis-Perino E, Perugini J, Bonfante P (1996) Molecular diversity of fungi from 

ericoid mycorrhizal roots. Mol Ecol 5:123-131 
Pham GH, Kumari R, Singh A, Malla R, Prasad R, Sachdev M, Kaldorf M, Buscot B, Oelmul- 

ler R, Hampp R, Saxena AK, Rexer KH, Kost G, Varma A (2004) Axenic Cultures of 

Piriformospora indica. In: Varma A, Abbott L, Werner D, Hampp R (eds) Plant surface 

microbiology. Springer, Berlin Heidelberg New York, pp 593-613 
Podila GK, Lanfranco L (2004) Functional genomic approaches for studies of mycorrhizal 

symbiosis. In: Varma A, Abbott L, Werner D, Hampp R (eds) Plant surface microbiology, 

Springer, Berlin Heidelberg New York, pp 567-592 
Shahollari B, Varma A, Oelmueller R (2005) Expression of receptor kinase in roots is stimu- 
lated by the basidiomycete Piriformospora indica and the protein accumulates in Triton- 

X-100 insoluble plasma membrane microdomains. J Plant Physiol 162:945-958 
Solaiman MZ, Abbott LK (2004) Functional diversity of arbuscular mycorrhizal fungi on root 

surface. In: Varma A, Abbott L, Werner D, Hampp R (eds) Plant surface microbiology, 

Springer, Berlin Heidelberg New York, pp 331-349 
Taylor JW (1986) Fungal evolutionary biology and mitochondrial DNA. Exp Mycol 

Varma A, Abbott LK, Werner D, Hampp R (2004) The state of art. Plant surface microbiology. 

In: Varma A, Abbott L, Werner D, Hampp R (eds) Plant surface microbiology. Springer, 

Berlin Heidelberg New York, pp 1-11 
Verma S, Varma A, Rexer KH, Hassel A, Kost G, Sarabhoy A, Bisen P, Butenhorn B, Franken 

P (1998) Piriformospora indica, gen. et sp. nov, a new root colonizing fungus. Mycologia 

Welsh J, McClelland M (1990) Fingerprinting genomes using PCR with arbitrary primers. 

Nucleic Acids Res 18:7213-7218 
Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV (1990) DNA polymorphism 

amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Res 

Weifi M, Selosse MA, Rexer KH, Urban A, Oberwinkler F (2004) Sebacinales: a hitherto 

overlooked cosm of heterobasidiomycetes with a broad mycorrhizal potential. Mycol 

Res 108:1-8 
Zinno TD, Longree H, Maraite H (1998) Deversity of Pyrenophora tritici-repentis isolates 

from warm wheat growing areas: pathogenicity, toxin production and RAPD analysis. 

In: Duveiller E, Dubbin HJ, Reeves J, McNab A (eds) Helminthosporium blights of wheat, 

spot blotch and tan spot. CIMMYT, Mexico, pp 302-31 1 

Co-Cultivation with Sebacinales 

A.C. Kharkwal, R. Prasad, H. Kharkwal, A. Das, 

K. Bhatnagar, I. Sherameti, R. Oelmiiller, and A. Varma 

Mycorrhiza refers to an association or symbiosis between plants and fungi that 
colonize their roots during periods of active plant growth. The most common 
and prevalent, arbuscular mycorrhizal (AM) fungi, play an indispensable role 
in upgrading plant growth, vigour and survival by a positive impact on the nu- 
tritional and hydratic status of the plant and on soil health by increasing the 
reproductive potential, improving root performance and providing a natural 
defence against invaders including pests and pathogens (Newsham et al. 1995; 
Auge 2000; Borowicz 2001). 

The majority of land plants live in mycorrhizal interaction with fungi, a sym- 
biosis that has a strong impact on ecosystems, agriculture, flori-horticulture and 
forestry (Sanders 2003; Bidartondo et al. 2004; Koide and Mosse 2004; Pennisi 
2004). The benefits of mycorrhizal associations arise from nutrient transport be- 
tween the plant roots and fungal hyphae. The carbon source is transported from 
the plant to the fungus, whereas fungal hyphae serve as a fine link between the 
roots and the rhizosphere and improve the plants supply of inorganic nutrients 
(Harrison 1999; Bucking and Heyser 2003; Herrmanns et al. 2004; Koide and 
Mosse 2004). 

Applications of mycorrhizae in micropropagated plantlets are a boon for the 
micropropagation industry (Varma and Schuepp 1995). The key functions of 
AM co -cultivation can be summarized as follows: (1) improving root growth and 

Amit C. Kharkwal, Ram Prasad, Harsha Kharkwal, Aparajita Das, Kamya Bhatnagar, 

and Ajit Varma: Amity Institute of Microbial Sciences, Amity University, Sector 125, Noida, 

Uttar Pradesh, India, email: 

Irena Sherameti, Ralf Oelmiiller: Institute of General Botany, Department of Environmental 
Sciences, University of Jena, Dornburger Strasse 159, D-07743 Jena, Germany, 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

A.C. Kharkwal et al. 

plant establishment, (2) enhancing plant tolerance to (biotic and abiotic) stresses, 
(3) improving nutrient cycling, (4) enhancing plant community diversity. 

Sebacinaceae - Novel Fungi 

Bandoni (1984) revised the Tremellales and Auriculariales on the basis of ultra- 
structural, ontogenetic and ecological characters. The Sebacinaceae were trans- 
ferred to his new concept of Auriculariales that then included taxa with septate 
basidia and continuous parenthesomes, but without a yeast stage. Weifi and 
Oberwinkler (2001) validated wide parts of Bandoni s (1984) concept of the Au- 
riculariales in a molecular phylogenetic study using nuclear rDNA coding for 
the D1/D2 region of the large ribosomal subunit (LSU). Their molecular analy- 
sis confirmed the monophyly of the Sebacinaceae (including also Craterocolla 
cerasi, which fits the micromorphological concept of Sebacinaceae); however it 
also suggested that the Sebacinaceae form a separate lineage of Hymenomycetes 
that must be excluded from the Auriculariales. 

Warcup and Talbot (1967) isolated heterobasidiomycetes that they identi- 
fied from their sexual stages formed in axenic culture as Sebacina vermifera 
sensu stricto from the roots of Australian terrestrial orchids. Later such fungi 
were also isolated from pot-cultured ectomycorrhizae and arbuscular mycor- 

Table 1 6.1 Recognized members of the Sebacinaceae 

Fungus Remark 

Sebacina incrustans Non-culturable a 

S. epigaea Non-culturable a 

S. off. epigaea Non-culturable a 

Tremelloscypha gelatinosa Non-culturable a 

S. dimitica Non-culturable a 

E. bulobasidium rolleyi Non-culturable a 

Craterocolla cerasi Non-culturable a 

Piriformospora indica Culturable 

Sebacina vermifera sensu stricto Culturable 

Sebacina sp. Culturable 
Scientists have failed to culture these fungi on denned synthetic media 

16. Co- Cultivation with Sebacinales 

rhizae (Warcup 1988). Recently, using molecular methods like polymerase 
chain reaction (PCR), molecular cloning and sequencing, members of the Se- 
bacinaceae have been shown to be involved in various mycorrhizal associa- 
tions in the field: (1) orchid mycorrhizae (McKendrick et al. 2002; Selosse et 
al. 2002 a, b; Urban et al. 2003), (2) ectomycorrhizae (Berch et al. 2002). Since 
the remaining taxa of the Auriculariales sensu Bandoni (1984) are likely to 
be wood decomposers (Wells and Bandoni 2001), the mycorrhizal potential 
of the Sebacinaceae seems a good ecological features to separate members of 
this from other, morphologically quite similar heterobasidiomycetes that be- 
long to the Auriculariales. However, sebacinoids were demonstrated recently 
to be ectomycorrhizal (Selosse et al. 2002a). Observations on ectomycorrhizae 
and basidiomes suggest that species of Sebacinaceae are fairly common myco- 
bionts in various ectomycorrhizal plant communities (Urban et al. 2003). The 
phylogenetic position of the Sebacinaceae within the Basidiomycota gives an 
overview of phylogenetic relationships inside this subgroup of Hymenomyce- 
tes for which the new Sebacinales is proposed (Garnica et al. 2003; Michael 
Weifi, personal communication). Fungal strains included in the Sebacinaceae 

are given in Table 16.1. 

Host Spectrum 

Members of the Sebacinaceae were observed to be associated with a large num- 
ber of mono- and dicotyledonous plants (Table 16.2), inducing pronounced 
growth promotional effects (Varma et al. 2001), with the exception of the plants 
belonging to the Cruciferaceae and some plants belonging to the Chenopo- 
diaceae and Amaranthaceae (Read 1999; Varma et al. 1999, 2001; Singh et al. 
2003b). Literature suggests that the members of these groups normally do not 
form associations with AM fungi (Denison et al. 2003). Under in vitro con- 
ditions, P. indica and S. vermifera sensu stricto were demonstrated to interact 
with the root system of cruciferous and chenopodaceous plants, viz. mustard 
(Brassica junaceae), cabbage (Brassica oleracea var. capitata; Kumari et al. 2003), 
Arabidopsis thaliana (Pham et al. 2004a) and spinach (Spinacia oleracea). A 
report indicated the ability of P. indica to colonize the rhizoids of a liverwort 
(bryophyte), and the thalli failed to grow under in situ conditions in the ab- 
sence of this fungus (Varma et al. 2000, 2001; Pham et al. 2004a). P. indica was 
further shown to form associations with terrestrial orchids such as Dactylorhiza 
purpurella (Stephs.) Soo, D. incarnate L. Soo, D. majalis (Rchb. F.) Hunt & Sum- 
merh. and D. fuchsia (Druce) Soo (Blechert et al. 1999; Varma et al. 2001; Pham 
et al. 2004a; Prasad et al. 2005). 

A.C. Kharkwal et al, 

Table 1 6.2 Plant interactions tested with members of Sebacinaceae. Data is based on the root colo 
nization analysis in vivo and in vitro (c.f. Varma et al. 2001; Singh et al. 2003a, b) 

Acacia catechu (L.f.) Willd (black catechu) Glycine max L. Merr. (soybean) 

Acacia nilotica (L.) Willd (gum) 

Abrus precatorius L. ro- 
sary pea (precatory bean) 

Adhatoda vasica L. syn. (malabar nut) 

Aneura pinguis L. Dumort. (liverwort) 

Arabidopsis thaliana L. Heynh. 
(mouse ear cress) 

Artemisia annua L. (chinese wormwood) 

Azadirachta indica A. Juss (neem) 

Nicotiana tabaccum L. (tobacco) 
N. attenuata L. (mountain tobacco) 

Oryza sativa L. (rice) 

Petroselinum crispum L. (curly parsley) 

Pisum sativum L. (pea) 

Bacopa monniera L. Wett. (brahmi) 

Populus tremula L. (aspen) 

P. tremuloides Michx. (clone 
Esch5; quaking) 

Prosopis chilensis Stuntz sys. 
(chilean mesquite) 

P. juliflora (Swartz) DC. (honey mesquite) 

Cassia angustifolia Senna Patti 
(gallow grass hemp) 

Chlorophytum borivillianum Baker (musli) Quercus robur L. (clone DF 159; oak) 

Ch. tuberosum Baker (mexican orange) 

Cicer arietinum L. (chick pea) 

Coffea arabica L. (English coffee) 

Cymbopogon martinii Staph 
Van Motia (palmarosa) 

Dactylorhiza fuchsi Druce 
(Soo') (spotted orchid) 

D. incarnata L. Soo' (early marsh orchid) 

D. maculata L. Verm. 
(Northern marsh orchid) 

D. majalis Rchb. f. (broad 
leaved marsh orchid) 

D. purpurella ( Steph's) Soo' (lady orchid) 

Setaria italica L. (thumb millet) 
Solanum melongena L. (egg plant) 
Sorghum vulgare L. (millet) 
Spilanthes calva DC (clove) 

Tectona grandis Linn. f. (teak) 

Terminalia arjuna L. (Arjun tree/stembark) 

Tephrosia purpurea L. Pers. 

Withania somnifera L. Dunal 
(winter cherry) 

Zea mays var white (maize) 

Daucus carota L. Queen Anne's-lace (carrot) Zizyphus nummularia Burm. fiL (jujube) 
Delbergia sisso Roxburg (rosewood) 

16. Co- Cultivation with Sebacinales 

Functions of the Sebacinaceae 

Scientists from the Amity University Uttar Pradesh, Noida, have screened a 
novel endophytic fungus, Piriformospora indica, which mimics the capabilities 
of a typical AM fungus. P. indica is a recently isolated root-interacting fungus, 
related to the Hymenomycetes of the Basidiomycota (Verma et al. 1998). In con- 
trast to AM fungi, it can be easily cultivated in axenic culture where it produces 
chlamydo spores (Peskan-Berghofer et al. 2004; Oelmuller et al. 2005; Shahollari 
et al. 2005). The fungus is able to associate with the roots of various plant spe- 
cies in a manner similar to mycorrhiza and promotes plant growth (Varma et al. 
1999, 2001; Singh et al. 2002a, b, 2003a; Oelmuller et al. 2004; Pesken-Berghofer 
et al. 2004; Pham et al. 2004a; Shahollari et al. 2005). Pronounced growth pro- 
motional effects were also seen with terrestrial orchids (Blechert et al. 1999). 
The fungus can easily be cultivated on a number of synthetic and complex me- 
dia (Hill and Kafer 2001; Pham et al. 2004b). 

P. indica tremendously improves the growth and overall biomass produc- 
tion of diverse hosts, including legumes, medicinal and economically important 
plants (Varma et al. 1999, 2000). The plants tested in the laboratory conditions 
as well as in extensive field trials were Bacopa monieri, Nicotiana tobaccum (Sa- 
hay and Varma 1999, 2000), Artemisia annua, Petroselinum crispum (Varma et 
al. 1999), Azadirachta indica (Singh et al. 2002a, b, 2003a), Tridex procumbans, 
Abrus precatorius (Kumari et al. 2004), Chlorophytum borivilianum (Pham et al. 
2004a), Withania somnifera and Spilanthes calva (Rai et al. 2001) and Adhatoda 
vasica (Rai and Varma 2005). P. indica promotes the antifungal potential of the 
medicinal plant Spilanthus calva due to an increase in spilanthol content after 
interaction (Rai et al. 2004). P. indica promises to be an excellent agent for the 
biological hardening of tissue culture-raised plants as the fungus rendered more 
than 90% survival rate of the transferred plantlets of these plants and, by ex- 
cessive root proliferation and induction of secondary rootlets, protecting them 
from "transplantation shock" and potent root pathogens (Singh et al. 2002a, b, 
2003b; Varma et al. 2000). Therefore, this fungus has promise as a boon for the 
plant industries (Hazarika 2003; Singh et al. 2003a). 

Among the compounds released in root exudates, flavonoids are found to 
be present in P. indica. Flavonoids have been suggested to be involved in the 
stimulation of pre-contact hyphal growth and branching (Gianinazzi-Pearson 
et al. 1989; Siqueira et al.1991), which is consistent with their role as signalling 
molecules in other plant-microbe interactions (Giovannetti and Sbrana 1998). 
Cell wall-degrading enzymes like CMCase, polygalactouronase and xylanase 
were found in significant quantities both in the culture filtrate and in roots colo- 
nized with P. indica. 

P. indica showed a profound effect on disease control when challenged with 
the virulent root and seed pathogen Gaeumannomyces graminis. P. indica com- 
pletely blocked growth of this pathogen. This indicates that P. indica acts as a 

A.C. Kharkwal et al. 

potential agent for biological control of root diseases; however the chemical na- 
ture of the inhibitory factor is still unknown (Varma et al. 2001). 

P. indica has been reported to induce resistance to fungal diseases in the 
monocotyledonous plant barley, along with tolerance to salt stress without af- 
fecting plant productivity (Waller et al. 2005). The beneficial effect on the de- 
fence status is detected in distal leaves demonstrating a systemic induction of 
resistance. The systemically altered "defence readiness" is associated with an el- 
evated antioxidative capacity due to an activation of the glutathione-ascorbate 
cycle and an overall increase in grain yield. Interaction with Populus Esch5 re- 
vealed that P. indica could be directed in its physiological behaviour from mutu- 
alistic to antagonistic by specifically designed cultural conditions (Kaldorf et al. 
2005), hence making it a potential model system to study plant-microbe inter- 
actions. It provides a promising model organism for the investigation of benefi- 
cial plant-microbe interactions, and enables the identification of compounds, 
which may improve plant growth and productivity and maintain soil productiv- 
ity. The various multifunctional roles of P. indica are outlined in Fig. 16.1. 

Eco-Functional Identity 

Members of the Sebacinales, P. indica and S. vermifera colonize the root cortex 
and forms inter- and intracellular hyphae. Within the cortical cells, the fungus 
often forms dense hyphal coils or branched structures, intracellularly. P. indica 
also forms spore- or vesicle-like structures within or between the cortical cells. 

Multi-functional Symbiotic Fungus 

Resistance Against 
High Temperature 

Bi ©fertilizer 

Basic Research 

Resistance Against 

Heavy Metals 

Fig. 16.1 Multifunctional 
role of P. indica 

Bio- herbicide 

I mmu no-modulator 

Plant Protector 

16. Co- Cultivation with Sebacinales 

Like AM fungi, hyphae multiply within the host cortical tissues and never tra- 
verse through the endodermis. Likewise, they also do not invade the aerial por- 
tion of the plant (stem and leaves). 

The characteristic features of P. indica are the following: 

axenically cultivable on synthetic media, 

no clamp connections, 

anastomosis occurs frequently, 

hypha-hypha aggregation often observed, 

no hyphal knots, 

simple septum with dolipores and continuous, straight parenthosomes 

(Fig. 16.2 inset), 

chlamydo spores 16-25 |im in length, 10-17 urn in width, 

8-25 nuclei per spore. 

The fungus promises to serve as the substitute of AM fungi to overcome the 
long-standing enigma of science. The functional similarities with AM fungi are 
the following: 
• broad and diverse host spectrum, 

Fig. 16.2 P. indica: an 
overall view of the typical 
growth and differentiation 
of hyphae on solidified 
Kafer medium (the white 
arrow shows the hyphal 
coil and pear-shaped 
spore). Inset: a magnified 
view showed the dolipore 
and parenthosomes of P. 
indica (a section of hypha 
was observed in electron- 
transparent material): the 
small white arrow indicates 
the dolipore and the black 
arrows indicate the con- 
tinuous parenthosomes. 
This septal pore is typical 
for Hymenomycetes 

A.C. Kharkwal et al, 

hyphae extramatrical, inter- and intracellular, 

hyphae never invade the endodermis, 

chlamydo spores in soil and within cortical tissues, 

sexual stages not seen, 

positive phytopromotional effects on tested hosts, 

phosphorus mobilizer, 

phosphorus transporter, 

tool for biological hardening of micropropagated plantlets, 

potent biological control agent against root pathogens. 

Axenic Co-Cultivation of Sebacinaceae 

Circular agar discs (about 4 mm in diameter) infested with spores and actively 
growing hyphae of J! indica were placed onto Petri dishes (90 mm, disposable; 
Tarson, India) containing solidified Hill and Kafer medium. Inoculated Petri 
dishes (90 mm, disposable) were incubated in an inverted position for 7 days at 
28±2 °C in the dark. Usually 4-5 fully-grown fungus agar discs (4 mm in diam- 
eter) were inoculated into each 500-ml Erlenmeyer flask containing 250 ml of 
Hill and Kafer broth. Flasks were incubated at 28±2 °C, at constant shaking at 
100 rpm on a rotary shaker. The same procedure was performed for S. vermifera 
sensu stricto and Sebacina sp. 

1. Circular agar discs (about 4 mm in diameter) infested with spores and ac- 
tively growing hyphae of P. indica are placed onto Petri dishes (90 mm, dis- 
posable) containing solidified Hill and Kafer medium (Fig. 16.3a). 

2. Inoculated Petri dishes (90 mm, disposable) are then incubated in an inverted 
position for 7 days at 28±2 °C in the dark. 

3. Four or five fully grown fungus agar discs (4 mm in diameter; Fig. 16.3b) are 
inoculated into each 500-ml Erlenmeyer flask containing 250 ml of Aspergil- 
lus broth. 

4. Flasks are incubated at 28±2 °C, at constant shaking at 100 rpm on a rotary 
shaker (Fig. 16.3c). 

16. Co- Cultivation with Sebacinales 

Fig. 16.3 a Circular agar discs (about 4 mm 
in diameter) infested with spores and actively 
growing hyphae of P. indica inoculated onto 
Petri dishes containing solidified Hill and 
Kafer medium, b Fully grown fungus on solidi 
fied Hill and Kafer medium after 7-8 days. 
c Growth of P. indica on Kafer liquid medium 

A.C. Kharkwal et al, 

1. Hold the mother culture of P. indica grown on Hill and Kafer medium (Hill 
and Kafer 2001) inside a laminar flow hood. 

2. Make the discs by using the bottom of a sterile glass Pasteur pipette measur- 
ing about 4 mm in diameter. 

3. Inoculate one disc per Petri plate fortified with Hill and Kafer medium con- 
taining 1% agar. 

4. Wrap the Petri plates with paraffin tape to avoid any contamination. 

5. Incubate the Petri plates at 28±2 °C. 

6. Growth normally commences on the third day and, after 12 days, the fungus 
completely covers the surface of the agar plate (Fig. 16.3b). 

Media Compositions 

1. The Hill and Kafer medium composition is given in Table 16.3. 

2. For modified Hill and Kafer medium (Varma et al. 2001), the medium com- 
position is the same, except that the quantities of yeast extract, peptone and 
casein hydrolysate are reduced to one-tenth in quantity. 

3. Glucose asparagine agar (for Actinomycetes): 

Table 1 6.3 Composition of Hill and Kafer medium (Hill and Kafer 2001). The pH is adjusted to 6.5 
with 1 N HCl/NaOH. All stocks are stored at 4 °C except vitamins, which are stored at -20 °C. In 
broth culture, agar is excluded 

Constituent Concentration (g/1) 

Glucose 20.0 
Peptone 2.0 

Yeast extract 1.0 

Casamino acid 1.0 

Vitamin stock solution 1.0 ml 

Macroelements from stock 50 ml 
Microelements from stock 2.5 ml 

Agar 1 
CaCl 2 ,0.1M 1.0 ml 

FeCl 3 ,0.1M 1.0 ml 

16. Co- Cultivation with Sebacinales 

Table 16.3 (continued) 

Macroelements (major elements) stock (g/1) 

NaN0 3 

MgS0 4 .7H 2 

KH 2 P0 4 

Microelements (trace elements) stock (g/1) 

ZnS0 4 .7H 2 

MnCl 2 .4H 2 

FeS0 4 .7H 2 

CoCl 2 .6H 2 

CuS0 4 .5H 2 

(NH 4 ) 6 Mo 7 27 .4H 2 

Na 2 EDTA 

Vitamins (%) 

Pyridoxal phosphate 

Amino benzoic acid 

Concentration (g/1) 

Concentration (g/1) 

K 2 HP0 4 

Distilled water 

pH at 25 °C 

1000 ml 

Directions: ingredients are suspended in 1000 ml of distilled water. Dissolve by boiling com- 
pletely. Distribute in flasks and sterilize in the autoclave at 15 psi pressure (103 kPa) at 121 °C 
for 15 min 

A.C. Kharkwal et al, 

4. Hoagland solution (Hoagland and Arnon 1938) 

Concentration (g/1) 

Macro -nutrients: 

MgS0 4 .7H 2 

Ca(N0 3 ) 2 .4H 2 

KN0 3 

CuS0 4 5H 2 

MnCl 2 .4H 2 

ZnS0 4 .7H 2 

CuS0 4 .5H 2 
Iron source 

Directions: all ingredients are dissolved separately in double-distilled water and then mixed 
(pH = 6.7) 

5. Malt extract medium (Gallowey et al. 1962): 

Concentration (g/1) 

Malt extract 
Mycological peptone 

6. Malt yeast extract medium 

Concentration (g/1) 

Yeast extract 
Malt extract 
pH (25 °C) 

7. Malt yeast extract agar: add 2% (w/v) agar to the above malt yeast extract 

16. Co- Cultivation with Sebacinales 

8. Modified Melin-Norkrans (MMN) medium (Johnson et al. 1957) 

Constituent Concentration 

NaCl 0.4 mM 

KH 2 P0 4 3.7 mM 

(NH 4 ) 2 HP0 4 2.0 mM 

CaCl 2 0.3 mM 

MgS0 4 0.6 mM 

FeCl 3 3.6 mM 

Thiamine hydrochloride 0.2 mM 

Trypticase peptone 0.1% (w/v) 

Glucose monohydrate 1.0% (w/v) 

Malt extract 5.0% (w/v) 

Trace elements from stock 10 ml/1 

a. Stock solution of trace elements: 

Constituent Concentration 

KC1 0.2 M 

H3BO3 0.1 M 

MnS0 4 .H 2 22.0 mM 
ZnSO, 8.0 mM 

CuSO, 2.1 mM 

pH 5.8 

9. MMN agar medium: add 1.2% (w/v) agar to the above MMN medium. 

10. Plate count agar (APHA 1978): 

Constituent Concentration (g/1) 

Trypton 5.0 

Yeast extract 2.5 

Dextrose 1.0 

Agar 15.0 

pH (25 °C) 7.0±0.2 

Directions: suspend about 23.5 g of plate count agar in 1000 ml of distilled water. The medium is 
completely dissolved by boiling and is then sterilized at 15 psi pressure at 121 °C for 15 min. 

A.C. Kharkwal et al, 

11. Potato dextrose agar (PDA; APHA 1978) 

Concentration (g/1) 

Potato peel 

Distilled water 
pH (25 °C) 

Directions: the periderm (skin) of potatoes (200 g) is peeled off, cut into small pieces and boiled 
in 500 ml of water, until a glass rod easily penetrates them. After filtration through cheesecloth, 
dextrose is added. Agar is dissolved and the required volume (1 1) is made up by the addition of 
water. The medium is autoclaved at 15 psi pressure at 121 °C for 20 min 

12. Water agar (WA) 

Concentration (g/1) 

Daichin agar 

7 (0.7%) 

13. 20% Knop solution: 

Concentration (g/1) 

Daichin agar 

Vitamin B5 (Gamborg and Phillips 1996) 

Stock solution I 

Stock solution II 

Stock solution III 

Stock solution IV 

Stock solution V 

20.0 (2.0%) 
8.0 (0.8%) 

Adjust pH to 6.4 with 1 N KOH 

16. Co- Cultivation with Sebacinales 

14. Composition of stock solutions I-V for Knop solution 

Stock solution 

Concentration (g/1) 

Stock solution I 

Stock solution II 
Stock solution III 
Stock solution IV 
Stock solution V 

KN0 3 

MgS0 4 .7H 2 
Ca(N0 3 ) 2 .4H 2 

KH 2 P0 4 

MnCl 2 

(or MnCl 2 .4H 2 0) 

CuS0 4 .5H 2 

(or CuS0 4 .2H 2 0) 

ZnS0 4 .7H 2 

CoCl 2 .6H 2 

H 2 Mo0 4 

(or Na 2 Mo0 4 .2H 2 0) 

Seed Surface Sterilization and Germination 

Maize seeds are soaked in sterile water overnight and surface-sterilized by wash- 
ing with 90% ethanol for a few seconds and either with 0.01% mercuric chloride 
solution for 10 min or with 4% (v/v) NaOCl for 15 min, then washed five times 
with sterile distilled water and finally rinsed with 70% (v/v) ethanol for 30 s. 
This is followed by a quick treatment with 15% (v/v) NaOCl; chemicals adhered 
are removed by repeated rinsing with sterile distilled water (or a better alterna- 
tive method can be used as described in Section 16.8.1; Gamborg and Phillips 
1996). The seeds are kept 1 cm apart in a sterile Petri dish layered with germi- 
nating paper or aseptically transferred to water agar plates (0.7% agar) and left 
for germination at 25±2 °C for 4 days in the dark. 

A.C. Kharkwal et al, 

Protocol for Seed Surface Sterilization 

1. Collect desired quantity of seeds. 

2. Soak in sterilized distilled water overnight. 

3. Treat with 70% ethanol for 30 s with stirring. 

4. Wash three times with sterile distilled water to remove traces of ethanol. 

5. Wash with 1.5% NaOCl solution for 20 min with stirring 

6. Wash three times with sterilized distilled water. 

7. Wash with 15% NaOCl for 20 s. 

8. Wash six times with distilled water to remove traces of NaOCl. 

Garden soil is sterilized by autoclaving three times at 121 °C at 15 psi pres- 
sure (103 kPa), at intervals of 48 h. Sand is acid-treated in 10% HC1 overnight 
and washed in running tapwater until the pH becomes neutral. Sterile soil and 
acid-washed sand are dried in a hot-air oven. Soil and sand are mixed in the 
ratio of 3:1 for filling the pots. 

Inoculum Placement in the Pots 

Live inoculum of P. indica is required. This contains spores and fungal hyphae. 
In the pot, a soil base is added first, up to one-third of the depth of pot. Then 
live inoculum is layered over it. Above this layer, one layer of soil base is added 
to sandwich the inoculum between the layers of soil base. For the inoculation of 
P. indica, mycelium is mixed in a small amount of sterile soil and then spread as 
above, in a sandwich model at the rate of 1%. 

Surface-sterilized seeds are transferred to the pots. When the plants reach 
2-3 cm, they are then treated with Hoagland solution. The morphological fea- 
tures of each plant are observed and recorded at weeks 2, 4 and 8. 

P. indica - Photobiont Interaction 

Fungus-treated plants were compared with untreated control plants in terms 
of morphological and anatomical characteristics. As an impact of P. indica, the 

16. Co- Cultivation with Sebacinales 

treated plants showed early germination in comparison with the uninoculated 
control. After 30 days, prominent differences were seen. P. indica- treated plants 
become longer with more nodes and leaves than the control. 

Growth Conditions 

Pots were placed in a greenhouse maintained at 30±2 °C, 16 h photoperiod 
(1000 lux) and 75% relative humidity for four months. The plants were fertilized 
with 10% strength Hoagland solution (Hoagland and Arnon 1938) on every 
alternate week, consisting of phosphorus and devoid of phosphorus nutrients. 
Plants were irrigated with sterile tapwater on every alternate day to maintain a 
relative moisture of about 60%. 

Growth Parameters 

1. Aerial length: the height of each plant was measured at intervals of 14, 28 and 
42 days. Experiments were recorded in triplicate. 

2. Aerial biomass: each endophyte-inoculated plant was carefully taken in trip- 
licate from the pots for fresh and dry quantification at intervals of 14, 28 and 
42 days. Plants were wiped with tissue paper and air-dried for fresh weight. 
Later they were dried at 80 °C for 12 h in an air-circulation Memmert-type 
oven. Samples were desiccated at room temperature before weighing on a 
Mettler balance (AE 160). 

3. Underground length: underground parts were thoroughly washed under 
running tapwater to remove the adhering soil particles. The length of the un- 
derground part was measured in triplicate readings. 

4. Underground biomass: after excessive washing, the moisture was blotted out 
with filter paper, then air-dried and weighed for fresh weight on a Mettler 
balance (AE 160). 

5. Endophyte dependency: the endophyte dependency (ED) of Zea mays L. var 
white was determined using the formula given by Gerdemann (1975), which 
was modified by Plenchette et al. (1983) to give a percent increase of yield 
relative to that of mycorrhizal plants. This results in a figure between 0% and 
100% rather than an unlimited percent increase: 

ED = (Parameter with mycorrhiza - parameter without mycorrhiza)/ 
(Parameter with mycorrhiza) xlOO 

ED was used instead of mycorrhiza dependency (MD) to designate endo- 
phyte dependency. 

A.C. Kharkwal et al, 

Comparative Study on Plant Growth 
with Treated Endosymbionts 

Both P. indica and Sebacina vermifera sensu stricto exhibited the highest positive 
growth-promoting effect on maize plants, as evidenced by better aerial length 
(above ground), enhanced and healthier foliage and a well developed rooting 
system, as compared with other endophytic strains. S. vermifera sensu stricto 
showed a little less growth -promoting effect than P. indica. 

Mycorrhiza dependency (MD) was used as an index to compare the receptiv- 
ity of different plant species to AM fungi (Gerdemann 1975; Plenchette et al. 
1983). This can also be used for other endophytes, such as P. indica and S. ver- 
mifera sensu stricto. In the present study, ED was used instead of MD, as the test 
organisms do not develop a typical mycorrhizal association. P. indica showed 
the highest ED over the other related endophytes. The more intense root prolif- 
eration in treated plants observed in the present experiments might be due to 
the synthesis of as yet unidentified extracellular phytohormones by mycobionts 
(Singh et al. 2000; Varma et al. 2001). The ED value was 211.13 for Spilanthes 
calva and 671.90 for Withenia somnifera. These data suggest that P. indica has 
a greater influence on the growth of W. somnifera than on that of S. calva (Rai 
et al. 2001). The ED of a host plant can be altered by factors such as soil type 
and the soil P content of mycorrhizal species (Azcon and Ocampo 1981; Menge 
et al. 1978). Amongst the reasons proposed for the differences in ED in differ- 
ent plants or varieties of the same species, Baylis (1995) reported that root-hair 
length and root thickness could determine the ED level. Rajapakse and Miller 
(1988) observed that the average length of fine roots was negatively correlated 
with ED in cowpea. 

In Vivo Co-Cultivation of Sebacinales 

The Sebacinaceae members were also inoculated into sterile soil in polyethylene 
or earthenware pots in five replicates, using 0.5 kg capacity pots for mass culti- 
vation. The soil was autoclaved thrice on alternate days and air-dried. Riverbed 
sand was soaked in 10% HC1 overnight and then washed under running tap- 
water until the pH reached neutrality. An air-dried mixture of soil and sand in 
the ratio of 3:1 (Feldmann and Idczak 1994) was used as substratum. Pots were 
also surface-sterilized by 70% ethanol and were then half-filled with this mix- 
ture and the inoculum was layered over it. Five holes were made into each pot 
and into each hole approximately 1 g of endomycorrhizal inoculum was added 
(80 spores/fungal propagules per 10 g soil). Five germinated seeds of 10 mm 

16. Co- Cultivation with Sebacinales 

length were placed 1-2 cm above the inoculum layer in the marked holes in 
each pot (Fig. 16.4a, b). The pots were maintained in an environmentally con- 
trolled greenhouse at 25±2 °C with 16 h light/8 h dark and relative humidity 
60-70%, with a light intensity of 1000 lux. Roots were checked for colonization 
after 15-20 days. The soil cultures, along with the root propagules obtained after 
four months, were stored in a cold room for further use. Root pieces with spores 
and hyphal fragments can be used as a live propagule (inoculum) for experi- 
ments or to introduce fungi into soils. Similarly, for comparative photomyco- 
biont growth of P. indica and S. vermifera sensu stricto, a disc (4 mm diameter) 
of inoculum infested with hyphae and spores was taken per plant. 

soil inoculum 

Fig. 1 6.4 a Polyethylene pots (0.5 kg capacity) contained an autoclaved sand and soil mixture (1:3) 
at pH 7.0. Stage i Soil inoculum consisting of spores, hyphae and colonized root propagules. Stage 
it Sandwich of 1 cm layer of inoculum. Stage Hi Micropropagated plantlets were plated up to the 
second layer in an upward direction. A little sterile tap water was gently sprinkled to moisten the 
upper soil layer b see next page 

A.C. Kharkwal et al, 

agar disk infested with 
spores & hyphae 

Fig. 16.4 (continued) b Polyethylene pots (0.5 kg capacity) contained an autoclaved sand and soil 
mixture (1:3) at pH 7.0. Stage i Culture inoculum in Petri dish consisting of spores and hyphae. 
Stage ii A hole was made in the centre of the pot, up to 2 cm deep, with the help of a surface-steril- 
ized, specially designed plastic rod. An agar disc (4 mm diameter) infested with spores and hyphae 
was placed in the hole. Stage Hi Micropropagated plantlets were inserted into the hole in an upward 
direction and the top was covered with the same substratum. A little sterile tap water was gently 
sprinkled to moisten the upper soil layer 

Members of the Sebacinaceae have been found to be associated with a large 
number of mono- and dicotyledonous plants. Their interactions have shown 
growth promotion in diverse plant genera. P. indica and S. vermifera are root 
endosymbionts that can be considered as model organisms to study the hidden 
mystery of mycorrhizal world, since these fungi mimic the AM fungal charac- 

16. Co- Cultivation with Sebacinales 

The axenic cultivability of Sebacinales members P. indica and S. vermifera 
makes them ideal tools for further bio technological exploitation. They serve as 
excellent organisms for biotechnological applications in the fields of agricul- 
ture, forestry, flori-horticulture, viticulture and arboriculture. They can also be 
used for the synthesis of herbicides, weedkillers, pesticides and several enzymes 
of industrial importance. Functionally, co- cultivation with P. indica not only 
promotes plant growth but also increases the plants active constituents and en- 
hances disease resistant. It is also an excellent biological hardening agent and 
the fungus renders an above 90% survival rate in tissue culture transplantation 
plants. Axenic cultivation of P. indica is very simple and the fungus can be nor- 
mally multiplied on a variety of cheap media within a very short time and can 
be produced on a large scale. The axenically produced fungal inoculum can be 
directly used for co -cultivation under greenhouse and field conditions. 

APHA (1978) Standard methods for examination of dairy products, 14th edn. APHA, Wash- 
ington, D.C. 
Auge RM (2000) Stomatal behavior of arbuscular mycorrhizal plants. In: Kapulnik Y, Douds 

DD (eds) Arbuscular mycorrhizas: physiology and function, pp 201-237 
Azcon R, Ocampo JA (1981) Factors affecting the vesicular- arbuscular mycorrhizal infection 

and mycorrhizal dependency of wheat cultivars. New Phytol 87:677-685 
Bandoni RJ (1984) The Tremellales and Auriculariales and alternative classification. Trans 

Mycol Soc Jpn 25:489-530 
Baylis NTJ (1995) Statistical methods in biology. Cambridge University Press, Cambridge 
Berch SM, Allen TR, Berbee ML (2002) Molecular detection, community structure and phy- 

logeny of ericoid mycorrhizal fungi. Plant Soil 244:55-66 
Bidartondo MI, Burghardt B, Gebauer G, Bruns TD, Read DJ (2004) Changing partners in 

the dark: isotopic and molecular evidence of ectomycorrhizal liaisons between forest 

orchids and trees. Proc R Soc Lond 271:1799-1806 
Blechert O, Kost G, Hassel A, Rexer R-H, Varma A (1999) First remarks on the symbiotic 

interactions between Piriformospora indica and terrestrial orchids. In: Varma A, Hock B 

(eds) Mycorrhizae, 2nd edn. Springer, Berlin Heidelberg New York, pp 683-688 
Borowicz VA (2001) Do arbuscular mycorrhizal fungi alter plant-pathogen relations? Ecol- 
ogy 82:3057-3068 
Bucking H, Heyser W (2003) Uptake and transfer of nutrients in ectomycorhizal associations: 

interactions between photosynthesis and phosphorus nutrition. Mycorrhiza 13:59-69 
Denison RD, Bledsoe C, Kahn M, Gara FO, Simms EL, Thomashow LS (2003) Cooperation in 

the rhizosphere and the free rider problem. Ecology 84:838-845 
Feldmann F, Idczak E (1994) Inoculum production of vescicular- arbuscular mycorrhizal 

fungi for use in tropical nurseries. In: Norris JR, Read DJ, Varma A (eds) Methods in 

microbiology, vol 24. Academic, London, pp 339-358 
Gallowey LD, Burgess R (1962) Applied mycology and bacteriology, 3rd edn. Hill, London, 

pp 54-57 
Gamborg OL, Phillips GC (1996) Sterile techniques. In: Gamborg OL, Phillips GC (eds) Plant 

cell tissue and organ culture. Narosa, New Delhi, pp 67-79 

A.C. Kharkwal et al. 

Garnica S, Weifi M, Oertel B, Oberwinkler F (2003) Phylogenetic relationships of European 
Phlegmacium species (Cortinarius, Agaricales). Mycologia 95:1155-1170 

Gerdemann JW (1975) Vesicular- arbuscular mycorrhizae. In: Torrey JG, Clarkson DT (eds) 
The development and function of roots. Academic, London, pp 575-591 

Gianinazzi- Pearson V, Branzanti B, Gianinazzi S (1989) In vitro enhancement of spore ger- 
mination and early hyphal growth of a vesicular- arbuscular mycorrhizal fungus by host 
root exudates and plant flavonoids. Symbiosis 7:243-255 

Giovannetti M, Sbrana C (1998) Meeting a non-host: the behaviour of AM fungi. Mycorrhiza 

Harrison M (1999) Molecular and cellular aspects of the arbuscular mycorrhizal symbiosis. 
Annu Rev Plant Physiol Plant Mol Biol 50:361-389 

Hazarika BN (2003) Acclimatization of tissue- cultured plants. Curr Sci 85:1704-1712 

Herrmanns S, Oelmuller R, Buscot F (2004) Manipulation of the onset of ectomycorrhiza for- 
mation by indole-3-acetic acid, activated charcoal or relative humidity in the association 
between oak microcuttings and Piloderma croceum: influence on plant development and 
photosynthesis. J Plant Physiol 161:509-517 

Hill TW, Kafer E (2001) Improved protocols for Aspergillus minimal medium: trace element 
and minimal medium salt stock solutions. Fungal Genet Newsl 48:20-21 

Hoagland DR, Arnon DI (1938) The water-culture method for growing plants without soil. 
Univ Calif Agric Exp Stn Circ 1938:346 

Johnson CN, Stout PR, Broyer RC, Carlton AB (1957) Comparative chlorine requirements of 
different plant species. Plant Soil 8:337-353 

Kaldorf M, Koch B, Rexer K-H, Kost G, Varma A (2005) Patterns of interaction between 
Populus Esch5 and Piriformospora indica: a transition from mutualism to antagonism. 
Plant Biol 7:210-218 

Koide RT, Mosse B (2004) A history of research on arbuscular mycorrhiza. Mycorrhiza 

Kumari R, Yadav HK, Bhoon YK, Varma A (2003) Colonization of cruciferous plants by Piri- 
formospora indica. Curr Sci 85:1648 

Kumari R, Pham GH, Sachdev M, Garg AP, Varma A (2004) Symbiotic fungi for eco friendly 
environment: a prospective, natural product radiance. CSIR 3:396-400 

McKendrick SL, Leake JR, Taylor DL, Reed DJ (2002) Symbiotic germination and develop- 
ment of the myco-heterotrophic orchid Neottia nidus-avis in nature and its requirement 
for locally distributed Sebacina spp. New Phytol 154:233-247 

Menge JA, Johnson ELV, Piatt RG (1978) Mycorrhizal dependency of several citrus cultivars 
under three nutrient regimes. New Phytol 81:553-559 

Newsham KK, Fitter AH, Watkinson AR (1995) Multifunctionality and biodiversity in arbus- 
cular mycorrhizas. Trends Ecol Evol 10:407-411 

Oelmuller R, Shahollari B, Peskan-Berghofer T, Trebicka A, Giang PH, Sherameti I, Oudhoff 
M, Venus Y, Altschmied L, Varma A (2004) Molecular analyses of the interaction be- 
tween Arabidopsis roots and the growth-promoting fungus Piriformospora indica. Endo- 
cytobios Cell Res 15:504-517 

Oelmuller R, Peskan-Berghofer T, Shahollari B, Trebicka A, Sherameti I, Varma A (2005) 
MATH- domain proteins represent a novel protein family in Arabidopsis thaliana and 
at least one member is modified in roots in the course of a plant/microbe interaction. 
Physiol Plant 124:152-166 

Pennisi E (2004) The secret life of fungi. Science 304:1620-1622 

Peskan-Berghofer T, Shahollari B, Giang PH, Hehl S, Markent C, Blank V, Kost G, Varma 
A, Oelmueller R (2004) Association of Piriformospora indica with Arabidopsis thaliana 
roots represent a novel system to study beneficial plant-microbe interactions and in- 
volve in early plant protein modifications in the endocytoplasmic reticulum and in the 
plasma membrane. Physiol Plant 122:465-471 

16. Co- Cultivation with Sebacinales 

Pham GH, Singh AN, Malla R, Kumari R, Saxena AK, Rexer K-H, Kost G, Luis P, Kaldorf M, 
Buscot F, Herrmann S, Peskan T, Oelmuller R, Mittag M, Declerck S, Hehl S, Varma A 
(2004a) Interaction of Piriformospora indica with diverse microorganisms and plants. 
In: Varma A, Abbott L, Werner D, Hampp R (eds) Plant surface microbiology. Springer, 
Berlin Heidelberg New York, pp 237-266 

Pham GH, Kumari R, Singh An, Kaldorf M, Buscot F, Oelmuller R, Tatjana P, Weiss M, 
Hampp R, Varma A (2004b) Axenic cultures of Piriformospora indica. In: Varma A, Ab- 
bott L, Werner D, Hampp R (eds) Plant surface microbiology. Springer, Berlin Heidel- 
berg New York, pp 593-615 

Plenchette C, Fortin JA, Furlan V (1983) Growth responses of several plant species to mycor- 
rhizae in a soil of moderate P-fertility 1: mycorrhizal dependency under field conditions. 
Plant Soil 70:199-209 

Prasad R, Pham GH, Kumari R, Singh A, Yadav V, Sachdev M, Peskan T, Hehl S, Oelmuller 
R, Varma A (2005) Sebacinaceae: culturable mycorrhiza-like endosymbiotic fungi and 
their interaction with non- transformed and transformed roots. In: Declerck S (ed) Root 
organ culture of mycorrhizal fungi. Springer, Berlin Heidelberg New York, pp 291-312 

Rai M, Varma A (2005) Arbuscular mycorrhiza-like biotechnological potential of Pirifor- 
mospora indica, which promotes the growth of Adhatpda vasica Nees. J Biotechnol 

Rai MK, Singh A, Arya D, Varma A (2001) Positive growth responses of Withania somnifera 
and Spilanthes calva were cultivated with Piriformospora indica in field. Mycorrhiza 

Rai MK, Varma A, Pandey AK (2004) Enhancement of antimycotic potential in Spilan- 
thes calva after inoculation of Piriformospora indica, a new growth promoter. Mycoses 

Rajapakse S, Miller JC Jr (1988) Relationship between cowpea root systems and mycorrhizal 
dependency. Hortic Sci 23:568-570 

Read DJ (1999) Mycorrhiza: the state of the art. In: Varma A, Hock B (eds) Mycorrhiza: struc- 
ture, function, molecular biology and biotechnology, 2nd edn. Springer, Berlin Heidel- 
berg New York, pp 3-34 

Sahay NS, Varma A (1999) Piriformospora indica: a new biological hardening tool for micro- 
propagated plants. FEMS Microbiol Lett 181:297-302 

Sahay NS, Varma A (2000) Biological approach towards increasing the survival rates of mi- 
cropropagated plants. Curr Sci 78:126-129 

Sanders I (2003) Preference, specificity and cheating in the arbuscular mycorrhizal symbiosis. 
Trends Plant Sci 8:143-145 

Selosse MA, Bauer R, Moyersoen B (2002a) Basal hymenomycetes belonging to Sebacinaceae 
are ectomycorrhizal on temperate deciduous trees. New Phytol 155:183-195 

Selosse MA, Weifi M, Jany JC, Tillier A (2002b) Communities and populations of sebacinoid 
basidiomycetes associated with the achlorophyllous orchid Neottia nidus-avis (L.) LCM 
Rich and neighbouring tree ectomycorrhizae. Mol Ecol 11:1831-1844 

Shahollari B, Varma A, Oelmiieller R (2005) Expression of receptor kinase in roots is stimu- 
lated by the basidiomycete Piriformospora indica and the protein accumulates in Triton- 
X-100 insoluble plasma membrane microdomains. J Plant Physiol 162:945-958 

Singh AR, Rexer K-H, Varma A (2000) Plant productivity determinants beyond minerals, 
water and light. Curr Sci 79:101-106 

Singh AN, Singh A, Malla R, Ghosh S, Varma A (2002a) Symbiotic fungi: a boon for plant 
industry. In: IIT (ed) Conference on biotechnology - the science and the business. IIT/ 
AIBA, New Delhi, pp 52-55 

Singh AR, Singh AN, Varma A (2002b) Piriformospora indica - in vitro raised legumi- 
nous plants: a new dimension in establishment and phytopromotion. Ind J Biotechnol 

A.C. Kharkwal et al. 

Singh AN, Singh AR, Kumari M, Kumar S, Rai MK, Sharma AP, Varma A (2003a) AMF- 
like fungus: Piriformospora indica - a boon for plant industry. In: Prasad BN (ed) Bio- 
technology in sustainable biodiversity and food security, Science Publishers, Enfield, pp 

Singh AN, Singh AR, Kumari M, Rai MK, Varma A (2003b) Biotechnology importance of 
Piriformospora indica - a novel symbiotic mycorrhiza-like fungus: an overview. Ind J 
Biotechnol 2:65-75 

Siqueira JO, Safir GR, Nair MG (1991) Stimulation of vesicular- arbuscular mycorrhiza for- 
mation and growth of white clover by flavonoid compounds. New Phytol 1 18:87-93 

Urban A, Weifi M, Bauer R (2003) Ectomycorrhizae involving sebacinoid mycobionts. Mycol 
Res 107:3-14 

Varma A, Schuepp H (1995) Mycorrhizae, their applications in micropropagated plantlets. 
Crit Rev Biotechnol 15:313-328 

Varma A, Verma S, Sudha A, Sahay NS, Franken P (1999) Piriformospora indica, a cultivable 
plant growth promoting root endophyte with similiarities to arbuscular mycorrhizal 
fungi. Appl Environ Microbiol 65:2741-2744 

Varma A, Rai MK, Sudha A, Sahay N (2000) Microbial biotechnology: new paradigms and 
role in sustainable agriculture. In: Rajak RC (ed) Microbial biotechnology for sustainable 
development and productivity. Scientific Publishers, New Delhi, pp 22-37 

Varma A, Singh A, Sudha A, Sahay NS, Sharma J, Roy A, Kumari M, Rana D, Thakran S, 
Deka D, Bharti K, Hurek T, Blechert O, Rexer K-H, Kost G, Hahn A, Maier W, Walter M, 
Strack D, Kranner I (2001) Piriformospora indica-. an axenically culturable mycorrhiza- 
like endosymbiotic fungus. In: Hock B (ed) The Mycota IX. Springer, Berlin Heidelberg 
New York, pp 125-150 

Varma A, Singh AR, Sudha A, Sahay NS, Kumari M, Bharati K, Sarbhoy AK, Maier W, Walter 
MH, Strack D, Franken P, Singh AN, Malla R, Hurek T (2002) Piriformospora indica-. a 
plant stimulator and pathogen inhibitor arbuscular mycorrhiza-like fungus. In: Markan- 
dey DK, Markandey NR (eds) Microorganisms in bioremediation. Capital Book, New 
Delhi, pp 71-89 

Verma S, Varma A, Rexer K-H, Hassel A, Kost G, Sarbhoy A, Bisen P, Buetehorn P, Fran- 
ken P (1998) Piriformospora indica gen. nov, a new root- colonizing fungus. Mycologia 

Waller F, Achatz B, Baltruschat H, Fodor J, Becker K, Fischer M, Heier T, Hiickelhoven R, 
Neumann C, Von Wettstein D, Franken P, Kogel K-H (2005) The endophytic fungus 
Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and 
higher yield. Proc Natl Acad Sci USA 102:13386-13391 

Warcup JH (1988) Mycorrhizal associations of isolates of Sebacina vermifera. New Phytol 

Warcup JH, Talbot PHB (1967) Perfect states of Rhizoctonias associated with orchids. New 
Phytol 66:631-641 

Weifi M, Oberwinkler F (2001) Phylogenetic relationships in Auriculariales and related 
groups - hypotheses derived from nuclear ribosomal DNA sequences. Mycol Res 

Wells K, Bandoni RJ (2001) Heterobasidiomycetes. In: Mclaughlin DJ, McLaughlin EG, 
Lemke PA (eds) The Mycota VII. Systematics and evolution, part B. Springer, Berlin Hei- 
delberg New York, pp 85-120 

Quantitative Histochemistry: 

a Forgotten Tool with New Applications 

R. Hampp and S. Haag 

Biological tissues are not homogenous; instead they consist of cells having spe- 
cific functions. A typical bifacial leaf, for example, contains not only photosyn- 
thetic mesophyll cells (palisade parenchma, spongy parenchyma) but also epi- 
dermal, guard and bundle sheath cells, as well as conducting elements. They all 
have defined functions, which indicate profound biochemical differences be- 
tween adjacent cells. Such differences are obliterated by tissue homogenation, 
which precedes most analytical biochemistry. This is even more a problem when 
different organisms come into close vicinity such as in symbiotic interactions. 
The roots of most plants form such symbiotic structures with soil fungi (mycor- 
rhiza). Here, fungal hyphae either grow along the surface of fine roots or pen- 
etrate root cortex cells, forming structures which extend their surface area for 
solute exchange (arbuscular mycorrhiza), or produce a hyphal mantle covering 
the surface of the fine root and connected with hyphae penetrating the cell wall 
of root cortex cells, thereby forming finger-like structures (Hartig net). This net 
also greatly increases the surface area available for solute exchange between fun- 
gus and host (the ectomycorrhiza). Here also, simple tissue homogenation does 
not reveal the biochemical properties of the respective organisms. Biologists 
have thus been challenged to develop methods that allow for selective sampling 
of specific cell types and analysis of the resultant small amounts of material. 

A general problem is the conservation of the metabolic state of the intact 
organ. Ideally, biochemical analysis would be non-invasive, but this goal is elu- 
sive. Unaltered cells are difficult to isolate, and even when they can be isolated, 
intact membranes limit the uptake of reaction components. Thus, histochemical 
approaches include various implementations of chemical fixation, embedding, 

University of Tubingen, Physiological Ecology of Plants, Auf der Morgenstelle 1 
72076 Tubingen, Germany, email: 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

R. Hampp and S. Haag 

or freeze stop. Because of its wider utility, we generally use the last method in 
our research. Although written more than 30 years ago "A flexible system of en- 
zymatic analysis" (Lowry and Passonneau 1972) is still the "bible" in this re- 
spect. In this publication, the reader can find most of the important details of 
procedures which are not specifically referenced in this chapter. 

Sample Preparation and Handling 

1 . Freeze stop of mycorrhiza: 

We generally develop mycorrhized roots in Petri dishes, in which fungal sus- 
pensions are added to already developed sterile roots of seedlings, the shoots 
of which are outside the Petri dish (Hampp et al. 1996). When mycorrhizae 
are well developed, the Petri dish is opened and flooded with liquid N 2 . This 
approach is the preferred method of quenching tissue because it stops en- 
dogenous reactions immediately. Under regular conditions, liquid N 2 is at its 
boiling temperature. The resulting gas layer between liquid N 2 and the sample 
insulates it and thus slows freezing. This effect can be reduced by precool- 
ing liquid N 2 to its freezing point (-210 °C) by evacuation (a Dewar flask is 
sealed with a rubber and connected to vacuum pump by an insulated copper 
tubing). Safety note: due to the condensation of 2 from the air into the liq- 
uid N 2 (which can form an explosive mixture), the Dewar flasks should not 
be open for extended periods of time. 

2. Storage of frozen tissue: 

Storage temperatures must be low enough to prevent ice crystal growth, 
metabolic activities and diffusion of solutes. In general, frozen tissues can be 
stored without significant losses or metabolic alterations for several months 
at -50 °C or below. We routinely keep our samples at -80 °C. 

3. Freeze-drying: 

The principles and equipment of freeze-drying are simple. In outline, the 
samples are transferred to a -35 °C to -40 °C compartment (commercial 
kitchen freezer at "super frost") and dried by reducting the pressure to around 
10" 3 mbar (100 Pa). The vacuum pump and the sample compartment are sep- 
arated by a cold trap. This can either be a container with dry ice (cheap) or a 
freezer working at around -100 °C. 

4. Storage of freeze-dried material: 

Dried tissue is stable at -20 °C, if stored under vacuum. To avoid the entry of 
water into the sample container upon admitting air, the orifice of the sample 
container has to be plugged before storage in a frost-free freezer (a "no frost" 
freezer). If this precaution is not taken, water condensing inside the orifice 
while the sample container is warming up could be sucked in upon releas- 

17. Quantitative Histochemistry: a Forgotten Tool with New Applications 273 

ing the vacuum. This can ruin the samples. Samples should only be removed 
when they have reached ambient temperature. Exposure to ambient condi- 
tions (more than 40% relative humidity, more than 20 °C) should be kept to 
a minimum. 

5. Dissection of tissue: 

The room used for tissue dissection should be air-conditioned and not exceed 
40% relative humidity or 20 °C stored samples are taken from the respective 
container under the precautions mentioned above. For handling, the samples 
are transferred to a piece of translucent Plexiglass, which rests on the stage of 
a stereomicroscope. As small samples are subject to static electricity, the latter 
can make handling a pain. Charges can be eliminated by spraying surfaces 
and tools with ionized air (ionizing compressed-air "guns" are commercially 
available). Alternatively, suitable radiation sources can be used (discs or bars 
containing 241 Americium or 210 Polonium). 

a. Sample transfer and dissection require special tools. Large samples (> 1 |ig; 
a freeze-dried poplar mycorrhiza weighs between 10 |ig and 15 ug) are 
handled with commercial preparatory needles. Smaller samples are han- 
dled with hair points. Such tools are made from Pasteur pipettes, the cap- 
illary tips of which are cut off. After fire-polishing the end, a curved hair 
is epoxyed onto it. Glueing a fine quartz fiber (2-5 urn diameter) to the 
hair points yields a small tip (for the production of glass fibers, see Lowry 
and Passonneau 1972). 

b. Different sizes of knives are needed for different operations. Larger sam- 
ples such as whole mycorrhizas can be cut into smaller sections with a 
scalpel or an ordinary razor blade. Smaller knives are made as follows: 
the cutting edge from a ordinary razor blade (about 2 mm wide) is cut 
from the rest of the blade by a paper cutter (a pair of heavy scissors will 
also do). Each sliver is then cut into pieces of 1-2 mm length. A fragment 
is epoxyed onto a nylon bristle (taken from a tooth brush), which is then 
glued to the trimmed metal end of a preparation needle. Care has to be 
taken to keep the blades free of rust (storage in a box with dry pearls) and 
of grease. The latter can be removed by successive washes with ethanol 
and acetone. 

6. Collection and transfer of samples: 

Dissected samples are collected on a transfer platform from the microscope 
stage (see Lowry and Passonneau 1972). In principle the platform consists 
of a wooden handle to which a 3- to 6-mm wide strip of a glass cover slip is 
glued (Fig. 17.1). Under a dissecting microscope, the samples are arranged in 
a single row parallel to the leading edge of the cover slip. To keep them clean 
and to prevent sample loss, the platforms are kept in (glass) Petri dishes (poly- 
styrene dishes build up electrical charges which can dissipate the samples). 

7. Determination of sample mass 

As the entire sample is used for analysis, sample mass is the only feasible refer- 
ence. Mass, however, can vary considerably between samples due to changes 

R. Hampp and S. Haag 

Fig. 17.1 Transfer platform 
for small samples fixed in 
front of the quartz fiber 
balance housing 

in cell wall thickness. It is thus advisable to establish mass per protein, etc., 
conversion factors with comparable samples on a larger-scale sample (com- 
pare Outlaw et al. 1981). Owing to the generally small size of sample, con- 
ventional balances are not suitable. Instead, quartz fibre balances are used. 
These consist of a quartz fibre with a diameter in the lower micron range, 
contained in a glass syringe housing. For fabrication, the lower end of the 
syringe barrel is cut off. At the lower end of the plunger, a short piece of cop- 
per wire is attached with epoxy resin. Then the plunger is inserted all the way 
into the barrel until the copper wire is exposed at the other end. The quartz 
fiber is then expoxyed to the copper wire, and the fiber is withdrawn into 
the body of the syringe for protection and to avoid turbulence from air cur- 
rents. Details on balance construction, ranges of sensitivity and calibration 
can be found in Lowry and Passonneau (1972). For our mycorrhiza samples, 
we use balance capacities of about 1 ug. Figure 17.2 details some steps about 
sample handling. Samples (Fig. 17.2a) arranged on a glass cover slip (com- 
pare Fig. 17.1) are transferred by means of a pointed tip to the end of the 
quartz fiber (Fig. 17.2b) contained in the glass syringe housing (Fig. 17.2c). 
The whole process is viewed by a horizontal stereomicroscope (Fig. 17.2d). 
Deflection of the fiber tip upon sample transfer is monitored by a calibrated 
microscale contained in one of the oculars (for calibration, see Lowry and 
Passonneau 1972). 

The sample chambers consist of a 5 mm thick Teflon tray with holes of 3 mm 
diameter. The holes are closed by a thin Teflon film stretched across the lower 

17. Quantitative Histochemistry: a Forgotten Tool with New Applications 275 

Fig. 1 7.2 Arrangements for sample weigh- 
ing: a freeze-dried ectomycorrhiza (fly 
agaric/ aspen) cut into sections (tip at left, 
base at right), b sample applied to the end 
of a quartz fiber, which is (c) contained 
in a volumetric pipette housing. After 
sample transfer, the latter is covered by a 
spring-suspended glass slide to avoid air 
turbulences inside the housing during 
weighing. Deflection of the glass fiber tip by 
the weight of the sample is determined by a 
microscale inside the ocular of a horizontal 
stereo microscope (d). Illumination is by 
glass fiber optics. The wooden beam seen in 
(d) is fixed independently of the balances 
and is used as a hand rest during manipula- 

end and fixed by insertion of Teflon tubing, with an outer diameter identical to 
the hole diameter. The Teflon membrane used is selected according to minimal 
fluorescence. The membrane supplied by Hansa Tech (UK) for use with their 
oxygen electrodes meets the requirements (Sauer, Reutlingen, Germany). 

In a practical assay, to avoid evaporation, the wells were filled with 10 |J of 
purified light mineral oil (Sigma, Taufkirchen, Germany). Using glass constric- 
tion pipettes, 2 (il of the assay cocktail were submerged in the oil. Subsequently, 
the tissue sample was pushed through the oil into the assay droplet by means 
of a tiny quartz fibre glued to a glass or wooden handle. Contact with the assay 
cocktail was indicated by a color change due to wetting of the sample. The whole 
Teflon tray was then transferred to the stage of the inverted microscope. The 
objective lens (PL Fluotar, Leitz; 40x/0.70 EF) was focused to a layer above the 

R. Hampp and S. Haag 

Fig. 1 7.3 Example of the ki- 
netics of neutral trehalase 
after digitizing of the pho- 
tomultiplier signals 

Teflon membrane within the brightest area of the droplet, avoiding any shadow- 
ing by the sample. The excitation light (Hg lamp HBO 103W/2; Leitz, Bensheim, 
Germany) was passed to the assay droplet by an excitation filter (330-380 nm) 
and reflected by a dichroic mirror (<400 nm). For exact details, see Outlaw et al. 
(1985). The analog signal resulting from the photomultiplier tube was digitized 
by an AD converter (Logger Pro, Vernier, Canada) and made visible as a kinet- 
ics graph on a PC screen (Fig. 17.3). 

Biochemical Analysis: Real Time Microassays 

Due to the small amounts of sample material, usually about 1 |ig dry weight, 
photometer signals resulting from NADH fluorescence in microdroplets were 
recorded. For this purpose a photomultiplier connected to an inverted micro- 
scope was used, principally as outlined by Outlaw et al. (1985). 

1. Sample preparation: 

Freeze-dried mycorrhizae (Fig. 17.4) were cut into four or five pieces of about 
equal length with microknives and weighed with a glass fiber balance in a 
conditioned room (40% RH, 20 °C). 

2. Enzyme assays. 

a. Trehalose phosphate synthase: 

The assay was carried out according to Vanderkammen et al. (1989; 
method 2). A total volume of 2 \A contained HEPES (50 mM, pH 7.6), 
glucose 6-phosphate (40 mM), MgCl 2 (2 mM), NADH (0.6 mM), phos- 

17. Quantitative Histochemistry: a Forgotten Tool with New Applications 277 

Fig. 17.4 Source of the ectomycorrhizas investigated. The ectomycorrhizas (swollen fine roots, ar- 
rows) were obtained by inoculation of the roots of aspen seedlings developed inside a Petri dish 
with a cell suspension of fly agaric. The photograph shows the root system after lyophilization 

phoeno/pyruvate (1.5 mM), lactate dehydrogenase (2 units), pyruvate ki- 
nase (2 units), and UDP glucose (1.7 mM). 
b. Neutral trehalase: 

Enzyme activity was assayed as glucose produced from trehalose hydroly- 
sis. Glucose was quantified enzymatically via phosphorylation by hexoki- 
nase and subsequent oxidation by NADP-dependent glucose 6-phosphate 
dehydrogenase (Jones et al. 1981). The assay volume was 2 |il, submersed 
below light mineral oil by means of a 2- ul- constriction pipette. 

Spatial Resolution of Basic Steps 

of Fungal Trehalose Metabolism in Symbiosis 

Trehalose, a non-reducing disaccharide consisting of two molecules of glucose, 
is present in most organisms except vertebrates (Benaroudj et al. 2001). It plays 
an important role as a protectant against abiotic stress. In mycorrhiza-form- 

R. Hampp and S. Haag 

Fig. 1 7.5 Rates of activity of enzymes along four sections of single mycorrhiza of about 2.5 ug each. 
a Neutral trehalase, b trehalose phosphate synthase. The values given are means for 12 individual 
mycorrhizas (±SE). n.d. Not detectable 

ing fungi, trehalose constitutes an important intermediary form of carbohydrate 
storage (Smith and Read 1997). 

Key enzymes of turnover are trehalose phosphate synthase and neutral tre- 
halase (for a recent review, see Bonini et al. 2004). The balanced acivity of both 
enzymes determines the amount of trehalose within fungal cells. In an ecto- 
mycorrhiza, as formed between fly agaric and fine roots of poplar, there is a 

17. Quantitative Histochemistry: a Forgotten Tool with New Applications 279 

distinct distribution of both enzyme activities (Fig. 17.5). While, on a total dry 
weight basis, neutral trehalase is nearly equally distributed across all sections 
(Fig. 17.5a), trehalose phosphate synthase is most prominently present closely 
behind the growing tip of the fine root. The activity of this enzyme declines to- 
wards the base of the fine root, where it is no longer detectable (Fig. 17.5b). 

Other data obtained for the same sections (amounts of partner-specific car- 
bohydrates, enzyme activities; Hampp et al., unpublished data) clearly indicate 
highest fungal activities in zone Ml. 

The examples given are based on "macro dissection" as we only used relatively 
large parts of mycorrhizas. Spatial resolution can, however, largely be extended 
by cutting smaller parts (e.g. separation of the hyphal mantle from the Hartig 
net) and concomitantly decreasing the assay volume (see Outlaw et al. 1985). 

Part of this work presented was financed by a grant from the Deutsche 

Benaroudj N, Lee DH, Goldberg AL (2001) Trehalose accumulation during cellular stress 
protects cells and cellular proteins from damage by oxygen radicals. J Biol Chem 

Bonini BM, Van Dijck P, Thevelein JM (2004) Trehalose metabolism: enzymatic pathways 
and physiological functions. In: Brambl R, Marzluf GA (eds) The mycota III, biochemis- 
try and molecular biology. Springer, Berlin Heidelberg New York, pp 291-332 

Hampp R, Ecke M, Schaeffer C, Wallenda T, Wingler A, Kottke I, Sundberg B (1996) Axenic 
mycorrhization of wild type and transgenic hybrid aspen expressing T-DNA indoleace- 
tic acid-biosynthetic genes. Trees 11:59-64 

Jones MGK, Outlaw WH Jr, Lowry OH (1981) Enzymic assays of 10~ 7 to 10~ 14 moles of su- 
crose in plant tissues. Plant Physiol 60:379-383 

Lowry OH, Passonneau JV (1972) A flexible system of enzymatic analysis. Academic, New 

Outlaw WH Jr, Manchester J, Zenger V (1981) The relationship between protein content and 
dry weight of guard cells and other single cell samples of Viciafaba L. leaflet. Histochem 
J 13:329-336 

Outlaw WH Jr, Springer SA, Tarczynski MC (1985) Histochemical technique. A general 
method for quantitative enzyme assays on single cell extracts with a time resolution of 
seconds and a reading precision of femtomoles. Plant Physiol 77:659-666 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis. Academic, London 

Vanderkammen A, Francois J, Hers H-G (1989) Characterization of trehalose-6-phosphate 
synthase and trehalose-6-phosphate phosphatase of Saccharomyces cerevisiae. Eur J Bio- 
chem 182:613-620 

Ion Cyclotron Resonance Fourier 
Transform Mass Spectrometry for Non- 
Targeted Metabolomics of Molecular 
Interactions in the Rhizosphere 

P. Schmitt-Kopplin, N. Hertkorn, M. Frommberger, 
M. Lucio, M. Englmann, A. Fekete, and I. Gebefugi 

Plant health and quality is challenged by the attack of soil-borne pathogens and 
increased environmental stress. Therefore, a detailed understanding of mech- 
anisms and processes in the rhizosphere is essential to ensure, e.g. safe food 
production of high quality. The rhizosphere (the root zone of plants) is a very 
special environment and a region of extremely intense interaction of organisms 
of all taxonomic levels, and as such a chemical environment with a large num- 
ber of substances with different origin; either excreted by the organisms to their 
neighbourhood (bacteria, fungi and many other organisms as well as natural 
organic matter) or vice versa (Fig. 18.1; see also 

Metabolites of various interacting partners (plants, microbes, soil) in the 
rhizosphere constitute the chemical scenario of activation or inhibition (gene 
activation and control of metabolic and signalling pathways). Known signalling 
compounds of the plants, like salicylic acid, jasmonic acids and flavonoids and 
novel components of early response mediators or S-containing metabolites may 
have protective or signalling functions inside and/or outside the roots. Microbes 
excrete a variety of secondary compounds, like antibiotics of different chemical 
nature, siderophores or specific signalling molecules (i.e. phytohormones or N- 
acylhomoserine lactones; AHLs) to enable interacting with other microbes or 
the plant (Eberl 1999). AHL-mediated cross-talk is reported to be effective also 
across species borders within microbial communities (Pierson et al. 1998) and 
even between prokaryotes and eukaryotes (Mathesius et al. 2003; Schuhegger et 
al. 2006). 

GSF - Research Center for Environment and Health, Institute of Ecological Chemistry, 
Molecular BioGeoanalysis / BioGeomics, Ingolstadter LandstraCe 1, D-85764 Neuherberg, 
Germany, Fax: ++49-89-3187-3358, email: 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

P. Schmitt-Kopplin et al, 

P 1 3 fl t Fig. 18.1 Some important interacting 

partners studied in the rhizosphere 

Bacteria /^f^\ Fungi 

Natural organic matter 

These compounds induce specific gene expression in neighbouring microbes 
and the root, initiating specific responses. The soil environment also contributes 
to the metabolic scenario of the root/soil interface through water-soluble com- 
pounds released from the organic soil matrices. The analysis of these signal- 
ling molecules and the related soluble natural organic matter in the different 
ecological environments requires a combination of analytical approaches com- 
plementary in their resolution and sensitivity for a qualitative and quantitative 

The big challenge is in analytical chemistry to find the best tools to enable 
description of the chemical space and to understand the chemical regulations 
in living systems in general. Here we present our conceptual analytical approach 
to assess information on molecular interactions in the rhizosphere using non- 
targeted metabolomics with an integrated chemical biology approach; this implies 
the combination of complementary disciplines such as biology and chemistry, 
supported with analytical tools for a quantitative and qualitative assessment of 
selected metabolites and signalling molecules in the rhizosphere. 

The Chemical Biology Approach 

Chemical biology is a modern approach that utilizes the full spectrum and con- 
cepts of organic, physical, analytical and inorganic chemistry and mathemati- 

18. Metabolomics in the Rizosphere 

cal analysis for the examination of biological processes (Schreiber 2005). Small 
molecules play key roles at the core of life sciences, health and environment, 
including topics related to the origin of life, memory and cognition, sensing 
and signalling, modulation and regulation, cell circuiting and, along these lines, 
open novel avenues in the understanding and treatment of diseases. Protein in- 
teractions mediate the formation of specific small molecules, that themselves 
modulate many of the multiple individual functions of protein networks. Ad- 
ditional distinct small and macromolecules such as peptides, RNA, carbohy- 
drates, lipids and their covalent and non-covalent adducts (glycoproteins, lipo- 
saccharides, lipoproteins, etc.) are involved in interactions and modulations of 
molecular processes of life. Different disciplines have become merged under the 
umbrella of chemical biology, involving proteomics, glycobiology (Bertozzi and 
Kiessling 2001) and lipidomics (Wenk 2005); metabolomics represents a tool to 
describe the complement of small molecules and biomarkers involved in bio- 
logical processes with time and spatial resolution. 

Chemical biology has matured into an interdisciplinary approach with im- 
pulses from bioorganic chemistry (Kadereit et al 2000) and medical chemistry 
(Wess et al 2001), organic synthesis, structural biology, molecular and cell biol- 
ogy as well as biotechnology, microarray techniques and molecular informatics. 
The goal is to understand the effect of (de novo) small molecules in biological sys- 
tems and to use this knowledge to trigger these systems (Stockwell 2004). There- 
fore, chemical biology can also be regarded as an extension of medical chemistry 
and drug discovery to natural and living systems in general. The chemical biol- 
ogy approach is ideally applicable to study the complexity of the interactions 
between the different living and nonliving compartments occurring in the rhi- 
zosphere on a molecular level. 

Complementary Analytical Approaches 

Complementary approaches of analytical chemists need to be used and adapted 
in close interaction with soil scientists, soil microbiologists and biologists to 
reach the goals of the studying interactions in the rhizosphere on a molecular 
level. Adequate sampling and sample preparation (cleanup or concentration of 
target compounds) is followed with a separation of the analytes based on their 
structural properties (charge, size, hydrophilicity/hydrophobicity, etc.) and a de- 
tection strategy offering best sensitivity or best profiling properties (Fig. 18.2). 
The analytical platform is complemented with nuclear magnetic resonance spec- 
troscopy and ultrahigh resolution mass spectrometry for structural description 
on the molecular level. 

Different levels of the analytical approaches must be distinguished (Fig. 18.3): 
targeted analysis, metabolite profiling and non-targeted analysis. 

P. Schmitt-Kopplin et al, 

Sample : 

Plant tissue, 
microbial cells 
Complex matric 

Analytical / preparative 
separation techniques 

(CE. gel electrophoresis} 

(liquid or gas. column or 
thin layer ...} 

5 & 

Detection feelective/unsHectrve) 

Optica!; direct* indirect UV-Vis. 

Electrochemical: potentio metric. 

conductivity, amperometric 

Radioactivity (p) 

Mass selective: various 
Ionizations A PC I. APPI, ESI. 
El. APLI. MALDI .,. 

Fig. 18.2 Sample preparation, cleanup/concentration, separation and detection as a classic ap 
proach in analytical chemistry 

Targeted Analysis 

Quantitative evaluation of concentrations of chemicals (organic and inorganic, 
natural and anthropogenic, ambient to trace amounts) from various matrices 
after precise and adapted sample preparation (cleanup, concentration). 

The substances are of known chemical structures and of known or in-silico 
estimated physico-chemical properties. Each analytical approach allows the 
analysis of a few to a hundred components (multi-residue approach) per run. 
The use of standard chemicals (commercially available or synthesized) leads to 
the possible quantification of the analytes. Cleanup and sample pre-concentra- 
tion [e.g. Solid phase (micro)extraction; SPE] are the first steps in the analysis, 

18. Metabolomics in the Rizosphere 

- dcw teclmolosdes (FT/MS, NMR) 

- miniaturization (cliip teclmology, 
multiple cells analysis) 

timed leclinolosy 

- limited chemical classes 
< 100 components 

- uniltit esidtte analysis 

lion targeted 

Metabolite inventory 

Metabolite profiling 

Specific *omics 
Prate omics 

mixtures of chemical classes 
Up to > 10000 components 

classical techno logics , 
preparanv c/a ua K'fical 
effective sample preparation 
Low to high tlirougliput 

quantitative analysis 

qualitative approach 

Fig. 18.3 Illustration of the different levels in the analytical approach 

followed by electrophoretic or chromatographic separation (capillary electro- 
phoresis, electro chromatography, liquid chromatography, gas chromatography) 
and adapted detection (UV-Vis, fluorescence, mass spectrometry). 

Metabolite Profiling 

Here the targeted components are more in number and one focuses on classes 
of metabolites (i.e. lipids, sugars, peptides, proteins, etc.). The cleanup methods 
and instrumentation are tuned for these classes of compounds, based on their 
physico-chemical properties, and form the basis of the *Omics fields developed 
recently (lipidomics, glycomics, peptidomics, proteomics, etc.). The informa- 
tion is of a structural basis with further possible target quantification. Very often 
miniaturization of the separation techniques is a goal to enable high throughput 
(HTP) analysis for screening purposes. 

Non-Targeted Analysis 

Here new technologies are developed and optimized for a qualitative/semi-quan- 
titative evaluation of the presence of chemical classes in complex mixtures - the 
molecular inventory needed to allow process descriptions or the discovery of 

P. Schmitt-Kopplin et al. 

new biomarkers. Cleanup is done in such a way as to alter the sample as little 
as possible, trying to keep as much as structural information as possible in the 
complex samples. 

Within this last approach non-targeted metabolomics finds its place and high- 
end technologies such as nuclear magnetic resonance (NMR) spectroscopy and 
especially ion cyclotron resonance fourier transform mass spectrometry (ICR- 
FT/MS; which will be presented here in more detail) are ideal tools to get struc- 
tural information on a large quantity of components within one single sample. 

The combined use of microfluidic technologies for separation/cleanup and 
liquid microhandling, with new ionization techniques (APPI) and ultrahigh 
resolution mass spectrometry certainly are uniquely suited for identification 
of known and hitherto unknown metabolites and possible biomarkers in very 
complex samples and for the analysis of often unseparable mixtures. 

Resolving Structural Information from Molecular 
Complexity with ICR-FT/MS 

Because of its ultrahigh resolution in excess of 200 000 full width at half maxi- 
mum (FWHM) in broad band measurements (or up to 2 000 000 FWHM in 
ultrahigh resolution mode) and a mass accuracy of routinely less than 0.2 ppm, 
high field (12 Tesla) FTICR-MS allows for an advanced chemical characteriza- 
tion of metabolites of known and hitherto unknown structure in complex and 
heterogenous samples of biological origin like plant or bacteria cell extracts, 
natural or artificial oligo- and multispecies systems, or in complex mixtures de- 
rived from biological precursors: "in particular, systems in which very high mass 
measurement accuracy is required, very complex mixtures are to be analyzed, or 
very limited amounts of sample are available may be uniquely suited to interro- 
gation by FTICR mass spectrometry' (Hofstadler et al. 2005). The use of newly 
available on-chip nanoelectrospray ionization systems enables in addition an- 
other significant increase in sensitivity, a drastic reduction in sample amount 
and a more efficient ionization of low-abundant ions in the presence of highly 
abundant (matrix) species. The improvement in mass resolution is exemplified 
in Fig. 18.4 by comparing the mass profiles and details of a surface water natural 
organic matter (Suwannee river fulvic acids) as analysed with classic ion -trap 
technology and ICR-FT/MS. This profile is representative of the hydrophobic 
fraction that can be extracted from soil percolation water and shows already the 
complexity of the chemistry in the root zone. 

By setting sensible chemical constraints, FTICR-MS allows for the assign- 
ment of individual elemental compositions to most of up to 10 000 peaks from 
one single measurement across a sizable mass range. This information and the 
informative order of (changing) elemental composition patterns gives unprece- 
dented insight into, e.g. the nature of metabolites, their possible origin and their 

18. Metabolomics in the Rizosphere 

Ion Trap/MS 

Fig. 18.4 Comparison of ion trap MS and ICR-FT/MS of a natural organic matter (fulvic acid) 
showing the high resolving power of ICR-FT/MS 

function in an organism. Unlike in classic mass spectrometry, which in practice 
seldomly exceeds a resolution of 10 000 FWHM or a mass accuracy of 5 ppm, 
and even in comparison with low-field FTMS instruments (7 T), where typical 
values may be 100 000 FWHM and 1 ppm, respectively, strategies to compare 
different datasets are completely different in high-field FTMS. New ways of peak 
alignment and detecting similarity/dissimilarity in samples through new soft- 
ware algorithms and statistical methods are necessary. 

P. Schmitt-Kopplin et al. 

Nowadays, only a tiny fraction of the enormous datasets acquired with 
FTICR-MS are readily understood, and new and intuitive procedures have to 
be developed to extract molecular level structural information from complex 
natural mixtures of unknowns (metabolites, peptides, macromolecules, com- 
plex materials). 

Top-Down Approach: From ICR-FT/MS-Profiling Analysis 
to Structural Hypothesis 

For thousands up to tens of thousands of peaks from a single FTMS spectrum 
of a highly complex sample, a detailed description of the complexity itself and 
analysis of the presence (or absence) and of the consequences of the informative 
order in different visualization approaches is indispensable. 

The crucial point of meaningful data interpretation and the first step of the 
analytical process towards the above-mentioned identification of, e.g. signalling 
molecules, biomarkers or metabolites reacting (i.e. increasing, decreasing, ap- 
pearing or disappearing) in relation to environmental parameters, or existing in 
different taxonomic groups, is a detailed comparison of the datasets. 

A possible approach is illustrated in Fig. 18.5 with the profile of a complex 
growth medium based on agar (Fig. 18.5a) and that of the corresponding bac- 
terial extract on this medium (similar at first glance but full of differences in 
details, Fig. 18.5b). From the profiles, these peaks appearing in Fig. 18.5b can be 
picked out and assigned in elementary composition (CHONS) from their exact 
mass. The analysis of a sufficient number of samples is needed for a statistical 
approach, as illustrated in Fig. 18.6, and these tools can be used to answer a 
number of different open questions, e. g. in chemical taxonomy of micro-organ- 

■ » i<y ■ i ■ ■* i A ii 

Unique mass in b 

Exact mass 

Formula assignment 

— — ^^-^ — 

ih n 

Fig. 18.5 Positive electrospray ionization ICR-FT/MS of agar growth medium (a) and a bacterial 
groth (Burcholderia sepacia LA3) grown on agar (b). On the right is a possible comparison of the 
two complex mixtures and assignment of specific bacterial components 

18. Metabolomics in the Rizosphere 

ft * 

C4 ^ 

— ' u 

rt « g 

o-£ ■* H 

^ -a s 

oj 2 ^ 

>; H 

•i-H c/D 

2 5 

• i-H 

■ IB 

m iS! 

■ • - 
■ f . -,; 

- i5 

1 * 

' l km "fc— • ■ ■ 

*' LI- 

■ ■ 

2 o> 

1 8 II 

^ Q to Qc 

■ ■■>■■ 

■ '■■■■ 

• - 

l" '! 

■ ■>•■■■ 

|"f rni i" 
• ■ • ■ ■ ■ ■ t ■ r ■ ■ ■ i ■ i | i ■ * i i* i M ■ Mil 
I l| [ I ill 
ir Trrmrrr" 
\ nri 
iiinril iiiiiitiliilflilllilfi 
i f I I I i I I f * I J J i tl M M I i t p f f P i f m J t 

6 : ■ -Mil 

g > > IL toth 

2 -* ^ j S ^ 

U u »- « 

ifouoidd^ 9Ai;T?;Tji?nb 

P. Schmitt-Kopplin et al, 

isms, plant mutant analysis, metabolite detection in plant organs and their time- 
dependent translocation. 

Complementary Analytical Tools 

The ICR-FT/MS and NMR technologies generate enormous amounts of data (in 
comparison with other analytical approaches that rather average the structural 
information one can derive from them), that first need to go through a series 
of mathematical and statistical data mining and visualization algorithms prior 
squeezing out the essence of information. 

This is illustrated in Fig. 18.6. When choosing a non targeted approach, both 
ICR-FT/MS and NMR generate thousands of experimental values (chemical 
shift related to functional group and respectively exact mass assignable to an el- 
emental composition in C, H, O, N) per analysed variable (interaction partners, 
bacterial strain, interaction partner, time and space scales, etc.). For exploratory 
visualization, here hierarchical clustering analysis and the correlation matrix 
were used. The patterns or trends related to class separation could be detected 
by PLS discriminant analysis (PLS-DA). It was performed in order to sharpen 
the separation between groups of observations, by rotating principal compo- 
nents analysis (PCA) components such that a maximum separation among 
classes is obtained, and to understand which variables carry the class separating 

1 8.4.3 

Bottom-Up Approach: From Hypothesis-Driven Experiments 

Upwards to ICR-FT/MS 

Certain micro-organisms within the diverse soil microflora are able to interact 
specifically with plant roots. In the genera Burkholderia and Pseudomonas, e.g. 
many root-associated strains (plant protective or pathogenic) but also human 
pathogens are known. It has recently been found that signalling molecules of 
the iV-acylhomoserine lactone (AHL) type also trigger responses similar to in- 
duced systemic resistance in plant roots. Looking for AHL signalling molecules 
in complex media involves target analysis strategies described above using clas- 
sic chromatographic approaches and in-silico separation simulation. ICR-FT/ 
MS can be used here as a tool for confirmation of the presence of the one or the 
other AHL molecule through exact mass determination. As already pointed out 
by others (Kind and Fiehn 2006), a mass accuracy of even less than 1 ppm alone 
may not be high enough for the assignment of one unique elemental formula to 

18. Metabolomics in the Rizosphere 

c - 

P. Schmitt-Kopplin et al. 

an exact mass, when, like in the present bacterial extracts, a plethora of possible 
structures can be expected. Thus especially the combination of exact mass mea- 
surements by ultrahigh resolution mass spectrometry with chromatographic 
data from ultrahigh resolution separation gives unprecedented insight into the 
nature of metabolites, their possible origin and their function in an organism 
confronted with pathogens or symbiotic partners (Fig. 18.7). 

As a result of the considerations above, it should become clear that chemical 
analysis of the rhizosphere, in which FTICR-MS can play a decisive role, should 
always be part of an interdisciplinary approach involving biologists, chemists 
and biomathematicians, as it requires the development of new sampling strate- 
gies, new ways of sample preparation, new strategies for the analysis itself, and, 
maybe as the most important part, new ways of data interpretation in a mean- 
ingful way. 

Bertozzi C, Kiessling L (2001) Chemical Glycobiology. Science 291:2357-2364 

Eberl L (1999) N-Acyl homoserinelactone-mediated gene regulation in Gram- negative bac- 
teria. Syst Appl Microbiol 22:493-506 

Hofstadler SA, Sampath R, Blyn LB, Eshoo MW, Hall TA, Jiang Y, Drader JJ, Hannis JC, 
Sannes-Lowery KA, Cummins LL, Libby B, Walcott DJ, Schink A, Massire C, Ranken R, 
Gutierrez J, Manalili S, Ivy C, Melton R, Levene H, Barrett- Wilt G, Li F, Zapp V, White 
N, Samant V, McNeil JA, Knize D, Robbins D, Rudnick K, Desai A, Moradi E, Eckera DJ 
(2005) TIGER: the universal biosensor. Int J Mass Spectrom 242:23-41 

Kadereit D, Kuhlmann J, Waldmann H (2000) Linking the field - the interplay of organic 
synthesis, biophysical chemistry, and cell biology in the chemical biology of protein lipi- 
dation. Chem Biochem 1:144-169 

Kind T, Fiehn T (2006) Metabolomic database annotations via query of elemental composi- 
tions: mass accuracy is insufficient even at less than 1 ppm. BMC Bioinformatics 7:234 

Mathesius U, Mulders S, Gao M, Teplitski M, Caetano-Anolles G, Rolfe BG, Bauer WD 
(2003) Extensive and specific responses of a eukaryote to bacterial quorum- sensing sig- 
nals. Proc Natl Acad Sci USA 100:1444-1449 

Pierson EA, Wood DW, Cannon JA, Blachere FM, Pierson LS (1998). Interpopulation signal- 
ing via N-acyl-homoserine lactones among bacteria in the wheat rhizosphere. Mol Plant 
Microbe Interact 11:1078-1084 

Schreiber SL (2005) Small molecules: the missing link in the central dogma. Nat Chem Biol 

18. Metabolomics in the Rizosphere 

Schuhegger R, Ihring A, Gantner S, Bahnweg G, Knappe C, Vogg G, Hutzler P, Schmid M, 
Van Breusegem F, Eberl L, Hartmann A, Langebartels C (2006) Induction of systemic re- 
sistance in tomato plants by N-acylhomoserine lactone-producing rhizosphere bacteria. 
Plant Cell Environ 29:909-918 

Stockwell B (2004) Exploring biology with small organic molecules. Nature 432:846-854 

Wenk MR (2005) The emerging field of lipidomics. Nature 4:594-610 

Wess G, Urmann M, Sickenberger B (2001) Medizinische Chemie: Herausforderung und 
Chancen. Angew Chem 113:3443-3453 

Application of Terminal-Restriction 
Fragment Length Polymorphism 
for Molecular Ana lysis of Soil Bacterial 

A. Mengoni, E. Giuntini, and M. Bazzicalupo 

DNA-based techniques have become a powerful tool for studying the diversity 
and the composition of soil bacterial communities in cultivation-independent 
ways (Torsvik and 0vreas 2002). One of the most important methods for the 
surveys of soil bacteria is the analysis of a 16SrDNA clone library (Giovannoni 
et al. 1990; Hugenholtz et al. 1998) or, more and more promising, the analysis 
of a metagenomic library (Rondon et al. 2000). However, due to the complex- 
ity of soil communities and the effort required for this type of analysis, clone 
libraries have been restricted to the analysis of a single or a few samples in an 
environment. To circumvent the limitations of the clone library approach, sev- 
eral PCR-based methods exist which allow rapid fingerprinting and monitor- 
ing of many samples. Terminal-restriction fragment length polymorphism (T- 
RFLP) is a PCR-based tool which has been introduced for specifically studying 
the genetic diversity of bacterial communities (Liu et al. 1997; Marsh 1999; Kitts 
2001). T-RFLP analysis is based on the detection of a single restriction fragment 
in each sequence amplified directly from the environmental sample of DNA and 
is capable of surveying dominant members comprising at least 1% of the total 
community (Dunbar et al. 2000). Community fingerprintings obtained are well 
correlated with those obtained with other methods like denaturing gradient gel 
electrophoresis (DGGE) or ribosomal intergenic spacer analysis (RISA; Hart- 
mann et al. 2005). T-RFLP has been widely used in recent years for the analysis 
of bacterial communities in different conditions (for examples, see Moeseneder 
et al. 1999; Osborn et al. 2000; Richardson et al. 2002; Sakano et al. 2002; Fierer 
et al. 2003; Lueders and Friedrich 2003; Nagashima et al. 2003) and to assess 

Dipartimento di Biologia Animale e Genetica'Leo Pardi', Via Romana 17 
1-50125, Firenze, Italy, Tel: +390552288242, Fax: +390552288250, 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

A. Mengoni et al. 

spatial and temporal heterogeneity and dynamics of bacterial communities in 
soil (Kuske et al. 2002; Mengoni et al. 2004, 2006), sediments and water envi- 
ronments (Scala and Kerkhof 2000; Braker et al., 2001; Casamayor et al. 2002; 
Konstantinidis et al. 2003). Moreover, T-RFLP has recently been proposed as 
a standard methodology for assessing soil fertility in comparison to fatty acid 
methyl ester (FAME) analysis (Suzuki et al. 2005). 

Terminal restriction fragment (TRF) patterns obtained by using the T-RFLP 
technique are generated and analyzed in a series of steps that combine PCR, 
restriction enzyme digestion and gel electrophoresis. Extracted DNA is sub- 
jected to PCR amplification using primers homologous to conserved regions 
in a target gene. One primer is labeled on the 5' end, usually with a fluorescent 
dye. Amplicons are then digested with a restriction enzyme and the restricted 
products subjected to electrophoresis in either a polyacrylamide gel or a cap- 
illary gel electrophoresis apparatus. The obtained TRF patterns are then com- 
pared among different samples to depict similarities and dissimilarities among 
different communities. For the phylogenetic description of a bacterial commu- 
nity, PCR is performed using primers which anneal to conserved sequences of 
the 16S rRNA gene and the TRF pattern obtained represents an estimate of the 
number of different 16S rRNA genes present in the community, i.e. different 
bacterial groups (Fig. 19.1). Obtained bands can then be taxonomically inter- 
preted either by their direct cloning (Mengoni et al. 2002), or by comparing the 
length of the restriction fragments with sequences present in a library of 16S 

DNA extracted from sample 

PCR amplification with 16S rDNA-specific primers 

Labeled primer 

■ ■ . » T^ 

£ 3 ^ -^^j^/^;^:^ ^^ I 

^-'I'l^rvvvv^vvvvvvv v tvvvvvvvvvvji j 

Digestion with restriction enzyme 

■ . ■ 
■ ■ 

X 1 =_/ 

r m " ■ " 12*"-* '-"*' '_" , "_' 8 ' '_* 8 ' '_' V "-?" r '- n ' r '-" t '' - V 'J""'"-"'! \2" rt 2^".2~' V"' V"' a?*! fc'-'"- , "- J "- J "-' T "-* 

: = :i = jvvvvv^ jvy^yyvvv l \> r^r^r^r>^ r^ 

Dimension (bp) 

Electrophoresis on automated sequencer 

Fig. 19.1 Schematic representation of T-RFLP technique. See text for details 

19. Application of TRFLP for Molecular Analysis of Soil Bacterial Communities 297 

rDNA previously prepared (Dunbar et al. 2000; Urakawa et al. 2000; Fey et al. 
2001; Grant and Ogilvie 2004), or by an "in-silico" approach on a 16S rDNA 
database (Marsh et al. 2000; Kent et al. 2003). 

A General Protocol for Taxonomic T-RFLP Profiling 
of Soil Bacterial Communities 

Thermal cycler, gel electrophoresis apparatus with power supply, agarose, au- 
tomated sequencer for capillary electrophoresis equipped with discrete band 
analysis software, UV transilluminator and gel documentation system. 
Caution: UV rays are dangerous. Protect eyes with a plastic shield. 

Reagents and Solutions 

Double distilled water (ddH 2 0) sterilized by autoclaving or filtering. Prepare 
100 ul aliquots before sterilization and keep at -20 °C. Discard the aliquot 
after each use. 

50 mM MgCl 2 stock solution (usually supplied with the Taq DNA poly- 

Stock solution of a mixture of desoxyribonucleotide triphosphates (dNTPs): 
2 mM of each dNTP in ddH 2 0. 

Taq DNA polymerase or other thermostable DNA polymerase. 
Restriction enzymes with 4-base recognition sequence (i.e. Hinfi, Mspl> Hhal y 
TaqI, Rsal) and their specific buffers. 

Primer for the amplification of the gene of interest. For instance, on 16SrDNA, 
27f primer (5' GAGAGTTTGATCCTGGCTCAG) and 1495r primer (5' 
CTACGGCTACCTTGTTACGA) give good results. 27f primer is labeled at 
the 5' end with a fluorescent dye (6-FAM). Prepare stock solutions of primers 
at 10 |iM. 

A. Mengoni et al. 

DNA size marker: good examples are a 100-bp or 1-kbp ladder for agarose 
gel electrophoresis and TAMRA 500 (Applied Biosystems) for capillary elec- 

Genomic DNA: use concentrations of 10 ng/|il. For extracting DNA from soil 
we routinely use the FASTDNA kit for soil (BIO 101). Alternatively, good re- 
sults are obtained using the extraction method developed by Burgmann et al. 
(2003) for extracting both DNA and RNA from soil. 

Kit for the purification of PCR products from unincorporated primers and 
salts. We usually obtain good results with the MinElute PCR purification kit 

Note: All the above reagents should be kept at -20 °C. 

TAE buffer: 40 mM Tris/acetate, 1 mM EDTA, pH 8. Prepare a 50x stock so- 

lOx loading buffer: 70% (w/v) glycerol, 0.5% (w/v) bromophenol blue; store 
at 4 °C. 

Ethidium bromide stock solution: 10 mg/(il; store in a dark bottle. 
Caution: Ethidium bromide is a powerful mutagen: wear gloves when han- 

dling this compound; wear mask when weighing it. 

Experimental Procedure 

Extract the DNA from soil by using an extraction procedure which works both 
on gram-negative and on gram-positive bacteria (for references, see Section 
19.2.1 Materials). Perform the PCR amplification in a total volume of 50 |J 
containing: the diluted buffer of Taq DNA polymerase, 1.5 mM MgCl 2 , 10 mM 
dNTPs, 2 units of Taq DNA polymerase, 10 pmol of each primer, 10-20 ng of 
template DNA. 

For instance for ten samples, consider a Master Mix solution for 1 1 reactions 
using the following volumes: add 1 |il of template DNA (from solutions previ- 
ously prepared at 10 ng/|il) in 0.2-ml PCR tube; prepare a Master Mix , adding 
485.1 [A of dH 2 0, 1 1 (al of each primer solution, 55 |J of lOx PCR buffer (pro- 
vided with Taq DNA polymerase), 16.5 [A of 50 mM MgCl 2 and 4.4 ul of Taq 
DNA polymerase (5 units/ \xl); mix and aliquot 49 |il of Master Mix solution in 
the 0.2-ml PCR tubes. 

The described PCR conditions have been optimized in a Perkin-Elmer 9600 
thermal cycler (Perkin-Elmer). The reaction mixtures, after incubation at 95 °C 
for 1.5 min, are cycled through the following temperature profile: denaturation 
at 94 °C for 30 s, annealing temperature for 30 s and extension at 72 °C for 
2 min. For the first five cycles, the annealing temperature is set at 60 °C, for the 
following five cycles 55 °C and for the last 25 cycles 50 °C. Finally, the reaction 
mixtures are incubated at 72 °C for 10 min. 

19. Application of TRFLP for Molecular Analysis of Soil Bacterial Communities 299 

1. Check 5 (il of each amplification mixture by agarose gel (1.0% w/v) electro- 
phoresis in TAE buffer (0.04 M Tris-acetate, 0.001 M EDTA) containing 1 (ig/ 
ml (w/v) of ethidium bromide. 

2. Purify (and concentrate if necessary) the amplification products from prim- 
ers and salts by using a dedicated kit. 

3. Digest 600 ng of amplified 16S rDNA in a total volume of 15 ul with 20 units 
of the chosen restriction enzyme. Incubate for 3 h at the optimal incubation 
temperature for the restriction enzyme (37 °C or 65 °C for Taql). Heat-inac- 
tivate the enzyme by incubation the mixture at 70 °C for 15 min (80 °C for 
20 min for Taql). 

4. Separate the digested products by capillary electrophoresis on an automated 
sequencer (ABI 310 genetic analyzer, Applied Biosystems). Inject 5 |al of di- 
gestion product with 0.5 ul of molecular weight standard TAMRA-500 (Ap- 
plied Biosystems). Run the electrophoresis as indicated by the instruments 

1. Low intensity of T-RFLP bands or weak amplification of 16S rDNA: 
Check purity and quantity of extracted DNA. Try a different extraction 
method and a range of different template DNA concentrations. Check re- 
agents and procedure with a control primer pair and DNA. Verify that prim- 
ers are labeled correctly and load higher quantities of digestion product on 
the automated sequencer to optimize signal fluorescence. 

2. Too many or too few bands: 

Assay different restriction enzymes. A good theoretical estimation of the 
level of polymorphism shown by the enzyme can be obtained from the in- 
silico digestion of the database present in the Ribosomal Database Project by 
using the TAP software (Marsh et al. 2000; 

Standardization of T-RFLP Profiles 

The T-RFLP technique usually produces a profile of a bacterial community, 
which shows 20-40 peaks (bands or TRFs) for each restriction enzyme used 
(Fig. 19.2). The information gained by the single experiment can be increased 
by digesting the amplified 16S rDNA with other restriction enzymes and then 
combining the obtained profile to reach 100-200 peaks per sample. 

A. Mengoni et al, 

»o - 

«Q Q Q 

a cn — 

-Zj Gi ■=» 

4P k". ^F O 

i i • 

<-J *- 

O </> 

^ S 

O o> 

^ ° 

oi H 

<! O. 

s ° 

"" St 

+-> qj 
c/d +-> 

a> a* 

b£ U 

u ex 

CD +3 

a- 2 
Ph -Q 

iZ -C 

19. Application of TRFLP for Molecular Analysis of Soil Bacterial Communities 301 

One of the most frequent problems in T-RFLP pattern analysis is the presence 
of very small peaks resulting from either artefacts or differences in DNA loading 
which can skew similarity profiles that are based on presence/absence data (Liu 
et al. 1997; Dunbar et al. 2000). To avoid the presence of nonreproducible peaks 
derived from artefacts, at least two independently extracted DNA and three PCR 
reactions for each extracted DNA can be performed. The resulting three diges- 
tion products from the same extracted DNA are then mixed and run in a single 
capillary electrophoresis. In this way nonreproducible peaks, which are often 
due to 16S rDNA species present in a concentration at the limit of the detection 
threshold or to artefacts generated during PCR amplification tend to disappear 
because of the dilution performed with the replicate reactions. The possibility to 
compare profiles obtained from different analyses then allow consideration of 
only those peaks present in both DNA extraction, thus reconstructing a "syn- 
thetic profile" of the community. The software GelComparll (Applied Maths) is 
a good platform for the analysis of chromatograms obtained after capillary elec- 
trophoresis and includes useful tools for a first statistical analysis of data (cluster 
and principal component analyses). In general, for the analysis of chromato- 
grams, peaks below 50-100 units of fluorescence are not included because of 
their low level of reproducibility. However, differences in DNA loading can also 
generate slightly different profiles and it could be useful to standardize the DNA 
quantities loaded into the capillary. Kaplan et al. (2001) present a method for 
standardizing T-RFLP patterns based on TRF peak area. The amount of DNA 
loaded onto a gel or a capillary is estimated as the sum of all TRF peak areas in a 
pattern (total peak area). Dunbar et al. (2001) propose a method for standardiz- 
ing TRF patterns based on peak height. The sum-of-peak-height values are then 
standardized between samples by proportionally decreasing the height of each 
peak in the profiles until the sum of peak heights (total fluorescence) for each 
profile equals the lowest value represented among the samples. 

Other Applications of T-RFLP to Soil Bacterial Communities 

In addition to taxonomic profiling, T-RFLP can also be used to characterize 
functional diversity in a bacterial community. In fact, in principle one can make 
use of primers anchored to conserved sequences present in functional genes 
and generate amplicons and TRFs from a DNA sample which reflect the func- 
tional genetic diversity present in the community. This approach has been used 
to explore the diversity of genes involved in nitrogen fixation (nifii; Noda 1999), 
nitrification (amoA; Horz et al. 2000), denitrification (nosZ; Scala et al. 2000), 
nitrite reduction (m'rS; Braker et al. 2001), methane oxidation (pmoA; Pester et 
al. 2004) and mercury resistance (merR; Bruce 1997). Moreover, T-RFLP can 
also be used to type the genetic diversity of retro -transcribed RNA extracted 

A. Mengoni et al. 

from soil. This approach can be useful when the diversity of expressed func- 
tional genes or the taxonomic diversity (16S rRNA) of metabolically active cells 
has to be targeted (Rogers et al. 2005; Mengoni et al. 2006). Actually, because 
RNA is labile and ribosome numbers have been correlated with cellular activity 
total rRNA might reflect the diversity of the metabolically active members of the 
community After RNA extraction from soil, reverse transcription is performed 
to produce cDNA molecules, which are subsequently PCR-amplified with the 
selected primer pair following the standard T-RFLP protocol. In this way it is 
possible to compare, within a soil community, the genetic diversity of the most 
metabolically active bacterial groups (T-RFLP on 16S rRNA), with that of the 
bacterial community present (T-RFLP on 16S rDNA). 

Analysis of soil bacterial communities with T-RFLP patterns provides a rapid 
and reproducible way to compare communities and assess community dynam- 
ics. However, some precautions must be taken when preparing the data for 
analysis to minimize artifacts and to produce robust profiles. T-RFLP profiling 
has the advantage of being simply and rapidly produced on existing standard 
DNA sequencing equipment. T-RFLP patterns are then automatically digitized 
and easily analyzed with a variety of clustering and multivariate statistical tech- 
niques (Rees et al. 2004; Blackwood et al. 2003). Due to this easy and automated 
processing, many samples can be analyzed at the same time, allowing (as the 
large and increasing amount of literature shows) far unprecedented opportuni- 
ties to correlate the structure and diversity of soil bacterial communities to the 
environmental parameters. 

Blackwood CB, Marsh T, Kim SH, Paul EA (2003) Terminal restriction fragment length poly- 
morphism data analysis for quantitative comparison of microbial communities. Appl 
Environ Microbiol 69:926-932 

Braker G, Ayala-del-Rio HL, Devol AH, Fesefeldt A, Tiedje JM (2001) Community structure 
of denitrifiers, Bacteria, and Archaea along redox gradients in Pacific Northwest marine 
sediments by terminal restriction fragment length polymorphism analysis of amplified 
nitrite reductase (nirS) and 16S rRNA genes. Appl Environ Microbiol 67:1893-1901 

Bruce KD (1997) Analysis of the mer gene subclass within bacterial communities in soils 
and sediments resolved by fluorescent- PCR restriction fragment length polymorphism 
profiling. Appl Environ Microbiol 63:4914-4919 

19. Application of TRFLP for Molecular Analysis of Soil Bacterial Communities 303 

Burgmann H, Widmer F, Sigler WV, Zeyer J (2003) mRNA extraction and reverse transcrip- 
tion-PCR protocol for detection of nifli gene expression by Azotobacter vinelandii in 
soil. Appl Environ Microbiol 69:1928-1935 

Casamayor EO, Massana R, Benlloch S, 0vreas L, Diez B, Goddard VJ, Gasol JM, Joint I, 
Rodriguez- Valera F, Pedros-Alio C (2002) Changes in archaeal, bacterial and eukaryal 
assemblages along a salinity gradient by comparison of genetic fingerprinting methods 
in a multipond solar saltern. Environ Microbiol 4:338-348 

Dunbar J, Ticknor LO, Kuske CR (2000) Assessment of microbial diversity in four Southwest- 
ern United States soils by 16S rRNA gene terminal restriction fragment analysis. Appl 
Environ Microbiol 66:2943-2950 

Dunbar J, Ticknor O, Kuske CR (2001) Phylogenetic speciticity and reproducibilily and new 
method for analysis of terminal restriction fragment profiles of 16S rRNA genes from 
bacterial communities. Appl Environ Microbiol 67:190-197 

Fey A, Chin KJ, Conrad R (2001) Thermophilic methanogens in rice field soil. Environ Mi- 
crobiol 3:295-303 

Fierer N, Schimel JP, Holden PA (2003) Influence of drying- re wetting frequency on soil bac- 
terial community structure. Microb Ecol 45:63-71 

Giovannoni SJ, Britschgi TB, Moyer CL, Field KG (1990) Genetic diversity in Sargasso Sea 
bacterioplankton. Nature 345:60-63 

Grant A, Ogilvie LA (2004) Name that microbe: rapid identification of taxa responsible for 
individual fragments in fingerprints of microbial community structure. Mol Ecol Notes 

Hartmann M, Frey B, Kolliker R, Widmer F (2005) Semi- automated genetic analyses of soil 
microbial communities: comparison of T-RFLP and RISA based on descriptive and dis- 
criminative statistical approaches. J Microbiol Methods 61:349-360 

Horz H, Rotthauwe J, Lukow T, Liesack W (2000) Identification of major subgroups of am- 
monia-oxidizing bacteria in environmental sampies by T-RFLP analysis of amoA PCR 
products. J Microbiol Methods 39:197-204 

Hugenholtz P, Goebel BM, Pace NR (1998) Impact of culture-independent studies on the 
emerging phylogenetic view of bacterial diversity. J Bacteriol 180:4765-4774 

Kaplan CW, Astaire JC, Sanders ME, Reddy BS, Kitts CL (2001). 16S ribosomal DNA ter- 
minal restriction fragment pattern analysis of bacterial communities in feces of rats fed 
Lactobacillus acidophilus NCFM. Appl Environ Microbiol 67:1935-1939 

Kent AD, Smith DJ, Benson BJ, Triplett EW (2003) Web-based phylogenetic assignment tool 
for analysis of terminal restriction fragment length polymorphism profiles of microbial 
communities. Appl Environ Microbiol 69:6768-6776 

Kitts CL (2001) Terminal restriction fragment patterns: a tool for comparing microbial com- 
munities an assessing community dynamics. Curr Iss Int Microbiol 2: 1 7-25 

Konstantinidis KT, Isaaca N, Fett J, Simpson S, Long DT, Marsh TL (2003) Microbial diversity 
and resistance to copper in metal- contaminated lake sediment. Microb Ecol 45:191-202 

Kuske CR, Ticknor LO, Miller ME, Dunbar JM, Davis JA, Barns SM, Belnap J (2002) Com- 
parison of soil bacterial communities in rhizospheres of three plant species and the in- 
terspaces in an arid grassland. Appl Environ Microbiol 68:1854-1863 

Liu W-T, Marsh TL, Cheng H, Forney LJ (1997) Characterization of microbial diversity by 
determining terminal restriction fragment length polymorphism of genes encoding 16 
rRNA. Appl Environ Microbiol 63:4516-4522 

Lueders T, Friedrich MW (2003) Evaluation of PCR amplification bias by terminal restric- 
tion fragment length polymorphism analysis of small- subunit rRNA and mcrA genes by 
using defined template mixtures of methanogenic pure cultures and soil DNA extracts. 
Appl Environ Microbiol 69:320-326 

A. Mengoni et al. 

Marsh TL (1999) Terminal restriction fragment length polymorphism (T-RFLP): an emerg- 
ing method for characterizing diversity among homologous populations of amplification 
products. Curr Opin Microbiol 2:323-327 

Marsh TL, Saxman P, Cole J, Tiedje J (2000) Terminal restriction fragment length polymor- 
phism analysis program, a Web-based research tool for microbial community analysis. 
Appl Environ Microbiol 66:3616-3620 

Mengoni A, Grassi E, Bazzicalupo M (2002) A cloning method for the taxonomic interpreta- 
tion of T-RFLP patterns. Biotechniques 33:990-992 

Mengoni A, Grassi E, Barzanti R, Biondi EG, Gonnelli C, Kim C-K, Bazzicalupo M (2004) 
Genetic diversity of bacterial communities of serpentine soil and of rhizosphere of the 
nickel-hyper accumulator plant Alyssum bertolonii. Microb Ecol 48:209-217 

Mengoni A, Tatti E, Decorosi F, Viti C, Bazzicalupo M, Giovannetti L (2006) Comparison 
of 16S rRNA and 16S rDNA T-RFLP approaches to study bacterial communities in soil 
microcosms treated with chromate as perturbing agent. Microb Ecol (in press) 

Moeseneder MM, Arrieta JM, Muyzer G, Winter C, Herndl GJ (1999) Optimization of ter- 
minal-restriction fragment length polymorphism analysis for complex marine bacterio- 
plankton communities and comparison with denaturing gradient gel electrophoresis. 
Appl Environ Microbiol 65:3518-3525 

Nagashima K, Hisada T, Sato M, Mochizuki J (2003) Application of new primer-enzyme 
combinations to terminal restriction fragment length polymorphism profiling of bacte- 
rial populations in human feces. Appl Environ Microbiol 69:1251-1262 

Noda S, Ohkuma M, Usami R, Horikoshi K, Kuda T (1999) Culture independent charactem- 
ization of a gene responsible for nitrogen fixation in the symbiotic microbial community 
in the gut of the termite Neotermes koshunensis. Appl Environ Microbiol 65:4935-4942 

Osborn AM, Moore ER, Timmis KN (2000) An evaluation of terminal- restriction fragment 
length polymorphism (T-RFLP) analysis for the study of microbial community structure 
and dynamics. Environ Microbiol 2:39-50 

Pester M, Friedrich MW, Schink B, Brune A (2004) pmoA-based analysis of methanotrophs 
in a littoral lake sediment reveals a diverse and stable community in a dynamic environ- 
ment. Appl Environ Microbiol 70:3138-3142 

Rees GN, Baldwin DS, Watson GO, Perryman S, Nielsen DL (2004) Ordination and signifi- 
cance testing of microbial community composition derived from terminal restriction 
fragment length polymorphisms: application of multivariate statistics. A Van Leeuw Int 
J Microbiol 86:339-347 

Richardson RE, Bhupathiraju VK, Song DL, Goulet TA, Alvarez-Cohen L (2002) Phyloge- 
netic characterization of microbial communities that reductively dechlorinate TCE 
based upon a combination of molecular techniques. Environ Sci Technol 36:2652-2662 

Rogers GB, Carroll MP, Serisier DJ, Hockey PM, Kehagia V, Jones GR, Bruce KD (2005) Bac- 
terial activity in cystic fibrosis lung infections. Respir Res 6:49 

Rondon MR, August PR, Bettermann AD, Brady SF, Grossman TH, Liles MR, Loiacono KA, 
Lynch BA, MacNeil IA, Minor C, Tiong CL, Gilman M, Osburne MS, Clardy J, Handels- 
man J, Goodman RM (2000) Cloning the soil metagenome: a strategy for accessing the 
genetic and functional diversity of uncultured microorganisms. Appl Environ Microbiol 

Sakano Y, Pickering KD, Strom PF, Kerkhof LJ (2002) Spatial distribution of total, ammo- 
nia-oxidizing, and denitrifying bacteria in biological waste water treatment reactors for 
bioregenerative life support. Appl Environ Microbiol 68:2285-2293 

Scala DJ, Kerkhof LJ (2000) Horizontal heterogeneity of denitrifying bacterial communities 
in marine sediments by terminal restriction fragment length polymorphism analysis. 
Appl Environ Microbiol 66:1980-1986 

Suzuki C, Kunito T, Aono T, Liu CT, Oyaizu H (2005) Microbial indices of soil fertility. J Appl 
Microbiol 98:1062-1074 

19. Application of TRFLP for Molecular Analysis of Soil Bacterial Communities 305 

Torsvik V, 0vreas L (2002) Microbial diversity and function in soil: from genes to ecosystems. 
Curr Opin Microbiol 5:240-245 

Urakawa H, Yoshida T, Nishimura M, Ohwada K (2000) Characterization of depth-related 
population variation in microbial communities of a coastal marine sediment using 16S 
rDNA-based approaches and quinone profiling. Environ Microbiol 2:542-554 

Molecular Symbiotic Analysis Between 
Arabiopsis thaliana and Piriformospora 

B. Shahollari, K. Bhatnagar, I. Sherameti, 
A. Varma, and R. Oelmuller 

The molecular analysis of beneficial interactions of plants and fungi is often diffi- 
cult, either because one or both of the symbiotic partners are not well character- 
ized at the molecular level or because they can only grow together in symbiosis. 
We study the interaction of an endophytic fungus, Piriformospora indica, with 
Arabdiopsis thaliana. P. indica can interact with many different plant species in- 
cluding A. thaliana and promotes their growth, development and seed produc- 
tion. We use the model organism A. thaliana as the plant partner to understand 
the molecular basis for this beneficial plant/microbe interaction. The availability 
of a large number of well characterized mutants, knock-out lines and molecular 
tools for genetic analysis in A. thaliana allows a rapid identification of mecha- 
nisms and molecules involved in this interaction. This information can then be 
used to analyze the molecular basis of the interaction of P. indica with other 
economically important plant species. Since A. thaliana is normally not the host 
found in nature, the type of interaction and the molecules identified might also 
differ from the interaction of P. indica with other plant species. However, since 
the endophytic fungus interacts with many different plant species and since the 
plant responses are very similar, it is likely that the basic mechanisms are com- 
parable in all organisms. Thus, the A. thaliana/ P. indica interaction is an attrac- 
tive model system to study beneficial plant/microbe interaction at the molecular 

B. Shahollari, I. Sherameti, R. Oelmuller: Institute of General Botany, University of Jena, 
Dornburger Strasse 159, D-07743 Jena, Germany, 

K. Bhatnagar, A. Varma: Amity Institute of Microbial Sciences, Amity University, 
Uttar Pradesh, Sector 125, Noida 201303, India, email: 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmuller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

B. Shahollari et al, 

Beneficial Interaction Between Plants and Fungi 
Piriformospora indica and Arabidopsis thaliana 
as a Model System 

We study the interaction of P indica with A. thaliana. P. indica was originally 
isolated from the Indian desert and is a wide-host root-colonizing fungus, which 
allows the plants to grow under extreme physical and nutrient stress. The fungus 
can be cultivated on complex and minimal substrates and belongs to the Sebaci- 
nales in the Basidiomycota (Varma et al. 1999; Weiss et al. 2004). P. indica has 
a vast geographical distribution and is reported from Asia, South America and 
Australia. The fungus is interesting for basic research as well as biotechnological 
applications because it functions: (1) as a plant biofertilizer in nutrient-deficient 
soils, (2) as a bioprotector against root pathogens, insects and heavy metals, (3) 
as a bioregulator for plant growth development, early flowering, enhanced seed 
production, and stimulation of active ingredients in medicinal plants and (4) as 
a bio-agent for the hardening of tissue culture-raised plants. Positive interaction 
has been established for many plants of economic importance in agriculture, 
forestry and flori-horticulture, including orchids (Bhatnagar and Varma 2006) 
and those utilized for biodiesel production. P. indica also interacts with a bryo- 
phyte, Aneura pinguis, and a pterdophyte, Pteris ensiormis. Similar to arbuscular 
mycorrhizal fungi, P. indica stimulates nitrate assimilation in the roots and solu- 
bilizes insoluble phosphatic components in the soil. The interaction of P. indica 

Fig. 20.1 Wild-type Arabidopsis seedlings, which were grown in the absence (-) or presence (+) of 
P. indica for 6 days. For a better demonstration, two seedlings were grown in one Petri dish 

20. Interaction between A. thaliana and P. indica 309 

with the model plant Arabidopsis is being used to understand the molecular ba- 
sis of this beneficial plant/microbe interaction. 

The lack of any specificity in the host plant species suggests that the fungus 
utilizes well conserved recognition and signaling molecules which are present 
in all plant species. Furthermore, since an interaction can be seen already at 
the level of bryophytes, one might hypothesize that the symbiosis is based on 
ancient phylogenetic routes in plants. 

Our strategy is based on the observation that Arabdiopsis in etalic seedlings 
(as well as adult plants) grow taller in the presence of a defined amount of fungal 
hyphae (Fig. 20.1). We have established conditions which allow us to follow the 
growth promotion mediated by P. indica over a period of 14 days in Petri dishes. 
If colonized seedlings are then transferred to soil, growth promotion is easily 
visible and is accompanied by an increase in seed production. 

Co-Cultivation of P. indica and Arabidopsis 
under Standardized Growth Conditions 

1. Co -cultivation of the two symbiotic partners: 

P indica promotes growth of Arabidopsis seedlings in nature, in the green- 
house and under sterile conditions in Petri dishes. A. thaliana seeds [from 
wild-type, ecotype Columbia, EMS mutant lines (Lehle, San Diego, USA) 
or homozygote T-DNA insertion lines ( 
mutants/worldwide.jsp)] are surface-sterilized and placed on Petri dishes 
containing MS nutrient medium (Murashige and Skoog 1962). After cold 
treatment at 4 °C for 48 h, plates are incubated for 7 days at 22 °C under con- 
tinuous illumination (100 |imol m~ 2 s" 1 ). Simultaneously, P. indica is cultured 
as described previously (Verma et al. 1998; Peskan-Berghofer et al. 2004) on 
Hill and Kafer medium, solidified with 1% (w/v) agar (Hill and Kafer 2001). 
For the co -cultivation experiments, 9 day-old A. thaliana seedlings are trans- 
ferred to nylon disks (mesh size 70 \xm) placed on top of a modified PNM cul- 
ture medium (5 mM KN0 3 , 2 mM MgS0 4 , 2 mM Ca(N0 3 ) 2 , 0.01 \xM FeS0 4 , 
70 |iM H3BO3, 14 |iM MnCl 2 , 0.5 [iM CuS0 4 , 1 |iM ZnS0 4 , 0,2 uM Na 2 Mo0 4 , 
0.01 |iM CoCl 2 , 10.5 gl _1 agar, pH 5.6), in 90 mm Petri dishes. One seedling 
is used per Petri dish. Fungal plugs of approximately 5 mm in diameter are 
placed at a distance of 1 cm from the roots. Plates were incubated at 22 °C 

under continuous illumination from the side (max. 80 |imol m" s" ). Growth 
of the seedlings is monitored by taking pictures every day, or by determining 
the fresh weight of the roots and aerial parts over a period of 14 days of co- 
cultivation. Figure 20.1 shows seedlings 6 days after co- cultivation. 

B. Shahollari et al. 

Thereafter the plants are transferred to soil and cultivated in multi-trays with 
Aracon tubes in a temperature-controlled growth chamber at 22 °C under 
long-day conditions (light intensity: max. 80 umol m~ 2 s -1 )- Before transfer 
to soil, the roots of the seedlings grown in the presence of the fungus are 
examined under the microscope to test whether hyphae and spores have de- 
veloped within and around the roots (Fig. 20.2). In addition, for plants which 
are growing in the presence of P. indica, the soil is mixed carefully with the 
fungus (1%, w/v). The fungal mycelium is obtained from liquid cultures after 
removal of the medium and washed with an excess of distilled water. Control 
seedlings without the fungus are grown in soil without the fungus. Uninoc- 
culated control plants and those infected by the fungus are kept in Aracon 
tubes and their growth is monitored until the collection of seeds (Fig. 20.3). 
Seeds are collected in the Aracon tubes and quantified as grams of seed per 
plant. The weight of a seed is not altered by the fungus. 
Isolation of mutants: 

We isolated (ethyl-methanesulfonate, EMS or knock-out) mutants which 
failed to respond to the fungus with regard to growth promotion under the 
above-described conditions. Originally, mutations were induced by EMS 
(0.3%, Sigma-Aldrich Chemie) in the Columbia ecotype, as described by 
Sommerville and Ogren (1982). EMS is an alkylating agent that produces 
point mutations by adding an ethyl group to a nucleic acid, resulting in a GC 
to AT transition. Mutagenized seeds were sown on soil and after 12 weeks, 
seeds from each Ml plant were collected. Approximately 10 000 individual 
seedlings were then used to test for their response to P. indica, as described 
above. Positive candidates were further analyzed for other responses which 
are induced in Arabidopsis roots in response to P. indica. 

Fig. 20.2 Root hair colonized by fungal 
spores. Parts of the roots were removed 
from the seedling prior to transfer to soil 
to test whether the fungus had colonized 
the roots. Sections were stained with cotton 
blue and examined under the light micro- 
scope (Zeiss Axioplan model MC 100) 

20. Interaction between A. thaliana and P. indica 

Fig. 20.3 Arabidopsis plants grown in the 
absence (-) or presence (+) of P. indica in 
a multi-tray with Aracon tubes. The picture 
was taken while the seeds were ripening. 
The line of dots (••••) indicates the height 
of each plant 

3. Seed production: 

Putative mutants obtained in the primary screen were transferred to soil to 
collect seeds; 50 seedlings of the next generation were then co -cultivated with 
P. indica (and 50 wild-type seedlings were used as controls) to confirm that 
the mutants did not respond to P. indica. Positive candidates were then again 
transferred to soil to collect seeds of the third generation. 

4. Analysis of gene expression in the mutants: 

In addition to the growth-promoting response, we tested whether several in- 
dependent responses normally induced by the fungus were not induced in 
the mutants. Based on microarray analyses and suppression substractive hy- 
bridization techniques (cf. below) we identified genes which responded very 
early to co- cultivation with the fungus in A. thaliana roots. We used some of 
these genes as markers to test whether they were not regulated in the mutants 
co-cultivated with P. indica (cf. Fig. 20.4). 

5. Analysis of a post-translational modification of a MATH protein in the 
plasma membrane of roots: 

The interaction of P. indica with Arabidopsis roots is also detectable at the 
protein level. We identified a MATH protein in the plasma membrane of 
the roots which is transiently modified in response to the fungus (Peskan- 
Berghofer et al. 2004). This modification is not detectable in a mutant which 
does not recognize the fungus (Oelmuller et al. 2005). Although the function 
of the MATH protein and the kind of the mutation is not known at present, 
it represents a characteristic and a highly specific post-translational response 
which is independent from those involved in gene expression. 

B. Shahollari et al, 

Fig. 20.4 Analysis of P. indica induced 
responses in wild-type seedlings (WT) as 
well as two mutant seedlings designated 
as Mu-1 and Mu-2. RT-PCR analyses of 
the message levels for the receptor kinase 
At5gl6590, the homeodomain transcrip- 
tion factor At2g35940, the 2-nitropropane 
dioxygenase (NPDO, At5g64250), the 
glucan-water dikinase (SEX1, Atlgl0760) 
and nitrate reductase (Nia2, Atlg37130) in 
the roots. Actin was used as control. The 
RT-PCR analysis was performed days 
and 5 days after the beginning of co-culti- 
vation, and the PCR products were run on 
an agarose gel 

Map-Based Cloning of a Mutated Gene 

The strategy of map -based cloning tries to identify molecular markers which 
are closely linked to the gene of interest. Since the complete Arabidopsis ge- 
nome is sequenced, many of these markers can be found on the Arabidopsis 
homepage ( The mutations were mapped using restric- 
tion fragment length polymorphism (RFLP)- and polymerase chain reaction 
(PCR) -based markers on a F2 progeny and F3 families deriving from a single 
cross between the male donor plants of homozygous lines of the ecotype Co- 
lumbia and the female recipient plants of the ecotype Landsberg errecta. The 
markers display different patterns for plants that are homozygous or hetero- 
zygous for an appropriate genomic locus. DNA for PCR based mapping was 
prepared from a single leaf of a plant using a rapid DNA isolation procedure 
(see below). The markers which were generally used are available under www. (cf. also Bell and Ecker 1994; Klimyuk and Jones 1997; Neff et 
al. 1998). To assign the mutant locus to one of the Arabidopsis chromosomes, 

20. Interaction between A. thaliana and P. indica 313 

a population of at least 28 plants homozygous at the gene of interest was ana- 
lyzed (cf. Konieczny and Ausubel 1993). Furthermore, the distance between 
two markers on the same chromosome should be approximately 50 cM before 
a linkage can be detected. 

Rapid DNA Extraction 

For PCR-based mapping purposes, DNA was isolated from individual leaves of 
adult plants. One has to make sure that removal of the leaf does not cause severe 
damage to the plant, since seeds need to be collected from the adult plants. The 
leaf was homogenized with a metal pestle in a 1.5-ml tube after addition of 0.5 ml 
extraction buffer (7 M urea, 300 mM NaCl, 50 mM Tris-HCl, pH 8.0, 1% N- 
laurylsacrosinate, 20 mM EDTA). After incubation at 37 °C for 5 min, 500 |ilof 
phenol/chloroform/isopropanol (25:24:1) was added, centrifugal for 10 min, 
and the DNA was precipitated with isopropanol from the aeqnous phase. After 
washing with 80% ethanol, the DNA was resuspended in 30 |J TE buffer. 

Confirmation of a Mutated Phenotype 

of an EMS Mutant by the Analysis of an Independent 

T-DNA Insertion Line 

T-DNA knock out lines are available from: 
naexpress. The Arabidopsis mutants can be obtained from the Salk, Sail, Gabi, 
Riken or other collections. In many cases, the seed material obtained from the 
stock center is heterozygote with regard to the T-DNA insertion and might also 
contain more than one insertion in the genome. Thus, seeds of the next genera- 
tion need to be screened for homozygote knock-out lines. Therefore, the seeds 
obtained from the stock center are surface-sterilized and placed on Petri dishes 
containing MS nutrient medium (Murashige and Skoog 1962). After cold treat- 
ment at 4 °C for 48 h, plates are incubated for 3-4 weeks at 22 °C under con- 
tinuous illumination (100 |imol m~ 2 s" 1 ). Plants are then transferred to the soil. 
After 2 weeks growing in soil, DNA is isolated from one leaf of each plant, as 
described. This DNA is used for PCR. The primers for PCR are available from: The PCR reactions for the determi- 
nation of the insertion sites are performed as described by: http://signal.salk. 

B. Shahollari et al, 

Differntial Display to Identify Genes 
which are Regulated in Response to P. indica 

1. Isolation of lateral roots and lateral root RNA: Arabidopsis seedlings were 
grown in the presence or absence of P. indica. The seedlings were removed 
from the nylon membrane with a forcept and dipped into liquid nitrogen for 
approximately 5 s. Most of the lateral roots remained in the liquid nitrogen, 
while main roots stayed with the seedlings. Approximately 0.4 g of lateral 
roots were collected from at least five independent experiments and ground 
in liquid nitrogen. The resulting powders were used for RNA extraction and 
cDNA syntheses. The tester cDNA was obtained from the root material co- 
cultivated with the fungus, while the driver cDNA derived from the control 

The cDNA from control roots can be mixed with cDNA from the fungus. 
Normally, we used 10% fungal cDNA and 90% plant cDNA as driver cDNA. 
We performed this protocol with different plant species. When Arabidopsis 
was used as a host, we omitted this step since Arabidopsis sequences were 
easily detectable after sequencing of clones from the suppression substracted 

RNA extraction was performed with the RNA extraction kit (RNeasy Quia- 
gen, Hilden, Germany). The quality of the RNA was checked spectrophoto- 
metrically by measuring the absorbance (A) at 260, 280 and 300 nm. The 
A260M280 ratio should be at least 1.95, the A 2 6o/A 3 oo ratio should be at least 0.5. 

2. Generation of cDNAs for a suppression substraction library: an equal amount 
of RNA (0.1 |ig) was used for cDNA synthesis using the SMART PCR cDNA- 
synthesis kit from Clontech (Palo Alto). The cDNAs were used for the cre- 
ation of a substracted library with the help of the PCR-select cDNA substrac- 
tion kit (BD Bioscience Clontech, Palo Alto). A detailed protocol is available 

In brief: 

a. The resulting tester and driver cDNAs are digested with Rsal to obtain 
small blunt-end cDNA fragments. 

b. The tester cDNA are separated into two fractions, and ligated to two dif- 
ferent types of adapters. 

c. The two tester cDNA pools are hybridized two times to an excess of 
driver cDNA to enrich differentially expressed sequences among single- 
stranded tester cDNAs. 

d. Differentially expressed cDNAs are amplified by PCR. 

e. Depending on the co- cultivation time of the roots with P. indica, the sub- 
stracted libraries contains between 20 (14 days of co -cultivation) and 350 
(3 days of co -cultivation) clones. 

20. Interaction between A. thaliana and P. indica 

3. Differential screening 

a. Individual bacteria are grown to isolate plasmid DNA. 

b. The insertions are amplified by PCR with Ml 3 forwards and reverse 

c. The PCR products are separated on 1% agarose gels and blotted onto 
nylon membranes (Hybond N; Amershan Biosciences, Freiburg, Ger- 

cDNA from control and inoculated lateral roots are radiolabeled with 32 P 
(>5xl0 6 cpm ml -1 ) and Superscript II reverse transcriptase (Invitrogen, 
Karlsruhe, Germany). 

e. Hybridization is performed to two identical nylon membranes and the 
signals are quantified using a phosphorimager (cf. Fig. 20.5). 

Activation Tagged Lines 

Activation tagging with constitutive enhancer elements was developed by Rick 
Walden at the Max Planck Institute in Cologne, Germany. A T-DNA vector with 

+ P. Indica 

- P. indica 

• * 

• • 

• • 

• • 

« • 

• • 

• • 

• • 

Fig. 20.5 Dot blot hybridization of radiolabled cDNA from Arabidopsis roots, which were grown 
in the presence (+ P. indica) or absence (- P. indica) of the fungus. Note that the message levels for 
some of the genes are upregulated by P. indica, while others are identical (controls). Hybridization 
occurred to two identical filters, on which cDNA fragments from genes were spotted which were 
identified in the suppression substractive hybridization or which were used as controls 

B. Shahollari et al. 

enhancer elements from the highly active cauliflower mosaic virus 35S pro- 
moter can cause transcriptional activation of nearby genes, because activated 
genes can be associated with a T-DNA insertion (cf. Weigel et al. 2000; http:// 

We screened activation tagged lines from various sources for their response 
to P indica and found that a few lines responded much more sensitive to the 
fungus than the wild type (cf. Fig. 20.6). When grown in the absence of the fun- 
gus, no difference from the wild type could be detected. Thus, this approach is 
very helpful for the identification of genes and proteins which can stimulate the 
response to P. indica when present at higher levels in the plants. 

Fig. 20.6 An activation tagged line is more sensitive to P. indica than the wild type, a Wild type with 
the fungus, b wild type without the fungus, c activation tagged line with the fungus, d activation- 
tagged line without the fungus 

20. Interaction between A. thaliana and P. indica 317 

Identification of Biochemical Pathways 

in A. thaliana which are Regulated by P. indica 

The available microarray data as well as differentially expressed gene data can 
be used to understand (signaling) pathways which are targets for P. indica. To 
this end, the regulatory network can be best analyzed by superimposing the pro- 
teins identified at the level of their mRNAs on the Kyoto encyclopedia of genes 
and genomes (KEGG; The KEGG path- 
way database is a collection of pathway maps representing our knowledge on 
the molecular interaction and reaction networks for metabolism, carbohydrate 
energy, lipid, nucleotide and amino acid metabolisms, glucan, cofactor and vi- 
tamins biosynthesis, enzymes involved in secondary metabolites, etc. Such an 
analysis should finally lead to the understanding of signaling processes, crucial 
signaling molecules as well as metabolic pathways which can be manipulated in 
A. thaliana by the endophytic fungus P. indica. 

Bell CJ, Ecker JR (1994) Assignment of 30 microsatellite loci to the linkage map of Arabidop- 
sis. Genomics 19:137-144 

Bhatnagar K, Varma A (2006) The healthy marriage between terrestrial orchids and fungi. J 
Hill Res 19:1-12 

Hill TW, Kafer E (2001) Improved protocols for Aspergillus medium: trace elements and min- 
imum medium salt stock solutions. Fungal Genet Newsl 48:20-21 

Klimyuk VI, Jones JD (1997) AtDMCl, the Arabidopsis homologue of the yeast DMC1 gene: 
characterisation, transposon-induced allelic variation and meiosis- associated expres- 
sion. Plant J 11:1-14 

Konieczny A, Ausubel FM (1993) A procedure for mapping Arabidopsis mutations using co- 
dominant ecotype-specific PCR-based markers. Plant J 4:403-410 

Murashige T, Skoog F (1962) A revised medium for rapid growth and bioassays with tobacco 
tissue cultures. Physiol Plant 15:473-497 

Neff MM, Neff DJ, Chory J, Pepper AE (1998) dCAPS, a simple technique for the genetic 
analysis of single nucleotide polymorphisms: experimental applications in Arabidopsis 
thaliana genetics. Plant J 14:387-392 

Oelmiiller R, Peskan-Berghofer T, Shahollari B, Sherameti I, Varma A (2005) MATH-domain 
containing proteins represent a novel gene family in Arabidopsis thaliana and are in- 
volved in plant/microbe interactions. Physiol Plant 124:152-166 

Peskan-Berghofer T, Shahollari B, Giang PH, Hehl S, Markert C, Blanke V, Varma AK, Oel- 
miiller R (2004) Association of Piriformospora indica with Arabidopsis thaliana roots 
represents a novel system to study beneficial plant-microbe interactions and involves 
early plant protein modifications in the endoplasmatic reticulum and at the plasma 
membrane. Physiol Plant 122:465-477 

Sommerville CR, Ogren WL (1982) Isolation of photorespiration mutants in Arabidopsis 
thaliana. In: Edelman M, Hallick RB, Chua N-H (eds) Methods in chloroplast molecular 
biology. Elsevier Biomedicinal, New York, pp 129-139 

B. Shahollari et al. 

Varma A, Verma S, Sudha V, Sahay N, Britta B, Franken P (1999) Piriformospora indica - a 

cultivable plant growth promoting root endophyte with similarities to arbuscular my- 

corrhizal fungi. Appl Environ Microbiol 65:2741-2744 
Verma SA, Varma A, Rexer K-H, Hassel A, Kost G, Sarbhoy A, Bisen P, Biitehorn B, Franken 

P (1998) Piriformospora indica, gen. et sp. nov, a new root- colonizing fungus. Mycologia 

Weigel D, Ahn JH, Blazquez MA, Borevitz JO, Christensen SK, Fankhauser C, Ferrandiz C, 

Kardailsky I, Malancharuvil EJ, Neff MM, Nguyen JT, Sato S, Wang ZY, Xia Y, Dixon RA, 

Harrison MJ, Lamb CJ, Yanofsky MF, Chory J (2000) Activation tagging in Arabidopsis. 

Plant Physiol 122:1003-1013 
Weiss M, Selosse MA, Rexer KH, Urban A (2004) Sebacinales: a hitherto overlooked cosm of 

heterobasidiomycetes with a broad mycorrhizal potential. Mycol Res 108:1-8 

Biophysical Phenomics Reveals Functional 
Building Blocks of Plants Systems Biology: 
a Case Study for the Evaluation 
of the Impact of Mycorrhization 
with Piriformospora indica * 

R.J. Strasser, M. Tsimilli-Michael, D. Dangre, and M. Rai 

Soil microbial activity is a main parameter in ecosystem functions. Arbuscular 
mycorrhiza fungi are mutualistic microsymbionts of about 90% of higher plants 
in natural, semi-natural and agricultural plant communities. As mycorrhizo- 
sphere systems can be tailored to help plants to survive in nutrient-deficient, 
degraded habitats or during stress periods, they are highly advantageous in sus- 
tainable agriculture. However, the success of this practise, as for any microbial 
inoculation, depends strongly on the effectiveness of mycorrhization, which de- 
pends on complex interactions between plant and symbiont. 

Mycorrhization has multiple effects on the physiology of the plant at different 
levels. We focus our interest on the responses of the photo synthetic apparatus and 
especially on photosystem (PS) II (see e.g. Tsimilli-Michael et al. 2000) which is 
well known to be a component of the plant system highly sensitive to any stress. 

Our approach for the evaluation of the effectiveness of mycorrhization, which 
we term biophysical phenomics, is based on the description of an in vivo vitality 
analysis (behaviour/performance) of PSII, i.e. the description of a biophysical 
phenotype. The tools that provide access to this phenotyping, termed the "JIP- 
test", are based on the analysis of the fast fluorescence kinetics O-J-I-P exhibited 

Reto J. Strasser, Merope Tsimilli-Michael: Laboratory of Bioenergetics, University of Geneva, 
Chemin des Embrouchis 10, CH-1254 Jussy-Geneva, Switzerland, 

Merope Tsimilli-Michael: Ath. Phylactou 3, CY-1100, Nicosia, Cyprus, 
email: cy 

Devanand Dangre, Mahendra Rai: Department of Biotechnology, SGB Amravati University, 

Amravati-444602, Maharashtra, India, 

* Dedicated to the memory of Hannes Schuepp, a great scientist and a wonderful person. 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmuller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

R.J. Strasser et al. 

by all oxygenic photo synthetic organisms upon illumination (for reviews, see 
Strasser et al. 2000, 2004). 

Moreover, in our analysis, we show that biophysical phenotyping, which re- 
fers to the system macrostate, allows us to recognise and evaluate impacts on 
the function and (re) distribution of the heterogeneous microstates - functional 
building blocks - whose balance defines the macrostate (Strasser and Tsimilli- 
Michael 2005). 

We also present, as an application of our approach, a case study of the benefi- 
cial role of the emerging growth booster and in vitro -cultivable Piriformospora 
indica (Varma et al. 1999) on chick peas (Cicer arietinum L. Chafa variety) ex- 
posed to cadmium stress, which we further compare with the impact of typical 
arbuscular mycorrhiza fungi (Glomus mosseae, Glomus caledonium). 

Biophysical Phenomics of the Fast Fluorescence Rise O-J-l-P 

The Energy Cascade in the Photosynthetic Apparatus 

A simplified scheme for the energy cascade in photosystem II of the photo - 
synthetic apparatus is presented in Fig. 21.1 (modified after Epitalawage et al. 
2003). Not only solar energy but any light energy of suitable wavelengths, i.e. 
wavelengths that can be absorbed by chlorophyll and accessory pigments, has 
the same fate. In the energy conservation pathway, the flux of photons is trans- 
formed sequentially to a flux of excitons, a flux of electrons and a flux of mol- 
ecules. The electron flow is coupled to the formation of adenosine triphosphate 
(ATP), which is a high-energy compound. The end-products are molecular 
oxygen (0 2 ), evolved by water (H 2 0) splitting, and sugars, formed from carbon 
dioxide (C0 2 ). Part of the excitation is not conserved; it is dissipated, mainly as 
heat and less as fluorescence emission by chlorophyll (Chi) a. As the kinetics 
of Chi a fluorescence reflect changes in the function and structure of PSII and, 
concomitantly, changes in the whole electron transport chain, they provide a 
very useful, non-invasive tool for the investigation of the behaviour and perfor- 
mance of the photosynthetic apparatus. 

Microstates - Functional Building Blocks of Photosynthesis 

According to open system thermodynamics, the Gibbs energy, linked to bio- 
chemical activity (quantity term), and the entropy-related energy component, 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 321 

Solar energy 

Absorption ABS 

Heat dissipation DI 

Trapping TR 

Reaction | Energy 
centre I Conservation 

Electron transport ET 

C0 2 / Sugar 

Biological activity, Growth, Biomass 

Fig. 21.1 A simplified scheme for the energy cascade in photosystem II (PSII) of the photosyn- 
thetic apparatus (modified after Epitalawage et al. 2003). Light absorption (ABS) creates excited 
chlorophyll. Part of the excitation energy is dissipated, mainly as heat (heat dissipation, DI) and less 
as fluorescence emission (F); another part is channelled to the reaction centre (trapping, TR) to be 
converted to redox energy (Energy Conservation), with the simultaneous evolution of oxygen (02) 
by water (H20) splitting. The redox energy creates electron transport (ET), which, via PSI (not 
shown), leads ultimately to C0 2 fixation into sugars (Metabolism) 

linked to the structure, complexity and organization of the system (quality 
term) follow optimization strategies, potentially establishing steady-states (sta- 
bility term) under given conditions (see Strasser and Tsimilli-Michael 2005). 

Recognizing the high complexity and heterogeneity of the photo synthetic 
system in nature (see also Strasser 1985; Strasser and Tsimilli-Michael 1998), we 
propose that its apparent state is a heterogeneous macrostate, determined by the 
statistical distribution of microstates, as listed in the model shown in Fig. 21.2 
(modified after Strasser and Tsimilli-Michael 2005): architecture of PSII and 
PSI antenna, i.e. size and connectivity among units (grouped/separate), light- 
harvesting complexes (LHC II and I), kinase-catalyzed migration from PSII to 
PSI of an LHC component when phosphorylated (LHC-P), spill-over from PSII 
to PSI antenna, types of electron donation to PSII raction centers (from wa- 

R.J. Strasser et al. 

e" donors 

non-Q A - 

e" donors 

non-Q B - 

Q B -reducing 

PQ pool 
Cyt b6/f, PC 

non-CC>2- Vs^A — \ v 1 — 

4~ . ^ _ NADP-reducing 
fixing ^r » 

CO2 fixation 

LHC 1 

Fig. 21.2 Heterogeneity 
of microstates/functional 
units, whose balance de- 
termines the macrostate of 
the photosynthetic system 
(modified after Stras- 
ser and Tsimilli-Michael 
2005). For details, see text 

ter oxidation or internal/external donors), Qa reducing reaction centers (RC) 
or non-QA reducing (heat sinks), Qb reducing or non-Qe reducing (slow Qa re- 
oxidizing) units, states of intermediate electron carriers (PQ pool, Cytb6/f, PC), 
splitting of PSI acceptor side, in non-NADP-reducing pathways and NADP-re- 
ducing pathways, the latter further split in non-C0 2 -fixing and towards C0 2 
fixation. For any steady- macro state (optimal/adapted), the balance of mecha- 
nisms governing the distribution of microstates is equivalent to optimizations of 
quantity, quality and stability, which are interrelated, governed by the genetics 
of the system, its resources and its environment. Concomitantly, stress is any 
disturbance of the achieved balance, upon which the system undergoes micro- 
state changes towards a new optimal balance, i.e. a new macrostate (Strasser and 
Tsimilli-Michael 2005). 

Measuring Fluorescence Transients with PEA, 
Handy-PEA and FIM- Fluorimeters 

Chl a fluorescence transients exhibited by any photosynthetic material are mea- 
sured by a PEA (Plant Efficiency Analyser) or Handy-PEA fluorimeter (Hansat- 
ech Instruments, Kings Lynn, UK; Fig. 21.3) or FIM fluorimeter (Fluorescence 
Induction Meter 1500; ADC, Hoddesdon, UK). The transients are induced by a 
red light (peak at 650 nm) of 600 W m~ 2 (equivalent to 3200 \iE s" 1 m~ 2 ) provided 
by an array of six (PEA and FIM fluorimeters) or three (Handy-PEA fluorim- 
eter) light- emitting diodes, and recorded for 1 s with 12 bit resolution. The data 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 323 

Fig. 21.3 The PEA (Handy- 
PEA) fluorimeter used for 
our studies. The photo is 
from in situ measurements, 
with the clips already put 
on the leaves to dark- adapt 
them. The insert shows 
the sensor of the instru- 
ment, which provides, by 
LEDs, the red actinic light 
(650 nm) and collects the 
fluorescence signals 

acquisition in the PEA and FIM fluorimeters is every 10 [as for the first 2 ms, 
every 1 ms between 2 ms and 1000 ms and every 100 ms thereafter (for further 
details, see Strasser et al. 1995; for reviews, see Strasser et al. 2000, 2004), while 
in the Handy-PEA fluorimeter it is every 10 [as (in the interval 10 us to 0.3 ms), 
every 0.1 ms (0.3-3.0 ms), every 1 ms (3-30 ms), every 10 ms (30-300 ms), etc. 
(see e.g. Toth et al. 2005). The first reliable measurement with PEA and FIM 
fluorimeters is at 50 us, while with the Handy-PEA fluorimeter it is at 20 us. 

How Fluorescence Kinetics Provide an Insight 
to the Micro states - Functional Blocks of PSII 

Qualitative Screening of Many Samples 

Screening of many samples in situ by recording Chi a fluorescence transients 
is a very simple task. Figure 21.4 depicts Chi a fluorescence transients of dark- 
adapted leaves of Hedera (left panel) and Shejfflera (right panel), measured with 

R.J. Strasser et al. 

3500 " 

300(1 -; 

2500 - ; 

2000 " " 

1500 -: 

E 1000 ■: 

500 - 

- ■ ■ ' "'■■ 

2000 " 

1 600 " - 

1200 - 

mwi -- 

400 - 

1.0 - 

0.8 " 

0.6 - 

2.0 t 

1.5 - 

0.5 - 

J i 1 1^1.1 1 I ■ | ii| 

I I I 1 1 1 I 

.... 4)2 

0,0 1 

1 1. 1 

, ms 

i.o -- 

0,8 - 

0.6 - 

0.4 - 

0.2 - 

4.0 - 

1.0 -- 

AW t 

Time, ms 

Fig. 21.4 Chi a fluorescence transients of dark adapted leaves of Hedera (left panels) and Shefflera 
(right panels), measured with PEA and Handy-PEA fluorimeters respectively. Young leaves (black 
open triangles) and mature leaves (open grey circles) from both plants were measured. The tran- 
sients, induced by saturating red actinic light (peak at 650 nm) of 600 W m~ (equivalent to about 
3000 uE s~ m~ ), are plotted on a logarithmic time-scale. The plots in the upper panels depict the 
kinetics of the raw fluorescence data, F t . The kinetics of the relative variable fluorescence V t and W t , 
calculated from the raw data as V t = (F t -Fo)/(F M -Fo) and W t = VJVj = (F t -F )/(Fj-F ), are depicted 
in the plots of the middle and lower panels respectively (left axis). In the plots of V t and W t , the cor- 
responding differences AV t and AW t , between the average transients of young and mature leaves 
(young minus mature) are also plotted (black closed diamonds; right axis). For other details, see 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 325 

PEA and Handy-PEA fluorimeters, respectively. Young leaves (black open trian- 
gles) and mature leaves (open grey circles) from both plants were measured. The 
transients, induced by saturating red actinic light (peak at 650 nm) of 600 W m~ 2 
(equivalent to about 3000 \iE s" 1 m~ 2 ), are plotted on a logarithmic time-scale. 

The plots in the upper panels depict the kinetics of the raw fluorescence data, 
F t . The first to observe is that all the transients are polyphasic with, however, 
differences between the two species. We can also clearly observe that Shejfflera 
(right panel) exhibits a high homogeneity among samples, which permits the 
distinction between young and mature leaves, while in Hedera possible differ- 
ences are hidden under the wide heterogeneity between samples. 

However, when we transform the kinetics of the raw data to the kinetics of the 
relative variable fluorescence V t = (F t -F )/(F M -F ) or W t = V t /Vj = (F t -F )/(Fj-F ) 
[for the definition of terms and symbols, see text below as well as Fig. 21.5 and 
Table 21.1], we can see in the respective plots of the middle and lower panels 
a clear distinction between young and mature leaves for both species. In these 
plots, the corresponding differences AV t and AW t , between the average tran- 
sients of young and mature leaves (young minus mature) are also plotted (black 
closed diamonds; secondary vertical axis). 

The Typical O-J-l-P Fluorescence Transient: Definition 

of Steps and Selection of Fluorescence Data for the JIP-Test 

The Chi a fluorescence transient, known as the Kautsky transient (Kautsky and 
Hirsh 1931), consists of a rise completed in less than one second and a subse- 
quent slower decline towards a steady state. Our method presented here utilises 
only the fast rise that is generally accepted to reflect the accumulation of the 
reduced form of the primary quinone acceptor Q A , otherwise the closure of the 
reaction centres (RCs), which is the net result of Q A reduction due to PSII activ- 
ity and Qa reoxidation due to photosystem I (PSI) activity. When the photosyn- 
thetic sample is kept for a few minutes in the dark, Q A is fully oxidised, hence 
the RCs are all open, and the fluorescence yield at the onset of illumination is 
denoted as F (minimal fluorescence). The maximum yield F P at the end of the 
fast rise, depending on the achieved reduction-oxidation balance, acquires its 
maximum possible value - denoted as F M - if the illumination is strong enough 
to ensure the closure of all RCs. A lot of information has been driven during 
the past 70 years from the fluorescence transient (for reviews, see Papageorgiou 
1975; Briantais et al. 1986; Govindjee et al. 1986; Krause and Weiss 1991; Dau 
1994; Govindjee 1995; Strasser et al. 2000, 2004). 

Transients recorded with high time-resolution fluorimeters, e.g. the PEA- or 
Handy-PEA instrument that we use, have provided additional and/or more ac- 
curate information (Strasser and Govindjee 1992; Strasser et al. 1995; for re- 
views, see Strasser et al. 2000, 2004). The fluorescence rise kinetics was shown 
to be polyphasic, clearly exhibiting, when plotted on a logarithmic time-scale, 

R.J. Strasser et al, 

Table 21 .1 Summary of terms, definitions and formulae used by the JlP-test 

Experimental signals 

Minimal fluorescence intensity 

Maximal fluorescence intensity 
Fluorescence intensity at 2 ms (J-step) 
Fluorescence intensity at 30 ms (I-step) 
Fluorescence intensity at 300 us 

Symbol Formula 

F l 

Normalised signals 

Maximum variable fluorescence 

Relative variable fluorescence (from F to F M ) 
Relative variable fluorescence (from F to Fj) 
Relative variable fluorescence at the J-step 
Relative variable fluorescence at the I-step 

Initial slope a of the V = f(f) transient: M = 

(AV7Ar)o = (dV7dr)o = [dQ A /Q A; totai)/dr] = 
initial rate of primary photochemistry 

v t 

V ] 

— -Fm — F 

M - J- 

= (F t - F ) / (F M - F ) 
= (F t - F ) / (F ] - F ) 
= (Fj - F ) / (F M - F ) 
= (F : - F ) / (F M - F ) 

= 4x (F 30 o H s - ^o) / (F M - F ) 

Specific fluxes: energy fluxes per reaction centre 

Specific flux for absorption 
Specific flux for trapping 3 
Specific flux for dissipation 3 
Specific flux for electron transport 3 

ABS/RC = (Mo/Vj) / [1 - (Fo/Fm)] 

TRo/RC = (Mo/Vj) 

DIo/RC = (ABS/RC) - (TRo/RC) 

ETo/RC = (Mo/Vj) x (1 - Vj) 

Yields or ratios of fluxes 

Maximum quantum yield 3 of primary 
photochemistry: (p Po = TR /ABS 

Maximum yield 3 of electron trans- 
port: (pEo — ETo/ABS 

Efficiency 3 of a trapped exciton to move 
an electron into the electron transport 

chain further than Q A : \|/o — ET /TR 

= [1 - (Fo/Fm)] 

= [1 - (Fo/Fm)] x (1 - Vj) 

= (i - v^o 

At the onset of illumination (at 50 (is for PEA and FIM, or at 20 us for Handy-PEA, in which 
case the initial slope must be calculated between 20 us and 270 us) 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 327 

30 ms 

-50 \xs 

► M = (AV/At)o 

0.2 0.4 

Time, ms 

J I I I I I I I 

J I I I I I I I 

J I I I I I I I 

J I I I I I I I 

J I I I I I I I 

J I I I I I I I 

Time, ms 

Fig. 21 .5 A typical Chi a polyphasic fluorescence rise O-J-I-P, exhibited by higher plants. The tran- 
sient is plotted on a logarithmic time-scale from 50 us to 1 s. The marks refer to the selected fluo- 
rescence data used by the JlP-test for the calculation of structural and functional parameters. The 
signals are: the fluorescence intensity F (at 50 (is), the fluorescence intensities Fj (at 2 ms) and Fi (at 
30 ms) and the maximal fluorescence intensity Fp = Fm (at fenax). The insert presents the transient 
expressed as the relative variable fluorescence V = (F-Fo)/(F M -F ) vs time, from 50 (is to 0.75 ms on 
a linear time-scale, demonstrating how the initial slope, also used by the JlP-test, is calculated: M 
= (dWdf)o = (AV7Af)o = (V 3 o(Vs)/(0.25 ms) 

the steps J (at 2 ms) and I (at 30 ms) between the initial O (F ) and maximum 
P level (F P ). Moreover, a much more precise detection of F is achieved, as well 
as the detection of the initial slope, which offers a link to the maximum rate of 
photochemical reaction. 

Despite differences among species (as e.g. shown in Fig. 21.4), all oxygenic 
photosynthetic material investigated so far using this method show this poly- 
phasic rise, labelled O-J-I-P. A typical Chi a fluorescence transient O-J-I-P is 
shown in Fig. 21.5, plotted on a logarithmic time-scale. The following original 
data are utilised by the JlP-test: the maximal measured fluorescence intensity, 

R.J. Strasser et al. 

F P , equal here to F M since the excitation intensity is high enough to ensure the 
closure of all RCs of PSII; the fluorescence intensity at 50 us considered as the 
intensity F when all RCs are open; the fluorescence intensity at 300 us (F 300vls ) 
required for the calculation of the initial slope M = (dV/dt) = (AV/At) of the 
relative variable fluorescence (V) kinetics (see insert in Fig. 21.5); the fluores- 
cence intensities at 2 ms (J-step) denoted as F ]y and at 30 ms (I-step) denoted as 
Fi (for reviews, see Strasser et al. 2000, 2004). 

The O-L-K-J-l-H-G-P Fluorescence Transient: From Steps to Bands 

As shown in Fig. 21.4, the kinetics of AV t and AW t (where V t and W t are differ- 
ent expressions of relative variable fluorescence) reveal bands hidden in the J- 
and I-steps of the fluorescence kinetics F t , which are much richer in information 
than the original O-J-I-P. 

Figure 21.6, which utilises the results of a stress study - nitrogen deficiency in 
cowpea plants (Vigna unguiculata L) - reported by Schmitz et al. (2001), offers a 
detailed presentation of these bands, regarding their position and labelling and 
their relation with the main steps. (Note: the transients are here presented as 
kinetics of A V t ; choosing AW t would lead to the resolution of the same bands, as 
can be seen in Fig. 21.4). The sequence of events is distinguished in single-turn- 
over and multiple-turnover events. Moreover, the main information that can be 
derived from each band is depicted, namely information concerning: Q A , the 
oxidised primary quinone acceptor; p 2G > the overall grouping probability within 
PSII antenna; OEC, the oxygen -evolving complex; Qb, the reduced (one elec- 
tron) secondary quinone acceptor; Qb , the reduced (two electrons) secondary 
quinone acceptor; Q B H 2 , the protonated secondary quinone acceptor; EC re d> the 
fully reduced electron carriers. 

One can easily see that this list of derivable information provides an insight 
to microstates - functional building blocks of photosynthesis, to which we de- 
convolute (see Fig. 21.2) the macrostate - biophysical phenotype. 

The JIP-Test: Conversion of Experimental Signals to Biophysical Parameters 
and the Performance Index 

For the evaluation of the impact of any stress and, similarly, of mycorrhizo- 
sphere activity on plants, we apply the "JIP-test", which provides a quantitative 
analysis of the in vivo vitality - behaviour/performance - of PSII, i.e. a quanti- 
tative description of the biophysical phenotype - macrostate, by accessing the 
different microstates - functional building blocks. The "JIP-test" is an analysis of 
the fast fluorescence kinetics O-J-I-P exhibited by all oxygenic photosynthetic 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 329 

Single-turnover events 

O L K 

0.02 0.15 0.3 

Q A p 2G OEC Q a 

Multiple-turnover events 

F t 

Q B H 2 EC r ed 

1 10 

Time, ms 

Fig. 21.6 Chlorophyll a fluorescence transients exhibited by dark-adapted leaves of cowpea plants 
(Vigna unguiculata L) grown at different KN0 3 concentrations (based on data from Schmitz et al. 
2001) are presented as kinetics of relative variable fluorescence V t = (Ft-Fo)/(F M -Fo), open circles, 
left axis, and as difference kinetics, AV b i.e. nitrogen deficient minus control (closed circles, right 
axis; see also legend of Fig. 21.4), where the extent of deficiency increases form bottom to top. 
The transients show the typical basic STEPS O-J-I-P (see also Fig. 21.5) while, as demonstrated 
in the upper panel, the difference transients reveal the full sequence of BANDS O-L-K-J-I-H-G-P 
(P or any F t ), which is much richer in information (for the L-band, see Fig. 21.8). INFOS refer to 
the main information that can be derived by each band, i.e. information concerning Q A (oxidised 
primary quinone acceptor), p 2 G (overall grouping probability within PSII antenna), OEC (oxygen 
evolving complex), Qi -(reduced secondary quinone acceptor, one electron), Qb (reduced second- 
ary quinone acceptor, two electrons), QbH 2 (protonated secondary quinone acceptor) and EC re d 
(fully reduced electron carriers). The vertical dashed line separates the phase of single -turnover 
events of primary photochemistry from that of multiple turnover events 

R.J. Strasser et al. 

organisms upon illumination, based on a simple model and the Theory of En- 
ergy Fluxes in Biomembranes (Strasser 1978, 1981). It is well documented that 
the shape of the O-J-I-P transient and its analysis by the JlP-test are efficient 
biophysical tools, not only in the recognition and evaluation of the beneficial 
role of mycorrhiza symbiosis on PSII activity (which we also approach as stress 
- see Tsimilli-Michael and Strasser 2002; see also Tsimilli- Michael et al. 2000) 
but, much more generally, in the biophysical phenotyping of the photosynthetic 
apparatus of a plant under any stress, biotic (e.g. Tsimilli-Michael et al. 2000) 
or abiotic, i.e. any stress caused by changes in different environmental condi- 
tions, e.g. light intensity, temperature, drought, atmospheric C0 2 or ozone el- 
evation, chemical influences (Srivastava and Strasser 1995, 1996; Srivastava et 
al. 1997; Tsimilli-Michael et al. 1995, 1996, 1999, 2000; Tsimilli-Michael and 
Strasser 2001; Van Rensburg et al. 1996; Kruger et al. 1997; Ouzounidou et al. 
1997; Clark et al. 1998, 2000; Van Heerden et al. 2003), even by diurnal changes 
(Strasser and Tsimilli-Michael 2001), as well as by senescence (Prakash et al. 
2003). For a review, see Strasser et al. (2004). 

The "JlP-test", which is a conversion of fluorescence data (selected as de- 
scribed above in; see also Fig. 21.5) to biophysical parameters and the 
performance index, is schematically presented in Fig. 21.7 and analytically in 
Table 21.1. 

The biophysical parameters, all referring to time zero (onset of fluorescence 
induction) are: (a) the specific energy fluxes (per reaction centre, RC) for absorp- 
tion (ABS/RC), trapping (TR /RC), dissipation (DI /RC = ABS/RC - TR /RC; 
not shown in Fig. 21.7, but see Table 21.1) and electron transport (ET /RC), (b) 
the flux ratios or yields, namely, the maximum quantum yield of primary photo- 
chemistry ((p Po = TRq/ABS), the efficiency (\|/ = ET /TR ) with which a trapped 
exciton can move an electron into the electron transport chain further than 
Qa and the quantum yield of electron transport ((p Eo = ET /ABS = (p Po x \|/ ), (c) 
the phenomenological energy fluxes (per excited cross-section, CS) for absorp- 
tion (ABS/CS), trapping (TR /CS), dissipation (DI /CS) and electron transport 
(ETq/CS). The amount of active PSII reaction centres per excited cross-section 
(RC/CS) is also derived by the JlP-test. [Note: the calculation of the phenomeno- 
logical fluxes is based on the ABS/CS flux, which can be directly determined (as 
Chl/area or Chl/dry weight or Chl/protein) or approximated by F or F M ] . 

Figure 21.7 depicts also the definition of the performance index on an absorp- 
tion basis, PI A bs> which compiles all basic biophysical parameters and, as well 

► Fig. 21.7 Conversion of fluorescence data selected from an O-J-I-P fluorescence transient to 
biophysical parameters with the JlP-test, which is based on the Theory of Energy Fluxes in Bio- 
membranes. The figure distinguishes experimental signals, normalised signals and biophysical pa- 
rameters, the latter being further distinguished in specific and phenomenological fluxes and yields 
(or flux ratios). The definition of the performance index on absorption basis, PIabs, is also depicted, 
together with the formulae which link the PIabs with the experimental and normalised signals and 
the biophysical parameters. (Chl RC and Chl an t stand for the chlorophyll content of the reaction cen- 
ters and of the antenna respectively, while Chl to tai = Chl an t + Chl RC stands for the total chlorophyll; 
for the definition of other symbols, see text, Table 21.1 and Fig. 21.5) 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 331 

i — 

i — 

1 1 

i ' 

r -. 

1 *^5 JO n 

1 *^J Sg 

■ 5S *«* I 

! 8 « 

Ms « ' 

1 ■ ? St ii 

i St •*• ' 

! 2 •& ' 

^ 1 

' ^ 1 

1 ^ r 

11 © 

! & 

! ^ ! 

, bq ; 

o , 

! Oh O 

! ^5 o 
! ^ Ph 

! U ^ 
! _^ -o 

U . 

/ ^ 

° 9 cr, 

s Pfo, 

R.J. Strasser et al. 

documented (for reviews, see Strasser et al. 2000, 2004), is a very appropriate 
representative index of the vitality of the photo synthetic system - macrostate: 

* *ABS 

Yrc <PPo Vo 

^Yrc 1"<Ppo l "Vo 

where y R c = Chl RC /Chl total , hence y rc /(1-Yrc) = Chl RC /Chl total ~ RC/ABS. 

According to the definition, the performance index is a product of expressions 
of the form [pj(l-pd], where the several pi stand for probabilities or fractions. 
Such expressions are well known in chemistry, with p x representing e.g. the frac- 
tion of the reduced and ( 1 —pi) the fraction of the oxidised form of a compound, 
in which case log[pi/(l-pi)] expresses the potential or driving force for the cor- 
responding oxido -reduction reaction (Nernsts equation). Extrapolating this in- 
ference from chemistry, we can define the log(PI A Bs) as the total driving force 
(DF ABS ) for photosynthesis of the observed system, created by summing up the 
partial driving forces for each of the several energy bifurcations (all at the onset 
of the fluorescence rise O-J-I-P). 

r w \ ( - 'N ( ... >i 

DF ABS='°g(PI A Bs)= ,0 S 

( <PPd 1 . .„( 

+ log — L ^— +log 

V ABS; ^U-^poJ w U"V y 

By presenting a clear distinction between experimental signals, normalised sig- 
nals and biophysical parameters, Fig. 21.7 depicts also how PI A bs can be directly 
calculated using any of these sets. 

Case Study 

Mycorrhization and the Advantages of Piriformosporaindica, 

an Emerging Growth Booster 

The beneficial role of arbuscular mycorrhiza fungi (AMF) is well documented. 
P. indica, which belongs to the Basidiomycota, is a newly described root endo- 
phyte (Verma et al. 1998) with AMF-like characteristics (Varma et al. 2001). 
Moreover, in contrast to AMF which are obligate endosymbionts, P. indica has 
the added advantage of being able to grow in axenic cultures - it is cultivable in 
vitro (Varma et al. 1999). 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 333 

P. indica has growth- and yield-promoting effects on a broad range of plants, 
including medicinal plants: shoot and root length, biomass, basal stem, leaf area, 
overall size, number of inflorescences and flowers and seed production are all 
enhanced in the presence of fungi (Rai et al. 2001). Inoculation with the fungus 
and application of fungal culture filtrate also increase tolerance to temperature 
and drought, as well as to heavy metals. For example, concerning cadmium, 
which exerts toxic effects on plants, P. indica provides alleviation of the caus- 
ative stress (tolerance up to 300 |ig Cd per gramme of air-dried soil). Moreover, 
P. indica has the properties of biofertilizer, bioregulator, phytoremediator, im- 
munomodulator and antioxidants/drugs enhancer (Varma, personal commu- 
nication). It also provides biocontrol against insects and pathogens (Pham et al. 
2004a, b,c). 

All these impressive traits make P. indica very valuable, both for basic re- 
search, as an excellent model organism for the study and understanding of the 
beneficial plant-microbe interactions and for applied research, as a powerful 
new candidate tool for improving plant production systems in agroforestry and 
flori-horticulture applications for sustainable agriculture. 

We here apply our approach for a comparative study of the beneficial role of 
typical arbuscular mycorrhiza fungi (G. mosseae, G. caledonium) and P. indica, 
on chick peas (Cicer arietinum L. Chafa variety) exposed to cadmium stress. 

Phenomics of the O-J-l-P Fluorescence Transient for the Study 
of Cadmium Stress on Chick Peas {Cicer arietinum L. Chafa variety) 
With and Without Symbiosis With Glomus mosseae, G. caledonium 
and Piriformospora indica 

As analysed above (Fig. 21.6), normalisations and differences of the fluorescence 
transients reveal a deconvolution of the typical O-J-I-P shape into additional 
bands, carrying useful information about microstates of the photosynthetic sys- 

Figure 21.8 is an application of this approach to the presented case study. O- 
J-I-P Chi a fluorescence transients are plotted as kinetics of the relative variable 
fluorescence W t = VJV ] = (F t -F )/(F 1 -F ) on a logarithmic time-scale (like in 
the lower panel of Fig. 21.4). The presented transients were exhibited by dark- 
adapted leaves of chickpea (C. arietinum L. Chafa variety) measured with the 
Handy- PEA fluorimeter at the 42nd day after inoculation with G. mosseae 
(black diamonds), G. caledonium (black squares) and P. indica (black circles). 
All inoculated plants were under cadmium stress (added on the 21st day). The 
transients from non-inoculated plants of the same age in the absence (control, 
grey circles) or presence of Cd (black triangles) are also depicted. We observe 
that these transients (open symbols) show minor differences (similarly to the 

R.J. Strasser et al. 

Time, ms 

Fig. 21.8 Chi a fluorescence transients (each presenting average kinetics of raw fluorescence data 
from 12 samples) of dark- adapted leaves of chick peas (Cicer arietinum L. Chafa variety) measured 
with the Handy-PEA fluorimeter at the 42nd day after inoculation with G. mosseae {black dia- 
monds), G. caledonium (black squares) and P. indica (black circles). All inoculated plants were under 
cadmium stress (added on the 21st day). The transients from non-inoculated plants of the same age 
in the absence of Cd (control, grey circles) or presence of Cd (black triangles) are also depicted. The 
transients are presented as kinetics of the relative variable fluorescence W t = V t / Vj = (F t -F )/(Fj-F ), 
open symbols, left axis, and as AW t (treated minus control; closed symbols, right axis). The insert 
depicts, on a linear time-scale from 50 us to 300 us, the transients normalised as (F t -Fo)/(F3oo^ s -Fo), 
as well as their differences A[(Ft-Fo)/(F3oo^-Fo)] from the control, which reveal the L-band 

cases presented in Figs. 21.4, 21.6). However, when plotted as difference kinetics 
AW t (treated minus control; closed symbols), they reveal major differences con- 
cerning the amplitudes of the bands. The difference kinetics demonstrate that: 
(a) the trend of the impact of all three symbionts is the same and (b) this impact 
is the almost complete elimination (range 50 us to 2 ms) or even the overcom- 
pensation (2 ms to 1 s) of the major effects of Cd stress on the transients. Similar 
information is derived from the insert of Fig. 21.8, where the transients are de- 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 335 

i.o O, 

J I I L 

10 20 30 40 50 60 

Days after inoculation with P. indica 

g i.o ■- 

10 20 30 40 50 60 

Days after inoculation with P. indica 

Fig. 21.9 The relative performance index PlABs/PlABs,controi (left panel) and the relative maximum 
quantum yield of primary photochemistry (pp /(pPo,controi (right panel), from day 10 to day 56 after in- 
oculation of chickpeas (C. arietinum L. Chafa variety) plants with P. indica. Inoculated (grey circles) 
and non-inoculated (black circles) plants were put under cadmium stress on the 21st day The value 
of the parameter from non-inoculated, and without addition of cadmium, plants of the same age 
was used as the control value of each parameter (subscript "control") 

picted, on a linear time-scale from 50 [is to 300 (is, as (F t -F )/(F 300VLS -F ) y along 
with their difference A[(F t -F )/(F 300 ^ s -F )] from the control. It is worth noting 
that, when this normalisation is used, the difference transients reveal the L-band 
(not appearing in AW t ; see legend of Fig. 21.6). 

Let us now follow the impact of Cd stress with and without symbiosis on 
parameters derived by the JlP-test. 

We first demonstrate a comparison of the impact of P. indica on the perfor- 
mance index PI A bs (for definition and formulae, see Fig. 21.7) and the commonly 
used maximum quantum yield of primary photochemistry (p Po (for definition 
and formulae see Table 21.1) by depicting in Fig. 21.9 their stress kinetics from 
day 10 to day 56 after inoculation with P. indica. Inoculated (grey circles) and 
non-inoculated plants (black circles) were put under cadmium stress on the 21st 
day. The parameters are presented as PlABs/PlABs,controi (left panel) and (pp /(pPo,controi 
(right panel), where PI A Bs,controi and (pp , C ontroi refer to non-inoculated plants of the 
same age that were not put under cadmium stress (control plants). 

We observe that the PlABs/PlABs,controi undergoes wide changes during the 
course of the stress. Though Cd addition is shown to affect both non-inocu- 
lated and inoculated plants, the beneficial role of the symbiont concerning the 
tolerance to Cd stress is clearly revealed. (pp /(pp ,controi appears much less sensi- 
tive than PlABs/PlABs,controi and thus much less appropriate in detecting vitality 

R.J. Strasser et al, 

cpp o =TR /ABS 

V|/ = ETq/TRo 

cp Eo = ETq/ABS 

Fig. 21 .10 The impact of cadmium stress on different parameters derived by the JlP-test from the 
fluorescence transients (for terms, definitions and formulae, see Section, also Fig. 21.5 and 
Table 21.1). The figure refers to the 42nd day after inoculation with G. mosseae {diamonds), G. cale- 
donium (squares) and P. indica (circles). All inoculated plants were under cadmium stress (added 
on the 21st day). The case of non-inoculated plants of the same age under cadmium stress is also 
depicted (triangles). Each case is represented by an octagon, where the value of each parameter 
is normalised on that of the control case (i.e. non-inoculated, and without addition of cadmium, 
plants of the same age), which is thus depicted by the regular octagon (dashed thick line) 

changes. However, magnification of the changes it undergoes (as shown in the 
insert) reveals that it exhibits a trend similar to that of PlABs/PlABs,controi for both 
non-inoculated and inoculated plants. 

The spider-plot of Fig. 21.10 presents the impact of cadmium stress on dif- 
ferent parameters derived by the JlP-test from the fluorescence transients, for 
non-inoculated and inoculated (with the three symbionts) plants. The param- 
eters are: PI A bs> <pp > tyo> <Peo> RC/ABS, V b TR /RC and ET /RC (see text in Sec- 
tion, also Fig. 21.5 and Table 21.1). The figure refers to the 42nd day 
after inoculation with G. mosseae (diamonds), G. caledonium (squares) and P. 
indica (circles). All inoculated plants were under cadmium stress (added on the 
21st day). Non-inoculated plants of the same age under cadmium stress are also 
depicted (triangles). Each case is represented by an octagon, where the value of 
each parameter is normalised on that of the control case (i.e. non-inoculated, 
and without addition of cadmium, plants of the same age), which is thus de- 
picted by the regular octagon (dashed thick line). 

Further than depicting in a comparative way the quantitative impact of stress 
on the individual parameters, each of which is linked to microstates, the presen- 
tation of the results with a spider-plot has the advantage of providing an easy 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 337 

f 20 

5 10 

Gm +Cd 

Pi +Cd 

J I I L 

J I I L 

J I I L 

J I I L 

J L 

Performance index PIabs 

Fig. 21 .1 1 Correlation of the height of the plant (physiological parameter) and the performance in- 
dex PIabs (biophysical parameter) derived by the JlP-test, for non-inoculated chick peas (C. arieti- 
num L. Chafa variety) plants in the absence (control) or presence (+Cd) of cadmium, or inoculated 
with G. mosseae, G. caledonium and P. indica and exposed to cadmium stress (Gm+Cd, Gc+Cd and 
Pi +Cd y respectively) 

recognition of stress effects. We can immediately see the distortion from the 
regular octagon (control) caused by Cd (triangles), which can be registered as 
the characteristic pattern of Cd stress; and we can also see that, for plants in 
symbiosis with any of the three symbionts, almost no distortion from the con- 
trol pattern (regular octagon) occurs. 

Correlation of Physiological with Biophysical Parameters 

Further than proving the high sensitivity of the performance index, we also 
checked whether and how it is related with physiological parameters, commonly 
used for the evaluation of the impact of symbiosis on the vitality of plants. Fig- 
ure 21.11 shows indeed a striking correlation between the height of the plant 
and the performance index PI A bs- The data presented come from non-inocu- 
lated chick peas (C. arietinum L. Chafa variety) plants in the absence (control) 
and presence (+Cd) of cadmium, as well as from plants inoculated with G. mos- 
seae, G. caledonium and P. indica and exposed to cadmium stress (Gm+ Cd, Gc+ 
Cd and Pi+ Cd, respectively). 

R.J. Strasser et al, 

Biophysical phenomics, as we term our approach, here applied for the evalua- 
tion of the effectiveness of mycorrhization, is shown to be powerful for the de- 
scription of an in vivo vitality analysis (behaviour/performance) of PSII, i.e. for 
the description of a biophysical phenotype (macrostate), as well as for the recog- 
nition and evaluation of stress impacts on microstates (the functional building 
blocks into which the macrostate is deconvoluted). With this approach we dem- 
onstrate the beneficial role of typical AMF and of the equally effective P. indica, 
concerning tolerance to Cd stress. 

Our techniques are thus shown to be very suitable for studying the effective- 
ness of soil microbial activity. The advantages of these techniques can be sum- 
marised as follows: 

• They provide an early diagnosis of vitality changes (primary stress effects, 
hence stress tolerance). 

• They can be used to screen not only leaves but any green part of the plant. 

• They are rapid - only a few seconds are needed for each measurement. 

• They can be applied in vivo. 

• They can be carried out anywhere - in the field, in the greenhouse or even in 
tissue cultures - and even on samples as small as 2 mm 2 . 

• They are not invasive. 

• They are inexpensive. 

Briantais JM, Vernotte C, Krause GH, Weiss E (1986) Chlorophyll a fluorescence of higher 

plants: chloroplasts and leaves. In: Govindjee, Amesz J, Fork DC (eds) Light emission by 

plants and bacteria. Academic, New York pp 539-583 
Clark AJ, Landolt W, Bucher J, Strasser RJ (1998) The response ofFagus sylvatica to elevated 

C02 and ozone probed by the JlP-test based on the chlorophyll fluorescence rise OJIP. 

In: De Kok LJ, Stulen I (eds) Responses of plant metabolism to air pollution and global 

change. Backhuys, Leiden, pp 283-286 
Clark AJ, Landolt W, Bucher J, Strasser RJ (2000) Beech (Fagus sylvatica) response to ozone 

exposure assessed with a chlorophyll a fluorescence performance index. Environ Pollut 

Dau H (1994) Molecular mechanisms and quantitative models of variable photosystem II 

fluorescence. Photochem Photobiol 60:1-23 
Epitalawage N, Eggenberg P, Strasser RJ (2003) Use of fast chlorophyll a fluorescence tech- 
nique in detecting drought and salinity tolerant chickpea (Cicer arietinum L.) varieties. 

Arch Sci Geneve 56:79-93 
Govindjee (1995) Sixty- three years since Kautsky: chlorophyll a fluorescence. Aust J Plant 

Physiol 22:131-160 
Govindjee, Amesz J, Fork DC (1986) Light emission by plants and bacteria. Academic, New 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 339 

Kautsky H, Hirsch A (1931) Neue Versuche zur Kohlensaureassimilation. Naturwissen- 
schaften 19:964 

Krause GH, Weiss E (1991) Chlorophyll fluorescence and photosynthesis: the basics. Annu 
Rev Plant Physiol Plant Mol Biol 42:313-349 

Kruger GHJ, Tsimilli-Michael M, Strasser RJ (1997) Light stress provokes plastic and elastic 
modifications in structure and function of photosystem II in camellia leaves. Physiol 
Plant 101:265-277 

Ouzounidou G, Moustakas M, Strasser RJ (1997) Sites of action of copper in the photosyn- 
thetic apparatus of maize leaves: kinetic analysis of chlorophyll fluorescence, oxygen 
evolution, absorption changes and thermal dissipation as monitored by photoacoustic 
signals. Aust J Plant Physiol 24:81-90 

Papageorgiou G (1975) Chlorophyll fluorescence: an intrinsic probe of photosynthesis. In: 
Govindjee (ed) Bioenergetics of photosynthesis. Academic, New York, pp 319-371 

Pham GH, Singh A, Malla R, Kumari R, Prasad R, Sachdev M, Luis P, Kaldorf M, Tatjana P, 
Harrmann S, Hehl S, Declerck S, Buscot F, Oelmuller R, Rexer KH, Kost G, Varma A 
(2004a) Interaction of P. indica with other microorganisms and plants. In: Varma A, 
Abbott L, Werner D, Hampp R (eds) Plant surface microbiology. Springer, Berlin Heidel- 
berg New York, pp 237-265 

Pham GH, Kumari R, Singh A, Sachdev M, Prasad R, Kaldorf M, Buscot F, Oelmuller R, Tat- 
jana P, Wei(3 M, Hampp R, Varma A (2004b) Axenic cultures of Piriformospora indica. 
In: Varma A, Abbott L, Werner D, Hampp R (eds) Plant surface microbiology. Springer, 
Berlin Heidelberg New York, pp 593-616 

Pham GH, Srivastava A, Saxena AK, Pareek A, Varma A (2004c) Protocol to understand the 
interaction between rhizobacteria and symbiotic fungus: Piriformospora indica. In: Po- 
dila G, Varma A (eds) Basic research and applications: Mycorrhizae. (Microbiology se- 
ries, vol 1) IK International, New York, pp 425-450 

Prakash JSS, Srivastava A, Strasser RJ, Mohanty P (2003) Senescence-induced alterations 
in the photosystem II functions of Cucumis sativus cotyledons: probing of senescence 
driven alterations of photosystem II by chlorophyll a fluorescence induction O-J-I-P 
transients. Indian J Biochem Biophys 40:160-168 

Rai M, Acharya D, Singh A, Varma A. (2001) Positive growth responses of the medicinal 
plants, Spilanthus calva and Withania somnifera to inoculation by Piriformospora indica 
in field trials. Mycorrhiza 11:123-128 

Schmitz P, Maldonado- Rodriguez R, Strasser RJ (2001) Evaluation of the nodulated status of 
Vigna unguiculata probed by the JlP-test based on the chlorophyll a fluorescence rise. In: 
CSIRO (ed) Proceedings of the 12th international congress on photosynthesis. CSIRO, 
Collingwood, S36-012 

Srivastava A, Strasser RJ (1995) How do land plants respond to stress temperature and stress 
light? Arch Sci Geneve 48:135-145 

Srivastava A, Strasser RJ (1996) Stress and stress management of land plants during a regular 
day. J Plant Physiol 148:445-455 

Srivastava A, Guisse B, Greppin H, Strasser RJ (1997) Regulation of antenna structure and 
electron transport in PS II of Pisum sativum under elevated temperature probed by 
the fast polyphasic chlorophyll a fluorescence transient OKJIP. Biochim Biophys Acta 

Strasser RJ (1978) The grouping model of plant photosynthesis. In: Akoyunoglou G (ed) 
Chloroplast development. Elsevier, Dordrecht, pp 513-524 

Strasser RJ (1981) The grouping model of plant photosynthesis: heterogeneity of photosyn- 
thetic units in thylakoids. In: Akoyunoglou G (ed) Photosynthesis III. Structure and 
molecular organisation of the photosynthetic apparatus. Balaban International Science 
Services, Philadelphia, pp 727-737 

Strasser RJ (1985) Dissipative Strukturen als Thermodynamischer Regelkreis des Photosyn- 
theseapparates. Ber Deutsche Bot Ges Bd 98:53-72 

R.J. Strasser et al. 

Strasser RJ, Govindjee (1992) The FO and the O-J-I-P fluorescence rise in higher plants and 
algae. In: Argyroudi-Akoyunoglou JH (ed) Regulation of chloroplast biogenesis. Ple- 
num, New York pp 423-426 

Strasser RJ, Tsimilli-Michael M (1998) Activity and heterogeneity of PS II probed in vivo by 
the chlorophyll a fluorescence rise 0-(K)-J-I-P. In: Garab G (ed) Photosynthesis: mecha- 
nisms and effects, vol V. Kluwer Academic, Rotterdam, pp 4321-4324 

Strasser RJ, Tsimilli-Michael M (2001) Stress in plants, from daily rhythm to global changes, 
detected and quantified by the JlP-test. Chim Nouv 75:3321-3326 

Strasser RJ, Tsimilli-Michael M (2005) State-changes realising adaptation to stress as the re- 
sult of an optimized redistribution of functional microstates. In: van Est A, Bruce D 
(eds) Photosynthesis: fundamental aspects to global perspectives. Allen, Montreal, pp 

Strasser RJ, Srivastava A, Govindjee (1995) Polyphasic chlorophyll a fluorescence transient in 
plants and cyanobacteria. Photochem Photobiol 61:32-42 

Strasser RJ, Srivastava A, Tsimilli-Michael M (2000) The fluorescence transient as a tool to 
characterize and screen photosynthetic samples. In: Yunus M, Pathre U, Mohanty P 
(eds) Probing photosynthesis: mechanism, regulation and adaptation. Taylor and Fran- 
cis, London, pp 443-480 

Strasser RJ, Tsimilli-Michael M, Srivastava A (2004) Analysis of the chlorophyll a fluores- 
cence transient. In: Papageorgiou GC, Govindjee (eds) Chlorophyll fluorescence: a sig- 
nature of photosynthesis. (Advances in photosynthesis and respiration series, vol 19) 
Kluwer Academic, Rotterdam, pp 321-362 

Toth SZ, Schansker G, Strasser RJ (2005) In intact leaves, the maximum fluorescence level 
(FM) is independent of the redox state of the plastoquinone pool: a DCMU- inhibition 
study. Biochim Biophys Acta 1708:275-282 

Tsimilli-Michael M, Strasser RJ (2001) Fingerprints for climate changes on the behaviour of 
the photosynthetic apparatus, monitored by the JlP-test. A case study on light and heat 
stress adaptation of the symbionts of temperate and coral reef foraminifers in hospite. 
In: Walther G-R, Burga CA, Edwards PJ (eds) Fingerprints of climate changes - adapted 
behaviour and shifting species ranges. Kluwer, New York, pp 229-247 

Tsimilli-Michael M, Strasser RJ (2002) Mycorrhization as a stress adaptation procedure. In: 
Gianinazzi S, Haselwandter K, Schuepp H, Barea JM (eds) Mycorrhiza technology in 
agriculture: from genes to bioproducts. Birkhauser, Basel, pp 199-209 

Tsimilli-Michael M, Kriiger GHJ, Strasser RJ (1995) Suboptimality as driving force for adap- 
tation: a study about the correlation of excitation light intensity and the dynamics of flu- 
orescence emission in plants. In: Mathis P (ed) Photosynthesis: from light to biosphere, 
vol V. Kluwer Academic, Rotterdam, pp 981-984 

Tsimilli-Michael M, Kriiger GHJ, Strasser RJ (1996) About the perpetual state changes in 
plants approaching harmony with their environment. Arch Sci Geneve 49:173-203 

Tsimilli-Michael M, Pecheux M, Strasser RJ (1998) Vitality and stress adaptation of the sym- 
bionts of coral reef and temperate foraminifers probed in hospite by the fluorescence 
kinetics O-J-I-P. Arch Sci Geneve 51:1-36 

Tsimilli-Michael M, Pecheux M, Strasser RJ (1999) Light and heat stress adaptation of the 
symbionts of temperate and coral reef foraminifers probed in hospite by the chlorophyll 
a fluorescence kinetics O-J-I-P. Z Naturforsch 54C:671-680 

Tsimilli-Michael M, Eggenberg P, Biro B, Koves-Pechy K, Voros I, Strasser RJ (2000) Syn- 
ergistic and antagonistic effects of arbuscular mycorrhizal fungi and Azo spirillum and 
Rhizobium nitrogen- fixers on the photosynthetic activity of alfalfa, probed by the chlo- 
rophyll a polyphasic fluorescence transient O-J-I-P. Appl Soil Ecol 15:169-182 

Van Rensburg L, Kriiger GHJ, Eggenberg P, Strasser RJ (1996) Can screening criteria for 
drought resistance in Nicotiana tabacum L. be derived from the polyphasic rise of the 
chlorophyll a fluorescence transient (OJIP)? S Afr J Bot 62:337-341 

21. Biophysical Phenomics for Evaluating the Impact of Mycorrhization with P. indica 341 

Van Heerden PDR, Tsimilli-Michael M, Kruger GHJ, Strasser RJ (2003) Dark chilling effects 
on soybean genotypes during vegetative development: parallel studies of C02 assimi- 
lation, chlorophyll a fluorescence kinetics O-J-I-P and nitrogen fixation. Physiol Plant 

Varma A, Verma S, Sudha, Sahay N, Britta B, Franken P (1999) Piriformospora indica - a 
cultivable plant growth promoting root endophyte with similarities to arbuscular my- 
corrhizal fungi. Appl Environ Microbiol 65:2741-2744 

Varma A, Singh A, Sudha, Sahay N, Sharma J, Roy A, Kumari M, Rana D, Thakran S, Deka D, 
Bharti K, Franken P, Hurek T, Blechert O, Rexer K-H, Kost G, Hahn A, Hock B, Maier W, 
Walter M, Strack D, Kranner I (2001) Piriformospora indica: a cultivable mycorrhiza-like 
endosymbiotic fungus. In: Varma A, Hock B (eds) Mycota IX. Springer, Berlin Heidel- 
berg New York, pp 123-150 

Verma S, Varma A, Rexer K-H, Hassel A, Kost G, Sarbhoy A, Bisen P, Buetehorn P, Fran- 
ken P (1998) Piriformospora indica gen. nov, a new root- colonizing fungus. Mycologia 

Analysis of the Plant Protective Potential 
of the Root Endophytic Fungus 
Piriformospora indica in Cereals 

F. Waller, B. Achatz, and K.-H. Kogel 

Piriformospora indica is a recently discovered basidiomycete that infests roots 
of a large variety of mono- and dicotyledonous plants (Verma et al. 1998; Pham 
et al. 2004). Endophytic growth of this fungus in roots leads to enhanced plant 
growth (Varma et al. 1999), reminiscent of the beneficial effects of arbuscular 
mycorrhiza in host plants. We have recently shown that P. indica - upon suc- 
cessful establishment in the roots - reprogrammes barley to salt stress tolerance, 
resistance to diseases and higher yield. Successful powdery mildew infections in 
barley leaves are reduced by this root endophyte, due to a yet unknown mecha- 
nism of induced resistance (IR) (Waller et al. 2005). As P. indica can easily be 
cultured without a host plant (Varma et al. 1999), it is suitable both as a model 
system for research and for future applications in agriculture. Here, we present 
approaches and methods to study the mechanisms behind the observed patho- 
gen resistance induced by P. indica. These methods should provide valuable 
tools for studying the effect of root-interacting fungi on IR in cereals. 

Frank Waller, Beate Achatz, Karl-Heinz Kogel: Institute of Phytopathology and Applied Zool- 
ogy (IPAZ), Justus-Liebig-Universitat Giefien, Heinrich-Buff-Ring 26-32, D-35392 Giefien, 
Germany, email: 

Beate Achatz: Institute for Vegetables and Ornamental Crops, D- 14979 GroCbeeren, Germany 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

F. Waller et al, 

Plant Responses and Resistance 
to Pathogens 

Local Reactions 

Plants are continuously defending themselves against a plethora of attacking 
viruses, bacteria, fungi and invertebrates. Each plant cell has both preformed 
and inducible defence capabilities. Among the preformed defences are physi- 
cal barriers, such as the cell wall or, for example, secondary metabolites with 
antimicrobial properties. After recognition of the pathogen, induced defence re- 
sponses may comprise of local cell wall fortifications, the production or activa- 
tion of secondary metabolites, the localized release of antimicrobial compounds 
at sites of attack or a hypersensitive reaction (HR), leading to localized cell death 
which limits the spread of the pathogen in the plant. Local defence responses 
are accompanied by an enhanced expression of defence-related genes: patho- 
genesis-related genes (PR genes) respond rapidly to challenges by pathogens 
and have been widely used as markers for defence reactions in plants. 

Systemic Reactions and Resistance in Cereals 

A prior activation of plant defence that leads to resistance against pathogens 
is termed induced resistance (IR; Sticher et al. 1997). IR has been studied ex- 
tensively in the case of salicylic acid (SA)-mediated systemic acquired resistance 
(SAR) in dicotyledonous plants: Micro -lesions induced by necrotizing patho- 
gens trigger a local accumulation of salicylic acid, with mitogen-activated pro- 
tein kinases, H 2 2 and other signals being involved. Whereas the mobile signal 
leading to systemic responses is still a matter of debate, it is clear that the ex- 
pression of SAR marker genes, the PR genes, is controlled by the protein NPR1, 
which is necessary for SAR (Mou et al. 2003; Dong 2004). Another major type 
of IR is induced systemic resistance (ISR) which is triggered by non-pathogenic 
rhizobacteria. ISR depends on both NPR1 and the jasmonic acid/ethylene path- 
way, but not on SA (Pieterse et al. 1998). Cereals share many components of 
resistance pathways with dicotyledonous plants: SA derivatives induce, for ex- 
ample, resistance in cereals (Kogel et al. 1994), and NPR 1 homologues have 
been shown to be functional in rice (Chern et al. 2005). However, specific IR 
signalling components in cereals have yet to be characterized in detail (Kogel 
and Langen 2005). 

22. Plant Protective Potential of the Root Endophyte P. indica 345 

Beneficial Microbial Endophytes Protecting Cereals from Pathogens 

Micro-organisms growing inside of plants are referred to as endophytes. A 
large number of these are known to protect plants against pathogens. For ex- 
ample, grasses (Poaceae) are frequently associated with fungi of the Clavicipi- 
taceae (Ascomycota), with interactions ranging from mutualism to antagonism 
(Schardl et al. 2004). In these interactions, the endophyte is strictly confined to 
upper parts of the plant, grows only intercellularly and has a rather narrow host 
range. The beneficial effect of these endophytes has been shown to result from 
a direct antimicrobial and insecticidal activity of alkaloids. Another group of 
endophytic fungi, the arbuscular mycorrhiza (AM; Glomeromycota; Schussler 
et al. 2001) protect plants from various stresses, including root diseases (Dehne 
1987; Azcon-Aguilar and Barea 1996; Borowicz 2001; Harrison 2005; Hause and 
Fester 2005). An improved defence status of mycorrhizal roots is associated with 
an increased expression of the H 2 2 scavengers catalase, peroxidase and super- 
oxide dismutase (Blee and Anderson 2000; Pozo et al. 2002). Such an elevated 
antioxidant activity could protect roots from cell death mediated by necrotro- 
phic root pathogens, which require killing of host cells for a successful infection. 
Using a split root technique, it has been demonstrated that AM induce systemic 
protection against root pathogens (Cordier et al. 1998; Pozo et al. 2002). This 
systemic effect of mycorrhization is restricted to the root and does not protect 
plants from leaf diseases, but rather increases susceptibility to them (Shaul et al. 
1999; Gernns et al. 2001). In addition to this agronomic drawback of the AM 
symbiosis, AM cannot be cultured axenically, limiting a wide-spread field appli- 
cation. Since a biological approach to protect cereals from pathogens has a sig- 
nificant impact for modern plant production systems, exploiting an axenically 
cultivatable endophyte with the ability to protect all plant parts from pathogens 
would be an important step towards a feasible broad-range application of bio- 
logical measures in agriculture. 

Interaction of P. indica with Cereals 

P. indica is a basidiomycete fungus from the newly defined order Sebacinales 
(Hymenomycetes; Verma et al. 1998; Weifi et al. 2004). This endophyte infests 
roots of a large variety of mono- and dicotyledonous plants and can be axenically 
cultured (Verma et al. 1998, Pham et al. 2004). It has been shown that hyphae 
of P. indica develop both inter- and intracellular in the root cortex of a number 
of different plant species, thereby improving plant growth and stress tolerance 
(Varma et al. 1999, 2000). As the fungus' broad host range and easy cultivation 

R Waller et al. 

could be valuable for agricultural applications, we tested P. indica for the ability 
to protect barley from abiotic stress and pathogens (Waller et al. 2005). 

P. indica Colonizes Root Cortical Cells in Barley 

We analysed fungal growth in barley roots grown in P. md/ca-inoculated sub- 
strate upon staining with 0.01% acid fuchsin lactic acid (Kormanik and Mc- 
Graw 1982). For microscopy whole roots as well as longitudinal and cross-sec- 
tions produced by a cryo -microtome were used. Hyphae develop a dense mesh 
on the surface of the roots (Fig. 22.1a). Both hyphae and typical pear-shaped 
chlamydospores were localized intracellularly in the first few cell layers of the 
root (Fig. 22.1b), but could not be detected in the central root tissues beyond 
the endodermis. 

P. indica Enhances Biomass and Yield in Barley 

For growth experiments, barley seedlings were planted into pots with P. in- 
d/ca-inoculated soil (see Section 22.4.1). After five weeks of cultivation in the 
greenhouse, the fresh weight of shoots was evaluated. Shoot fresh weight was up 
to 1.65 times higher than that of control plants grown in soil without P. indica 
(Waller et al. 2005). Tests under field conditions, using Mitscherlich pots with 

Fig. 22.1 P. indica hyphae and spores on a barley root. Two weeks after inoculation of barley roots 
with P. indica, acid fuchsin lactic acid staining reveals a mesh of hyphae surrounding the root (cen- 
tral part and emerging lateral root exhibit autofluorescence; a, fluorescence microscopy), as well as 
typical pear-shaped chlamydospores (b, bright-field image) 

22. Plant Protective Potential of the Root Endophyte P. indica 347 

six plants per pot, revealed that a beneficial effect of P. indica on plant growth is 
present in plants until harvest: Grain yield increased by 11% in the barley elite 
cultivar Annabell as compared with control plants (Waller et al. 2005). This in- 
crease was mainly due to a higher number of ears per plant. 

Approaches to Study the Mechanism 
of ft/ntf/ca-lnduced Pathogen Resistance 

P. indica Induces Disease Resistance Against Root Pathogens 

To assess whether P. indica-infested plants are more resistant to biotic stress, 
barley roots were inoculated with macro conidia of the necro trophic fungal 
pathogen Fusarium culmorum (causing root rot). In the presence of P. indica, the 
devastating effect of E culmorum infection was strongly diminished: Root and 
shoot fresh weight was reduced only 2 -fold in P. indica-infested plants as com- 
pared with the 12 -fold decrease in controls with F. culmorum alone. Similar re- 
sults were obtained when resistance to the root-pathogenic fungus Cochliobolus 
sativus (hemibiotrophic life style) was tested. In axenic culture, P. indica did not 
exhibit antifungal activity to E culmorum nor to C. sativus, indicating that the 
protective potential of the endophytic fungus does probably not rely on antibio- 
sis (Waller et al. 2005). 

1. Method for infestation of barley with P. indica and cultivation of plants: 
Barley was grown in pots with a 2:1 mixture of expanded clay (Seramis; Mas- 
terfoods, Verden, Germany) and Oil-Dri (Damolin, Mettmann, Germany) 
in an incubator with a 22 °C/18 °C day/night cycle, a photoperiod of 16 h 
(240 umol m~ 2 s" 1 photon flux) and 60% relative humidity. Plants were fertil- 
ized weekly with 20 ml of a 0.1% Wuxal top N solution (N/P/K: 12/4/6; Scher- 
ing). For inoculation with P. indica, 2 g of crushed mycelium were added to 
300 g of substrate before sowing. P. indica was propagated in liquid Aspergil- 
lus minimal medium (Peskan-Berghofer et al. 2004) on a horizontal rotary 
shaker at 1 8-22 °C. Mycelium from liquid culture was washed with water to 
remove remaining traces of medium and crushed using a Waring Blendor 
(VWR International, Darmstadt, Germany) before adding it to the substrate. 
For yield evaluations, barley was sown in soil containing P. indica mycelium 
(4 g per 300 g of substrate) and grown for 4 weeks in a growth chamber after 
which six plantlets were transplanted into 6-1 Mitscherlich pots (Stoma, Sieg- 
burg, Germany) filled with a mixture of a loam soil and sand (1:2). Soil nutri- 

R Waller et al. 

ent additives were 0.25 g of N, 0.4 g of P, 1.6 g of K, and 0.2 g of Mg; N was 
applied a second time at a rate of 0.25 g per pot, 2 weeks after planting. 
2. Method for testing Fusarium culmorum in barley: 

To test the effect of F. culmorum, barley was grown as described above. Two 
weeks after planting into P. indica containing soil, plants were transferred into 
pots containing macroconidia of F. culmorum. Root and shoot fresh weight 
was measured two weeks after inoculation with F culmorum. 

P. indica Induces Systemic Disease Resistance 

We recorded the effect of P. indica infestation on leaf infections by the biotro- 
phic barley powdery mildew fungus, Blumeria graminis f.sp. hordei. A reduc- 
tion in powdery mildew infection on leaf segments of P. indica-infested plants 
could be observed. Frequencies of mildew colonies decreased by 48% in second 
youngest leaves and by 58% in youngest leaves of 3 -week-old P. indica infested 
plants (Waller et al. 2005). 

Beside a reduction in pustule number, we frequently observed a smaller size 
and a reduced density of pustules. We quantified colonies belonging to three 
categories "large compact white colonies" (cat. I), "smaller, less dense colonies" 
(cat. II), and "colonies smaller than 0.3 mm in diameter" (cat. Ill; Fig. 22.2). In 
P. indica-infested plants, a shift towards smaller colonies was observed. This in- 
dicates a resistance mechanism that is limiting the development of the fungus 
after successful penetration. One possible explanation could be a reduced sup- 
ply of nutrients to the fungus. 

P. indica no n -infested 

- infested 

Fig. 22.2 Phenotype of Blumeria graminis pustules on barley leaves of P. indica infested plants. 
Shown are pustules on barley leaves 6 days after inoculation with Blumeria graminis f.sp. hordei (a, 
b). We quantified the percentage of colonies belonging to three categories: large, compact white 
colonies (as can be seen in a; cat. I), smaller, less dense colonies (as in b; cat. II) and colonies smaller 
than 0.5 mm in diameter (cat. III). In P. indica-infested plants, a shift towards smaller colonies, as 
compared with P. indica non-infested plants, was observed (c, d) 

22. Plant Protective Potential of the Root Endophyte P. indica 349 

Microscopic analysis of powdery mildew on barley leaves revealed higher 
frequencies of HR as well as a cell wall-associated defence visible as cell wall 
appositions. These observations confirmed that the pathogen is arrested by an 
active plant response. As P. indica grows only in the outer cell layers of the host 
root and does not infest barley leaves, these data demonstrate a systemic plant 
response mediated by an endophytic fungus. 

1. Method for leaf segment test: 

To assess powdery mildew resistance, leaf segments 7 cm in length were cut 
about 1 cm distal from the leaf sheath. Leaf segments were placed on 0.7% 
agar plates containing 40 mg 1 _1 benzimidazol (to inhibit leaf senescence). In- 
oculation was performed by shaking barley leaves heavily infected with B. 
graminis f.sp. hordei, race A 6 (Wiberg 1974) in an inoculation tower about 
1 m above the plates and manually circulating the air to ensure equal distribu- 
tion of the spores. Inoculation density was checked by counting the number 
of spores per square millimetre, using a counting plate of denned size placed 
beside the plates with the leaf segments and counting the spores in this plate 
using a microscope. For counting the number of successful interaction sites, 
an inoculation density of 8-20 spores mm -2 was used. Plates were placed in 
an incubator at 18 °C with a 16 h /8 h light/dark cycle. After 6 days, pustules 
were visible and could be counted on a defined leaf segment, e.g. 3 cm or 
5 cm in length. The severity of powdery mildew infection (disease index) was 
calculated as colonies produced by B. graminis on a defined leaf area. Gener- 
ally, at least nine leaves were used per experiment and standard deviation as 
well as significance level calculated (unpaired Students t-test). 

2. Method for microscopic classification of interactions with the powdery mil- 
dew fungus: 

For cytological analysis, youngest leaves of three-week-old barley plants 
were inoculated with B. graminis f.sp. hordei (A6) as described above. Then 
whole plants were incubated in an incubator at 18 °C with a 16 h/8 h light/ 
dark cycle. 

For H 2 2 detection, a histochemical staining method using 3,3-diaminoben- 
zidine (DAB) was used (Thordal-Christensen et al. 1997). After inoculation 
of the whole plant with powdery mildew and incubation for 27-43 h (de- 
pending on which stage of infection is visualized), leaves were cut and placed 
with the cut side in a solution of 1 mg ml -1 DAB for approximately 5 h. Sub- 
sequently, the leaves were destained [0.15% trichloroacetic acid (w/v) in eth- 
ylalcohol/chloroform (4:1 (v/v)]. The solution was changed once during the 
next 48 h of incubation. Leaf segments were stored in 50% glycerol. 
Staining of fungal structures and microscopy was done as described by Huck- 
elhoven and Kogel (1998): To stain fungal structures for bright-field micros- 
copy, leaves were incubated in 10% blue ink (v/v, Pelikan 4001; Pelikan, Han- 
nover, Germany) in 25% acetic acid for 1 min followed by a washing step to 
remove excess ink. Autofluorescence was observed by fluorescence micros- 
copy (excitation wavelength 485 nm). For cytological studies, an Axioplan 
microscope (Zeiss, Jena, Germany) was used. For quantification of interac- 
tion types, one hundred or more attacked short cells (cell type A and B of 

R Waller et al. 

Fig. 22.3 Interaction of the powdery mildew fungus B. graminis f. sp. hordei with its host plant 
Hordeum vulgare. Shown are interaction sites at 32 h (d, e, f), 48 h (b, c) and 72 h (a) after inocula- 
tion with the pathogen B. graminis f.sp. hordei. After formation of a primary germtube (pgt) on the 
surface of the leaf, conidia (con) of the pathogen form a secondary germtube (sgt) that penetrates 
the epidermal leaf cell (a, b). a Overview of a successful penetration, with the fungus developing its 
nutrition organ, the haustorium (hau) and elongated secondary hyphae (esh) spreading on the leaf 
surface; b and c show the same cell as bright-field (b) and fluorescence (c) images. Active responses 
of the plant can stop the biotrophic pathogen from spreading through the plant, either by local 
cell death, resulting from a hypersensitive reaction (HR) of the penetrated cell (b, c, d) or by local 
fortifications of the cell wall at the site of attempted penetration (papilla = pap; b, e). Sites of H 2 2 
accumulation are detected by staining with 3,3-diaminobenzidine (DAB), as can be seen in b and 
d as the brown staining of the attacked cell and in e as the brown stain surrounding the papillae. 
Autofluorescence is visible at sites of HR (c), as phenolic cell wall components accumulate 

the epidermis, according to Koga et al. 1990) were scored per leaf. Cellu- 
lar responses to powdery mildew attack were categorized by counting cells 
showing (1) an active defence response, (HR, visible as whole cell autofluo- 
rescence, DAB staining), (2) a local defence stopping a penetration attempt 
(non-penetrated cell, visible as the formation of cell wall appositions), or (3) 
a successful penetration (formation of a haustorium; Fig. 22.3). 

Assessment of the Antioxidant Capacity of P. indica- Infested Roots 

The protective activity by P. indica against root pathogens with necrotrophic 
nourishment strategies prompted us to analyse the antioxidant status of infested 

22. Plant Protective Potential of the Root Endophyte P. indica 351 

roots. Ascorbate levels were consistently higher at one, two and three weeks af- 
ter root infestation with P. indica, while levels of dehydroascorbate (DHA) were 
reduced. At the same time, activity of ascorbate recycling dehydroascorbate re- 
ductase (DHAR) increased. Concomitantly, slightly enhanced total glutathione 
concentrations and glutathione reductase activities were observed (Waller et 
al. 2005). It can be reasoned that higher antioxidant levels protect roots from 
cell death provoked by the root pathogens E culmorum and C. sativus. Because 
production of reactive oxygen species and host cell killing is a prerequisite for 
successful fungal development and pathogenesis of necrotrophic fungi (Gov- 
rin and Levine 2000), we hypothesize that higher antioxidant capacity, such as 
elevated ascorbate levels, could cause the observed reduction of necrotrophic 
pathogens in the barley root. 

Gene Expression Induced by P. indica in Barley Leaves 

To gain information on the nature of P. indica-induced systemic protection of 
leaves against powdery mildew infection, we analysed the expression of "marker 
genes", indicative of specific resistance pathways. Interestingly, a number of genes 
typically associated with IR are not induced in the interaction with P. indica. 
Genes tested include patho genesis-related protein 1 (PR 1), patho genesis-related 
protein 5 (PR 5), barley chemical induced protein 1 (BCI 1; Befier et al. 2000), 
and jasmonate induced protein 23 (JIP 23; Hause et al. 1996). As barley leaves 
do not show a constitutive up-regulation of typical marker genes for SA and JA, 
it is possible that other signalling pathways are involved in inducing systemic 
resistance after P. indica infestation of the roots (Waller et al. 2005). To elucidate 
the P. indica mediated IR mechanism, future strategies include screening of the 
Affymetrix Barley 1 gene chip (Close et al. 2004; Affymetrix, Santa Clara, Calif., 
USA) and custom-made microarrays with subtracted cDNA libraries enriched 
in P. indica-induced transcripts. 

Cereals provide the staple crops for feeding a growing world population. Differ- 
ent approaches have to be taken to provide a stable harvest of these crops. Along 
with high yields, resistance against abiotic stress and pathogens is a prime goal. 
Identification of P. indica, an axenically cultivatable endophyte with the ability 
to protect the plant systemically from pathogens is an important step towards 
a broad-range application of more efficient biological measures in agriculture. 
Understanding the molecular mechanism mediated by P. indica will enable us to 

R Waller et al. 

envisage new approaches to ensure healthy plants producing stable harvests. The 
methods presented in this chapter provide the means to analyse these mecha- 
nisms in all interactions of cereals with beneficial microbes. 

The authors thank Ralph Huckelhoven for providing Fig. 22.1b. Work in our 
laboratory was supported by the Deutsche Forschungsgemeinschaft (grant FOR 

Azcon-Aguilar C, Barea JM (1996) Arbuscular mycorrhizas and biological control of 
soil-borne plant pathogens - an overview of the mechanisms involved. Mycorrhiza 

Befier K, Jarosch B, Langen G, Kogel K-H (2000) Expression analysis of genes induced in 
barley after chemical activation reveals distinct disease resistance pathways. Mol Plant 
Pathol 1:277-286 

Blee KA, Anderson AJ (2000) Defence responses in plants to arbuscular mycorrhizal fungi. 
In: Podila GK, Douds DD (eds) Current advances in mycorrhizae research. APS, St. 
Paul, pp 27-44 

Borowicz VA (2001) Do arbuscular mycorrhizal fungi alter plant-pathogen relations? Ecol- 
ogy 82:3057-3068 

Chern MS, Fitzgerald HA, Canlas PE, Navarre DA, Ronald PC (2005) Over- expression of a 
rice NPR1 homologue leads to constitutive activation of defense response and hypersen- 
sitivity to light. Mol Plant Microbe Interact 18:511-520 

Close TJ, Wanamaker SI, Caldo RA, Turner SM, Ashlock DA, Dickerson JA, Wing RA, Mue- 
hlbauer GJ, Kleinhofs A, Wise RP (2004) A new resource for cereal genomics: 22K barley 
genechip comes of age. Plant Physiol 134:960-968 

Cordier C, Pozo MJ, Barea JM, Gianinazzi S, Gianinazzi Pearson V (1998) Cell defense re- 
sponses associated with localized and systemic resistance to Phytophthora parasitica 
induced in tomato by an arbuscular mycorrhizal fungus. Mol Plant Microbe Interact 

Dehne H-W (1987) Zur Nutzung der VA Mykorrhiza als Antistressfaktor. Angew Bot 

Dong X (2004) NPR1, all things considered. Curr Opin Plant Biol 7:547-552 

Gernns H, Alten HV, Poehling HM (2001) Arbuscular mycorrhiza increased the activity of a 
biotrophic leaf pathogen - is a compensation possible? Mycorrhiza 11:237-243 

Govrin EM, Levine A (2000) The hypersensitive response facilitates plant infection by the 
necrotrophic pathogen Botrytis cinerea. Curr Biol 10:751-757 

Harrison MJ (2005) Signaling in the arbuscular mycorrhizal symbiosis. Annu Rev Microbiol 

Hause B, Fester T (2005) Molecular and cell biology of arbuscular mycorrhizal symbiosis. 
Planta 221:184-196 

Hause B, Demus U, Teichmann C, Parthier B, Wasternack C (1996) Developmental and tis- 
sue-specific expression of JIP-23, a jasmonate-inducible protein of barley Plant Cell 
Physiol 37:641-649 

22. Plant Protective Potential of the Root Endophyte P. indica 353 

Huckelhoven R, Kogel K-H (1998) Tissue-specific superoxide generation at interaction sites 
in resistant and susceptible near-isogenic barley lines attacked by the powdery mildew 
fungus (Erysiphe graminis f. sp. hordei). Mol Plant Microbe Interact 11:292-300 

Koga H, Bushnell WR, Zeyen RJ (1990) Specificity of cell type and timing of events associated 
with papilla formation and the hypersensitive reaction in leaves of Hordeum vulgare at- 
tacked by Erysiphe graminis f.sp. hordei. Can J Bot 68:2344-2352 

Kogel K-H, Langen G (2005) Induced resistance and gene expression in cereals. Cell Micro- 
biol 7:1555-1564 

Kogel K-H, Beckhove U, Dreschers J, Munch S, Romme Y (1994) Acquired resistance in bar- 
ley. Plant Physiol 106:1269-1277 

Kormanik PP, McGraw A-C (1982) Quantification of vesicular- arbuscular mycorrhizae in 
plant roots. In: Schenck NC (ed) Methods and principles of mycorrhizal research. Amer- 
ican Phytopathological Society, St. Paul, pp 37-45 

Mou Z, Fan W, Dong X (2003) Inducers of plant systemic acquired resistance regulate nprl 
function through redox changes. Cell 113:935-944 

Peskan-Berghofer T, Markert C, Varma A, Oelmiiller R (2004) Association of Piriformos- 
pora indica with Arabidopsis thaliana roots represents a novel system to study beneficial 
plant-microbe interactions and involves early plant protein modifications in the endo- 
plasmic reticulum and at the plasma membrane. Physiol Plant 122:465-477 

Pham GH, Singh A, Malla R, Kumari R, Prasad R, Sachdev M, Rexer K-H, Kost G, Luis P, 
Kaldorf M, Buscot F, Herrmann S, Peskan T, Oelmiiller R, Saxena AK, Declerck S, Mittag 
M, Stabentheimer E, Hehl S, Varma A (2004) Interaction of Piriformospora indica with 
diverse microorganisms and plants. In: Varma A, Abbott LK, Werner D, Hampp R (eds) 
Plant surface microbiology. Springer, Berlin Heidelberg New York, pp 237-265 

Pieterse CMJ, Van Wees SCM, Van Pelt JA, Knoester M, Laan R, Gerrits H, Weisbeek PJ, Van 
Loon LC (1998) A novel signaling pathway controlling induced systemic resistance in 
Arabidopsis. Plant Cell 10:1571-1580 

Pozo MJ, Cordier C, Dumas- Gaudot E, Gianinazzi S, Barea JM, Azcon-Aguilar C (2002) Lo- 
calized versus systemic effect of arbuscular mycorrhizal fungi on defence responses to 
Phytophthora infection in tomato plants. J Exp Bot 53:525-534 

Schardl CL, Leuchtmann A, Spiering MJ (2004) Symbioses of grasses with seedborne fungal 
endophytes. Annu Rev Plant Biol 55:315-340 

Schussler A, Schwarzott D, Walker C (2001) A new fungal phylum, the Glomeromycota: phy- 
logeny and evolution. Mycol Res 105:1413-1421 

Shaul O, Galili S, Volpin H, Ginzberg I, Elad Y, Chet I, Kapulnik Y (1999) Mycorrhiza-in- 
duced changes in disease severity and PR protein expression in tobacco leaves. Mol Plant 
Microbe Interact 12:1000-1007 

Sticher L, Mauch-Mani B, Metraux JP (1997) Systemic acquired resistance. Annu Rev Phyto- 
pathol 35:235-270 

Thordal-Christensen H, Zhang ZG, Wei YD, Collinge DB (1997) Subcellular localization of 
H202 in plants - H 2 2 accumulation in papillae and hypersensitive response during the 
barley-powdery mildew interaction. Plant J 1 1:1 187-1 194 

Varma A, Verma S, Sudha, Sahay N, Biitehorn B, Franken P (1999) Piriformospora in- 
dica, a cultivable plant-growth-promoting root endophyte. Appl Environ Microbiol 

Varma A, Singh A, Sudha, Sahay NS, Sharma J, Roy A, Kumari M, Rana D, Thakran S, Deka 
D, Bharti K, Franken P, Hurek T, Blechert O, Rexer K-H, Kost G, Hahn A, Maier W, 
Walter M, Strack D, Kranner I (2000) Piriformospora indica: an axenically cultureable 
mycorrhiza-like endosymbiotic fungus. In: Hock B (ed) The Mycota IX. Springer, Berlin 
Heidelberg New York, pp 125-150 

Verma S, Varma A, Rexer K-H, Hassel A, Kost G, Sarbhoy A, Bisen P, Biitehorn B, Franken P 
(1998) Piriformospora indica, gen. et sp. nov, a new root- colonizing fungus. Mycologia 

R Waller et al. 

Waller F, Achatz B, Baltruschat H, Fodor J, Becker K, Fischer M, Heier T, Huckelhoven R, 
Neumann C, von Wettstein D, Franken P, Kogel K-H (2005) The endophytic fungus 
Piriformospora indica reprograms barley to salt stress tolerance, disease resistance and 
higher yield. Proc Natl Acad Sci USA 102:13386-13391 

Weifi M, Selosse M-A, Rexer K-H, Urban A, Oberwinkler F (2004) Sebacinales: a hitherto 
overlooked cosm of heterobasidiomycetes with a broad mycorrhizal potential. Mycol 
Res 108:1003-1010 

Wiberg A (1974) Genetical studies of spontaneous sources of resistance to powdery mildew 
in barley. Hereditas 77:89-148 

Members of Sebacinales Confer 
Resistance Against Heavy Metal Stress 
in Plants 

N. Hahn, A. Varma, R. Oelmiiller, and I. Sherameti 

We study the effect of endophytic fungi on the protection of plants against heavy 
metal stress. Co -cultivation of several members of the Sebacinales with Loliom 
perenne, Festuca rubra rubra, barley and Arabidopsis confers resistance to high 
concentrations of Cd 2+ . We are using molecular tools to understand the basis of 
this resistance, using Arabidopsis as a model system. Here, we describe protocols 
which allow the identification of genes and proteins which are involved in con- 
ferring Cd 2+ resistance in Arabidopsis. Genes which are differentially expressed 
in response to Cd 2+ treatments in Arabidopsis roots in the presence and absence 
of endophytic fungi can be identified by microarray or differential display tech- 
nics. Further, the separation of protein extracts from differentially treated tissues 
on two-dimensional gels, and the use of mass spectrometry for the identification 
of protein spots which differ in their intensity under the different conditions, al- 
low the identification of proteins which are involved in this scenario. 

Scientific Background 

Cd + , a non-essential heavy metal pollutant of the environment, derives from var- 
ious agricultural, mining or industrial activities as well as car exhaust gases (Foy 

Nadin Hahn, R. Oelmiiller, I. Sherameti: Institute of General Botany and Plant Physiology, 
University of Jena, Dornburger Strasse 159, D-07743 Jena, Germany, 

A. Varma: Amity Institute of Microbial Sciences, Amity University, Sector 125, 
Noida 201303, India, email: 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

N. Hahn et al. 

et al. 1978). Because Cd + is highly soluble in water and thus rapidly distributed 
in aquatic ecosystems (Lockwood 1976), it exerts an enormous toxicity. Plants 
acquire Cd 2+ mainly from contaminated water through the root system. Above 
a certain Cd 2+ level, toxic effects become visible. Chlorosis, for instance, may be 
caused by iron deficiency or uptake of high Cd 2+ levels, because both uptake and 
distribution of heavy metals, in particular Cd 2+ , in the plants interact with the 
iron metabolism (Haghiri 1973; Root et al. 1975; Siedlecka 1999). Furthermore, 
Cd 2+ appears to cause phosphorus deficiencies and manganese transport prob- 
lems (Godbold and Huttermann 1985; Guerinot and Eiche 1999) and interferes 
with the uptake, transport and cellular availability of several other elements, such 
as Ca 2+ , Mg 2+ , PO^or K + . Cd 2+ also inhibits enzyme activities (Lockwood 1976; 
Marschner 1995), causes chromosomal abberations (Avanzi 1999) and blocks 
cell division and proliferation (Rosas et al. 1984). Many studies also contribute 
to the understanding of the cellular and subcellular localization of Cd 2+ and its 
distribution throughout the plant (c.f. Kiipper et al. 2000; Ager et al. 2002). 

The uptake is only poorly understood. Studies with different species suggest 
that Cd 2+ can be transported together with Zn 2+ and Fe 2+ (Korshunova et al. 
1999; Moreau et al. 2002). There is also evidence that Cd 2+ uptake is mediated 
by a transporter system for Mn 2+ (Himeno et al. 2002). The increase in Cd 2+ in 
the external medium causes an increase in Mn 2+ uptake and translocation to 
the shoots, further evidence that Cd 2+ and Mn 2+ are co-transported (Ramos et 
al. 2002). Most of the Cd 2+ accumulates in leaves in the cell wall fraction and 
this accumulation is fairly independent of the Cd 2+ level in the nutrient solu- 
tion (Ramos et al. 2002). Within the cell, the lowest Cd 2+ concentration is found 
in the chloroplasts. In Arabidopsis, Cd 2+ is preferentially sequestered within the 
trichome of the leaf surface (Ager et al. 2002). 

Detoxification of Cd 2+ within the cell occurs mainly by phytochelatins (Grill 
et al. 1985, 1987; Cobbett et al. 1998; Cobbett 2001). Phytochelatins are syn- 
thesized from glutathione. Phytochelatin-deficient mutants of Arabidopsis have 
confirmed the important role of glutathione as a substrate for phytochelatin bio- 
synthesis and its role in Cd 2+ detoxification. The A. thaliana CADI (AtPCSl) 
gene encodes a phytochelatin synthase and cadi mutants are Cd 2+ hypersensi- 
tive (Cazale and Clemens 2001). Two copies of this gene are present in the Ara- 
bidopsis genome and both are expressed (Cazale and Clemens 2001). There are 
several reports demonstrating that elevated levels of Cd 2+ stimulate antioxidant 
enzyme activities, such as glutathione reductase and superoxide dismutases (c.f. 
Fornazier et al. 2002) or inhibitors of antioxidative enzymes such as superoxide 
dismutases or peroxidases (Gallego et al. 1999; Mascher et al. 2002). 

More recently, substantial progress has been made in understanding heavy 
metal homeostasis in plants. Heavy metal P-type ATPase transporters (HMA; 
Williams and Mills 2005) belong to an ancient family of metal pumps with 
diverse functions in plants. They play an essential role in zinc homeostasis in 
Arabidopsis (Hussain et al. 2004). Three of these transporters (HMA2, 3, 4) are 
closely related to each other. HMA2 and HMA4 expression occurs predomi- 
nantly in the vascular tissue of roots, stems and leaves, and they play a role in 

23. Resistance Against Heavy Metal Stress in Plants 357 

zinc translocation. Hma2 and hma3 mutations confer increased sensitivity to 
Cd 2+ (Hussain et al. 2004). HMA4 was able to complement an Escherichia coli 
mutant impaired in Zn 2+ , but not in Cu 2+ homeostasis. Heterologous expression 
of HMA4 in Saccharomyces made the yeast more resistant to Cd 2+ (Mills et al. 
2003). A null mutant of HMA4 in Arabidopsis exhibited a lower translocation of 
Zn 2+ and Cd 2+ from the root to the shoot, while an overexpressor displayed an 
increase in the Zn 2+ and Cd 2+ content (Verret et al. 2005). Bernard et al. (2004) 
could show that the Thlaspi caerulescens homolog of HMA4 is highly expressed 
in a Cd 2+ hyperaccumulator. 

Differential Display to Understand Cd 2+ Resistance 
Mediated by Endophytic Fungi 

Differential display technology is described in Chapter 20 in this book. Using 
this technique we have identified several Cd 2+ -regulated genes in Arabidop- 
sis roots. One of these genes (accession number AF412407) codes for HMA4 
(Fig. 23.1). Interestingly, the expression level of this gene in Arabidopsis roots 
co -cultivated with the endophytic fungus Piriformospora indica is two times 
lower than in control plants, although these plants were grown without Cd 2+ 
(Fig. 23.2). This might explain why an endophyte can confer heavy metal resis- 
tance to plants. 

Studies on Protein Level 

Two-dimensional gel electrophoresis is used to identify proteins in Arabidopsis 
roots which differ in their amounts after different treatments [e.g. in the pres- 
ence or absence of P. indica and/or Cd 2+ (100-200 umol)]. For better analysis 
we separate soluble and membrane-associated proteins. Soluble protein extracts 
are obtained after homogenation of roots in a buffer containing 100 mM Tris, 
pH 7.0, 10 mM MgCl 2 , 2,2% SDS 1 mM (3-mercapto-ethanol. The slurry is first 
centrifuged at 40 000 g for 20 min, before high-speed centrifugation at 100 000 g 
for 10 min. After determination of the protein concentration, the supernatant is 
used for two-dimensional gel electrophoresis. 

The pellet of the last centrifugation is used for the separation of membrane 
proteins. The membranes are resuspended in 100 mM Tris, pH 7.0, 10 mM 
MgCl 2 , 10 mM mercapto-ethanol and kept at 75 °C for 20 min. 
1. To precipitate the membrane proteins, 40-60 \xg protein in 100 \j! buffer is 

N. Hahn et al, 

10 20 30 40 50 60 

•k | ic | "k k | "k | "k | 

70 80 90 100 110 120 

~k | ~k | ~k k | ~k | "jt | 

1JK9 B 65 qkdaiirqaqkpnssavailetfqkytlDQKKDTAVRGLARIVQVqenktlfditvnqVP 12 4 

qi 19552399 48 ILVDHDPSKVSIKDLVAA VA 67 

qi 2498247 41 VWEFDAP-ATQDLIKEA LL 59 

qi 20090199 42 VNVTYDSRITDSHVIRMT LL 61 

qi 15643089 38 KKVWET — ENLDSVLKK LE 55 

qi 13541083 42 AWKVDDS-VDPEKLEDAe vFK 62 

qi 16082329 42 AEWIDESKISPEKLEDAr vFK 63 

* i 

consensus 62 DAGYKVEEIK 71 

query 77 EARLEANVRv 8 6 

1JK9 B 125 EAGNYHASIH 134 

qi 19552399 68 EVGYTAKPSA 77 

qi 2498247 60 DAGQEVV 66 

qi 20090199 62 EAGYKNIWET 71 

qi 15643089 5 6 EIDYPVESYQ 65 

qi 13541083 63 KTRYRGEVRD 72 

qi 1608232 9 64 VTRYRGEVRK 73 

Fig. 23.1 The "Conserved Domain Database" at the NCBI server recognizes a copper chaperone 
domain. The figure shows an alignment of a consensus sequence, the gene identified in this 
paper and several typical proteins from various organisms which share the conserved region. The 
localization of conserved residues is visualized by bold letters. Lower case letters indicate gaps to 
optimize the alignment. Numbers on the right and left of the column indicates the position of the 
amino acid as deposited in the Databank, gi 19552399 Copper chaperone from Cory neb acterium 
glutamicum. gi 2498247 Copper ion binding protein from Helicobacter pylori, gi 20090199 
Heavy metal-associated protein from Methanosarcina acetivorans. gi 15643089 Heavy metal 
binding protein from Thermotoga maritima. gi 13541083 Copper chaperone from Thermoplasma 
volcanium. gi 16082329 Mercuric resistance operon regulatory protein merP related protein from 
Thermoplasma acidophilum 

2. 400 ul methanol is added, vortexed and- after centrifugation- the pellet is 

3. 100 ul chloroform is added, vortexed, an additional 200 ul water was added, vor- 
texed again and- after centrifugation- the upper phase is carefully removed. 

4. 300 ul methanol is added to the rest, vortexed and centrifuged again. The pel- 
let contains the membrane-associated proteins. 

5. The pellet is washed twice with methanol (500 |il), dried in a Speed-Vac and 
the proteins resuspended in the appropriate sample buffer for 2D gel electro- 

23. Resistance Against Heavy Metal Stress in Plants 

Fig. 23.2 mRNA levels of HMA4 in 14-day-old Arabidopsis roots. A Control, seedlings without 
treatment. B Seedlings co-cultivated with Piriformospora indica. C Seedlings cultivated on 200 uM 
Cd + from day 9 to day 14. D Seedlings cultivated on 200 uM Cd + from day 9 to day 14 in the pres- 
ence of Piriformospora indica. The mRNA levels for the control seedlings (A) were taken as 100. 
Based on four independent microarrays 

Two-Dimensional Gel Electrophoresis, Preparation of Proteins 

1. 180 ug protein in 100 ul extraction buffer is precipitated with methanol, dried 
and resuspended in 380 ul of sample buffer [8 M urea, 2 M thiourea, 30 mM 
dithioereitrol, 4% (w/v) CHAPS, 20 mM Tris base, 0.5% bromophenol blue, 
0.5% IPE buffer (pH 3-10, Amersham Pharmacia), 0.05% dodecyl-(3-D- 
maltoside] . 

2. 350 ul of the supernatant is added to 1.75 ml of 0.5% (v/v) IPE buffer for iso- 
electric focusing (Amersham Pharmacia, Freiburg, Germany). 

3. For the second dimension the gel system of Schager and von Jagow (1987) is 

4. Gels are stained with silver (Fig. 23.3). 

Mass Spectrometry, Preparation of Samples by Tryptic Digestion 

Silver-stained gel spots are excised and the proteins extracted into 500 ul of 
50 mM ammonium bicarbonate, supplemented with 60 ng/|J trypsin. After ly- 
ophilization, the pellet was resuspended in 5 ul of water/acetonitrile/formic acid 
(95:5:0.1) prior to LC-MS analysis. Peptide analyses, analyte sampling, chroma- 
tography and acquisition of data were performed on a LC (Famos-Ultimate; LC- 
Packings) coupled with an LCQ Deca XP ITMS according to the manufacturers 
instructions. Using these techniques we can identify several proteins which are 
up- or down -regulated by the endophytic fungus P. indica in the absence or 

N. Hahn et al. 

Fig. 23.3 Two-dimensional gels from root plasma membrane of seedlings grown in the absence 
(left) or presence (right) of 100 |im Cd + . Protein spots which differ in the two preparations are 

presence of Cd + and which might be involved in conferring heavy metal resis- 
tance in plants. Analysis of null mutants (cf. Chapter 20) and over-expressers in 
the genes for these proteins demonstrates whether they play a role in P. indica- 
mediated heavy metal resistance. 

Ager FJ, Ynsa MD, Dominguez-Solis JR, Gotor C, Respaldiza MA, Romero LC (2002) Cad- 
mium localization and quantification in the plant Arabidopsis thaliana using micro- 
PIXE. Nucl Instr Methods Phys Res B Beam Interact Mater Atoms 189:494-498 

Avanzi M (1999) Observazioni sullattivita citologica di alcuni composti chimic. Caryologica 

Bernard C, Roosens N, Czernic P, Lebrun M, Verbruggen N (2004) A novel CPx-ATPase 
from the cadmium hyper accumulator Thlaspi caerulescens. FEBS Lett 569:140-148 

Cazale AC, Clemens S (2001) Arabidospis thaliana expresses a second functional phytochela- 
tin synthase. FEBS Lett 507:215-219 

Cobbett CS (2001) Heavy metal detoxification in plants. Phytochelatin biosynthesis and func- 
tion, IUBMB Life 51:183-188 

Cobbett CS, May MJ, Howden R, Rolls B (1998) The glutathione-deficient cadmium- sensitive 
mutant, cad2-l, of Arabidopsis thaliana is deficient in (3-glutamylcysteine synthase. Plant 
J 16:73-78 

Fornazier RF, Ferreira RR, Vitoria AP, Molina SMG, Lea PJ, Azevedo RA (2002) Effect of cad- 
mium on antioxidant enzyme activities in sugar cane. Biol Plant 45:91-97 

Foy C, Chaney AL, White MC (1978) The physiology of metal toxicity in plants. Annu Rev 
Plant Physiol 29:511-566 

Gallego SM, Benavides MP, Tomaro MC (1999) Effect of cadmium ions on antioxidant de- 
fense system in sunflower cotyledons. Biol Plant 42:49-55 

23. Resistance Against Heavy Metal Stress in Plants 361 

Godbold DL, Huttermann A (1985) Effect of Zn, Cd and Hg on root elongation of Picea abies 
(Karst.) seedlings and the significance of these metals to forest die-back. Environ Pollut 

Grill E, Winnacher EL, Zenk MH (1985) Phytochelatins: the principle heavy-metal complex- 
ing peptides of higher plants. Science 230:674-676 

Grill E, Winnacker EL, Zenk MH (1987) Phytochelatins, a class of heavy-metal-binding pep- 
tides from plants, are functionally analogous to metallothionines. Proc Natl Acad Sci 
USA 84:439-443 

Guerinot ML, Eiche D (1999) Zeroing in on zink uptake in yeast and plants. Curr Opin Plant 
Biol 2:244-249 

Haghiri H (1973) Cadmium uptake by plants. J Environ Qual 2:93-96 

Himeno S, Yanagiya T, Enomoto S, Kondo Y, Imura N (2002) Cellular cadmium uptake me- 
diated by the transport system of manganese. Tohoku J Exp Med 196:43-50 

Hussain D, Haydon MJ, Wang Y, Wong E, Sherson SM, Young J, Camakaris J, Harper JF, 
Cobbett CS (2004) P-type ATPase heavy metal transporters with roles in essential zinc 
homeostasis in Arabidopsis. Plant Cell 16:1327-1329 

Korshunova YO, Eide D, Clark WG, Guerinot ML, Pakrasi HB (1999) The IRT1 protein from 
Arabidopsis thaliana is a metal transporter with a broad substrate range. Plant Mol Biol 

Kiipper H, Lombi E, Zhao-Fang J, McGrath S-P (2000) Cellular compartimentation of cad- 
mium and zinc in relation to other elements in the hyperaccumulator Arabidopsis hal- 
/en.Planta 212:75-84 

Lockwood MP (1976) Effects of pollutants on aquatic organisms. Cambridge University 
Press, New York 

Marschner H (1995) Mineral nutrition of higher plants. Academic, London, pp 189-179 

Mascher R, Lippmann B, Holzinger S, Bergmann H (2002) Arsenate toxicity: effects on oxi- 
dative stress response molecules and enzymes in red clover plants. Plant Sci 21:1-10 

Moreau S, Thomson TM, Kaiser BN, Trevaskis B, Guerinot ML, Udvardi MK, Puppo A, Day 
DA (2002) GmZIPl encodes a symbiosis-specific zinc finger transporter in soybean. J 
Biol Chem 277:4738-4746 

Mills RF, Krijger GC, Baccarini PJ, Hall JL, Williams LE (2003) Functional expression of 
AtHMA4, a PIB-type ATPase of the Zn/Co/Cd/Pb subclass. Plant J 35:164-176 

Ramos I, Esteban E, Lucena JJ, Garate A (2002) Cadmium uptake and subcellular distribution 
in plants of Lactuca sp.- Mn interaction. Plant Sci 162:761-767 

Root RA, Miller RJ, Koeppe DE (1975) Uptake of cadmium- its toxicity and effect on the 
iron-to-zinc ratio in hydroponically grown corn. J Environ Qual 4:473-476 

Rosas M, Carbajal ME, Gomez- Arroyo S, Belmont R, Vilalogos-Pietrini R (1984) Cytogenetic 
effects on cadmium accumulation on water hyacinth (Eichoreia cratsiper) Environ Res 

Schagger H, Jagow G von (1987) Tricine-sodium dodecyl sulphate polyacrylamide gel elec- 
trophoresis for the separation of proteins in the rage of 1 to 100 kDa. Anal Biochem 

Siedlecka A, Krupa Z (1999) Cd/Fe-interaction in higher plants- its consequences for the 
photosynthetic apparatus. Photosynthetica 36:321-331 

Verret F, Gravot A, Auroy P, Preveral S, Forestier C, Vavasseur A, Richaud P (2005) Heavy 
metal transport by AtHMA4 involves the N-terminal degenerated metal binding do- 
main and the C-terminal Hisll stretch. FEBS Lett 579:1515-1522 

Williams LE, Mills RF (2005) (lB)-ATPases- an ancient family of transition metal pumps 
with diverse functions in plants. Trends Plant Sci 10:491-502 

Screening of Plant Growth-Promoting 

C.S. Nautiyal and S.M. DasGupta 

Microorganisms are essential for the maintenance of sustainable ecosystems 
and microbial biodiversity. Microorganisms include bacteria, actinomycetes, 
and fungi, occupy an important niche in every ecosystem, and are important in 
recycling the elements in nature and in the decomposition of organic matter. Of 
the microorganisms, bacteria are the most common type, possibly because they 
grow rapidly and have the ability to utilize a wide range of substances as either 
carbon or nitrogen sources. The most prominent group of bacteria present in 
the rhizosphere are the non-sporulating gram-negative rods. Fungi and actino- 
mycetes are also present but their populations are smaller than the bacteria. 

Colonization of the plant root system is the very first step in nearly all inter- 
actions between plants and soil-borne microbes. The region of contact between 
root and soil where soil is affected by roots was designated as the "rhizosphere" 
by Hiltner in 1904. He believed that the rhizosphere microorganisms play an 
important role in plant development. Sorensen in 1997 defined the rhizosphere 
as the volume of soil surrounding the plant roots in which bacterial growth is 
stimulated.The rhizosphere has attracted much interest, since it is a habitat in 
which several biologically important process and interactions take place. 

The rhizosphere refers in general to the portion of soil adjacent to the roots of 
living plants. It supports a diverse and densely populated microbial community, 
and is subjected to chemical transformations caused by the effect of root exu- 
dates and metabolites of microbial degradation. The bacterial communities as- 

C. Shekhar Nautiyal: Plant-Microbe Interaction Laboratory, National Botanical Research 
Institute, Rana Pratap Marg, Lucknow, 226001, email: 

Sangeeta Mehta DasGupta: Amity Institute of Microbial Sciences, 
Amity University, Uttar Pradesh, Sector 125, Noida, 201303 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmuller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

C.S. Nautiyal and S.M. DasGupta 

sociated with this microzone are thought to be determined by the quantity and 
composition of root exudates that serve as substrates for microbial growth. Root 
exudates can also selectively affect the growth of bacteria and fungi that colo- 
nize the rhizosphere by serving as selective growth substrates for soil micro- 
organisms. These microbial associations may result in endophytic, symbiotic, 
associative, or parasitic relationships within the plant, depending on the type 
of microorganisms, soil nutrient status, and soil environment. The best known 
groups are symbiotic members of the family Rhizobiaceae, mycorrhizal fungi 
and plant growth -promoting rhizobacteria (PGPR). 

Candidature for Being a Rhizobacteria 

Plant growth-promoting rhizobacteria (PGPR) are free-living bacteria that have 
a beneficial effect on plants, as they enhance emergence, colonize roots, and 
stimulate growth. In addition to bacteria present on the root surface (rhizo- 
plane) and in the rhizosphere, there are significant numbers of bacteria present 
in the root interior that are also beneficial for plant growth. 

Rhizobacteria essentially possess the property of rhizosphere competence, 
meaning that they are able to compete for the habitat and nutrition in the rhi- 
zosphere and have the ability to outnumber the resident microflora of the rhi- 
zosphere. Microorganisms that can grow in the rhizosphere are ideal for use as 
bioinoculants, since the rhizosphere provides the front-line defense for roots 
against attack by pathogens. Bacterial root colonization comprises a series of 
steps: migration towards plant roots, attachment, distribution along the root, 
and finally growth and establishment of the population. 

The relative rates of utilization of root exudates may determine different de- 
grees of competence. Alternatively, dissimilarities in rhizosphere competence 
may be attributable to the differences in the extent of bacterial attachment to 
the root surface, especially since adhering cells presumably are more likely to be 
transported with the extending root or are closer to the source of exudates than 
are bacteria at some distance from the root. Adherence of a variety of bacterial 
species to roots has indeed been the subject of considerable study (Dazzo 1980). 
However, the extensive colonization of roots by some bacteria may simply reject 
their ability to survive in large numbers in the absence of the plant (Acea et al. 
1988). In view of the potential benefits that can be gained by successful estab- 
lishment of rhizobia, free-living N 2 -fixing bacteria, species capable of control- 
ling plant pathogens, and plant growth-promoting bacteria in the rhizosphere, 
and the inconsistent results obtained to date following inoculation with these 
microorganisms, it is important to establish the properties of bacteria that are 
responsible for rhizosphere competence. Findings suggest the importance of 

24. Screening of Plant Growth- Promoting Rhizobacteria 365 

initial cell density in determining the extent of colonization of the rhizosphere. 
They also show that growth rate and attachment, at least alone, are not major 
factors in root colonization, although they may add to the rhizosphere com- 
petence of bacteria that can survive in large numbers in soil. Because of the 
potential value of inoculants added to soil or seeds in consistently increasing N 2 
fixation, stimulating plant growth or resulting in the control of plant pathogens, 
additional study is warranted to establish more completely the attributes of bac- 
teria that contribute to rhizosphere competence. Therefore, a study to evaluate 
several hypotheses to explain why bacteria differ in their capacity to colonize the 
root zone is important. The colonizing ability of a strain can at present be evalu- 
ated only in vivo. Sufficient information on the factors involved in this complex 
process is not yet available to enable an assessment to be made by investigating 
the biochemical or genetic makeup of a strain. However, through the use of ge- 
netic means, some factors which play a role in the colonization of root surfaces 
are being recognized. 

Screening Methods 

Criteria for Screening 

The isolation and development of plant-beneficial bacterial strains applicable 
to a variety of crops, soils, and locations will depend upon the development 
of improved detection and screening procedures that more rapidly screen and 
identify beneficial strains (Nautiyal 1997a, b). 

Selection of Screening Methods 

Screening methods for microorganisms can be selected on the basis of their 
abundance and cultivability. For example those in abundance can directly be 
screened from rhizospheric samples, whereas those in lesser amounts can be 
labeled in situ with fluorescent dyes. Also, using random or specific primers, 
those difficult to culture or non-culturable can be screened. Thus it is impor- 
tant to select a screening method that gives the best yield in terms of bacterial 

C.S. Nautiyal and S.M. DasGupta 

Classic Methods 

Direct Screening from Soil 

Bacteria which are in abundance can directly be screened from the soil adhering 
to the root by using the following technique. Soil adhering to the roots should 
be gently shaken onto a sterile paper of known weight and weighed again. Se- 
rial dilution of the soil samples (10% soil in 0.85% saline MilliQ water; MQW) 
should be plated on nutrient agar.Bacteria representative of the predominant 
morphologically distinct colonies present on the plates are selected at random 
and purified on minimal medium based on AT salts. 

Screening from Rhizosphere 

Roots should be thoroughly washed with tap water for 2 min to remove all the 
loosely adhering soil particles, followed by washing with sterile 0.85% (w/v) sa- 
line MQW. The roots are then macerated in 0.85% saline MQW with a mortar 
and pestle. Serial dilution of the root homogenate and soil samples (10% soil in 
0.85% saline MQW) should then be plated on nutrient agar. Bacteria representa- 
tive of the predominant morphologically distinct colonies present on the plates 
are selected at random and purified on minimal medium based on AT salts. 

Elective Culture Methods 

If specific chemical compounds are added to soil in the field or in the labora- 
tory and incubated under specific conditions, the organisms capable of growing 
under those conditions multiply and come to comprise a greater percentage of 
the total microbiota. Alternatively, if specific inhibitory chemicals or incuba- 
tion conditions are used, specific parts of the microbiota are decreased in over- 
all percentage. This very simple concept is the basis for a large fraction of the 
industrial uses for soil microbiology, such as isolating hydrocarbon-degrading 
bacteria, isolating bacteria that degrade various pollutants such as pesticides, 
PCBs, organochlorines, isolating bacteria (including actinomycetes) or fungi 
that produce new antibiotics, and many other examples. Because of the diversity 
of the microbiota in soil, this technique can often be applied to isolate microor- 
ganisms with any desired property. 

24. Screening of Plant Growth- Promoting Rhizobacteria 367 

Selective Culture Media 

All media used in microbiological laboratories are selective to some degree or 
another; there are no truly non-selective media. It is possible to make media and 
incubation conditions very selective by chemical and physical modifications. 
This is often very useful to isolate and count particular groups of bacteria or 
other organisms from soil samples. 

There are routine ways to produce selective media: 

1. Add compounds used by an organism as a nutrient source. 

2. Omit compounds required by most other organisms (omit nitrates and other 
fixed nitrogen sources to isolate nitrogen fixing bacteria). 

3. Add selectively biocidal compounds (penicillin to inhibit gram-positive bac- 
teria, neomycin and streptomycin as general bacterial inhibitors, actidone 
and nystatin as general fungal inhibitors). 

4. Change physical properties [pH, pE (redox potential), etc.]. 

5. Alter incubation conditions (temperature, water content, osmotic pressure, 
light, etc.). 

Using combinations of these techniques, it is possible to design very selec- 
tive media; Pseudomonas isolation medium is very specific for its named bacte- 
rial group. In theory, almost any physiological group of organisms can be cul- 
tured selectively. A single-stage isolation from a soil sample can be changed 
to a multi-stage isolation process by replica plating. Individual colonies are 
transferred in their original orientation on the plate by pressing a pad of ster- 
ile velvet cloth onto the surface of the plate, removing a small sample of each 
colony and pressing it onto the surface of a fresh plate. This can be a different 
growth medium so that only a part of the original population is able to grow on 
the new medium. In this way, progressive selective media can be used to isolate 
bacteria with combinations of properties. To enhance the detection of the par- 
ticular group of microorganism under study, it is also possible to improve the 
diagnostic precision of the media by using some properties of the organisms 
(pigment, fluorescence under ultraviolet, biochemical reactions with extra, 
added substrates, etc.). 

Non-Selective Media 

So-called "non-selective" media are only media and incubation conditions de- 
signed to isolate as large a part of the microbiota in soil as is possible. Truly non- 
selective media do not exist. The least selective media today may isolate 1-10% 
of the total soil bacteria and maybe 5-15% of the fungal population of soils. The 
media used for bacteria and fungi are different. 

C.S. Nautiyal and S.M. DasGupta 

Modern Methods 

Fluorescence Methods 

Many older methods using direct microscopic examination of soil samples are 
still in use today because of their simplicity. They are especially useful when 
examining smaller soil samples, such as pieces of organic materials or mineral 
grains. There are two main types of methods used to visualize the microorgan- 
isms in these samples: classic stains such as phenol aniline blue and fluorescent 
stains such as fluorescein isothiocyanate. The first can be examined after stain- 
ing with any bright-field, white-light microscope, assuming that light can be 
transmitted through the object being examined. The second uses a stain that 
emits light at a visible wavelength when illuminated with far- violet or ultraviolet 
light. This can be incident illumination that does not have to pass through the 
object. The mercury arc lamp is a strong source of ultraviolet light that is filtered 
though an excitation filter (to exclude all but ultraviolet light) and passed to a 
dichroic mirror. This mirror is coated with a very thin metal film that reflects 
ultraviolet light and does not allow it to pass through. It does allow visible light 
to go through and not be reflected. The ultraviolet light is passed down through 
the objective lens and focussed onto the object from the top (which is why the 
object can be opaque). If the fluorescent dyes staining the microorganisms fluo- 
resce in the visible spectrum, the emitted light is collected by the objective lens 
and passes through the dichroic mirror to the eyepiece lens and the eye of the 
observer. The eyepieces always contain a barrier filter (usually yellow) that pre- 
vents any of the ultraviolet light from reaching the eyes of the observer. 

The most common fluorescent stains are acridine orange, fluorescein isothio- 
cyanate (FITC), and rhodamine (fluoresces red). They react with parts of protein 
molecules - the sulfhydryl groups - and attach strongly to the protein molecules. 
Another example is calcofluor; it reacts with cellulose, chitin, and similar poly- 
saccharides and is useful for staining fungi and Actinomycetes. It is also relatively 
non-toxic and can be used as a vital stain to examine living cells. Other fluores- 
cent stains include europium chelate [europium (iii) thenoyltrifluoroacetonate] 
that stains nucleic acids and 4'-6'-diamidino-2-phenyl-indole (DAPI), ethidium 
bromide, and bisbenzimide (Hoechst 33258) that all stain DNA. 

Another group of fluorescent stains are the fluorescent probes. They differ 
from FITC and rhodamine in that they are not fluorescent until they come into 
contact with the correct environment. Typically this is the lipid within micro- 
bial cells. Only then do they fluoresce and emit visible light. Examples of this 
group are DANSYL chloride and the 8-anilino-l -naphthalene sulfonic acid salts 
(Mg-ANS, Na-ANS). Their major advantage is that they can be applied to soil 
samples and immediately examined without removing excess, unreacted stain. 
FITC and rhodamine need extensive washing to remove unreacted stain. 

24. Screening of Plant Growth- Promoting Rhizobacteria 369 

Fluorescent Antibody and Related Methods 
(Immunofluorescence Methods) 

The fluorescent antibody technique is the only one that can simultaneously lo- 
cate and identify microorganisms in intact soil samples or sections. 

The antibodies to microbial cells are produced by injecting the cells under 
study into a suitable animal (guinea pigs or rabbits are commonly used). After 
incubation, the animals produce antibodies to the microbial cells that can be 
isolated from serum samples of the animals. The antibodies are proteins and so 
can be reacted with FITC to produce FITC-antibody conjugates. These FITC- 
antibodies only adhere to the correct microbial cells if applied to a soil sample. 
When excess FITC-antibody conjugate has been removed by washing, only 
those microbial cells fluoresce and they can be simultaneously located and iden- 
tified by epifluorescence microscopy (as for FITC staining). 

It has been used in soil microbiology to identify nitrogen-fixing Rhizobium 
spp, Bacillus spp, various fungal genera such as Aspergillus, and a few Actinomy- 

One problem is the relatively non-specific nature of many antibody prepara- 
tions. Many bacteria in the same general taxonomic group have similar chemical 
structures on their cells and produce a complex of antibodies from those struc- 
tures that overlap with the complex produced by the other similar bacteria. Thus 
if the antibody complex is used to form the conjugate with FITC, that FITC-an- 
tibody will cross-react with the other bacteria as well as with the target species. 
Usually this reaction will be weaker but still significant. One way to "purify" the 
complex is to remove the cross-reacting antibodies by reacting them with the 
actual bacterial cells from the unwanted cross-reacting species. Any common 
antibodies (the cross-reacting group) will be adsorbed onto the surfaces of the 
added cells and removed from the complex. The remaining antibodies are then 
much more specific to the target species. 

A more recent modification of the method uses monoclonal or polyclonal 
antibodies produced in other microbial cells to obtain larger quantities of an- 
tibody for conjugation with FITC. Many of these antibodies are now available 
commercially from suppliers and some are available already conjugated and 
therefore labelled with FITC and/or rhodamine. 

Enzyme-linked Immunosorbant Assays 

Enzyme-linked immunosorbant assays (ELISAs) have found some use in soils 
when the population sought exceeds 10 000 cells/ml. The technique has been 
applied mainly to Rhizobia in soil and roots of legumes. The major difficulty is 

C.S. Nautiyal and S.M. DasGupta 

removal of the microbial cells from the substrates; both direct lysis in situ and 
removal of cells followed by lysis have been used. 

Molecular Methods 

Gene Probe and Nucleic Acid Hybridization 

These techniques rely on detecting specific sequences of nucleic acids in the or- 
ganisms under study. If the sequences used are carefully chosen to be diagnos- 
tic, this technique can find specific organisms in soils and other environmental 
samples. The gene probe is a short segment of nucleotides that binds specifically 
with the homologous sequence in the target microorganism. If the segment is 
labelled with radioactive 32 P, any binding to the target nucleotides can be de- 
tected by the presence of the radioactivity after reaction. 

Polymerase Chain Reaction 

The polymerase chain reaction (PCR) has recently been applied to microbial 
ecology. In this technique, extracted DNA is melted to form single strands, an- 
nealed with primers, and the DNA is extended from the primers by nucleotide 
addition using DNA polymerase enzyme. The primers are chosen to link to re- 
gions of DNA of interest (close to a diagnostic target sequence). 

Bioluminescence Marker Genes 

A bioluminescence marker gene is typically the lux gene of Vibrio fischeri. This 
gene causes photoluminescence in bacteria (emits light). If the gene can be in- 
serted into the target organisms, they become photoluminescent and this prop- 
erty can be used to detect them and track their fate in soil and water samples. 
This technique has been used with Escherichia coli and Pseuodomonas target 
organisms. It has been extended by fusing other genes with the lux gene and 
inserting both into cells. Naphthalene degradation is promoted by a nah gene 
which has been combined with the lux gene to make a diagnostic pair. This can 
track both the bacteria and their activity in soil or rhizospheric samples. 

24. Screening of Plant Growth- Promoting Rhizobacteria 371 

Metagenomics, the genomic analysis of a population of microorganisms that 
provides an access to the physiology and genetics of uncultured organisms, has 
emerged as a powerful technique in recent times. Metagenomic analysis in- 
volves isolating DNA from an environmental sample, cloning the DNA into a 
suitable vector, transforming the clones into a host bacterium, and screening the 
resultant transformants. Metagenomic analysis has several advantages over cul- 
ture or PCR-based methods. For example, it: (a) provides access to uncultured 
microorganisms, (b) does not require prior knowledge of gene sequences, and 
(c) recovers complete genes. 

Two methods are generally adopted for isolation of DNA: the direct lysis 
method and the cell extraction method. However, the direct analysis method 
has been reported to yield at least 10-fold more DNA than the cell lysis method. 
This method is based on the initial extraction of extracellular DNA with alkaline 
buffer, followed by the direct lysis of the cells in the soil by chemical and me- 
chanical means and then quantitative extraction of released DNA. For purifica- 
tion, multiple electrophoresis runs are commonly employed. 

Following purification, the metagenomic DNA is partially digested with 
restriction enzymes. Restriction digestion requires a starting DNA minimally 
three times longer than the desired insert. Then a library of the DNA based on 
the size required is prepared and a suitable vector is choosen for its insertion 
into a bacterial cell. There is a limited choice of vectors for cloning metagenomic 
DNA. The most commonly used vectors are: plasmids, fosmids, cosmids and 
bacterial artificial chromosomes (BACs). Plasmids are ideal for small-insert li- 
braries (less than 15 kb). Fosmids and cosmids are suitable for libraries with 
moderate size inserts (38-52 kb). These vectors have much greater cloning ef- 
ficiencies than BACs. Nonetheless, BAC is the choice for cloning for various 
reasons. BACs based on the E. coli factor can carry large inserts (>300 kb). Once 
a gene of interest is identified, phylogenetic anchors such as 16S rRNA gene and 
the archaeal DNA repair gene radA can be searched in the flanking DNA to 
provide a link of phylogeny with the functional gene. 

The applications of metagenomics are immense. The heart of this approach is 
that it provides us with access to the genome heterogeneity of both culture-de- 
pendent and culture-independent microorganisms. Metagenomics has already 
opened new avenues of research by enabling unprecedented analysis of genome 
and evolution in environmental contexts and providing access to far more mi- 
crobial diversity. The early screening campaigns of metagenomic libraries cen- 
tered around the cloning of genes encoding phylogenetically conserved molecu- 
lar traits to explore microbial diversity. 

C.S. Nautiyal and S.M. DasGupta 

Tracking of GEMs 

In order to follow the fate of a genetically engineered microorganism (GEM) 
in the environment, it is necessary to detect and quantify it in time and space. 
Both the organism and the genetic information that constitutes the modifica- 
tion must be tracked simultaneously and independently so that both loss of the 
new information from the GEM and its possible lateral transfer to indigenous 
microorganisms can be assessed. 

Traditional methods for the detection and enumeration of specific microbes 
generally involve sample dilution and plating for single colonies on solidified se- 
lective media. The medium may be selective for a natural property of the organ- 
ism or for a newly acquired property (e.g. lactose utilization, resistance to nali- 
dixic acid) that has been introduced specifically for the purpose of tracking the 
GEM and which differs from the introduced property that constitutes the crucial 
new functional aspect of the GEM. Exceptionally, this latter property may also 
serve as a basis for specific selection or detection of the GEM on solid media, 
thereby enabling both the organism and the newly acquired genetic information 
to be independently tracked by plating techniques. Where the newly acquired 
information does not itself confer a phenotypic property detectable by plating 
procedures, it can be directly linked to a marker which does have this property 
(e.g. genes encoding lactose utilization, catechol 2,3-dioxygenase, etc.). 

Realistically, only those microorganisms which can grow in the rhizosphere are 
suitable for use as biocontrol agents, as the rhizosphere provides the first line of 
defense for the roots of a plant against attack by soil-borne pathogens. Thus it 
is necessary to screen the rhizospheric bacteria having plant growth-promoting 
ability. Also the introduction of bioinoculants having plant growth -promoting 
and biocontrol activity will be successful if they have rhizosphere competence to 
exert the desired effect to the plants. 

Depending on that availability and culturability of microorganisms there are 
several classic, modern, and molecular methods to screen them. Looking at the 
biodiversity of microorganisms, we are presently able to culture only 1-2% of 
them. This is where metagenomics plays an important role. By virtue of it, many 
genes beneficial for plant health can be isolated from the rhizosphere and can 
then be cloned in a bacterium for its expression. 

These screening methods would by large help us to formulate better bioin- 
oculants to replace the chemical fertilizers, which continuously challenge the 
soil and human health. 

24. Screening of Plant Growth- Promoting Rhizobacteria 373 

Acea MJ, Moore CR, Alexander M (1988) Survival and growth of bacteria introduced into 
soil. Soil Biol Biochem 20:509-515 

Akopyants NS, Fradkov A, Diatchenko L, Hill JE, Siebert PD, Lukyanov SA, Sverdlov ED, 
Berg DE (1998) PCR-based subtractive hybridization and differences in gene content 
among strains of Helicobacter pylori. Proc Natl Acad Sci USA 95:13108-13113 

Blomberg GV, Lugtenberg BJJ (2001) Molecular basis of plant growth promotion and biocon- 
trol by rhizobacteria. Curr Opin Plant Biol 4:343-350 

Brady SF, Chao CJ, Handelsman J, Clardy J (2001) Cloning and heterologous expression of a 
natural product biosynthetic gene cluster from eDNA. Org Lett 3:1981-1984 

Britto de Oliveira RG, Wolters AC, Elsas JD van (1995) Effects of antibiotics in soil on the 
population dynamics of transposon Tn5 carrying Pseudomonas fluorescens. Plant Soil 

Dandurand LMC, Knudsen GR ( 2002) Sampling microbes from the rhizosphere and phyl- 
losphere. In: Hurst CJ, Crawford RL, Knudsen GR, Mclnerney MJ, Stetzenbach LD (eds). 
Manual of environmental microbiology, 2nd edn. ASM, Washington, D.C., pp 516-526 

Dazzo FB (1980) Adsorption of microorganisms to roots and other plant surfaces. In: Bit- 
ton G, Marshall KC (eds) Adsorption of microorganisms to surfaces. Wiley, New York, 

Deacon JW, Berry LA (1993) Biocontrol of soil-borne plant pathogens: concepts and their 
application. Pest Sci 37:417-426 

Devliegher W, Arif MAS, Verstaete W (1995) Survival and plant growth promotion of de- 
tergent-adapted Pseudomonas fluorescens ANP15 and Pseudomonas fluorescens 7NSK2. 
Appl Environ Microbiol 61:3865-3871 

Dewar K, Sabbagh L, Cardinal G, Veilleux F, Sanschagrin F, Birren B, Levesque RC (1998) 
Pseudomonas aeruginosa PAOl bacterial artificial chromosomes: strategies for mapping, 
screening, and sequencing 100 kb loci of the 5.9 Mb genome. Microb Comp Genomics 

Preston GM, Bertrand N, Paul BR (2001) Type III secretion in plant growth-promoting Pseu- 
domonas fluorescens SBW25. Mol Microbiol 41 999-1014 

Gal M, Preston GM, Massey RC, Spiers AJ, Rainey PB (2003) Genes encoding a cellulosic 
polymer contribute toward the ecological success of Pseudomonas fluorescens SBW25 on 
plant surfaces. Mol Ecol 12:3109-3121 

Gillespie DE, Rondon MR, Handelsman J (2004) Metagenomic libraries from uncultured 
microorganisms. In: Osborn AM (ed) Molecular microbial ecology. BIOS Scientific, Ox- 
ford (in press) 

Guyon P, Petit A, Tempe J, Dessaux Y (1993) Transformed plants producing opines specifically 
promote growth of opine-degrading agrobacteria. Mol Plant Microbe Interact 6:92-98 

Kim U, Birren B, Slepak T, Mancino V, Boysen C, Kang H, Simon M, Shizuya H (1996) Con- 
struction and characterization of a human bacterial artificial chromosome library. Ge- 
nomics 34:213-218 

Kluepfel DA (1993) The behaviour and tracking of bacteria in the rhizosphere. Annu Rev 
Phytopathol 31:441-472 

Lam ST, Torkewitz NR, Nautiyal CS, Dion P (1997) Microorganisms with mannopine catabo- 
lizing ability. US Patent 5 610 044 

Lan R, Reeves PR (2000) Intraspecies variation in bacterial genomes: the need for a species 
genome concept. Trends Microbiol 8:396-401 

Landa BB, Mavrodi DM, Thomashow LS, Weller DM ( 2003) Interactions between strains 
of 2,4-diacetylphloroglucinol-producing Pseudomonas fluorescens in the rhizosphere of 
wheat. Phytopathology 93:982-994 

C.S. Nautiyal and S.M. DasGupta 

Li DM, Alexander M (1990) Factors affecting co-inoculation with antibiotic-producing bac- 
teria to enhance rhizobial colonisation and nodulation. Plant Soil 129:195-201 

Lugtenberg BJJ, Dekkers L, Bloemberg GV ( 2001) Molecular determinants of rhizosphere 
colonization by Pseudomonas. Annu Rev Phytopathol 39:461-490 

Lynch JM (1990) The rhizosphere. Wiley, Chichester 

Albareda M, Dardanelli MS, Sousa C, Megias M, Tempranol F, Rodriguez-Navarro D (2006) 
Factors affecting the attachment of rhizospheric bacteria to bean and soybean roots. 
FEMS Microbiol Lett 259:67-73 

Mathre DE, Cook RJ, Callan NW (1999) From discovery to use traversing the world of com- 
mercializing biocontrol agents for plant disease control. Plant Dis 83:972-983 

Mavrodi DV, Mavrodi OV, McSpadden BB, Gardener BB, Landa DM, Weller W, Thomashow 
LS (2002) Identification of differences in genome content among p/z/D-positive Pseudo- 
monas fluorescens strains by using PCR-based subtractive hybridization. Appl Environ 
Microbiol 68:5170-5176 

Mehta S, Nautiyal CS (2001) An efficient method for qualitative screening of phosphate solu- 
bilizing bacteria. Curr Microbiol 43:51-56 

Nairn JD, Chanway CP (1999) Recovery of rhizosphere-colonizing GEM from inside wheat 
roots. Can J Microbiol 45:612-615 

Nautiyal CS (1997a) A method for selection and characterisation of rhizosphere competent 
bacteria of chickpea. Curr Microbiol 34:12-17 

Nautiyal CS (1997b) Selection of chickpea rhizosphere competent Pseudomonas fluorescens 
NBRI1303 antagonistic to Fusarium oxysporum f. sp. ciceri, Rhizoctonia bataticola and 
Pythium sp. Curr Microbiol 35:52-58 

Nautiyal CS (2002) A biologically pure culture of bacteria which suppresses diseases caused 
by pathogens in chickpea crops and a culture of bacteria comprising a strain of Pseudo- 
monas fluorescens. US Patent 6495362 

Nautiyal CS (2006) Biological control of plant diseases by natural and genetically engineered 
fluorescent Pseudomonas spp. In: Ray RC, Owen P, Ward W (eds) Microbial biotechnol- 
ogy in horticulture. Science, Enfield, pp 125-162 

Nautiyal CS, Dion P (1990) Characterization of the opine-utilizing microflora associated with 
samples of soil and plants. Appl Environ Microbiol 56:2576-2579 

Nautiyal CS, Mehta S, Rehman A, Singh HB (2004) Bioinoculants for sustainable agriculture. 
In: Singh SP, Singh HB (eds) Eco- agriculture with bioaugmentation: an emerging con- 
cept. Rohitashwa, Lucknow, pp 148-162 

Nautiyal CS, Mehta S, Singh HB (2006) Biological control and plant growth-promoting Bacil- 
lus strains from milk. J Microbiol Biotechnol 16:184-192 

Nishimura M, Nakamura S, Hayashi N, Asakawa S, Shimizu N, Kaku H, Hasebe A, Kawasaki 
S (1998) Construction of a BAC library of the rice blast fungus Magnaporthe grisea and 
finding specific genome regions in which its transposons tend to cluster. Biosci Biotech- 
nol Biochem 62: 1515-1521 

Ochiai H, Inoue Y, Hasebe A, Kaku H (2001) Construction and characterization of a Xan- 
thomonas oryzae pv. oryzae bacterial artificial chromosome library. FEMS Microbiol Lett 

O'Connell KP, Goodman RM, Handelsman J (1996) Engineering the rhizosphere expressing 
a bias. Trends Biotechnol 14:83-88 

Quaiser A, Ochsenreiter T, Klenk HP, Kletzin A, Treusch AH, Meurer G, Eck J, Sensen CW, 
Schleper C (2002) First insight into the genome of an uncultivated crenarchaeote from 
soil. Environ Microbiol 4:603 

Randon MR, August PR, Bettermann AD, Brady SF, Grossman TH, Liles MR, Loiacono KA, 
Lynch BA, MacNeil IA, Minor C, Tiong CL, GilmanM, Osburne MS, Clardy J, Handels- 
man J, Goodman RM (2000) Cloning the soil metagenome: a strategy for accessing the 
genetic and functional diversity of uncultured microorganisms. Appl Environ Microbiol 

24. Screening of Plant Growth- Promoting Rhizobacteria 375 

Steffan RJ, Goksoyr J, Bej AK, Atlas RM (1988) Recovery of DNA from soils and sediments. 
Appl Environ Microbioll 54:2908 

Stein JL, Marsh TL, Wu KY, Shizuya H, De Long EF (1996) Characterization of uncultivated 
prokaryotes: isolation and analysis of a 40 kilobase-pair genome fragment from a plank- 
tonic marine archaeon. J Bacteriol 178:591-599 

Research Methods in Arbuscular 
Mycorrhizal Fungi 

A. Gaur and A. Varma 

Mycorrhizas are widespread associations between plant and fungi and are char- 
acterized by a bi-directional transfer of nutrients, where plants provide sugar to 
the fungi and these help the plants in the acquisition of mineral nutrients from 
the soil (Smith and Barker 2002). Additionally, mycorrhizal fungi also aid in 
soil-water extraction, increasing the drought tolerance of the host (Subrama- 
nian et al. 1997; Mathur and Vyas 2000). These associations are also reported 
to improve the plants ability to tolerate heavy metal toxicity (Khan 2001), as 
well as attacks by pathogens (Calvet et al. 1993; Filion et al. 1999; Fusconi et 
al. 1999) and herbivores (Gehring and Whitham 1991; Borowicz 1997). At the 
single plant level, these benefits result in increased mass production and plant 
competitive ability. 

Arbuscular mycorrhizal (AM) fungi are soil microorganisms that establish a 
mutual symbiosis with the majority of higher plants, providing a direct physi- 
cal link between soil and plant roots (Strullu 1991). These fungi are the most 
ancient (Redecker et al. 2000) and widespread mycorrhizal associations. AM 
fungi were recently placed in a new monophyletic phylum, the Glomeromy- 
cota, encompassing three orders (Schussler et al. 2001) and five families (Mor- 
ton and Redecker 2001). Associations with these fungi are widespread among 
tropical trees, shrubs and herbs (Harley and Smith 1983), including members 
of the Araucariaceae (Smith and Read 1997). About 95% of the worlds plant 
species belong to characteristically mycorrhizal families (Smith and Read 1997) 
and potentially benefit from AM fungus-mediated mineral nutrition (Jeffries 
and Barea 1994) due to the fundamental role played by these glomalean fungi 

Amity Institute of Microbial Sciences, Amity University, Uttar Pradesh, Sector- 125, 
Noida 201301, UP, India, email: 
Noida 201303, UP, India, email: 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmuller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

A. Gaur 

in biogeochemical element cycling. AM symbioses occur in almost all habitats 
and climates, including disturbed soils (Enkhtuya et al. 2002) and those derived 
from mine activities (Bi et al. 2003). Today, there is increased research interest 
in understanding the basic physiology and ecology of mycorrhiza in vivo, in 
vitro, and in situ. Only through such extensive efforts can we hope to reliably 
manage mycorrhiza in forestry and agriculture. 

The purpose of this chapter is to highlight the basic methods in mycorrhizal 
research. A wide range of methods are currently being used by various research 
groups; and each method needs to be assessed for the particular application re- 

Assessment of AM Fungal Propagules in Soil 

The spores of AM fungi are larger than those of most fungi (ranging from 10 \xm 
to 1000 urn in diameter) and can easily be observed under a dissecting micro- 
scope. However, spore counts often underestimate the numbers of AM fungi 
since colonized roots and hyphae can also serve as propagules. Therefore, vari- 
ous assays have been used to estimate total propagule number (Sylvia 1994). 

Soil Sampling 

Soil samples are collected from the rhizosphere of a plant. One kilogram of soil 
in each sample is collected at a depth of 30-50 cm. Six composite samples are 
collected to represent the soil sample of each site and kept in plastic bag at tem- 
perature around 2-5 °C. The wet soil samples are air-dried at room temperature 
before storage. These soil samples are then extracted to separate spores. 

Spore Extraction 

AM fungal spores are extracted from soil by wet sieving and decanting, as de- 
scribed by Gerdemann and Nicolson (1963), and by sucrose centrifugation, as 
described by Smith and Skipper (1979). The soil sample (100 g) is suspended 
in 1 1 water by gentle stirring. A dispersant such as sodium hexametaphosphate 
can be used with clay soils. Heavier particles are then allowed to settle for a 
few seconds and the liquid is decanted through a 450 |im sieve to remove large 

25. Research Methods in Arbuscular Mycorrhizal Fungi 379 

particles of organic matter and allow the spores pass through. Next, the sus- 
pension is passed through a 100 |im sieve and then through a 63 |im sieve. The 
spores and small amount of debris that remain on the 63 |im sieve are poured 
into a centrifuge tube containing water and centrifuged at 1800 rpm. The up- 
per solution is poured off, 40% sucrose is added to the debris at the bottom and 
the mixture is then centrifuged for 2 min at 1800 rpm. The upper solution is 
separated for examination under the stereoscopic microscope. The spores which 
are collected under the microscope are stored in Ringers solution (Daniels and 
Graham 1976) for identification. 

Quantification of Spore Numbers 

The entire sieving after the wet sieving and decanting method is examined in 
nematode-counting dishes (Doncaster 1962) under a dissecting microscope 
at 60x magnification. These counting dishes enable a complete sample to be 
counted more rapidly and facilitate the separation of viable spores (which mostly 
sink) from non-viable ones (which mostly float). The non-viable floating spores, 
mostly concentrated in the scum on the meniscus at the edge of the dish, are 
empty or gas-filled shells. Viable spores, viz. those with cytoplasm and oil glob- 
ules (readily checked by piercing with a needle), rarely float and those that do 
are mostly very small spores or large spores which have dried out and become 
difficult to re-wet. The extracted spores can also be counted on filter paper after 
filtering the sieving through a Whatman filter paper (Gaur and Adholeya 1994). 
However, there are certain limitations to direct counting of spores. First, some 
AM fungi produce spores too small to be extracted or counted using these tech- 
niques [e.g. Glomus tenuis (Greenall) Hall (1977)]. Second, it has been claimed 
that some AM fungi may not produce spores (Baylis 1969). And third, even the 
spores that are large enough to be extracted and counted may not all be recov- 
ered (Clarke and Mosse 1978). The most probable number (MPN) technique 
(or method of ultimate dilution) for enumerating viable microorganisms has 
been proposed as a possible solution to the problems faced when using the usual 
methods of counting AM fungal propagules (Sylvia 1994). 

I nfectivity Assays 

A more straightforward approach for comparing AM populations among soils 
is an infectivity assay. The drawback is that actual propagule numbers are not 
estimated. The MPN of infective propagules can be estimated as described by 
Porter (1979). A 10-fold dilution series is first made by mixing 10 g soil for each 

A. Gaur 

replicate of treatment with 90 g diluent sterilized sand. The second dilution is 
made by mixing 10 g soil/sand mixture from the first dilution with a further 
90 g diluent sterilized sand. This dilution is done up to 10" 5 with five replicates. 
Then, 10 g aliquots of 10~ 3 , 10" 4 and 10" 5 dilutions are placed in plastic pots, each 
containing 350 g sterilized sand. Three sorghum seeds are sown in one pot and, 
a week later, the seedlings are thinned to one. The plants are harvested after 
6 weeks under glasshouse conditions, where they are maintained by periodi- 
cally supplying nutrient solution devoid of phosphorus. The sorghum roots are 
washed free of soil, autoclaved in 10% KOH and stained in trypan blue-locto- 
glycerol. Infection is observed under 40x magnification and the MPN is calcu- 
lated as described by Alexander (1982). 

In an another procedure described by Gaur et al. (1998), the inoculum is 
mixed with 20, 40, 60 and 80% of the sterilized soil and transferred to 5x 9-cm 
plastic pots after homogenization. Five replicates are prepared for each level of 
dilution. Eight germinated seeds of Zea mays are planted per pot and cultivated 
for 12 days in a greenhouse before the roots are washed, stained and processed 
for estimation of primary infection points. The number of primary entry points 
is counted on a whole-root system under a stereoscopic microscope (40x). 

Identification of AM Fungi 

The ability to make a good, semi-permanent, diagnostic slide is critical in mak- 
ing a species determination for a specimen of AM fungi (Schenck and Perez 
1990). Semi-permanent mountants, such as polyvinyl alcohol-lactic acid-glyc- 
erol (PVLG; Table 25.1; Koske and Testier 1983) or Hoyer s (Cunningham 1972), 
allow slides to remain useable for years. 

Pick out 40-100 typical, clean spores with a pipette or other device and place 
them in a watch glass containing distilled water. A drop of PVLG is then placed 
on a clean and dry microscope slide. Add 10-25 spores with a minimum amount 
of water to the mountant. Gently mix the spores and mountant together with a 

Table 25.1 Composition of important reagents used in mycorrhizal techniques: 1. PVLG moun 

Polyvinyl alcohol 8 . 3 3 g 

Distilled water 50 ml 

Lactic acid 50 ml 

Glycerine 5 ml 

Polyvinyl alcohol (24-32 centripose viscosity) can be used 
and dissolved in water by heating (90 °C) overnight 

25. Research Methods in Arbuscular Mycorrhizal Fungi 381 

needle or other object to slightly disperse the spores. Allow the mountant to set 
for 4-5 min to become more viscous and then add a coverslip gently onto the 
mountant without the formation of any air bubble. Do not apply pressure to the 
coverslip in this process. Let the mountant with spores dry overnight in a flat 
position. Clean off any excess mountant with a muslin cloth moistened with a 
solvent such as ethanol. Seal the edges of the coverslip with a clear fingernail 
polish or other sealant and allow it to dry. Repeat the steps with a second drop 
of PVLG on another slide. Gently break the spore walls under coverslip of this 
second slide by applying light pressure on the coverslip with the back of the 
needle. It is very important that the break of the spore wall be adequate. The 
spores should not be crushed during the process. The spores can also be stained 
in a drop of Melzers reagent (Morton 1991; Table 25.2) by mixing with PVLG 
in a ratio of 1:1. The AM species can be identified using spore color, size wall 
structure and other morphological structures (Schenck and Perez 1990). 

Use of Fatty Acids for Identification of AM Fungi 

Fatty acids derived from abundant phospholipids of AM fungi (located in mem- 
brane structures) and neutral lipids (located in storage structures) are poten- 
tially useful for estimating the biomass of infective AM propagules (Olsson et 
al. 1995). In addition some fatty acids have potential as specific markers for AM 
fungi. For example, fatty acids 16:lco5c, 18:lco7c, 20:3, 20:4 and 20:5 have been 
detected either exclusively or in higher amounts in AM spores and the roots of 
plants colonized by AM fungi, prompting attempts at identification, character- 
ization or differentiation of AM fungi on the basis of fatty acid profiles. 

Madan et al. (2002) performed fatty acid methyl ester (FAME) analysis on the 
spores of four AM fungi (Glomus coronatum, G. mosseae, Gigaspora margarita, 
Scutellospora calospora) and showed 16:lco5c to be the dominant fatty acid pres- 
ent. In addition, spores of G. margarita contained large quantities of 18:lco9c 
and three 20-C fatty acids (20:lco9c, 20:2co6c, 22:lco9c) that were not present in 
the spores of the other two species. The results of this study confirmed the use 
of 16:lco5c as a marker fatty acid for AM fungi in controlled environments and 
suggested that 18:lco9c, 20:lco9c, 20:2co6c and 22:lco9c could be used as possible 
markers for the detection of G. margarita. 

Table 25.2 Composition of important reagents used in mycorrhizal techniques: 2. Melzers reagent 
- mixed 1 : 1 (v/v) with PVLG 

Iodine 1.5 g 

Potassium iodide 5 g 

Distilled water 100 ml 

A. Gaur 

Quantification of AM Fungal Root Colonization in Root 

Arbuscular mycorrhizal fungal structure in roots is usually not observed with- 
out appropriate staining because internal structures are obscured by the natural 
pigments and cell contents within roots. Clearing procedures, which use chemi- 
cal agents to remove cell contents and cell wall pigments, are a valuable method 
for viewing internal features in plant tissues (Gardner 1975). 

The preparation of plant roots for quantification of the extent of AM coloni- 
zation is probably the most frequently performed procedure in AM research. 
Biological stains have been selected which bind to the fungal structures with- 
out much background staining of the plant tissue. Over the years, several tech- 
niques have been published which document methods for clearing and subse- 
quent staining of roots to reveal the mycorrhiza. The first of these, described by 
Phillips and Hayman (1970), used trypan blue (TB) and this method has been 
widely adopted. A modification was described by Koske and Gemma (1989), in 
which some of the toxic reagents were eliminated from the process, although TB 

Clearing and Staining Roots 

Clearing and staining procedures require that root samples should be washed 
free of soil. It is important that clearing with KOH (Kormanik and McGraw 
1982; Brundrett et al. 1984) and staining solution volumes are sufficient for the 
amount of roots being processed and that roots are not tightly clumped together 
for uniform contact with solutions. To ensure uniform staining, the roots should 
be chopped into small (1-2 cm) segments. 

1. Wash root specimens stored in capsules under running tap water thoroughly. 
Place them in beaker containing 5-10% KOH solution for about 15-30 min. 

2. Pour off the KOH solution and rinse the capsules well in a beaker using at 
least three complete changes of tap water or until no brown color appears in 
the rinse water. 

3. Cover the capsules in the beaker with alkaline H 2 2 at room temperature for 
10 min or until the roots are bleached. 

4. Rinse the capsules in the beaker thoroughly, using at least three complete 
changes of tap water to remove the H 2 2 . 

5. Cover the capsules in the beaker with 1% HC1 and soak for 3-4 min. Then 
pour off the solution. Do not rinse after this step because the specimens must 
be acidified for proper staining. 

6. Cover the capsules in the beaker with staining solution (0.01% acid fuchsin 
in lactoglycerol or 0.05% trypan blue in lactophenol) and keep them over- 
night for staining. 

25. Research Methods in Arbuscular Mycorrhizal Fungi 

7. After removing from the capsules, place the root specimens in a glass Petri 
plate or multiwell plate for destaining. The destaining solution (50% glycerol) 
is the standard used in Step 6 but, of course, without the stain. Semi-perma- 
nent slides of stained roots can be made with PVLG mountant. For tempo- 
rary slides, the stained roots can be observed in plain lactoglycerol. 

Modifications of Staining Procedure 

Modifications to standard clearing and staining procedures have been proposed 
for safety reasons. Vierheilig et al. (1998) demonstrated adequate staining of 
mycorrhizal roots with ink-vinegar solutions as a safe alternative to the haz- 
ardous, toxic and potentially carcinogenic stains. Other authors have proposed 
the use of acid fuchsin (AF; Kormanik and McGraw 1982; Merryweather and 
Fitter 1991) or chlorazol black E (Brundrett et al. 1984; Table 25.3). However, 
a major problem of most stains is that they are known or suspected carcino- 
gens (Coombes and Haveland- Smith 1982) and, in order to solve this, Grace 
and Stribley (1991) proposed replacing TB with aniline blue or methyl blue, 
although Brundrett et al. (1996) suggest that there is insufficient evidence that 
these latter two stains are not also toxic. In addition, effective clearing of roots 
involves the use of KOH, which is caustic. 

Vital staining procedures that measure succinate dehydrogenase activity can 
be used to confirm that the mycorrhizal fungus hyphae being enumerated are 
metabolically active (Schaffer and Peterson 1993; Tisserant et al. 1993; Vivas 
et al. 2003). Abdel-Fattah (2001) reported histochemical staining of succinate 
dehydrogenase and alkaline phosphatase (vital stain) activities as enzyme mark- 
ers in various AM fungal structures. Grace and Stribley (1991) reviewed the 
use of stains in the literature for 1989 and 1990 and found that 68% of authors 
used TB, 18% CBE, 9% AF and 5% some other procedure. A further technique, 
auto-fluorescence (fluorescence microscopy) was first described by Ames et al. 

Table 25.3 Composition of important reagents used in mycorrhizal techniques: 3. Staining solu 

0.01% acid fuschin 

0.05% trypan blue 

0.03% chlorozol black E (CBE) 

Lactic acid 
Distilled water 

0.01 g acid fuschin in 100 ml lactoglycerol 

0.05 g trypan blue in 100 ml lactoglycerol 

0.03 g CBE in lactoglycerol (dissolve 
CBE in water before adding equal vol- 
umes of lactic acid and glycerol) 

876 ml 
64 ml 
60 ml 

A. Gaur 

(1982) and involves subjecting roots to ultraviolet illumination, under which 
the arbuscules auto-fluoresce. The method was found to work well and no sig- 
nificant differences were found between the extents of colonization detected by 
this method and by that of Phillips and Hayman (1970). Subsequent workers 
also reported the auto -fluorescence of fungal structures other than arbuscules 
(Jabaji-Hare et al. 1984). 

Measurement of Root Colonization by AM Fungi 

Measurement of mycorrhizal root colonization is done after clearing and stain- 
ing the roots. Root length can be measured simultaneously with mycorrhizal 
colonization by a gridline intersection procedure (Giovannetti and Mosse 1980) 
or separately by making slides and viewing them under a compound micro- 
scope (McGonigle et al. 1990). Here we describe the assessment of mycorrhizal 
colonization using the Biermann and Linderman (1981) method (frequency 
distribution method) in which the colonization is assessed (using a compound 
microscope) as a proportion of the root length colonized by mycorrhizal fungi. 

1. Spread randomly selected, stained root segments (1 cm in length) in lacto- 
glycerol within a Petri dish marked with a 1-cm grid to facilitate scanning 
and view them under a stereomicroscope at 12x to 50x. 

2. Calibrate the ocular micrometer with the stage micrometer by placing it on 
the eyepiece of a compound microscope. 

3. Mount 5-10 root pieces on each glass slide and calibrate the ocular microm- 
eter with the stage micrometer at the particular magnification of the com- 
pound microscope and observe the root pieces. 

4. Estimate the proportions of each root segment consisting of vesicles, arbus- 
cules and hyphae, to the nearest 10%. 

5. Record the frequency distributions from samples containing 25, 50, 100 root 
segments. The percent root length with mycorrhizal fungi in the sample is 
calculated from the frequency distribution. 

Extraction and Quantification of Extra-Radical Mycelium 
of AM Fungi in Soils 

One of the important advances in the past decade of mycorrhizal research was 
the increased emphasis on the structure, organization and function of the extra- 
radical mycelium (ERM). 

The first step in ERM assessment, for example determining lengths and meta- 
bolic activity, is extracting the ERM from the soil or growth substrate. One set 

25. Research Methods in Arbuscular Mycorrhizal Fungi 385 

of ERM extraction techniques is based on vacuum filtration of a soil suspen- 
sion through a membrane filter. This membrane filtration technique (MFT) was 
introduced by Hanssen et al. (1974). The technique was modified recently by 
several authors and is now widely used for the assessment of ERM lengths of 
AM fungi (Boddington et al. 1999). Vilarino et al. (1993) developed another 
extraction technique using a rotating wire frame to retrieve the ERM fragments 
from an agitated soil suspension. A third set of extraction techniques is based on 
sucrose flotation and centrifugation (Schubert et al. 1987). All these techniques 
are suitable for quantification of the lengths of ERM with respect to the spatial 
distribution of the hyphae in soil (Dodd 1994). Their disadvantage, however, is 
that they severely disturb the ERM network during sample processing. Thus, the 
identification of structures such as branched absorbing structures (BAS; Bago 
et al. 1998a,b) or the measurement of morphological parameters such as hy- 
phal branching or anastomoses formation is often difficult. A simple "inserted 
membrane technique" (IMT) for sampling mycorrhizal extraradical mycelium 
(ERM) was developed as an alternative to the commonly used MFT (Balaz and 
Vosatka (2001). The ERM was extracted by insertion of cellulose nitrate or cel- 
lulose acetate membrane filters (0.45-0.6 |im pore size) into the mycorrhizo- 
sphere of host plants. The membranes with adhered ERM were removed at har- 
vest and stained: (a) with trypan blue for estimation of total hyphal length and 
(b) with enzyme stains to indicate the viability of the ERM. 

Assessment of Growth Response of Effective Isolates 

Any measure of the benefit provided by mycorrhizas depends on the relative 
contribution of root and mycorrhiza-mediated nutrient uptake to plants (Janos 
1980). Mycorrhizal dependency has often been quantified by calculating the 
yield ratio between mycorrhizal plants and uninoculated control plants grown 
in a particular soil at a single soil P level (Koide et al. 1988; Manjunath and 
Habte 1991). However, it is better to analyze mycorrhizal benefits across a range 
of soil P levels, by producing nutrient response curves. 

Mycorrhizal dependency is a plant property which refers to the degree of its 
responsiveness to mycorrhizal colonization. It can be measured by quantifying 
the growth improvement owing to the mycorrhizal performance, such as the rel- 
ative non-mycorrhizal contribution compared with mycorrhiza-mediated nu- 
trient uptake (Plenchette et al. 1983; Brundrett 1991). Mycorrhizal dependency 
is the result of morphological and physiological plant traits which are modu- 
lated by both the nutrient availability of the soil, particularly P, and the effective- 
ness of the mycorrhizal fungus involved (Khalil et al. 1994). It can vary greatly 
from one plant species to another and even between cultivars or ecotypes within 
a single species (Azcon and Ocampo 1981). Some plant species can be obligato- 
rily mycorrhizal for P uptake (Janos 1980; Merryweather and Fitter 1996). 

A. Gaur 

Inoculum Production of AM Fungi 

Since AM fungi are obligate symbionts, they are always produced on roots. The 
method of culture and inoculum production of AM fungi vary from the pot 
culture techniques of Brundrett and Juniper (1995) to the currently used tech- 
niques, such as on-farm production (Sieverding and Barea 1991; Douds et al. 
2005a, b, 2006), nutrient film technique (Mosse and Thompson 1984), aeropon- 
ics (Jarstfer and Sylvia 1995) and axenic culture (Fortin et al. 2002). Apart from 
the host plant (Sreenivasa and Bagyaraj 1988), many factors such as temperature 
(Furlan and Fortin 1973), light (Ferguson and Menge 1982), pot size and soil 
fertility (Menge et al. 1978) and the particle size of the growth substrate (Gaur 
and Adholeya 2000) are known to affect inoculum production of AM fungi. 

On-Farm Production of AM Fungi 

On-farm inoculum production is a promising technique for large-scale AM 
fungal inoculum production where the inoculum is produced on-farm, directly 
on the site of its application, using local resources. The mycorrhizal inocula can 
be prepared by harvesting the roots of growing plants and applied in the rest 
of the field over a period of time. The soil left in the nursery after removing 
the roots also contains large amounts of AM fungal propagules; and it serves 
as the source for further and continued production of inocula for in-house use 
for the farmer. Gaur and Adholeya (2002) conducted experiments in marginal 
soil for enhancing crop production along with producing a higher number of 
AM fungal propagules. The procedure is described in detail by Sieverding and 
Barea (1991) and can produce 5000 1 of soil inocula from a 25 m 2 plot. Gaur and 
Adholeya (2002) reported production of five fodder crops (Zea mays, Medicago 
sativa, Trifolium alexandrinum, Avena sativa. Sorghum vulgare) in marginal soil 
along with producing a high number of indigenous AM propagules. 

Procedure for On-Farm Inoculum Production of AM 

Large-scale production of AM fungi begins with a starter culture. The starter 
culture can be procured either by isolating or by ordering it from various labo- 
ratories that maintain pure cultures of specific interest. 

Soil in nursery beds should be sterilized either with methyl bromide or formalin 
by drenching it up to at least 45 cm depth with either of the solutions. After treat- 

25. Research Methods in Arbuscular Mycorrhizal Fungi 387 

ing with chemicals the soil should be covered for 3 days and then kept open for at 
least 8 days before commencing any operation. Sunlight for sterilization involves 
covering the soil with transparent polythene sheets for a minimum of 20 days. 

1. Preparation of nursery bed: 

The nursery soil should be raised up to 30 cm. Making surrounding furrows 
of a similar depth can do this. Soil should be thoroughly mixed and prefer- 
ably sieved. If the soil is compact, sand may be mixed for good mycorrhizal 
development, in a ratio of 2:1. 

2. Sowing and inoculation: 

Furrows of 6 cm depth are made in the nursery beds and AM propagules, 
mixed with any suitable carrier, are placed in the furrows. The inoculum 
should contain at least 30-40 spores per gram of substrate. The inoculum 
should be covered with a thin layer of soil on which host seeds (preferably 
monocots) should be sown. 

3. Maintenance and monitoring: 

The beds should be watered when required and should be kept free from 
weeds. After 3 months, the extent of colonization and spore production could 
be assessed. 

Traditional Culture Methods 

The most frequently used technique for increasing propagule number is the 
propagation of AM fungi on a suitable host in disinfested soil using pot cul- 
tures. Examples of the plants that have been used successfully include alfalfa, 
maize, onion and sudan grass. Hosts can be propagated from seeds that may be 
disinfested with sodium hypochloride or hydrogen peroxide. Hepper (1984) 
reviewed procedures for disinfestations and for germinating spores. All the 
components of the culture system are disinfected before the initiation of pot 
culture. The most commonly used method is heat pasteurization, where large 
batches of soil may be treated by heating to 85 °C for two 8-h periods with 
48 h between treatments in a commercial soil pasteurizer. Conducive envi- 
ronmental conditions for culturing AM fungi are a balance of light intensity, 
adequate moisture and moderate temperature without detrimental addition of 
fertilizers or pesticides (Jarstfer and Sylvia 1992). Good light quality and high 
photosynthetic flux density are necessary for high root colonization and spore 
production (Whitbeck 2001). Soil moisture affects AM fungal development di- 
rectly or indirectly (Al-Karaki et al. 1998). Amendments with fertilizers and 
chemicals can have both beneficial and detrimental effects on the development 
of colonized root systems and sporulation. Responses to P and N fertilization 
may be strain-dependent (Douds and Schenck 1990) and are affected by rela- 
tive amounts of N and P. 

A. Gaur 

To initiate pot cultures, a layer of inoculum is placed 1-2 cm below the seed 
or cuttings. Initial isolates are obtained by trapping the infested soil collected 
from the field. However, these mixed cultures should rapidly be processed for 
purification and single-species cultures initiated. Detailed methods for pot cul- 
turing and extensive discussion on these methods are provided by Jarstfer and 
Sylvia (1992). Cultures reaching a high propagule density (10 spores/g) after a 
number of multiplication cycles can be stored using suitable methods (Staddon 
and Fitter 2001) after air-drying. Furthermore, AM fungi have been cultured 
with plant host in different substrates such as sand, peat, expanded clay, perlite, 
vermiculite, soilrite (Mallesha et al. 1992), rockwool (Heinzemann and Weritz 
1990) and glass beads (Redecker et al. 1995). 

1. Rhizosphere soil is collected, with shoots of trap plant cut at the crown, and 
roots are finely chopped and mixed with the soils using a sharp chopper. 

2. The chopped roots and soil are mixed 1:1 (v/v) with autoclaved coarse sand 
in a mechanical mixer, or massaged well in a durable plastic bag. 

3. The soil mix is then transferred to a 15 -cm plastic pot. 

4. Seeds of suitable trap plant are planted in the pot. 

5. The pot cultures are maintained in a greenhouse for at least 3 months and 
sporulation is checked from time to time. Sanitary tests may also be carried 
out to ensure no contamination from parasitic fungi occurs. 

6. Fertilizer application is kept to a minimum, to encourage AMF proliferation. 

7. Trap culture pots are later left to dry under shade for up to 2 weeks. 

8. The spores are harvested using the sieving and decanting technique or the 
density-gradient centrifugation technique. 

9. The monospecific spores are now ready for inoculation onto seedlings of the 
desired crops. 

AM Fungal Culture Using Aeroponic and Hydroponic Culture 

The major benefit of aeroponic and hydroponic culture systems is that colo- 
nized roots and spores are produced free of any substrate, permitting more 
efficient production and distribution of inocula. Here, plants are inoculated 
with AM fungi and grown in sand or vermiculite for 4-5 weeks under condi- 
tions conducive for rapid colonization, after which they are washed and non- 
destructively checked for colonization and then they are transferred into the 

25. Research Methods in Arbuscular Mycorrhizal Fungi 389 

In aeroponics, the plants root system is exposed constantly to an aerated 
mist of dilute nutrient solution. Unlike soil culture, hydroponics or other tra- 
ditional growth cultures, aeroponics shows good root hair development due to 
the highly aerated environment surrounding the root system. Aeroponic culture 
allows control of root zone temperature, nutrition, moisture and gaseous phase. 
An aeroponic system for the production of AM fungi was first used by Sylvia 
and Hubbell (1986). Mohammad et al. (2000) reported the production of Glo- 
mus intraradices in an aeroponic system where they compared the conventional 
atomizing disc with the ultrasonic nebulizer technology as misting sources. 
Laurent et al. (1999) used this culture method to produce Acacia mangium sap- 
lings associated with AM fungi. 

The hydroponics or nutrient film technique was adapted for AM fungus in- 
oculum production by Mosse and Thompson (1984). Culture host plants are 
placed on an inclined tray over which flows a layer of nutrient solution. As in the 
aeroponic culture, seedlings must be precolonized in another media. Dugassa 
et al. (1995) presented a hydroponic system for culturing and maintaining the 
vesicular- arbuscular mycorrhizal fungus. 

Monoaxenic Culture of AM Fungi 

Recently, Ri T-DNA-transformed roots were used to obtain colonized root cul- 
tures. Becard and Fortin (1988) presented a detail evaluation of the root organ 
culture technique and reported basic improvements necessary for AM fungus 
colonization of roots. Cultures are initiated by transfer of pregerminated, sur- 
face-sterilized spores or surface-sterilized, colonized root pieces into Petri plates 
of minimal media (Becard and Fortin 1988) or modified Strullu-Romand me- 
dium (Declerck et al. 1996). 

The establishment of in vitro root-organ cultures has greatly influenced our 
understanding of the AM symbiosis. Root-organ cultures were first developed 
by White and co-workers (White 1943; Butcher and Street 1964; Butcher 1980). 
These authors used excised roots on synthetic mineral media supplemented 
with vitamins and a carbohydrate source. Pioneering work by Mosse and Hep- 
per (1975) used root cultures obtained from Lycopersicum esculentum Mill, 
(tomato) and Trifolium pratense L. (red clover) to establish in vitro mycorrhiza 
with Glomus mosseae Nicolson & Gerd. The authors demonstrated for the first 
time that spores of an AM fungus could be successfully used to colonize excised 
roots growing on a mineral-based medium. Later, Strullu and Romand (1986, 
1987) showed that it was also possible to re-establish mycorrhiza on excised 
roots of Fragaria x Ananassa Duchesne (strawberry), Allium cepa L. (onion) 
and tomato, using the intraradical phase (i.e., vesicles or entire mycorrhizal root 
pieces) of several species of Glomus as inoculum. A natural genetic transforma- 
tion of plants by the ubiquitous soil bacterium Agrobacterium rhizogenes Conn. 

A. Gaur 

(Riker et al. 1930) produces a condition known as hairy roots. This stable trans- 
formation (Tepfer 1989) produces Ri T-DNA transformed plant tissues that are 
morphogenetically programmed to develop as roots. Their modified hormonal 
balance makes them particularly vigorous and allows profuse growth on arti- 
ficial media (Tepfer 1989). The first in vitro sporulation of an AM fungus was 
obtained by Becard and Fortin (1988) using carrot hairy roots colonized by 
Glomus intraradices Schenck & Smith. Plenchette et al. (1996) reported Glomus 
versiforme associated in vitro with Ri T-DNA transformed carrot root and after 
4 months of cultivation, numerous axenic AM propagules were obtained. 

Storage of AM Fungal Inoculum 

Spore of AM fungi are generally stored at 4 °C in dried po-culture soil (Fergu- 
son et al. 1982). Cryopreservation of spores at -60 °C to -70 °C has also been re- 
ported (Douds and Schenck 1990). Cultures of AM fungi should be dried slowly 
with the host plant and frozen in situ. 

AM fungi, the most widespread symbionts on earth, are receiving attention be- 
cause of the increasing range of their application in sustainable agriculture and 
ecosystem management. Since AM fungi are obligate symbionts, most studies 
have been conducted on a host plant grown in a sterilized medium using pot 
culture methods. Procedures such as single-spore culture isolates of AM fungi 
have been a valuable resource, not only for plant growth experiments, but also 
for taxonomic and biochemical studies. Several techniques for establishing sin- 
gle-spore isolate have used germinated and ungerminated spores. The current 
chapter has covered basic techniques in AM fungal research such as the isola- 
tion of AM fungal spores from soil, their identification, the establishment of pot 
cultures in the greenhouse, methods for isolating extra-radical mycelium from 
soil, vital staining of mycorrhizal roots and methods for AM fungal inoculum 
production. New approaches to the study of the biology of AM fungi have also 
been developed, involving growing these fungi in Ri T-DNA transformed root 
cultures in which some AM fungus species develop profusely and form viable 

25. Research Methods in Arbuscular Mycorrhizal Fungi 391 

Abdel-Fattah Gamal M (2001) Measurement of the viability of arbuscular- mycorrhizal fungi 
using three different stains; relation to growth and metabolic activities of soybean plants. 
Microbiol Res 156:359-367 

Alexander M (1982) Most probable number method for microbial populations. In: Page AL, 
Miller RH, Keene DR (eds) Methods of soil analysis. Part 2. Chemical and microbiologi- 
cal properties. Soil Science Society of America, Madison, pp 815-820 

Al-Karaki GN, Al-Raddad A, Clark RB (1998) Water stress and mycorrhizal isolate effects on 
growth and nutrient acquisition of wheat. J Plant Nutr 21:891-902 

Allen MF, Allen EB, Friese CF (1989) Responses of the nonmycotrophic plant Salsola kali to 
invasion by vesicular ± arbuscular mycorrhizal fungi. New Phytol 1 1 1:45-49 

Ames RN, Ingham ER, Reid CPP (1982) Ultraviolet-induced autofluorescence of arbuscular 
mycorrhizal root infections: an alternative to cleaning and staining methods for assess- 
ing infections. Can J Microbiol 28:351-355 

Azcon R, Ocampo JA (1981) Factors affecting the vesicular- arbuscular infection and mycor- 
rhizal dependency of thirteen wheat cultivars. New Phytol 87:677-685 

Bago B, Azcon- Aguilar C, Goulet A, Piche Y (1998a) Branched absorbing structures (BAS): 
a feature of the extraradical mycelium of symbiotic arbuscular mycorrhizal fungi. New 
Phytol 139:375-338 

Bago B, Azcon- Aguilar C, Piche Y (1998b) Architecture and developmental dynamics of the 
external mycelium of the arbuscular mycorrhizal fungus Glomus intraradices grown un- 
dermonoxenic conditions. Mycologia 90:52-62 

Balaz M, Vosatka M (2001) A novel inserted membrane technique for studies of mycorrhizal 
extraradical mycelium. Mycorrhiza 11:291-296 

Baylis GTS (1969) Host treatment and spore production by endogone. NZ J Bot 7:173-174 

Becard G, Fortin JA (1988) Early events of vesicular- arbuscular mycorrhiza formation on Ri 
T-DNA transformed roots. New Phytol 108:211-218 

Bi YL, Li XL, Christie P, Hu ZQ, Wong MH (2003) Growth and nutrient uptake of arbuscu- 
lar mycorrhizal maize in different depths of soil overlying coal fly ash. Chemosphere 

Biermann B, Linderman RG (1981) Quantifiying vesicular arbuscular mycorrhizae: a pro- 
posed method towards standardization. New Phytol 87:63-67 

Boddington CL, Bassett EE, Jakobsen I, Dodd JC (1999) Comparison of techniques for ex- 
traction and quantification of extraradical mycelium of arbuscular mycorrhizal fungi in 
soils. Soil Biol Biochem 31:479-482 

Borowicz VA (1997) A fungal root symbiont modifies plant resistance to an insect herbivore. 
Oecologia 112, 534-542 

Bowen GD (1984) Future directions in plantation nutrition research. In: Bowen GD, Nambiar 
EKS (eds) Nutrition of plantation forest. Academic, London, pp 489-505 

Brundrett MC, Juniper S (1995) Non- destructive assessment of germination and single-spore 
isolation of VAM fungi and production of pot cultures from single spores. Soil Biol Bio- 
chem 27:85-91 

Brundrett MC, Bougher N, Dell B, Grove T, Malajczuk N (1996) Working with mycorrhizas 
in forestry and agriculture. (ACIAR monograph 32) ACIAR, Canberra 

Brundrett MC, Piche Y, Peterson RL (1984) A new method for observing the morphology of 
vesicular- arbuscular mycorrhizae. Can J Bot 62:2128-2134 

Brundrett MC (1991) Mycorrhizas in natural ecosystems. In: Macfayden A, Begon M, Fitter 
AH (eds) Advances in ecological research, vol 26. Academic, London, pp 171-313 

Butcher DN (1980) The culture of isolated roots. In: Ingram DS, Helgelson JP (eds) Tissue 
culture methods for plant pathologists. Blackwell Scientific, Oxford, pp 13-17 

A. Gaur 

Butcher DN, Street HE (1964) Excised root culture. Bot Rev 30:513-586 

Calvet C, Pera J, Barea MJ (1993) Growth response of marigold (Tagetes erecta L.) to inocula- 
tion with Glomus mosseae, Trichoderma aureoviride and Pythium ultimum in a peat-per- 
lite mixture. Plant Soil 148:1-6 

Clarke CA, Mosse B (1978) Recovery of VA mycorrhizal spores after germination. Rotham- 
sted Exp Stn Rep 1978:239 

Coombes RD, Haveland- Smith RB (1982) A review of the genotoxicity of food, drug and cos- 
metic colours and other azo, triphenylmethane and xanthene dyes. Mut Res 98:101-248 

Cunningham JL (1972) A miracle mounting fluid for permanent whole-mounts of micro- 
fungi. Mycologia 64:906-911 

Daniels BA, Graham SO (1976) Effects of nutrition and soil extracts on germination of Glo- 
mus mosseue spores. Mycologia 68:108-116 

Declerck S, Strullu DG, Plenchette C (1996) In vitro mass production of the arbuscular my- 
corrhizal fungus, Glomus versiforme, associated with Ri T-DNA transformed carrot 
roots. Mycol Res 100:1237-1242 

Dodd JC (1994) Approaches to the study of extraradical mycelium of arbuscular mycorrhizal 
fungi. In: Gianinazzi S, Schiiepp H (eds) Impact of arbuscular mycorrhizas on sustain- 
able agriculture and natural ecosystems. Birkhauser, Basel, pp 147-166 

Doncaster CC (1962) A counting dish for nematodes. Nematologica 7:334-337 

Douds DD, Schenck NC (1990) Crypreservation of spores of vesicular- arbuscular mycor- 
rhizal fungi. New Phytol 115:667-674 

Douds DD Jr, Nagahashi G, Pfeffer PE, Reider C, Kayser W (2006) On-farm production 
of AM fungus inoculum in mixtures of compost and vermiculite. Bioresour Technol 

Douds DD, Schenck NC (1990) Increased sporulation of vesicular- arbuscular mycorrhizal 
fungi by manipulation of nutrient regimes. Appl Environ Microbiol 56:413-418 

Douds DD Jr (2002) Increased spore production by Glomus intraradices in the split-plate 
monoxenic culture system by repeated harvest, gel replacement, and resupply of glucose 
to the mycorrhiza. Mycorrhiza 12:163-167 

Douds DD, Nagahashi G, Pfeffer PE, Kayser WM, Reider C (2005a) On-farm production and 
utilization of mycorrhizal fungus inoculum. Can J Plant Sci 85:15-21 

Douds DD, Nagahashi G, Pfeffer PE, Kayser WM, Reider C (2005b) On-farm production 
of AM fungus inoculum in compost- vermiculite mixtures. Appl Environ Microbiol 

Dugassa DG, Grunewaldt-Stocker G, Schonbeck F (1995) Growth of Glomus intraradices 
and its effect on linseed (Linum usitatissimum L.) in hydroponic culture. Mycorrhiza 

Enkhtuya B, Rydlova J, Vosatka M (2002) Effectiveness of indigenous and non-indigenous 
isolates of arbuscular mycorrhizal fungi in soils from degraded ecosystems and man- 
made habitats. Appl Soil Ecol 14:201-211 

Ferguson JJ, Menge JA (1982) The influence of light intensity and artificially extended photo- 
period upon infection and sporulation of Glomus fas ciculatus on sudangrass and on root 
exudation of sudan grass. New Phytol 92:183-191 

Ferguson JJ, Woodhead SH, Ross JP, Daniels BA (1982) Production of endomycorrhizal inoc- 
ulum. In: Schenck NC (ed) Methods and principles of mycorrhizal research. American 
Phytopathology Society, St. Paul, pp 47-59 

Filion M, St-Arnaud M, Fortin JA (1999) Direct interaction between the arbuscular mycor- 
rhizal fungus Glomus intraradices and different rhizosphere microorganisms. New Phy- 
tol 141:525-533 

Fisher RA, Yates F (1963) Statistical tables for biological, agricultural and medical research. 
Oliver and Boyd, Edinburgh 

25. Research Methods in Arbuscular Mycorrhizal Fungi 393 

Fortin JA, Guillaume B, Declerck S, Dalpe Y, St-Arnaud M, Coughlan AP, Piche Y (2002) 

Arbuscular mycorrhiza on root-organ cultures. Can J Bot 80:1-20 
Furlan V, Fortin JA (1973) Formation of endomycorrhizae by endogone calospora on Allium 

cepa under three temperature regimes. Nat Can 100:467-447 
Fusconi A, Gnavi E, Trotta A, Berta G (1999) Apical meristems of tomato roots and their 

modifications induced by arbuscular mycorrhizal and soilborne pathogenic fungi. New 

Phytol 142:505-516 
Gardner RO (1975) An overview of botanical clearing technique. Stain Technol 50:99-105 
Gaur A, Adholeya A, Mukerji KG (1998) A comparison of AM fungi inoculants using 

Capsicum and Polianthes in marginal soil amended with organic matter. Mycorrhiza 

Gaur A, Adholeya A (1994) Estimation of VAM spores in soil: a modified method. Mycor- 
rhiza News 6:10-11 
Gaur A, Adholeya A (2000) Effects of the particle size of soil-less substrates upon AM fungus 

inoculum production. Mycorrhiza 10:43-48 
Gaur A, Adholeya A (2002) Arbuscular- mycorrhizal inoculation of five tropical fodder crops 

and inoculum production in marginal soil amended with organic matter. Biol Fertil Soil 

Gehring CA, Whitham TG (1991) Herbivore -driven mycorrhizal mutualism in insect-suscet- 

ible pinyon pine. Nature 353:556-557 
Gerdemann JW, Nicolson TH (1963) Spores of mycorrhizal endogone extracted from soil by 

wet seiving and decanting. Trans Br Mycol Soc 46:235-244 
Giovannetti M, Mosse B (1980) An evaluation of techniques for measuring vesicular- arbus- 
cular mycorrhizal infection in roots. New Phytol 84:489-500 
Grace C, Stribley DP (1991) A safer procedure for routine staining of vesicular arbuscular 

mycorrhizal fungi. Mycol Res 95:1160-1162 
Hall IR (1977) Species and mycorrhizal infections of New Zealand Endogonaceae. Trans Br 

Mycol Soc 68:341-356 
Hanssen JF, Thingstad TF, Gohson J (1974) Evaluation of hyphal lengths and fungal biomass 

in soil by a membrane filter method. Oikos 25:102-107 
Harley JL, Smith SE (1983) Mycorrhizal symbiosis. Academic, London, pp 284 
Heinzemann J, Weritz J (1990) Rockwool: a new carrier system for mass multiplication of 

vesicular- arbuscular mycorrhizal fungi. Angew Bot 64:271-274 
Hepper CM (1984) Isolation and culture of VA mycorrhizal (VAM) fungi. In: Powell CL, 

Bagyaraj DJ (eds) VA mycorrhiza. CRC Press, Boca Raton, pp 95-112 
Jabaji-Hare S, Perumalla CJ, Kendrick WB (1984) Auto fluorescence of vesicles, arbuscules, 

and intercellular hyphae of a vesicular arbuscular fungus in leek (Allium porrum) roots. 

Can J Bot 62:2665-2669 
Janos DP (1980) Mycorrhizae influence tropical succession. Trop Succ 12:56-64 
Jarstfer AG, Sylvia DM (1992) Inoculum production and inoculation strategies for vesicu- 
lar- arbuscular mycorrhizal fungi. In: Meting B (ed) Soil microbial ecology; application 

in agriculture and environmental management. Dekker, New York, pp 349-377 
Jarstfer AG, Sylvia DM (1995) Aeroponic culture of VAM fungi. In: Varma A, Hock B (eds) 

Mycorrhiza structure, function, molecular biology and biotechnology. Springer, Berlin 

Heidelberg New York, pp 521-559 
Jeffries P, Barea JM (1994) Biogeochemical cycling and arbuscular mycorrhizas in the sus- 

tainability of plant soil systems. In: Gianinazzi S, Schuepp H (eds) Impact of arbuscular 

mycorrhizas on sustainable agriculture and natural ecosystems. Birkhauser, Basel, pp 

Khalil S, Loynachan TE, Tabatabai MA (1994) Mycorrhizal dependency and nutrient uptake 

by improved and unimproved corn and soybean cultivars. Agron J 86:949-958 

A. Gaur 

Khan AG (2001) Relationships between chromium biomagnification ratio, accumulation fac- 
tor, and mycorrhizae in plants growing on tannery effluent-polluted soil. Environ Int 

Koide R, Li M, Lewis J, Irby C (1988) Role of mycorrhizal infection in the growth and repro- 
duction of wild vs cultivated plants. I. Wild vs cultivated oats. Oecologia 77:537-543 

Kormanik PP, McGraw AC (1982) Quantification of vesiculartarbuscular mycorrhizae in 
plant roots. In: Schenk NC (ed) Methods and principles of mycorrhizal research. Ameri- 
can Phytopathology Society, St Paul, pp 37-45 

Koske RE, Testier B (1983) A convenient permanent slide mounting medium. Mycol Soc Am 
Newsl 34:59 

Koske RE, Gemma JN (1989) A modified procedure for staining roots to detect VA mycor- 
rhizas. Mycol Res 92:486-505 

Laurent FM, Leea S, Tham FY, Jie H, Diem HG (1999) Aeroponic production of Acacia man- 
gium saplings inoculated with AM fungi for reforestation in the tropics. For Ecol Manag 

Madan RC, Pankhurst BH, Smith H (2002) Use of fatty acids for identification of AM fungi 
and estimation of the biomass of AM spores in soil. Soil Biol Biochem 34:125-128 

Mallesha BC, Bagyaraj DJ, Pai G (1992) Perlite-soilrite mix as a carrier for mycorrhiza and 
rhizobia to inoculate Leucaena leucocephala. Leucaena Res Rep 13:32-33 

Manjunath A, Habte M (1991) Root morphological characteristics of host species having dis- 
tinct mycorrhizal dependency. Can J Bot 69:671-676 

Mathur N, Vyas A (2000) Influence of arbuscular mycorrhizae on biomass production, nutri- 
ent uptake and physiological changes in Ziziphus mauritana Lam. under water stress. J 
Arid Environ 45:191-195 

McGonigle TP, Miller MH, Evans DG, Fairchild GL, Swan JA (1990) A new method which 
gives an objective measure of colonization of roots by vesicular- arbuscular mycorrhizal 
fungi. New Phytol 115:495-501 

Menge JA, Steirle D, Bagyaraj DJ, Johnson ELV, Leonard RT (1978) Phosphorus concentrations 
in plants responsible for inhibition of mycorrhizal infection. New Phytol 80:575-578 

Merryweather JW, Fitter AH (1991) A modified method for elucidating the structure of the 
fungal partner in a vesicular arbuscular mycorrhiza. Mycol Res 95:1435-1437 

Merryweather J, Fitter A (1996) Phosphorus nutrition of an obligately mycorrhizal plant 
treated with the fungicide benomyl in the field. New Phytology 132:307-311 

Mohammad A, Khan AG, Kuek C (2000) Improved aeroponic culture of inocula of arbuscu- 
lar mycorrhizal fungi. Mycorrhiza 9:337-339 

Morton JB (1991) INVAM newsletters, vol 1-5. West Virginia University, Morgantown 

Morton JB, Redecker D (2001) Two new families of Glomales, Archaeosporaceae et Para- 
glomaceae, with two new genera, Archaeospora and Paraglomus, based on concordant 
molecular and morphological caracters. Mycologia 93:181-195 

Mosse B, Thompson JP (1984) Vesicular- arbuscular endomycorrhizal inoculum production. 
I. Exploratory experiments with beans (Phaseolus vulgaris) in nutrient flow culture. Can 
J Bot 62:1523-1530 

Mosse B, Hepper CM (1975) Vesicular- arbuscular infections in root-organ cultures. Physiol 
Plant Pathol 5:215-223 

Olsson PA, Baath E, Jakobsen I, Sdderstrdm B (1995) The use of phospholipids and neutral 
lipid fatty acids to estimate biomass of arbuscular mycorrhizal fungi in soil. Mycol Res 

Phillips JM, Hayman DS (1970) Improved procedures for clearing roots and staining parasitic 
and vesicular- arbuscular mycorrhizal fungi for rapid assessment of infection. Trans Br 
Mycol Soc 55:158-161 

25. Research Methods in Arbuscular Mycorrhizal Fungi 395 

Plenchette C, Declerck C, Diop TA, Strullu DG (1996) Infectivity of monoaxenic subcultures 
of the arbuscular mycorrhizal fungus Glomus versiforme associated with Ri-T-DNA- 
transformed carrot root. Appl Microbiol Biotechnol 46:545-548 

Plenchette C, Fortin JA, Furlan V (1983) Growth responses of several plant species to mycor- 
rhizae in a soil of moderate P- fertility. Part I. Mycorrhizal dependency under field condi- 
tions. Plant Soil 70:199-209 

Porter WM (1979) The most probable number method for enumerating infective propagules 
of vesicular arbuscular mycorrhizal fungi in soil. Aust J Soil Res 17:515-519 

Redecker D, Morton JB, Bruns TD (2000) Ancestral lineages of arbuscular mycorrhizal fungi 
(Glomales). Mol Phyl Evol 14:276-284 

Redecker D, Thierfelder H, Werner D (1995) A new cultivation system for arbuscular mycor- 
rhizal fungi on glass beads. Angew Bot 69:189-191 

Riker AJ, Banfield WM, Wright WH, Keitt GW, Sagen HE (1930) Studies on infectious hairy 
root of nursery apple trees. J Agric Res 41:507-540 

SchafTer GF, Peterson R (1993) Modifications to clearing methods used in combination with 
vital staining of roots colonized with vesicular- arbuscular mycorrhizal fungi. Mycor- 
rhiza 4:29-35 

Schenck NC, Perez Y (1990) Manual for the identification of VA mycorrhizal fungi. Syner- 
gistic, Gainesville 

Schubert A, Marzachi C, Mazziteli M, Cravero MC, Bonfante- Fasolo P (1987) Development 
of total and viable extraradical mycelium in the vesicular- arbuscular mycorrhizal fun- 
gus Glomus clarum Nicol. & Schenck. New Phytol 107:183-190 

Schussler A, Schwarzott D, Walker C (2001) A new fungal phylum, the Glomeromycota: phy- 
logeny and evolution. Mycol Res 105:1413-1421 

Sieverding E, Barea JM (1991) Perspectives de la inoculation de sistemas de production veg- 
etal con hongos formadores de micorrizas VA. In: Olivares J, Barea JM (eds) Fijacion y 
movilizacion biologica de nutrients. (Coleccion nuevas tendencias, vol II) CSIC, Ma- 
drid, pp 221-245 

Smith GW, Skipper HD (1979) Comparison of method to extract spores of vesicular arbuscu- 
lar mycorrhizal fungi. Soil Sci Soc Am J 43:722-725 

Smith SE, Barker SJ (2002) Plant phosphate transporter genes help harness the nutritional 
benefits of arbuscular mycorrhizal symbiosis. Trends Plant Sci 75:189-190 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis. Academic, London 

Sreenivasa MN, Bagyaraj DJ (1988) Selection of a suitable host for mass multiplication of 
Glomus fasciculatum. Plant Soil 106:289-290 

Staddon PL, Fitter AH (2001) The differential vitality of intraradical mycorrhizal structures 
and its implications. Soil Biol Biochem 33:129-132 

Strullu DG (1991) Les relations entre les plantes et les champignons. In: Strullu DG, Garbaye 
J, Perrin R, Plenchette C (eds) Les mycorhizes des arbres et plantes cultivees. Lavoisier, 
Paris, pp 9-49 

Strullu DG, Romand C (1986) Methode dbbtention d'endomycorhizes a vesicules et arbus- 
cules en conditions axeniques. CR Acad Sci Paris Sci Vie 303:245-250 

Strullu DG, Romand C (1987) Culture axenique de vesicules isolees a partir d'endomycorhizes 
et re-association in vitro a des racines de tomate. CR Acad Sci Paris Sci Vie 305:15-19 

Subramanian KS, Charest C, Dwyer LM, Hamilton RI (1997) Effects of arbuscular mycorrhi- 
zae on leaf water potencial, sugar content, and P content during drought and recovery of 
maize. Can J Bot 75:1582-1591 

Sylvia DM (1994) Vesicular- arbuscular mycorrhizal (VAM) fungi. In: SSSA (ed) Methods of 
soil analysis, part 2. Microbiological and biochemical properties. (SSSA book series, no 
5) Soil Science Society of America, Madison, pp 351-378 

A. Gaur 

Sylvia DM, Hubbell DH (1986) Growth and sporulation of vesicular- arbuscular mycorrhizal 
fungi in aeroponic and membrane systems. Symbiosis 1:259-267 

Tepfer D (1989) Ri T-DNA from Agrobacterium rhizogenes: a source of genes having appli- 
cations in rhizosphere biology and plant development, ecology and evolution. In: Ko- 
suge T, Nester EW (eds) Plant-microbe interactions, vol 3. McGraw-Hill, New York, pp 

Tisserant B, Gianinazzi- Pearson V, Gianinazzi S, Gollotte A (1993) In planta histochemical 
staining of fungal alkaline phosphatase activity for analysis of efficient arbuscular endo- 
mycorrhizal infections. Mycol Res 97:245-250 

Vierheilig H, Coughlan AP, Wyss U, Piche P (1998) Ink and vinegar, a simple staining tech- 
nique for arbuscular-mycorrhizal fungi. Appl Environ Microbiol 6:5004-5007 

Vilarino A, Arines J, Schiiepp H (1993) Extraction of vesicular- arbuscular mycorrhizal my- 
celium from sand samples. Soil Biol Biochem 25:99-100 

Vivas A, Marulanda M, Mez G, Barea JM, Azcon R (2003) Physiological characteristics 
(SDH and ALP activities) of arbuscular mycorrhizal colonization as affected by Bacillus 
thuringiensis inoculation under two phosphorus levels. Soil Biol Biochem 35:987-996 

Whitbeck JL (2001) Effects of light environment on vesicular- arbuscular mycorrhiza devel- 
opment in Inga leiocalycina, a tropical wet forest tree. Biotropica 33:303-311 

White PR (1943) A handbook of plant tissue culture. Cattel, Lancaster 

Field Trials of Bioinoculants 

I. Orta§ and A. Varma 

The most widespread symbiotic association between micro-organisms and 
higher plants are arbuscular mycorrhizae (AM), which are present in a range of 
horticultural, agricultural and forestry plants. The term mycorrhiza, which liter- 
ally means fungus-root (myco, fungus; rhiza, root), was first applied to fungus- 
tree associations described in 1885 by the German forest pathologist A.B. Frank. 
Mycorrhiza is a mutalistic symbiosis (non-pathogenic association) between 
soil-borne fungi and the roots of high plants. The symbiosis between fungi and 
plant root is a bi-directional movement of nutrients where carbon flows to the 
fungus and inorganic nutrients move to the plant, thereby providing a critical 
linkage between the plant root and soil in the rhizosphere. Mycorrhizal fungi 
usually proliferate both in the root and in the soil. In natural ecosystems, in nu- 
trient-poor or moisture-deficient soils, nutrients taken up by the extrametrical 
hyphae can lead to improved plant growth and reproduction. Since mycorrhiza- 
inoculated plants take more nutrients, they are more competitive and better able 
to tolerate environmental stresses than non -mycorrhizal plants. It has been esti- 
mated that 90% of all plant species belong to genera that characteristically form 
mycorrhizae (Smith and Read 1997). Mycorrhizal infection occurs in 83% of 
dicotyledonous and 79% of monocotyledonous plants (Peterson et al. 2004). 

A mycorrhizal root system seems able to selectively absorb phosphorus (P) 
from deficient soils (Fig. 26.1). In all these kinds of mycorrhiza, it is usual to 
find hyphal connections from the infected root into the soil. The hyphae may 
extend considerable distances (centimeters). The role of hyphae in mycorrhizal 

Ibrahim Ortas: University of (Jukurova, Faculty of Agriculture, Department of Soil Science, 
01330 Balcali, Adana, Turkey 

Ajit Varma: Amity Institute of Microbial Sciences, Amity University Uttar Pradesh, Sector 
125, Expressway, Noida 201303, UP, India, email: 

Soil Biology, Volume 1 1 

Advanced Techniques in Soil Microbiology 

A. Varma, R. Oelmiiller (Eds.) 

© Springer- Verlag Berlin Heidelberg 2007 

I. Orta§ and A. Varma 

Fig. 26.1 The role of 
mycorrhizal hyphae on 
nutrient depletion zone 
(Peterson et al. 2004) 

infection and nutrient uptake has not been studied intensively because a con- 
venient technique was not developed until recently. It has been estimated that 
the amount of external hyphae is 80 cm/cm root length in onions (Sanders and 
Tinker 1973). However it is not easy to measure the amount of external hyphae 
formed in soil by mycorrhizal fungi. 

Effect of Mycorrhizal Infection on Nutrient Uptake 

AM infection can increase plant growth and nutrient uptake, especially an in- 
crease in P uptake by the host. The contribution of mycorrhizae is considered to 
be a function of an increase in P uptake due to mycorrhizal infection. Plant roots 
infected with AM fungi are known to have a higher P absorption ability compared 
with non -mycorrhizal plants in P-deficient soils (Abbott and Robson 1982). 

Arbuscular mycorrhizal fungi (AMF) are generally known to benefit plant 
nutrient uptake such as P in soil of low fertility (Ortas 2003). Mycorrhizal inoc- 
ulation have a positive effect on maize plant P uptake, which was exhibited even 
when high level of P was applied; but high P fertilization reduced the degree of root 
colonization and also the quantity of external hyphae (Posta and Fuleky 1997). 

In arid and semi-arid areas such as Turkey there are limitations on the amount 
of water used for plant cultivation and most of the soils are low in nutrient con- 
tent, such as P, Zn and Fe, which are diffusion-limited in soils. Even if there were 
no deficiency of nutrient, there are several environmental stress factors such as 
temperature and, consequently, accumulation of salt in the soil due to evapora- 
tion. Thus there is a tendency to use the natural sources such as mycorrhizal 
fungi to reduce P fertilizer application and hence obtain better plant growth in 
nutrient-deficient soils. Also mycorrhizal inoculation reduces the quantity of P 

26. Field Trials of Bioinoculants 

fertilizer normally required (Charron et al. 2001). Soil chemical and biological 
factors strongly affect P management. It seems to be very important to manage 
P in soil, since it is an ecological necessity for the future of soil quality. 

For a given dry weight, mycorrhizal plants usually have higher P concentra- 
tions in their plant tissue than non -mycorrhizal plants (Stribley et al. 1980). How 
mycorrhizal plants obtain more P from soil than non -mycorrhizal plants is not 
yet fully understood. Several mechanisms have been proposed to define the AM 
effect on improving the absorption of available phosphate and these have been 
mentioned. Mycorrhizae may induce both quantitative and qualitative changes 
in plant P utilization (Smith and Read 1997). The amount of acid phosphatase 
present in AM hyphae (Tarafdar and Marschner 1994) and increased phospha- 
tase activity of root surfaces as a result of infection (Allen et al. 1981) may liber- 
ate inorganic P from organic P sources, making P available for uptake. Tinker 
(1975) suggested that the roots of mycorrhizal plants may alter the rhizosphere 
chemistry by changing soil pH and may produce exudates such as organic acids 
which may increase the availability of phosphorus by liberating phosphate ions 
in the soil. There is still a wide gap in the understanding of the mechanisms in- 
volved in increased P availability in the soil by mycorrhiza-infected roots. 

In addition to P, AM fungi enhance the acquisition of other nutrients, such 
as N and K, and immobile micro-nutrient cations, particularly Zn and Cu (Li 

Fries et al. (1998) tested the effect of different levels of P application on my- 
corrhizal formation and they found that under low P levels, a mycorrhiza-in- 
oculated plant accumulated a greater amount of shoot dry weight, root P con- 
centration and protein concentration than a non-inoculated plant. Medeiros et 
al. (1994) showed that mycorrhiza-inoculated plants had significantly higher 
uptake of P, K, Fe, and S than non-mycorrhizal plants. Plants colonized with 
AM fungi generally have greater growth and acquisition of mineral nutrients 
and often have a greater ability to withstand drought, compared with non-my- 
corrhizal plants (Al-Karaki and Clark 1998). 

Effect of Soil Fumigation and Mycorrhizal 
Inoculation on Plant Growth Under Field Conditions 

In the plain of Cukurova there is a serious problem with soil-borne disease such 
as plant parasitic nematodes, soil-borne plant pathogens, root-rot and some 
weed pests. Nearly 25% of yield reduction occurs from year to year. In order 
to prepare a safe seedbed and healthy yield, farmers are using a high amount 
of chemicals. Due to a combination of soil-borne pathogens, nematodes and 
weeds, soil fumigation with products such as methyl bromide (MeBr) has been 
essential for horticultural practice in this area. Since MeBr eliminates both de- 

I. Orta§ and A. Varma 

sirable organisms such as arbuscular mycorrhizal fungi (AMF) and undesirable 
soil organisms, the plant growth and nutrient uptake, especially P and Zn up- 
take, have significantly declined. 

Soil fumigation, as a partial soil sterilization, affects soil chemical properties 
in addition to the removal of viable mycorrhizal fungi and other micro-organ- 
isms. The fertility of sterilized soil may be different than non-sterile soil. Partial 
soil sterilization generally stimulates subsequent plant growth when compared 
with non-sterile soils (Ortas et al. 2004). The main aim of partial soil steriliza- 
tion in mycorrhizal studies is to eliminate indigenous mycorrhizal spores and 
pathogenic microbial activity in the soils, but this procedure often alters the 
chemical and biological properties of the soil. 

Soil fumigation may have a dual effect on plant growth, such as increased 
growth by elimination of soil-borne pathogens, or conversely, stunted growth 
by exacerbation of existing P deficiency. As a result of reduction of mycorrhizal 
colonization in low-P soils with soil fumigation, there is a Br accumulation in 
the soil and plant uptakes in Br are more than ten times greater than control 
plants (Haas et al. 1987). 

Since soil fumigation reduces useful organisms such as mycorrhizae, it is 
necessary to reinoculate mycorrhizae. Especially mycorrhiza-dependent plants 
need more mycorrhizal inoculation. It is very important to use mycorrhiza at 
least for horticulture plants which are transplanted to the soil as a seedling. It 
may be easy to produce mycorrhiza-inoculated seedlings. 

For these reasons, several field experiments were set up to investigate the in- 
teraction effect of MeBr, mycorrhizae and P fertilizer on plant yield, growth, 
nutrient uptake and mycorrhizal formation. The aim of the research is to inves- 
tigate the effect of MeBr, mycorrhizae and P fertilizer interaction on plant yield, 
growth, nutrient uptake and mycorrhizal formation. The overall results revealed 
that yields were lower in sterile (fumigated) plots than in the non-sterile (non- 
fumigated) ones. Conversely, MeBr application reduced yield compared with 
the non-fumigated one whether or not the plants were inoculated. As can be 
seen in Fig. 26.2, under field conditions, the yield of onion plants grown in the 
MeBr-treated plot was reduced. But mycorrhizal inoculation compensated the 
yield reduction, compared with the non-inoculated plots. 

In this experiment rhizosphere soil was also used as a mycorrhizal source; 
and it was found that, under field conditions, indigenous mycorrhizal inocula- 
tion increased the onion yield in sterile plots. The interpretations of the results 
show that mycorhizal inoculation may have had some other benefits to the plant, 
such as protecting it against soil-borne pathogens and environmental stress. 

The impact of mycorrhizal fungi is usually assessed by measuring plant 
growth and P uptake following inoculation of the fungi into sterilized soils 
(Hetrick et al. 1986). However, growth responses are erratic and sometimes oc- 
cur when AMF are added to non-sterile soil (Ortas et al. 1996). In some cases, 
the root colonization is less in non-sterile soil than in sterilized soil. 

Farmers use MeBr before horticultural crops are planted, for the elimination 
of undesirable soil organisms. At the same time, they kill off all organisms. Since 
the organisms have a long-term effect on sustainability and quality of soil, it is 

26. Field Trials of Bioinoculants 

40000 i 

35000 - 

^30000 - 

~25000 H 

}20000 H 

1 1 5000 J 

10000 - 

5000 - 

□ Sterile 

Non Sterile 

C D E 

A: -P - D - M B: -P -D +M C: -P +D -M D: -P +D +M 

E:+P-D-M F:+P-D+M G: +P +D -M H:+P+D+M 

P: phosphorus D: indigenous mycorrizae -M: no-mycorrhizae +M :Mycorrhiza 

Fig. 26.2 Effect of MeBr on onion yield under field conditions with and without indigenous and 
selected mycorrhizae 

sound to use alternative fumigant sources rather than MeBr. For example, using 
organic sources and mycorrhiza and their combination are alternative sources. 

Ortas et al. (2003) showed that AMF was very active in plants grown on non- 
fumigated soil and that AMF activity increased plant growth and nutrient up- 
take. In non-fumigated plots it seemed still that AMF were active since there 
was a high mycorrhizal infection. 

Ortas et al. (2003) showed that mycorrhizal inoculation increased plant yield 
significantly compared with non-inoculated plants. When zero P was applied, the 
effect of mycorrhizal inoculation on plant yield was higher than yield increased 
with additional P application. When zero P was applied, mycorrhizal inoculation 
increased tomato yield up to 52%, eggplants up to 28% and pepper up to 36%, 
but with P addition, mycorrhizal inoculation increased yield up to 28%, 14% and 
21%, respectively, compared with non-inoculated plants (Fig. 26.3). Mycorrhi- 
zal inoculation also increased plant zinc and copper uptake (Ortas et al. 2003). 

In fumigated plots P and Zn content reduced dramatically, which was related 
to a reduction in AMF colonization (Ortas et al. 2003). Mycorrhizal inoculation 
increased the root Mn concentration but not the shoot Mn concentration. 

It seems that plant yield supplied by mycorrhizal inoculation cannot be ex- 
plained only by the effect of mycorrhizal inoculation on nutrient uptake. 01- 
sen et al. (1999) found that mycorrhizal inoculation increased the pepper and 
tomato growth and they claimed that the growth response of vegetable crops 
grown within the greenhouse from colonization by an established mycorrhizal 

I. Ortas and A. Varma 

5000 t 
ff 4000 +- 

r 3000 4- 

a- 2000 4- 

£ 1000 - - 

Fig. 26.3 The effect 
of Me Br and mycor- 
rhizal inoculation on 
eggplant, tomato and 
pepper yields under 
field conditions 

6000 -r 

PI -M 

P1 + M 

^ 10000 
;g 8000 

*5 4000 

mycelium appeared to depend on a critical balance of P and C supply. Since the 
soil P level was medium and the plant P content had not been affected by my- 
corrhizal inoculation, it meant the soil P level was enough for both mycorrhizal 
and non -mycorrhizal plants. In the same field the experiment was repeated with 
several mycorrhizal inoculum for three years and the conclusion was that the 
effect of mycorrhizal inoculation on plant growth under field condition depends 
on year, and mycorrhizal inoculum potential. 

It appears that there are some other benefits from mycorrhizae for horti- 
cultural plants, such as controlling disease and increasing plant resistance. We 
conclude that, although mycorrhizal inoculation increases some vegetable yield, 
this increase is not easily explained through a better nutrient uptake by AMF 
plants than by un-colonized plants. Mycorhizal inoculation may have some 

26. Field Trials of Bioinoculants 

other benefits to plants, such as protection against soil-borne pathogens and 
environmental stress. 

Most of these studies have been performed in the greenhouse under controlled 
conditions without the influence of complex interactions of other environmental 
variables. When bringing any mycorrhizal question to the field, one of the more 
difficult problems is the creation of a suitable non-mycorrhizal control, since a ma- 
jority of plants is normally mycorrhizal. Fungicides can be useful in distinguish- 
ing the mycorrhizal effects on plants in the field from certain other influences. 

Eggplant, tomato and pepper are among the most valuable vegetables grown 
for fresh-market production in Cukurova region, Adana-Turkey Due to a com- 
bination of soil-borne pathogens, nematodes and weeds, the use of soil fumiga- 
tion such as MeBr has been essential for horticultural practice in this area. 

Effect of Mycorrhizal Inoculation on Plant Growth 
and Nutrient Uptake under Non-Sterile Field Conditions 

Indigenous AM fungi have been found in most non-sterile soils and experimen- 
tally it has been shown that introduced mycorrhizal inoculum can infect the 
host plant under non-sterilized soil conditions (Abbott and Robson 1978). This 
treatment usually alters soil fertility as the result of an alteration of soil chemi- 
cal and biological properties (Ortas and Harris 1996). Although soil fumiga- 
tions stimulate plant growth through eliminating the soil-borne pathogens and 
weeds, fumigation usually stunts plant growth due to a reduction in the viable 
AM population in low-fertility soils (Ellis et al. 1995). 

At low-level P applications, sweet corn yield increased as a result of mycor- 
rhizal inoculation (Fig. 26.4). Additionally, mycorrhizal inoculation increased 

4000 « 

60 100 

Phosphate applied (kg P 2 Os ha soil ^ 

80 • 

£ 20- 

50 100 

Phosphate applied (kg PjOj ha soil' 1 ; 

Fig. 26.4 The effect of different rates of P application (0, 50, 100 kg/ha P 2 5 ) and mycorrhizal in- 
oculation on sweet corn yield and root inoculation 

I. Ortas and A. Varma 

Table 26.1 The effect of phosphorus application and mycorrhizal inoculation on N, P and K con 
centration (%) in shoots of sweet corn at silking. ± Standard error 

Table 26.2 The effect of phosphorus application and mycorrhizal inoculation on micronutrient 
content (Zn, Fe, Cu, Mn; mg/kg dry weight) in shoots of sweet corn at silking 

plant N, P, K concentrations significantly (Table 26.1). Furthermore, plant Zn 
and Mn concentrations increased; however, Fe and Cu concentrations remained 
the same during the experiment (Table 26.2). In non-inoculated plants, the P 
concentration of sweet corn shoots increased as the P fertilization increased, but 
in inoculated plants there was no significant increase. Mycorrhizal inoculation 
increased significantly root colonization but, with the higher P level addition, 
the extent of AMF colonization was reduced. It was concluded that, although 
soils have potential indigenous spores which can effectively infect plant roots, 
additional mycorrhizal inoculation increases root infection significantly and 
consequently increases plant nutrient uptake and yield. 

As can be seen from Fig. 26.4, the increasing P addition also reduced the root 
infection, especially with 100 kg/ha P 2 5 application. Our previous experiments 
also showed similar results in the same soil. 

As can be seen from Table 26.1, mycorrhizal inoculation significantly in- 
creased sweet corn plant K content. It seems that the most important K uptake is 

26. Field Trials of Bioinoculants 

by mycorrhizal inoculation. So far most work has focused on P uptake; however 
K is very important element in terms of plant quality (Ortas and Sari 2003). 

Under field conditions without using soil sterilization it is important to man- 
age the indigenous mycorrhizae when the soil nutrients, especially phosphorus, 
are limited under the field conditions. For sustainable P management soil and 
crop management can help to get maximum benefit from indigenous mycorrhi- 
zae (Ortas and Sari 2003). The research area was a preserved area for a long time 
and no pesticide and herbicide were used. So it was expected that the area is rich 
in soil biological fertility especially in indigenous mycorrhizae. 

In order to see the effect of mycorrhizal inoculation on micro -nutrient up- 
take under field conditions a field experiment was set up in the Research Farm 
of the University of Cukurova, Faculty of Agriculture, Adana-Turkey. In this ex- 
periment onion, garlic, chickpea and horse bean plants were used as test plants. 
Cocktail mycorrhizae were used as mycorrhizae species. 

Since chickpea and horse bean are nitrogen -fixing plants they take more mi- 
cro-nutrient. Mycorrhiza inoculation significantly increased plant micro-nutri- 
ent uptake as well. 

The results showed that, in mycorrhizal plots, the yields of onion, garlic, chick- 
pea and horse bean plants was higher than in n on -mycorrhizal plants (Table 26.3). 
Mycorrhizal inoculation increased the shoot Cu and Zn content (Table 26.4). 

At the lowest P supply, shoot dry matter production was significantly de- 
pressed (Table 26.3). This decreasing effect of low P supply was particularly ob- 
vious when soils were sterilized and not inoculated with mycorrhizae. Inocula- 
tion of soil with mycorrhizae species significantly increased the plant growth 
and P uptake of plants, especially under low P supply (Table 26.3). In low P ap- 
plication, plant roots were strongly infected and consequently increased plant 
growth, but in high P level application there was a slight reduction in root infec- 
tion. The results show that mycorrhizal inoculation is an effective practice for 
improving crop production in P-deficient soils. 

In another experiment carried out under field conditions mycorrhizal inocu- 
lation was successfully applied in non- sterile soil conditions for wheat, which 
is a strategical plant for the region. During 1999 and 2000 a successive field 

Table 26.3 Effect of mycorrhizal inoculation and P application on onion, garlic, chickpea and 
horsebean yield under field conditions 

Yield (kg/ha) 

15 778+120 
23 500±102 
25 944±236 

68 611±2585 
87 389±3064 

78 222±2834 

25 667±157 

107 056±4878 

I. Ortas and A. Varma 

Table 26.4 Effect of mycorrhizal inoculation and P application on onion, garlic, chickpea and 
horsebean plant nutrient uptake and root infection under field conditions 

(mg/kg dry weight) 

experiment were set up on Menzilat soil series (typical xerofluvent) which is 
located in the Research Farm of the University of Cukurova, Faculty of Agricul- 
ture, Adana/Turkey In that experiment 0, 100 and 200 kg/ha P 2 5 were applied 
as triple superphosphate. Mycorrhizal inoculum was applied (by hand) 50 mm 
under the seeds. After two years evaluation it was found that mycorrhizal in- 
oculation under field conditions significantly increased wheat yield (Fig. 26.5). 
Also, increasing P application increased wheat yield. In the same experiment 
mycorrhizal inoculation also increased plant P, Zn and Cu content, compared 
with the control plant. 

The results show that mycorrhizal inoculation increased wheat yield, but at 
the same time indigenous soil mycorrhizal spores significantly inoculated plant 
roots and consequently the plant got a benefit from indigenous mycorrhizae. 

26. Field Trials of Bioinoculants 

Plant yield increased with increasing P addition in non-inoculated plots. But in 
the inoculated plot increasing the P addition increased plant yield up to 50 kg/ha 
P 2 5 . In further addition, P did not increase plant yield (Fig. 26.5). Also, root in- 
oculation reduced with increasing P addition. 

Plant species and cultivars are also different in term of nutrient uptake and 
their colonization by mycorrhizal fungi. Baon et al. (1993) tested eight barley 
cultivars for P efficiency by comparing their efficiency with G. etinicatum inocu- 
lum. Responsiveness to mycorrhizae was negatively correlated with agronomic 
P efficiency and P utilization efficiency. Similarly, Hetrick et al. (1996) used ten 
wheat cultivars compared at three P regimes and found that mycorrhizal re- 
sponsiveness declined with increasing P for the six "responsive" cultivars, but 
four "non-responsive" cultivars were unaffected. 

□ Non Inoculated 

□ Inoculated 

Fig. 26.5 The effect of 
mycorrhizal inoculation 
and P application on wheat 
yield under field condition 

Phosphorus application (kg P20fc/ha) 

DNon Inoculated 

□ inoculated 

Phosphorus application (kg P 2 (Vha) 

I. Orta§ and A. Varma 

Soil and Crop Management System 

Plant responses to mycorrhizal inoculation can be affected by several factors, 
such as mycorrhizal dependency of the host crop, the nutrient status of the soil 
and the inoculum potential of the mycorrhizal fungi. Also, soil and crop man- 
agement practices such as tillage, crop rotation and fallowing may adversely af- 
fect populations of mycorrhizal fungi in the field. Soil disturbance significantly 
reduces the native inoculum potential and consequently reduces nutrient up- 
take and plant growth (Ortas et al. 2002). Management practices can influence 
the types of vesicular- arbuscular mycorrhizal fungi found in agricultural soils. 
Culturing in soils from degraded ecosystems significantly influences the effec- 
tiveness of indigenous AMF isolated from disturbed and undisturbed soils (En- 
khtuya et al. 2000). The development of AMF isolates is reduced in soils with 
more adverse chemical properties, irrespective of the isolate origin (Enkhtuya et 
al. 2000). Understanding the contributions of soil micro-organisms to soil stabi- 
lization at the molecular level will lead to ways to enhance inputs for sustainable 
agricultural systems. 

Plant and soil management should be implemented for mycorrhiza-de- 
pendent higher plants, especially less soil distribution, less irrigation and less 
fertilizer application. In the past 50 years, it has been accepted that taking the 
maximum yield per unit of land has depredated the soil; and the indigenous 
mycorrhizal organisms have also been depredated. 

The management of mycorrhizal populations in the field is certainly feasible 
and requires a clear understanding of the ecology of plant communities and dif- 
ferent farming systems which affect the populations of mycorrhizal fungi and 
their diversity and the nutrient uptake and growth of crops. Mycorrhizal inocu- 
lation had a positive effect on maize plant P uptake, which was still exhibited 
even when a high level of P was applied. But high P fertilization reduced the 
degree of root colonization and also the quantity of external hyphae (Posta and 
Fuleky 1997). The major benefit of the mycorrhizal symbiosis for crops is im- 
proved P uptake; and the management of mycorrhizal fungi will be most critical 
when soil P is limiting. In temperate zones, P is sometimes applied in excess of 
crop demand. When the soil P is so high, then root infection percentages are 

Micro -nutrients are very important in terms of human health. Since agri- 
culture is the main source of macro- and micro-nutrients for human food, it is 
very important to produce a balance of feed plants for the food chain from soil 
to human. It has been also shown that mycorrhizal inoculation can increase mi- 
cro-nutrients such as Zn and Cu (Kothari et al. 1990). Liu et al. (2000) reported 
that the total content of Zn and Cu in maize shoots was higher in mycorrhizal 
than in non -mycorrhizal plants grown in soils with low P addition. Similarly, 
Tarkalson et al. (1998) and Ryan and Angus (2003) reported that, under field 

26. Field Trials of Bioinoculants 

conditions, the total crop Zn uptake and grain Zn concentration were positively 
correlated with colonization by AMF, due to enhanced Zn uptake after anthesis 
of the wheat plant. 

Inoculation Techniques 

Compared with pot experiments, less work has been done under field condi- 
tions. Field responses to mycorrhizal inoculation were often disappointing, es- 
pecially in high-input agricultural systems. It has been concluded by many re- 
searchers that mycorrhizae have little practical importance in agriculture, since 
each agro- ecosystem has its own ecological conditions, such as nutrient status of 
the soil, mycorrhizal dependency, inoculum potential of the indigenous mycor- 
rhizal fungi, crop rotation and fallow systems. Agriculturists should appreciate 
the distribution of mycorrhizae within their systems and understand the impact 
of their management decisions on mycorrhizal functioning (Orta§ et al. 2002). 
Inoculum potential can be adversely affected by management practices such as 
fertilizer application, pesticide use, crop rotation, fallowing, tillage and topsoil 
removal. Field experiments have shown that most agricultural plants are colo- 
nized by mycorrhizal fungi, which have a substantial impact, both positive and 
negative, on crop productivity (Johnson 1993). Under field conditions, native 
inoculum potential is generally low and sometimes ineffective (Ortas 2003). It 
is very important to know the mycorrhizal inoculation potential before using 
mycorrhizal inoculum. 

Since AM fungi cannot be grown on laboratory media, the production of a 
large quantity of inoculum is difficult, as is the inoculation of soil under field 
conditions. Also since most of the commercially important crops are mainly 
horticultural plants and are raised under nursery conditions before being trans- 
planted to the main field, the inoculation of soil in the nursery would not only 
result in a saving of the cost of production of the inoculum but would also help 
in the better establishment of the transplanted horticultural seedling. Horticul- 
ture plants which are grown as seedlings give a high response to mycorrhizae. 
Mycorrhizal seedlings are more reliable then non-mycorrhiza-inoculated ones. 
It is sound to produce mycorrhiza-inoculated seedlings before transplanting to 
the field conditions. Our early results showed that mycorrhiza-infected seed- 
lings are highly resistant to environmental stress factors. Under field conditions, 
the effect of mycorrhizal inoculation on mortality of seedling was tested. Ortas 
et al. (2004) observed that non -mycorrhizal seedlings had a high mortality but 
mycorrhizal seedlings had less mortality (Table 26.5). 

Inoculum strategies are very important. Ortas et al. (2004) tested several tech- 
niques to develop suitable inoculum strategies. Very recently biotechnological 

I. Ortas and A. Varma 

Table 26.5 Mycorrhizal and non-mycorrhizal dead and surviving seedlings after transplanting to 
field conditions (mean of three replicates; Ortas, unpublished data) 

Number of seed- 
lings transplanted 
to the plot 

Number of 

% dead 

dead seedlings seedlings 

% surviving 

Bell pepper 

Bell pepper 

techniques were applied before transplanting mycorrhiza-inoculated seedlings 
to the field conditions, which is a most feasible technique. 

Very recently a new technique was tested for better seedling performance un- 
der field conditions. Mycorrhiza-inoculated and uninoculated pepper seedlings 
were transplanted to the field with and without seedlings treated with a liquid 
solution containing mycorrhizal inoculum. The results showed that mycor- 
rhiza-inoculated seedling production is very important (Fig. 26.6). Also, before 
transplant to the field conditions, seedlings can be treated with a mycorrhizal 
liquid solution and are highly responsive to such inoculation. The technique is 
easy and practical. A liquid solution is prepared using a large quantity of spores 
(soil, roots, hyphae), mixed with water 1:1, v/v. Seedling roots are dipped into 
the solution before being transplanted to the nursery hole. 

26. Field Trials of Bioinoculants 

1 2000 n 

1 0000 - 

E 4000 - 

Pepper Cokteyl 

Fig. 26.6 Effect of different in- 
oculation types on paper plant 
growth under field conditions 
(Ortas, unpublished data) 

i i i i 

Type of Inoculation 

^ 8000 

~ 4000 

Pepper G. mosseae 

Type of Inoculation 

A large number of studies have expanded our understanding of the potential 
contribution of mycorrhizae to nutrient uptake under field conditions. Since plant 
species can give different effects upon mycorrhizal inoculation, these can be related 
to other beneficial effects of mycorrhizal infection. Also, the response depends 
on several factors, such as genetic variation and environmental factors. 

Recently it was reported that mycorrhizae have several benefits to plants other 
than nutrient uptake, such as resistance to water deficiency (Bowen and Rovira 
1999; Driige and Schonbeck 1992; Goicoechea et al. 1996). So it is very important 
to manage the indigenous mycorrhizae when soil nutrients, especially P, are 
limited under field conditions. For sustainable P management, soil and crop 
management can help to get maximum benefit from indigenous mycorrhizae 
(Ortas 2003). Bowen and Rovira (1999) suggested that a good managed 

I. Ortas and A. Varma 

rhizosphere would increase soil and plant quality. Rizosphere management can 
increase the useful micro-organisms in the plant-soil system. For this reason, the 
management of mycorrhizae is very important for agricultural sustain ability. 

Abbott LK, Robson AD (1978) Growth of subterranean clover in relation to the formation 
of endomycorrhizas by introduced and indigenous fungi in a field soil. New Phytol 

Abbott LK, Robson AD (1982) The role of vesicular- arbuscular mycorrhizal fungi in agricul- 
ture and selection of fungi for inoculation. Aust J Agric Res 33:389-408 

Al-Karaki GN, Clark RB (1998) Growth, mineral acquisition and water use by mycorrhizal 
wheat grown under water stress. J Plant Nutr 21:263-276 

Allen MF, Sexton JC, Moore TS Jr, Christensen M (1981) Influence of phosphate source on 
vesicular- arbuscular mycorrhizae of Bouteloua gracilis. New Phytol 87:687-694 

Baon JB, Smith SE, Alston AM (1993) Mycorrhizal responses of barley cultivars differing in P 
efficiency. Plant Soil 157:97-105 

Bowen GD, Rovira AD (1999) The rhizosphere and its management to improve plant growth. 
AdvAgron 66:1-102 

Charron G, Furlan V, Bernier-Cordou M, Doyon G (2001) Response of onion plants to ar- 
buscular mycorrhizae. 1. Effects of inoculation method and phosphorus fertilization on 
biomass and bulb firmness. Mycorrhiza 11:187-197 

Driige S, Schonbeck F (1992) Effect of vesicular- arbuscular mycorrhizal infection on transpi- 
ration, photosynthesis and growth of flax (Linus usitabissimum L.) in relation to cytoki- 
nin levels. J Plant Physiol 140:40-48 

Ellis JR, Watson DMH, Varvel GE, Jawson MD (1995) Methyl bromide soil fumigation alters 
plant elements concentrations. Soil Sci Soc Am J 59:848-852 

Enkhtuya B, Rydlova J, Vosatka M (2000) Effectiveness of indigenous and non-indigenous 
isolates of arbuscular mycorrhizal fungi in soils from degraded ecosystems and man- 
made habitats. Appl Soil Ecol 14:201-211 

Fries LLM, Pacovsky RS, Safir GR, Kaminski } (1998) Phosphorus effect on phosphatase ac- 
tivity in endomycorrhizal maize. Physiol Plant 103:162-171 

Goicoechea N, Antolin MC, Strnad M, Sachez-Diaz M (1996) Root cytokines, acid phos- 
phates and nodule activity in drought-stressed mycorrhizal or nitrogen- fixing alfalfa 
plants. J Exp Bot 47:683-686 

Haas JH, Bar-Yosef B, Krikun J, Barak R, Markovitz T, Kramer S (1987) Vesicular- arbuscular 
mycorrhizal fungus infestation and phosphorus fertigation to overcome pepper stunting 
after methyl bromide fumigation. Agron } 79:905-910 

Hetrick ABD, Kitt DG, Wilson T (1986) The influence of phosphorus fertilization, drought, 
fungal species, and non- sterile soil on mycorrhizal growth response in tall grass praiser 
plants. Can J Bot 64:1199-1203 

Hetrick BAD, Wilson GWT, Todd TC (1996) Mycorrhizal response in wheat cultivars: rela- 
tionship to phosphorus. Can J Bot 74:19-25 

Johnson NC (1993) Can fertilization of soil select less mutualistic mycorrhizae. Ecol Appl 

Kothari SK, Marschner H, Romheld V (1990) Effect of VA mycorrhizal fungi and rhizosphere 
microorganisms on root and shoot morphology, growth and water relationship in maize. 
New Phytol 116:303-311 

26. Field Trials of Bioinoculants 

Li XL, George E, Marschner H (1991) Extension of the phosphorus depletion zone in VA- 
mycorrhizal white clover in a calcareous soil. Plant Soil 135:41-48 

Liu A, Hamel C, Hamilton RI, Smith DL (2000) Mycorrhizae formation and nutrient uptake 
of new corn (Zea Mays L.) hybrids with extreme canopy and leaf architecture as influ- 
enced by soil N and P levels. Plant Soil 22:157-166 

Medeiros CAB, Clark RB, Ellis JR (1994) Growth and nutrient uptake of sorghum cultivated 
with vesicular- arbuscular mycorrhiza isolates at varying pH. Mycorrhiza 4:185-191 

Olsen JK, Schaefer JT, Edwards DG, Hunter MN, Galea VJ, Muller LM (1999) Effects of my- 
corrhizae, established from an existing intact hyphal network, on the growth response of 
capsicum {Capsicum annuum L.) and tomato (Lycopersicon esculentum Mill.) to five rates 
of applied phosphorus. Aust J Agric Res 50:223-237 

Ortas I, Harris PJ (1996) The effect of partial soil sterilization and seasonal change on soil 
degradation (N -mineralization and soil chemical properties). In: Adana (ed) Interna- 
tional conference on land degradation. Adana, Istambul, pp 204-217 

Ortas I, Harris PJ, Rowell DL (1996) Enhanced uptake of phosphorus by mycorrhizal sor- 
ghum plants as influenced by forms of nitrogen. Plant Soil 184:255-264 

Ortas I, Ortakci D, Kaya Z (2002) Various mycorrhizal fungi propagated on different hosts 
have different effect on citrus growth and nutrient uptake. Commun Soil Sci Plant 

Ortas I (2003) Effect of selected mycorrhizal inoculation on phosphorus sustainability in 
sterile and non-sterile soils in the harran plain in south Anatolia. J Plant Nutr 26:1-17 

Ortas I, Sari N (2003) Enhanced yield and nutrient content of sweet corn with mycorrhizal 
inoculation under field conditions. Agric Med 133:188-195 

Ortas I, Sari N, Akpmar Q (2003) Effects of mycorrhizal inoculation and soil fumigation on 
the yield and nutrient uptake of some solanaceas crops (tomato, eggplant and pepper) 
under field conditions. Agric Med 133:249-258 

Ortas I, Akpinar A, Coskan A, Demirbas A (2004) Producing mycorrhizal seedling for sus- 
tainable agriculture (short presentation at 8th meeting of COST Action 3.83). In: COST 
(ed) Exploring and exploiting the natural AM fungus diversity in stressed soil-plant sys- 
tem (from molecular techniques to biotechnological tools). COST, Grenada, pp 61 

Peterson RL, Massicotte HB, Melville LH (2004) Mycorrhizas: anatomy and cell biology. 
CABI, Ottawa 

Posta K, Fuleky G (1997) The effect of phosphorus on the mycorrhizal colonization of maize 
by Glomus Mosseae (Nicol. Gerd). Novenytermeles 46:573-582 

Ryan MH, Angus JF (2003) Arbuscular mycorrhizae in wheat and field pea crops on a low P 
soil: increased Zn-uptake but no increase in P-uptake or yield. Plant Soil 250:225-239 

Sanders FE, Tinker PB (1973) Phosphate inflow into mycorrhizal roots. Pest Sci 4:385-395 

Smith SE, Read DJ (1997) Mycorrhizal symbiosis, 2nd edn. Academic, London 

Stribley DP, Tinker PB, Rayne, JHB (1980) Relation of internal phosphorus concentration 
and plant weight in plants infected by vesicular arbuscular mycorrhizas. New Phytol 

Tarafdar JC, Marschner H (1994) Phosphatase activity in the rhizosphere and VA mycorrhizal 
wheat supplied with inorganic and organic phosphorus. Soil Biol Biochem 26:387-395 

Tarkalson DD, Jolley VD, Robbins CW, Terry RE (1998) Mycorrhizal colonization and nutri- 
tion of wheat and sweet corn grown in manure -treated and untreated topsoil and sub- 
soil. J Plant Nutr 21:1985-1999 

Tinker PB (1975) The chemistry of phosphorus and mycorrhizal effects on plant growth. 
In: Sender FS, Mosse B, Tinker PB (eds) Endomycorrhizas. Academic, London, pp 

Subject Index 

Abrus precatorius 250 
Acacia catechu 250 
Acacia mangium 389 
Acacia nilotica 250 
Acetosyringone (AS) 22 
Acid fuchsin (AF) 383 
Acid phosphatase 214, 239 
ACPase 214 

Acquired immune system 94 
Actinomycetes 170, 369 
Adaptive immune system 94 
Adenine hemisulfate 1 52 
Adhatoda vasica 250 
Adjuvant 75 
Adjuvant alum 75 
Adjuvant FCA 75 
Aeroponic 386 
Agaricus bisporus 22 
Agarose gel 170 
Agrobacterium rhizogenes 389 
Agrobacterium tumefaciens 22 
Alkaline phosphatase 215 
Allium cepa 389 
Allogeneic 101 
Allogeneic recipient 102 
Amanita 239 
Aminopterin 82 
Ammonia oxidizers 191 
Ammonium bicarbonate 162 
Ammonium persulfate solution 
amoA 301 
Amplicons 296 
Amplification 189,244 
Amplification plot 61, 71 

Amplified random intergeneric 

space analysis (ARISA) 4 
Amplified r DNA restriction 

analysis (ARDRA) 4 
Analysis program 48 
Anamorphic fungi 1 
Anastomosis 253 
Aneura pinguis 250,308 
Annealing 125, 244 
Antibody 73, 89 
Antigenic determinant 77 
Antigen-presenting cell 94 
Antioxidant capacity 350 
Antisense orientation 137 
Antisense RN A technology 137 
Arabidopsis 214, 356 
Arabidopsis befa-amylase(BMY8) 

Arabidopsis thaliana 
Aracon tube 310 
Araucariaceae 377 
Arbuscular mycorrhiza (AM) 

247, 397 
Arbuscular mycorrhiza fungi 

(AMF) 319,333 

Artemisia annua 

Arthrobotrys oligospora 
Ascitic fluid 80 
Ascomycetes 1 
Ascomycota 345 
Ascorbate 351 
Aspergillus 254 

Subject Index 

Aspergillus awamori 22 

Blast search 57 

Aspergillus medium 239 

Blocking buffer 226 

Auricular idles 248 

Blumeria graminis 348 

Auto-fluorescence 384 

Boletus 239 

Automated chromatogram 

Botrytis drier ea 22 

Automated fluorescent dye 

Bradford dye 157 

Automated sequencing 37 

Bradford method 157 

Avena sativa 386 

Brassica oleracea 

Axenic culture 386 

var. Capitata 249 

Azadirachta indica 250 

BRET 146 
Bromophenol blue 241 

Bacillus 191, 369 

Broth 254 

Bacopa monniera 250 

Burkholderia 290 

Bacterial artificial chromosomes 

(BACs) 371 

Cadmium 322, 337 

Barley chemical induced 

Caenorhabditis elegans 141 

protein 1 351 

Calcofluor 368 

(BAS) 385 

Capillary electrophresis 285 

Baseline 62 

Capillary sequencers 38 

Basidiomycetes 1 

- ABI prism 310 

Basidiomycota 249, 308 

genetic analyzer 38 

BD -cloning vector 26 

- ABI prism 3700 

Bicarbonate buffer 163 

DNA analyzer 38 

Bifacial leaf 271 

Carcinogen 114 

Big Dye terminator reactions 

> 40 

Cassia angustifolia 250 

Biochemical affinity blotting 

Catalase 345 

CCD Camera 38 

Cd 334 

Biochemical cross-linking 

Cd 2+ hyperaccumulator 357 

Biochemical far- western 146 

cDNA 53 

Biochemical polyacrylamide 

gel 146 

cDNA arrays 53 

Biochemical protein affinity 

cDNA library 149 

chromatography 146 

Cell lysis 156 

Biogenesis related protein \ 

Cell-mediated lympholysis 

Bioinoculants 372 

(CML) 99 

Biological control agent 254 
Biological hardening 254 
Bioluminescence marker gene 
Biomass determination 198 

Biophysical parameters 
Biophysical phenomics 
Biophysical phenotype 
Biophysical phenotyping 

BLAST analysis 44 

Cell proliferation 148 
Cell suspension 189 
Cellulose 201 
Central lymphoid tissue 94 
Chain termination 

dideoxynucleotide 36 
Chalcone synthase 133 
Chemical biology 282 
Chemical mutagenesis 140 
Chemotherapy 53 
Chimeric PCR products 8 

Subject Index 

Chi a fluorescence 320, 322 
Chi a fluorescence transient 325 
Chi a fluorescence transient 

O-J-IP 327 
Chlamydospore 253 
Class I MHC molecule 99 
Class II MHC molecule 97 
Chlorazol black E 383 
Chlorophytum borivillianum 250 
Chromatin mo edification 135 
Chromatin remodeling 141 
Chromium 99 
Chromosomal aberration 356 
Ch. Tuberosum 250 
Cicer arietinum 250 
Cis- regulatory element 149 
Citrate buffer 185 
Clonal proliferation 96 
Clone library 295 
Cloning 80 
Cluster 240 
Cochliobolus sativus 347 
Coffea arabica 250 
Co-immunoprecipitation 146 
Colonization 214 
Colorimetric assay 147 
Column chromatography 217 
Community composition 182 
Comparative CT method 59 
Competent Yeast Cells 26 
Complimentary sequence 115 
Computational methods 145 
Constitutive expression 138 
Coomassie blue staining 86 
Coomassie brilliant blue 1 56 
Corynebacterium glutamicum 358 
Cosmid 371 
Co-suppression 133 
Craterocolla 214, 248 
Craterocolla cerasi 248 
Cruciferaceae 249 

Cryostat section 
CTAB 242 
CT value 60 
Cultivar Annabell 

Culture-independent -DGGE 167 

Culture-independent -FAME 167 

Culture-independent method 167 

Culture-independent -RIS A 167 

Culture-independent-Soil DNA 167 

Cy3 126 

Cy5 126 

Cyclophilin 20 

Cyclotron Resonance Fourier 281 

Cymbopogon martinii 250 

Cytokines 96 

Cytometric bead array (CBA) 98 

Cytoplasmic protein 148 

Cytotoxic activity 99 

Cytotoxic T lymphocyte (CTL) 99 

16Sr DNA clone library 295 
Dactylaria 1 1 
Dactylorhiza fuchsia 249 
Dactylorhiza incarnata L. Soo' 250 
Dactylorhiza maculata L. Verm. 250 
Dactylorhiza majalis Rchb. F. 250 
Dactylorhiza purpurella 249 
Daucus carota 250 
DEAE-Sephadex 217 
Dehydroascorbate (DHA) 351 
Dehydroascorbate reductase 

(DHAR) 351 
Dehydrogenase 239 
Delbergia sisso 250 
2D -Electrophoresis 161 
Denaturation 125 
Denaturation cycle 244 
Denitrification 301 
Densitometric scanning 121 
DEPC 114 
Desoxyribonucleotide triphosphate 

(DNTP) 297 
Desulfovibrio 194 
Detergent 117 
Dexamethasone 138 
D extran sulfate 118 
(DGGE) 7,189,295 
DGGE Digitization 195 
DGGE GC tail 192 
DGGE Gel- 191 

Subject Index 

DGGE Gradient 194 
DGGE Normalization 195 
DGGE Separation 192 
DGGE Sequencing 193 
Dicer 134 
Dichroic mirror 276 

Dilution buffer 

Dilution plating technique 
DIS 147 

Disinfestation 387 
Dissection 273 
Dissecting microscope 273 
Dithiothreitol (DTT) 118 
Diversity 2, 188 
DNA 115,189,297 
DNA amplification 244 
DNA-BD fusion vector 26 
DNA binding domain 147 
DNA binding proteins 149 
DNA-CTAB complex 242 
DNA extraction 189 
DNA fingerprint 238 
DNA methylation 141 
DNA repair gene radA 371 
DNA sequences 147 
DNA sequencing 35 
DNA Silver staining 175 
DNA size marker 298 
DNA staining 175 
DNA staining 

Ethidium bromide 

DNA Sybr gold 
Dot/slot blot hybridization 
Double interaction screen 
dsRNA 135 
Duplicated gene 237 
Dye-terminator 46 

Ecological niches 1 
Ectomycorrhiza 271 
Ectomycorrhizal fungi 238 
Effector cell 101 
Effector immune response 93 
Efibulobasidium 214 

Efibulobasidium rolleyi 248 
EGFP Primers 30 
Electrochromatography 285 
Electropherograms 45 
Electrophoresis 86 
ELISA 88, 225 
ELISA - Competitive 88 
ELISA - Indirect ELISA 88 
ELISA Sandwich 88 
EMS 310 

EMS mutant lines 309 
Emulsification 223 
Endogenous control 57 
Endogenous genes 141 
Endonucleases 135 
Endonucleolytic cleavage 136 
Endophyte 345 
Energy cascade 320 
Energy flux 330 
Enzyme activity 216 
Enzyme slippage 45 
Enzyme slippage 

homopolymer region 45 
Eosinophils 98 
Epitope 73 

Equilibration buffer 160 
Ergosterol 182, 189 
Ericoid mycorrhizas 239 
EST database 126 
Esterase 239 
Estradiol 139 
Ethanol 138 

Ethanol precipitation 42, 49 
Ethidium bromide 244 
Ethyl-methanesulfonate 310 
ETS 5 

Excess dntps 48 
Extracellular pathogens 96 
Extrachromosomal 235 
Extra-radical mycelium (ERM) 384 

FACS 101 

6-FAM 297 

FAME 165, 296, 381 

FAME extraction 183 

Fast fluorescence kinetics O-J-IP 

Subject Index 

- Fast fluorescence rise O-J-I-P 

Fatty acid 182 

Fatty acid methyl ester (FAME) 

FCA 73 

Festuca rubra 355 
FIA 73 

Ficoll Hypaque 105 
Fine root 280 
Fingerprinting 8, 239 
First-strand cdna 124 
Flavonoids 281 

Flourescein isothiocyanate 
Flow cytometer 103 
Flow cytometry 96 
Fluorescein diacetate 205 
Fluorescence 100, 323 
Fluorescence correlation 

spectroscopy 144 
Fluorescence microscopy 385 
Fluorescence resonance energy 

transfer (FRET) 55 
Fluorescence transient 325 
Fluorescent antibody technique 369 
Fluorescent dye 126, 297 
Fluorescent FRET 

hybridization probe 54 
Fluorescent molecular beacon 54 
Fluorescent reporter 54 
Fluorescent Scorpion probe 54 
Fluorescent stains 368 
Fluorescent Syber green 54 
Fluorescent Taqman probe 54 
Fly agaric 280 
Formamide 118 
Fosmid 371 
FPS 144 

Fragment length polymorphism 

Freeze-drying 274 

FRET 144 

Freunds complete 222 

Freunds incomplete 222 

Freunds incomplete adjuvant 

(FIA) 75 

Fumigation 202 

Fumigation extraction method 205 

Functional blocks of PSII 323 

Functional building block 320, 338 

Functional genomic 134 

Fusarium 2 

Fusarium culmorum 348 

Fusarium oxysporum 22 

FWHM 286 

Gaeumannomyces graminis 251 
GAL4AD fusion library 26 
GAL4 protein 149 
Gcfung primers 9 
GC-rich template 40 
gDNA contamination 58, 69 
gDNA dnase I digestion 58 
Gel-based ABI prism 

377 sequencer 38 
Gene expression 53 
Gene silencing 133 
Genetic material 111 
Genetic polymorphism 245 
Genetically engineered 

microorganism (GEM) 372 
Genomic DNA 298 
Gigaspora margarita 215,381 
Glomalean fungi 377 
Glomeromycota 345 
Glomus caledonium 320 
Glomus coronatum 381 
Glomus etinicatum 407 
Glomus intraradice 215, 390 
Glomus mosseae 320, 389 
Glomus tenuis 379 
Glomus versiforme 390 
Glucan -water dikinase 312 
Glutaraldehyde 223 
Glutathione 351 
Glycine max 250 
Glycobiology 283 
Glycoprotein 214 
GPCR'S 18 
GPCR - STE3 20 
Graft versus host (GVH) 

Reaction 102 

Subject Index 

Gram negative bacteria 1 82 
Gram positive bacteria 182,189 

Haemophilus influenzae 112 

Hairpin RNA 137 

Handy-PEA 325 

Handy-PEA fluorimeter 322 

Hartignet 271,279 

Haustorium 350 

Hebeloma cylindrosporum 22 

Helicobacter pylori 358 

Helotiales 9 

Helper T cell 98 

Helper Thl cell 98 

Helper Th2 cell 98 

HEPES buffer 82 

Herbivore 377 

Hexamer 68 

Hexanol extraction 205 

Hhal 297 

Hi-Di formamide 49 

High template DNA 49 

Hinfl 297 

Histidine 147 

Histochemistry 271 

Histocompatibility complex 97 

Histogram 103 

hma2 357 

hma3 357 

H 2 2 detection 349 

Homologous recombination 137 

Homopolymer regions 49 

Hordeum vulgar e 350 

HTP 285 

Human genome project 35 

Humic acid 190 

Humic removal 1 90 

Humic substance 189 

Humoral immune response 96 

Humoral immunity 95 

Hybridization 112, 115 

Hybridization probes 54 

Hybridoma 77, 80 

Hydro dynamic 142 

Hydrologic cycle 201 

Hydrophilicity 285 

Hydrophobicity 285 
Hydroponic 388 
Hygromycin (hph) 29 
Hypersensitive reaction 
Hyphal mantle 271 
Hypocreales 9 
Hypoxanthine 78 

ICR-FT/MS 286 
Image analysis 163 
Immune cell 107 
Immune response 93 
Immune system 93 
Immunization 76 

- Booster 76 

Immunization Pre-immunized 76 
Immunization Primary 76 
Immunizing antigen 96 
Immuno -detection 227 
Immuno-fluorescence 228, 240 
Immunogen 74 
Immunoglobulin 73, 225 
Immunogold 240 

- Ethanol 43 

- Phenol 43 

- Salt 43,49 

Induced pathogen resistance 347 
Induced systemic resistance 

(ISR) 344 
Inducer 134 
Inducible RNAI 138 
Inhibitor 157 
Innate immune response 94 
Innate memory immune 

response 93, 96 
Inserted membrane technique 

(IMT) 385 
In situ hybridization 53 
Interaction library 26 
Internal transcribed spacers (ITS) 5 
Intron 137 

In vivo vitality analysis 319,338 
Iodonitrotetrazolium formazan 

(INTF) 208 
Ion exchange chromatography 217 

Subject Index 

Isoelectric focusing 156 
Isoelectric point 156 

Jasmonate induced protein 
Jasmonic acid 281 
JlP-test 328, 335 

Keratin 156 
Knop solution 260 

L-arginine 152 

Laccaria bicolor 

Lactarius 239 

Lactophenol 382 

Landsberg errecta 312 

Lbras gene 20 

Leucine 147 

LHCII 321 

LHCI 321 

Lignin 201 

Lipid extraction 1 86 

Lipidomics 283 

L-lysine 152 

L-methionine 152 

Loliom perenne 355 

L-tyrosine 152 

L-uracil 152 

Lux gene 370 

Lycopersicum esculentum 389 

Lymphocytes 93 

Lymphoid organs 94 

Lymphoid tissue 94 

Macrophages 79 
Macrostate 322, 338 
MACS - negative selection 104 
MACS - positive selection 104 
Magnaporthe grisea 22 
Magnetic activated cell sorting 

(MACS) 105 
Magnolia liliiferai 9 
MALDI 164 
Manual-chain termination 

dideoxynucleotide 36 

Manual sequencing 36 
Mass spectrometry 164, 287 
MATH protein 311 
Maximum quantum yield 

of primary photochemistry 335 
Medicago sativa 386 
Meloidogyne incognita 139 
Membrane filtration technique 

(MFT) 385 
mer R 301 
Mercaptoethanol 86 
Mercury resistance 301 
Metabolomic 281,286 
Metagenomic library 295 
Metagenomics 371 
Methane oxidation 301 
Methanosarcina acetivorans 
MHC molecule 96 
Microarray 126, 317 
Microarray analysis 112 
Microbe interaction 307 

communities 182 
dehydrogenase 202 
enzyme 201,207 
fluorescein diacetate 
fumigant 206 
hexanol 206 

soil respiration 
Micromass MALDI 164 
Micromass Q-TOF 164 
Micromass Q-TOF 

ultrahigh resolution 

mass spectrometry 283, 292 
Microphotometry 274 
Micropropagated plantlet 247 
MicroRNA 136 
Microsatellite 238 
Microstate 321, 338 
miRNA 135 
Mitomycin C 101 
Mixed-lymphocyte reaction 

(MLR) 101 
Mixed templates 45 

Subject Index 

MLR 101 

MMN agar medium 259 

Molecular breeding 142 

Molecular technique 4 

Monacrosporium 1 1 

Monoaxenic culture 389 

Monoclonal antibody 77, 103 

Most probable number (MPN) 

Mspl 297 

Multicapillary Electrophoresis 

(MCE) 38 
Multiplex limiting 

primer concentration 70 
Multiplex PCR 59, 70 
Multivariate analysis 188 
Mycorrhiza 377 
Mycorrhizal colonization 214 
Mycorrhizal dependency 385 
Mycorrhization 319,338 
Mycorrhizosphere 385 
Myeloma and spleen cell 79 
Myeloma (tumor) cell 78 

N-l primers 46 
N-acylhomoserine lactone 

(AHL) 281,290 
nah gene 370 
Native PAGE 218,220 
Neutral trehalase 276 
Nicotiana attenuata 250 
Nicotiana tabaccum 250 
nif genes 191 
nifH 301 
nirS 301 
Nitrification 301 
Nitrite reduction 301 
Nitrocellulose membrane 221 
Nitrogen fixation 301 
(NMR) 286, 290 
NMR Spectroscopy 283 
Non targeted analysis 283 
Non targeted metabolomics 282, 

Normalized reporter (Rn) 61 
Northern analysis 28 

Northern blot analysis 112 
No-RT (without RT enzyme) 

control 68 
nosZ 301 
NS1 9 

NTC (no-template control) 68 
NTS 5 
Nuclear 248 
Nuclear-Encoded Ribosomal DNA 

Gene 5 
Nuclear magnetic resonance 
Nuclear rDNA 248 
Nutrient film technique 386 
Nylon membrane 114 

Obligate endosymbionts 332 
O-J-I-P 329, 333 

- Fluorescence transient 325 
Oligo dT 68 
Oligonucleotide 240 
O-L-K-J-I-H-G-P 329 

- Fluorescence transient 328 

- ORFG 4 

Omniscript reverse transcriptase 
One-hybrid system 149 

- Motif 149 
Optimization 322 
Optimize signal fluorescence 
Orchid mycorrhizae 249 
Oryza sativa 250 
Osmium 230 

L-phenylalanine 152 
PAGE 158 

Palisade parenchyma 271 
Papain 73 

Para-formaldehyde 228 
Parenthosome 253 
Passive reference dye 61 
Pathogenesis related genes 

(PR genes) 344 
Pathogenesis related protein 1 351 
Pathogenesis related protein 5 351 
Pathogen resistance 343 
Pathogens 94 

Subject Index 

Paxillus involutus 22 
pBGgHg 23 
PCA 290 
PCR 4, 189 

PCR-based technique 238 
PCR -pitfall 192 
PCR -primer 191 
Penicillium 2 
Peptidase 239 
Performance index 328, 337 
Peripheral lymphoid tissue 94 
Peritoneal cavity 80 
Peritoneal macrophages 79 
Peroxidase 239 
Persulfate 2 1 9 
Petroselinum crispum 250 
Petunia 133 
pGADT7-Rec 26 
PGPR 364 
Phellesgate 139 
PhoretixTM 163 
Phosphatase 214 
Phosphate 39 
Phosphate buffer saline 228 
Phospholipid 182 
Phospholipid extraction 185 
Phospholipid fatty acid 1 82 
Phospholipid fractionation 187 
Phosphorimager 315 
Phosphorus mobilizer 254 
Phosphorus transporter 254 
Phosphorylation 20 
Photo -multiplicator (PMT) 128 
Photo synthetic apparatus 319 
Photosystem II 321 
Phylogenetic Diversity 10 
Phylogenetic study 248 
Phylogeny 7 
Phylotype 9 
Phytohormones 281 
Phytopromotional 254 
Phytopromotional effects 254 
Picea abies 239 
Pinus resinosa 20 

214, 307, 337 

Piriformospora indica 
Pisum sativum 250 
Plant - growth 343 
Plant growth residues 1 82 
Plant microbe interaction 307 
Plasma cells 95 
Plasmid 371 
Plasmid isolation 43 
Pleosporales 9 
PLFA 181 
PLS-DA 290 
pmoA 301 

Polyacrylamide gel 296 
PolyA tail 124 
Polyclonal antibodies 73 
Polymer 38, 49 
Polymerase 297 
Polymerase chain reaction 

(PCR) 190 
Polymerase DNA 298 
Polymerase enzyme 1 89 
Polymorphism 238 
Polyvinylidene difluoride 165 
Ponceau S stain 221 
PopOffl 139 
Populus Esch5 252 
Populus tremula 250 
Positive PCR control 68 
Post- transcriptional 133 
Potassium ferricyanide 162 
Potato dextrose agar 260 
Powdery mildew 350 
Prehybridization 118 
Primer 7 

Primer design 43, 56 
Primer dimer 49 
Probe 114 
Probe design 56 
Prokaryote 237 
Proliferation 96 
Propidium io dide 1 04 
Prosopis chilensis 250 
Prosopis juliflora 252 
Proteinase K 117 
Protein A sepharose 84 

Subject Index 

Protein extraction 156 
Protein-protein interaction 

- Computational 145 

- Experimental 145 
Protein solubilization 156 

Proteolytic enzyme 
Proteome 111 

- Protein 

- Protein expression 

- Protein map 155 
Protocol 8 

Pseudomonas 191, 290, 367 
PSI 321 
PSII-RC 321 
Pteris ensiormis 308 
Purification 83 

- Affinity chromatography 

- DEAE-Sepharose 
chromatography 83 

- Salting-out 83 

- Sepharose chromatography 
PVLG 383 
Pyrosequencing 39 
Pyruvate kinase 277 
Pythium 2 

Quartz fibre balance 

Quencher dye 
Quercus robur 

Random amplified polymorphic DNA 

RAPD 237 
Random mutagenesis 137 
RAPD analysis 244 
rDNA 248 
Reaction centre 325 
Real time - ABI prism 7700/7000 
Real time microassays 276 
Real time PCR 54 
Real time PCR machines 61 

Recognition sequence 
Redundant DNA 237 

Relative variable fluorescence 326 
Reporter dye 55 
Retro -transcribed RNA 301 
Reverse transcriptase 315 
Reverse Transcriptase-Polymerase 

Chain Reaction (RT-PCR) 123 
Reverse transcription 58 
Reverse two -hybrid system 

interaction 148 
RFLP 238 
Rhizobium spp 369 
Rhizoplane 364 
Rhizosphere 193, 247, 363, 400 
Rhizosphere competence 364 
Rhystimatales 9 
RIA 96 

Ribosomal DNA gene 5 
Ribosomal intergenic spacer analysis 

(RISA) 295 
RNA 113,193,301 
RNA-dependent RNA polymerase 

(RdRp) 134 
RNA-induced silencing complez 

(RISC) 134 
RNA interference 136 
RNA isolation 57 
RNA protein 150 
RNase 242 
RNase activity 125 
RNase III 135 

RNase protection assays 
Root colonization 384 
Rsal 297 

Saccharomyces cerevisiae 
Salicylic acid 281 
Salmon sperm 115 
Salting out 83 
SAR 344 
Scavengers 345 
Scorpion probes 54 
Scutellospora calospora 381 
SDS-PAGE 86, 158 
Sebacina 214, 248 
Sebacina aff. epigaea 248 

Subject Index 

Sebacinaceae 248, 355 
Sebacina dimitica 248 
Sebacina epigaea 248 
Sebacina incrustans 248 
Sebacinales 308, 345 
Sebacina vermifera 213,248 
Sense orientation 137 
Sensu stricto 248 
Sequence-specific RT primer 69 
Setaria italica 250 
Shannon- Weaver index 188 
Short oligonucleotide primer 238 
Shrimp alkaline phosphatase 

(SAP) 48 
Signal fluorescence 299 
Signaling genes 18 
Signaling pathways 18 
Silencing 133 
Silico 146 

Silver staining method 86 
Single tube PCR 59 
Sirna 135 

SiRNA-mRNA hybrid 1 36 
Sodium azide 90 
Sodium thiosulfate 162 
Soil aggregates 188 
Soil amendments 182 
Soil environment 156 
Soil environment enzyme 

activity 156 
Soil environment humic 

substance 156 
Soil enzyme 199 
Soil enzyme dehydrogenase 208 
Soil enzyme respiration 208 
Soil fungi 1 
Soil microbe 156 
Solanum melongena 250 
Sorghum vulgar 250, 386 
Sos Recruitment system 148 
Spatial calibration 50 
SPE 284 

Species identification 10 
Specific activity 216 
Spike 49 

Spilanthes calva 250 
Spinacia oleracea 249 
Spinner flask 81 
Spinobulbular Muscular atrophy 

(SBMA) 141 
Spleen cell 79 
Split Interaction 148 
Split-ubiquitin 148 
Spongy parenchyma 271 
Spore 3 
Sporophore 238 

Standard curve method 59 
Stress tolerance 345 
Strong terminator peak 48 
Structural genes 7 
Suillus bovinus 22 
Suillus granulatus 238 
Superoxide dismutase 345 
Superscript II reverse 

transcriptase 315 
Surface plasmon resonance 146 
Systemic disease resistance 348 

TAP software 

Taq 297, 300 

Taq DNA polymerase 40, 297 

TaqI 297 

Taqman assay 54 

Taq polymerase 171,241 

Taqman probes 54 

Target cell 101 

Targeted analysis 283 

Taxonomy 3 

T cell receptor 96 

T cytotoxic cell 96 

T cytotoxic cells 96 

T-DNA 140 

Tectona grandis Linn. 250 

TEMED 88,219 

Template DNA 170 

Template RNA 59 

Tephrosia purpurea 250 

Terminalia arjuna 250 

Subject Index 

Terminal restriction 295 
Terminal restriction fragment 

(TRF) 4, 296 
Terminal - Restriction Fragment 

Length Polymorphism 295 
Tetroxide 230 
T helper cell 96 
Therapeutic 141 
Thermal cycler 241 
Thermal stability 118 
Thermoplasma acidophilum 358 
Thermoplasma volcanium 358 
Thermotoga maritima 358 
Thlaspi caerulescens 357 
Three-hybrid 150 
Three-hybrid bridging factor 150 
Threshold 62, 71 
Thymidine 78 
TOC analyser 204 
Torenia hybrida 140 
Traditional systematics 1 
Transcribed spacers 7 
Transcription activation 

domain 147 
Transcription factor 147 
Transcriptome 111 
Transcriptomic 112 
Transcript quantification 53 
Transcript quantification 

cDNA array 53 
Transcript quantification 

in situ hybridization 53 
Transcript quantification 

northern blotting 53 
Transcript quantification 

reverse transcription 

- polymerase chain reaction 53 
Transcript quantification 

RNase protection assay 53 
Transfer buffer 4,226 
Transformation system 

for gene replacement 18 
Transilluminator 244 

Transposon 134 
TREE program 240 
Trehalose 278 
Trehalose metabolism 

neutral trehalase 276 
Trehalose phosphate synthase 276 
Tremellales 248 
Tremelloscypha 214 
Tremelloscypha gelatinosa 248 
T-RFLP 295 
T-RFLP analysis 295 
Trichoderma 1, 239 
Trichoderma harnazium 8 
Tricholoma terreum 238 
Trifolium alexandrinum 386 
Trypan blue (TB) 100,382 
Trypsin 163 

Tungsten halogen lamp 61 
Two hybrid system 147 
Two -hybrid system interaction 147 

UDP glucose 277 

Uniparentally 237 

Universal cycle 41 

UPGMA cluster analysis 240 

Uracil-N-glycosylase (UNG) 71 

Urea 156 

U V light 1 1 4 

UV rays 241 

UV transilluminator 241 

Vacuolar protein sorting 20 
Vector pGADT7-Rec 26 
Vermiculite 388 
Vibrio fischeri 370 
Viral genome 1 34 
Vitality 337 

Washing buffer 228 
Western blot 226 
Whatman paper 114 
Withania somnifera 250 
Woody Plant Medium 
(WPM) 24 

Subject Index 

X-ray film 116 
Xylariales 9 

Yeast two hybrid system 146 

Yields 330 

YPD medium 151 

Zea may 250, 380, 386 
Zinc homeostasis 356 
Zizyph us nummular i a 250